volume e Number 51979 Nucleic A c i d s Research Nucleotide sequence of the three major early promoters of bacteriophage T7 Ulrich Siebenlist Harvard Biological Laboratories, Cambridge, MA 02138, USA Received 4 December 1978 ABSTRACT I have determined the nucleotide sequences of the three major early promoters of bacteriophage T7 (Al, A2, A 3 ) . The sequences confirm the two main homologies found between other known promoters for E. coli RNA polymerase (nucleoside triphosphate:RNA nucleotidyl transferase, E.C. 2.7.7.6). In particular, all three T7 promoters show a very good match with the -35 region homology; the A2 and A3 promoters share a 17 basepair sequence in this region. On the other hand, the match with the Pribnow Box homology is much less pronounced and different for each T7 promoter. INTRODUCTION RNA polymerase initiates transcription at specific sites (promoters) on the DNA template. The enzyme first forms a stable binary complex at such sites. This association involves a limited unwinding of the DNA double helix (1). In the presence of ribonucleoside triphosphates, transcription ensues rapidly. Nucleotide sequences from several promoters for F. coli RMA polymerase reveal two regions of at least partial homoloqy. The first such region is commonly referred to as the Pribnow Box, and consists of seven base pairs centered approximately one helical turn upstream from the RNA start site (2,3,4). The second region with a partially conserved sequence is located about 35 base pairs in front of the first transcribed base; it is therefore called the -35 region. Several promoter mutations have been mapped within these two regions (5,6,7,8,9,10). It has been suggested that the -35 region is involved in the initial recognition by RNA polymerase and that the © Information Retrieval Limited 1 Falconberg Court London W1V5FG England 1895 Nucleic Acids Research Pribnow Box provides a binding site possibly involved with the melting of DNA (4,5). Direct evidence is missing, however. One therefore would like to identify the roles the two main regions of homology play and to pinpoint the precise bases RNA polymerase recognizes. To this end I have first located the three major early promoters of bacteriophage T7 (Al, A2 and A3) on specific restriction fragments and then sequenced them. These three promoters are considered strong ones, where almost all early RNA from T7 is initiated (11). They form a unique system in that they are very closely spaced. MATERIALS AND METHODS T7 DNA DNA of bacteriophage T7 was prepared as described by Minkley and Pribnow (11) ENZYMES Alu I restriction enzyme from Athrobacter luteus was prepared according to Roberts et. a_l (12) . Several enzymes were received as gifts: E. coli RNA polymerase (R. Simpson); T4 polynucleotide kinase (A. Maxam); restriction enzymes Taq I and Hpa II (D. McConnell); restriction enzyme Hindll/III (J. Sims); restriction enzyme Hinf I (G. Sutcliffe and D. Hourcade); restriction enzyme Hae III (F. Ausubel). The following enzymes were purchased: restriction enzyme Hha I (New England BioLabs); alkaline phosphatase (Worthington); ribonucleases Tl and U2 (Sankyo, Calbiochem). I am grateful to R. Roberts for enabling me to screen several of his restriction enzymes. ENZYMATIC CONDITIONS Restriction digests were generally performed in .01 M MgCl 2 , .01 M Tris-HCl pH 7.5, .1 mM EDTA, 1 mM dithiothreitol and .01 - .05 M KC1. Conditions for synthesis of and 32 labelling at 5' ends with [gamma- P] ATP were as described in Maxara and Gilbert (13). Briefly, to label the 5' ends, DNA was treated with alkaline phosphatase to remove 51 1896 Nucleic Acids Research terminal phosphates and then labelled with P by transfer from gamma-labelled ATP with T4 polynucleotide kinase. As a slight modification, the boiling step immediately preceding the transfer reaction was omitted during labelling of whole T7 molecules. Also, to complete the reannealing process of a previously boiled restriction digest of T7 after the transfer reaction, the mixture was brought to 50°C and allowed to cool slowly. GEL ELECTROPHORESIS AND ASSOCIATED TECHNIQUES Constituents of sequencing gels, their electrophoresis, autoradiography and the elution of DNA from gels have recently been described by Maxam and Gilbert (13). NITROCELLULOSE FILTER BINDING ASSAY Filter binding procedures are essentially those of Hinkle and Chamberlin (14). RNA polymerase was incubated with DNA for 2-5 minutes at 37°C in 50 -100 microliters of binding buffer (10 mM Tris-HCl pH 8, 10 mM MgCl 2 , .lmM EDTA, 05 M KC1, 1 mM dithiothreitol). The volume was then brought to 1 ml with binding buffer and rapidly passed through nitrocellulose filters (Schleicher and Schuell), which were presoaked in binding buffer. Filters were extracted with a 1% SDS, 10 mM Tris-HCl pH 7.5 solution. NUCLEOTIDE SEQUENCING DNA sequencing was according to the dimethylsulfate/ hydrazine technique of Maxam and Gilbert (13). RNA sequencing was according to Donis-Keller e_t. a_l (15) . Briefly, end-labeled RNA was partially digested with ribonucleases Tl (G specific) and U2 (A specific); also NaOH hydrolysis provided a complete set of partials representing all nucleotides. Electrophoresis of the Tl, U2 and NaOH partials on a sequencing gel allowed the reading of a G, A, pyrimidine sequence. Al mRNA SYNTHESIS .2 micrograms of the 520 basepair Hpa II fragment were incubated with 2-3 raicrograms of RNA polymerase in synthesis buffer for 30 minutes at 37°C (synthesis buffer: .15 M KC1, 1897 Nucleic Acids Research .1 mM EDTA, 10 mM MgCl , 1 mM dithiothreitol, 10 mM Tris-HCl pH 8 ) . The concentration of the ribonucleoside triphosphates was 50 micromolar; the only labeled triphosphate was [gammaPi ATP at a specific activity of about 300 Ci/mM. This labels the Al mRNA specifically at 5'. The products were then electrophoresed in a 12% TBE polyacrylamide, 7 M urea gel (TBE = .1 M Trisborate pH 8.3, 1 mM EDTA); the approximately 40 nucleotide long Al mRNA was the only visible band on an autoradiograph. RESULTS RESTRICTION MAPPING In order to identify restriction fragments carrying promoters, I bound these fragments to a nitrocellulose filter by forming specific binary complexes between RNA polymerases and promoter fragments. Only DNA bound to RNA polymerase will stick to nitrocellulose when filtered (14). Figure la shows the restriction fragments that were retained Figure 1. A 5% TBE polyacrylamide slab gel, stained with ethidium bromide, showing the top portion of an Alu I digest of 2 1/2 micrograms of T7 in lane (b), and the fragments of 10 micrograms of the same Alu I digest that were filterbound with 3 micrograms of RNA polymerase in lane (a). See Materials and Methods for filter binding procedure. 1898 Nucleic Acids Research on and then extracted from such a filter. Thus I identified an 815 basepair long Alu I fragment as a promoter fragment. Similarly, several other promoter fragments were identified: an approximately 1300 basepair long Hae III fragment, three Hpa II fragments of 520, 105 and approximately 1100 basepairs and two Hind II fragments 105 and 280 basepairs long. (A 795 basepair long Hind II fragment from the E. coli lac region and its Hae III digest served" as size markers (16) .) Increasing the molar ratio of RNA polymerase to DNA causes the retention of further specific fragments on filters (data not shown). I presume that such fragments contain weaker promoters. I focused attention on the strongest promoters; those that bound RNA polymerase first. Since only one promoter fragment was obtained with both Alu I and Hae III, these fragments may contain all three major promoters. Hpa II, on the other hand, cut between these promoters, creating three filterbound fragments. The major promoters are located within approximately 400 - 750 basepairs from the left end of T7 by electron microscopic mapping (most recent measurements: 17,18). Therefore, I reasoned that at least some of the filterbound fragments might contain the left terminus of T7, which would provide an ideal reference point for further mapping. To test this possibility, whole T7 DNA was labelled at the 5' termini with P (see Materials and Methods), and then digested with Alu I, for example. By electrophoresing this digest in parallel with an Alu I digest endlabelled after cutting, I identified the two terminal fragments of T7. Several of the filterbound promoter fragments are left terminal fragments of T7: the 815 basepair long Alu I fragment, the 1300 basepair Hae III and the 520 basepair Hpa II fragments (see Fig. 3 for final map). I now easily obtained a restriction map of the early (left terminal) region. For example. Fig. 2 shows a partial Hind II restriction digest of the 815 basepair long Alu I band labelled at the left terminus only, which establishes the location of the recognition sites of this enzyme. 1899 Nucleic Acids Research /.Q|O"O 6 3 0 Figure 2. Autoradiograph of a 5% TBE polyacryl amide gel, showing Hind II partiais of the left terminal 815 basepair long Alu I fragment of T7, labelled at the left terminus only (whole T7 was endlabelled and then digested with Alu I) . Sizes in numbers of basepairs are indicated on the right. Partiais were obtained by severely limiting digestion times. 245 80 70 Further restriction experiments led to the map shown in Fig. 3. With this map I deduced the approximate positions of the promoters and I proceeded to sequence the relevant DNA fragments. Since Pribnow had previously determined the sequences of portions of A2 and A3 these promoters were easy to identify on my sequences (2,4). For Al, however, I had to sequence the corresponding mRNA as well. SEQUENCING The previously published portion of the A3 sequence contained a Hinf I site about 15 nucleotides into its trans- 1900 Nucleic Acids Research Basapairs from thm laft end of T7 O 10O 200 9OO 3OO Alu I Hint I Hpa II Rha I Toq I : in AD "T"" : I Al —fr Figure 3. Restriction map of the leftmost region of T7 , indicating initiation sites for the three early promoters of Al, A2 and A3 and the approximately position of the minor promoter AO (17,18,19). Sequencing work for AO is in progress. Hsieh and Wang have established some of the restriction sites as well (19). cribed portion (2). The only such site in the early region, at about 740 basepairs from the left end of T7, this was a convenient restriction cut from which to sequence A3. Also, the map in Fig. 3 shows two convenient Hpa II cuts flankinq the A2 promoter. Microgram quantities of the 815 basepair Alu I fragment were digested with Hpa II and Hinf I to obtain thus two promoter fragments, the 104 basepair long Hpa II - Hpa II piece and the 112 basepair long Hpa II - Hinf I piece, containing A2 and A3 respectively. After labelling and electrophoresis I eluted both bands from the gel, and separated the strands by denaturing them in .3 NaOH and electrophoresing them on a 5% TBE polyacrylamide gel (the strand separation procedure is described by Haxam and Gilbert (13)). I isolated" the separated strands, and sequenced them according to the dimethylsulfate/ hydrazine technique of Maxam and Gilbert (13). The strands representing the sense strands of T7 (r strand) ran as the faster of the two for both fraamfints. Fig. 4 shows the sequences of A2 and A3 (the sequence obtained with one strand is confirmed by its counterpart on the other strand). The underlined portions are the sequences which Pribnow had elucidated previously (2,4) and which I 1901 Nucleic Acids Research -35 -10 -1+1 ACAAMCGGTTGACAACATGA AGTAAACACGGTACGATGTACCACATGAAACGACAGTGAGTC T7A3 AAACAGGTATTGACAACATGAAGTAACATGCAGTAAGATACAAATCGCTAGGTAACACTAGCAG T7A2 AAAA6A6TATTGACTTAAAGT CTAACCTATAGGATACTTACAGCCATCGAGAGGGACACGGCG pppAUCGACACGGA T7A1 T7AlmRHA Figure 4. Promoter sequences of Al, A2 and A3. The underlined portions of A2 and A3 are protected by HNA polymerase from pancreatic DNase digestion and have been sequenced pre= viously (2,4). The Al mRNA is indicated below the DNA sequence. Sequences are shown to -43, about the farthest base of A3 protected by RNA polymerase against exonuclease III (to be published) . Cutting with Hind II around the -35 region of A3 abolishes both binding to and transcription of that promoter (unpublished observation); a similar phenomonon has been observed in several other promoters (5). confirmed here. Hsieh and Wang (19) established independently the sequence contained in the Hind II - Hinf I portion of A3 as well. From the filter binding and restriction data presented above I located the Al promoter somewhere to the left of the Hind 11/ Hpa II restriction sites 525 basepairs from the left T7 terminus (see Fig. 3 ) . The Taq I site at position 480 was the only other restriction enzyme site in this region. The 480 basepair long Taq I fragment was obtained by digesting the terminal Alu I piece. After labelling its ends with 3 2 P , I cut with Hind II to get a 240 basepair fragment, labelled at its Taq I end only; this I sequenced directly. To sequence across and to the right of the Taq I site at position 480, I labelled the ends of the 280 basepair Hind II fragment (see Fig. 3) and separated its strands as described above. After sequencing both strands, I located the Taq I site and the beginning of the previous sequence on one of them. I now had a continuous sequence surrounding the Taq I site region. To show the Al promoter was indeed located in the region sequenced, I partially sequenced the RNA initiated at Al 1902 Nucleic Acids Research and matched this sequence with my DNA sequence to find the RNA initiation point. Fig. 5 shows the partial RNA sequence, which was determined according to Donis-Keller e_t. a^. (15) (see Materials and Methods). To achieve the necessary labelling at the 5' end of the message, I transcribed it off the 520 basepair Hpa II fragment (see Fig. 3) in the presence of [gamma-32P] ATP (see Materials and Methods). This RNA was 39 nucleotides in length and its start site agrees with the initation studies of Minkley and Pribnow (11). Fig. 4 Figure 5. Showing autoradiogram of the Al mRNA sequence (see Materials and Methods) , with NaOH hydrolysis, Tl and U2 partials in l a n e s *b' ' ' c ' a n d ' d ' respectively; lane (a) represents a control without any added RNases and shows background degradation of RNA. Bromophenol blue (BPB) runs with about 8 basepairs and xylene cyanol (XC) runs with about 26 basepairs. G G -^ .BPB G A G A G Py Py 1903 Nucleic Acids Research shows the Al promoter sequence and its transcript. DISCUSSION In order to detect nucleotides which might be relevant to promoter function, I have lined up all available promoter sequences in Fig. 6. (Similar analyses have recently been undertaken by others as well (37).) The sequences were aligned for maximum homology in the Pribnow Box and -35 region, treating each region separately, however. Due to this novel alignment, the distance between the two DNA regions varies among promoters, but only by + one basepair; whether this is significant cannot yet be assessed. Fig. 6 shows that the most probable sequences to be -35 c A G C T •30 AAAA C G G TTG ACA A CA T G A A T C T T C C A A A T A G T T C T A C A G G G C A G A T T C A C T A C T A G 6 1 6 7 7 5 4 4 A G T C T T T T G C T C A C A C T T T 4 2 5 9 GA G C GG GC G C GA TT T T AA CA G T GT A G C G AA CA T A G G C GG T CT AT A C AG AT T CT C C A A 6 3 7 4 T T T A T C G T T T G T T T G G C C A A G G G G G A G G G T A G G C C C G C T T T T A T T T T G T T T T T T A T T T T T T T T T T T C T T T T T T T T T G A C G A C G A C GAG G C A T A C G A C G T T G A C G CA G A C G A C A G A G A C G C A T A C G T C G T A T A C S 4 2 3 2 0 1 1 3 5 6 7 5 1 2 1 0 16 1 2 4 3 4 0 1 0 3 1 3 4 5 O 1 1 7 19 3 3 1 T A T T A A A A A A A A T A A A A C A T T A A T A C A A A G A A T A C C T G AA A A T T TT TC TT CC CT TT AC CT CA TT TT AT TT A C TT CG A GT ATA T TA T TT G CT T A A T CC T GT A AT C TT TAT T GA A T A T C T AA A A C G T T AT G T T T T G TT G C G 1 5 10 5 4 4 6 6 1 0 2 0 1 3 4 2 1 3 6 4 1 4 1 4 S 9 1 1 1 2 6 1I G T C C C T T A T A C A GT CC AG GG CT CG T C 3 4 6 7 -20 T AA A AC A CT T C T T G T GC T A TT A TT A TT T CG GCG T CG A A C T TG A GC C CT T CC C A T C GC G TC 7 3 3 7 4 3 8 5 1 4 6 9 -10 A C G G A T T G G A G A A C G T G C G A 6 9 3 3 C T G G T C G T C A T T T G T A G T C T 2 5 4 9 A A C C T T C A A C A A G G G T C T T T C T G G T G T T G T T A C T G G T T T T G A G G G A T G C A G G A G A G C G G G G T GG TG TG TC CT AT T T T T G T GC C T GT AT TT TT GT T T G T AT A CG ATA ATA ATA ATA ATA A C A T TC ATA T AA A TG T TA A AG A G A ACT A C A ATA A TG ATA A TG 0+1 A C C A A A A A A C A A A T A G A C A A T T T T T T T T T T T T T T T T T T T T 6 1 5 3 0 17 2 13 U 3 6 12 7 3 O 1 5 1 5 2 1 2 2 0 4 1 4 0 6 11 2 8 1 5 3 1 3 1 1 G T G G G A C G G A A G A T C A G A C G 0 O 3 2 T A A G A G A C G G G C C A T T T T G C 6 9 4 0 A C C A C ® T T7A1 C A G C C ® T T7A1 G C A C ® T C XPL T T G C @ T G \PR C T C C T © T XPO A C A © © © T fdX T C C T © T T fdll C T C C ® A A *IA T T A C ® A A SV40 T A C G C ® A trp C G C C C Q G Ucl G G T A C T T tit A A A T C © C T7A2 A C G T ® T G XPrm G A G T C C© G C C C®T C G T G © ® A T loo UVS G G T T ® T T gal(-cap) C T©©©©T fdVIII G C C C©C T TyrtRUA 5 4 6 7 5 7 2 5 4 4 3 6 6 4 6 9 2 2 4 6 5 8 6 3 5 5 4 2 3 1 7 1 0 Figure 6. The available promoter sequences for E. coli RNA polymerase are lined up for maximum homology in the --35 and Pribnow Box regions respectively; consequently the distance between these two regions varies by + one basepair. The X Prm and lac I sequences also allow a different alignment around -35"! Additional, recently published promoters support the homologies detected here. The sequences are shown out to -43, about the farthest base protected by RNA polymerase from exonuclease III in the case of A3 (to be published). UPL(20), APR (21,22), XPO(23), fdX(24,25), fd II (26,27), <f>XA(28) , SV40(29), trp (30), lac 1(31) tet(32), XPrm(33,34), 4>XD(28), (t>XB(28), lac UV5(5), gal (35) fdVIII(27), Tyr tRNA(36)). 1904 Nucleic Acids Research recognized by RNA polymerase are TTGACA and TATAAT for the -35 ion and the Pribnow Box, respectively. But not one of the promoters listed shows a perfect match with both 'ideal' sequences. Other regions exhibit some degree of homology as well (see Fig. 6 ) . I found relatively conserved stretches of basepairs immediately preceeding the Pribnow Box and following the -35 homology; the latter region is high in AT content and possibly plays an indirect role during the binding process. Although principal points of contact with RNA polymerase probably lie in the more highly preserved sequences, weaker homologies and even nonhomologus regions may define the promoters as well. Only experiments which directly probe the interaction between RNA polymerase and DMA on the nucleotide level will yield more information on this point. Since the existence of three closely spaced major early promoters of T7 may be to assure transcription under a variety of conditions (38), it is not surprising to observe extensive variance in their Pribnow Box sequences (except the second and the universally conserved sixth position), but all contain 'good' -35 sequences. Indeed, A2 and A3 share a seventeen basepair sequence in this region and detailed studies have revealed a particularly striking difference in the temperature and salt sensitivities between these two promoters (3 8). Two explanations for the lower transition temperature of A3 seem possible. The distance between the -35 region and the Pribnow Box is larger for A2 than for A3, and A3 has a slightly better match with the 'ideal' Pribnow Box sequence and the weak homology preceding it. Indeed, in the case of lac UV5 versus lac P S , a single base difference at the fifth position in the Pribnow Box (TA goes to AT) causes a larqe transition temperature change (37). Combining kinetic and structural approaches to the interaction of E. coli RNA polymerase with its various promoters, one should ultimately be able to 'read' any promoter code. The complete primary structure of the three strong promoters Al, A2 and A3 provide the basis for such experiments 1905 Nucleic Acids Research on T7. ACKNOWLEDGEMENTS I thank Walter Gilbert for advice and for help with the manuscript. This work was supported by a National Institutes of Health grant to Walter Gilbert (GM09541-17). REFERENCES 1. Saucier, J.-M., Wang, J.C. (1972) Nature New Biol. 239, 167-170. 2. Pribnow, D. (1975) Proc. Natl. Ac ad. Pci. USA 12^, 784-788. 3. Schaller, H., Gray, C , and Herrmann, K. (1975) Proc. Natl. Acad. Sci. USA 72, 737-741. 4. Pribnow, D.~fT97f) J. Mol. Biol. £9, 419-443. 5. Gilbert, W. (1976) in RNA Polymerase, eds. Losick, R. and Chamberlin, M. (Cold Spring Harbor Laboratory, Cold Sprinq Harbor, NY) pp. 193-205. 6. Maniatis, T., Ptashne, M., Backmann, K., Kleid, D., Flashman, S., Jeffrey, A. and Maurer, R. (1975) Cell 5, 109-113. 7. Dickson, R., Abelson, J., Barnes, W. and Reznikoff, W. (1975) Science 187, 27-35. 8. Kleid, D., Humayun, Z., Jeffrey, A. and Ptashne, M. (1976) Proc. Natl. Acad. Sci. USA 73, 293-297. 9. Meyer, B., Kleid, D. and Ptashne, M. (1975) Proc. Natl. Acad. Sci. USA 22.- 4785-4789. 10. Musso, R.E., DiLauro, R., Adhya, S. and de Crombrugghe B. (1977) Cell 12, 847-854. 11. Minkley, E.G., Pribnow, D. (1973) J Mol. Biol. 22' 255-277. 12. Roberts, R., Myers, P., Morrison, A and Murray, K. (1976) J. Mol. Biol. 102, 157-165. 13. Maxam, A. and Gilbert, W. (1977) Proc. Natl. Acad. Sci. USA 74, 560-564. 14. HTnkle, D. and Chamberlin, M (1972) J. Mcd. Biol. 7£' 157-185. 15. Donis-Keller, H-, Maxam, A.M and Gilbert, W. (1977) Nucleic Acids Res. £, 2527-2538. 16. Gilbert, W. , Gralla, J., Majors, J., Maxam, A. (1975) In: Protein Ligand Interactions (eds. Sund, H. and B]ane, G., Berlin: Walter de Gruyter) pp. 193-210. 17. Williams, R.C. (1977) Proc. Natl. ftcad. Sci. USA 74, 2311-2315. ~~ 18. Roller, T., Kuebler, 0., Portmann, R. , and Sogo, J..M. (1978) J. Mol. Biol. 120, 121-132. 19. Hsieh, T. and Wang, J. (1976) Biochemistry 1-5, 5776-5783. 20. Maniatis, T., Ptashne, M., Barrell, B.G., am! Donelson, J. (1974) Nature 250, 394-397. 21. Maniatis, T., Jeffrey, A., Kleid, D.G. (1975) Proc. Natl. Acad. Sci. USA T2, 1184-1188. 22. Walz, A., Pirotta, V. (1975) Nature 254, 118-121. 23. Scherer, G., Hobom, G., Kossel, K. (1977) Nature 265, 117-121. 1906 Nucleic Acids Research 24. Sugimoto, K., Okamato, T., Sugisaki, K., Takanami, M., (1975) Nature 253, 410-414. 25. Schaller, H., Gray, C , Herrmann, K. (1975) Proc. Natl. Acad. Sci. USA T2, 737-741. 26. Takanami, M., Sugimoto, K. , Sugisaki, H., Okamato, (1976) Nature 260, 297-302. 27. Seeburg, P., Nusslein, C., Schaller, H. (1977) Eur. J. Biochera. 74, 107-113. 28. Sanger, F., Air, G.M., Barrell, B.G. Brown, N.C., Coulson, A.R., Fiddes, J.C., Hutchison, C.A., Slocombe, P.M., and Smith, M. (1977) Nature 265, 687-695 29. Dhar, R., Weissman, S.H., Zair, B.S. Pan, J. (1974) Nucleic Acid. Res. 1, 595-614. 30. Bennett, G.N., Brown, K.D. and Yanofsky, C. (1977) Fed. Proc. 36, 878 (Abstract 3199). 31. Calos, M.P . (1978) Nature 274, 762-764. 32. Sutcliffe, G. (1978) Cold Spring Harbor Symp Ouant. Biol. Vol. 43, in press 33. Ptashne, M ., Backman, K., Humayun, M.Z., Jeffrey, A., Maurer, R. Meyer, B. and Sauer, R T. (1976) Science 194, 156-161. 34. Walz, A., Pirotta, V. , Ineichen, K. (1976) Nature 262, 665-669. 35. Husso, R. DiLauro, R., Rosenberg, M. and De Crombrugghe, B. (1976) Proc. Natl. Acad. Sci. USA 74, 106-110. 36. Sekiya, T , Takeya, T., Contreras, R., Kupper, M., Khorana, G. Landy, A. (1976) in RNA Polymerase eds. Losick, R. and Chamberlain, M. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) pp. 455-472. 37. Majors, J. (1977) Ph.D. Thesis, Harvard University. 38. Dausse, J.-P., Sentenac, A. and Fromageot, P. (1976) Eur. J. Biochem. 65, 387-393. 1907 Nucleic Acids Research 1908
© Copyright 2026 Paperzz