This information is current as
of June 17, 2017.
Long Distance Control of MHC Class II
Expression by Multiple Distal Enhancers
Regulated by Regulatory Factor X Complex
and CIITA
Michal Krawczyk, Nicolas Peyraud, Natalia Rybtsova,
Krzysztof Masternak, Philipp Bucher, Emmanuèle Barras
and Walter Reith
References
Subscription
Permissions
Email Alerts
This article cites 53 articles, 29 of which you can access for free at:
http://www.jimmunol.org/content/173/10/6200.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2004 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
J Immunol 2004; 173:6200-6210; ;
doi: 10.4049/jimmunol.173.10.6200
http://www.jimmunol.org/content/173/10/6200
The Journal of Immunology
Long Distance Control of MHC Class II Expression by
Multiple Distal Enhancers Regulated by Regulatory Factor X
Complex and CIITA1
Michal Krawczyk,* Nicolas Peyraud,* Natalia Rybtsova,* Krzysztof Masternak,*†
Philipp Bucher,‡ Emmanuèle Barras,* and Walter Reith2*
M
ajor histocompatibility complex class II (MHC-II)3
genes encode heterodimeric cell surface glycoproteins
specialized for the presentation of peptides to the Ag
receptor of CD4⫹ Th lymphocytes. This MHC-II restricted Ag
presentation directs the development and homeostasis of the mature CD4⫹ T cell population and orchestrates the initiation, propagation, and regulation of immune responses to exogenous Ags (1,
2). In humans, there are seven functional genes encoding the ␣and ␤-chains of the classical MHC-II molecules HLA-DP, HLADQ, and HLA-DR. The intracellular transport and peptide loading
of these molecules require the function of accessory genes, including those encoding the invariant chain (Ii) and the nonclassical
MHC-II molecules HLA-DO and HLA-DM (1, 3). With the exception of the Ii gene, which is located on chromosome 5, all these
genes are clustered in the class II region of the MHC locus on the
short arm of chromosome 6 (4, 5).
Establishing a proper pattern of MHC-II-restricted Ag presentation is critical for the immune system. The MHC-II and accessory genes are consequently tightly coregulated and expressed in a
precisely controlled fashion (6, 7). Constitutive expression is primarily restricted to specialized APCs (B cells, dendritic cells, and
macrophages) and epithelial cells of the thymus. Many other cell
*University of Geneva Medical School, Centre Médical Universitaire, Geneva, Switzerland; †NovImmune, Geneva, Switzerland; and ‡Swiss Institute for Experimental
Cancer Research, Swiss Institute of Bioinformatics, Epalinges, Switzerland
Received for publication April 8, 2004. Accepted for publication August 17, 2004.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by grants from the Swiss National Science Foundation, the
Comission pour la Technologie et de l’Innovation, and NovImmune.
2
Address correspondence and reprint requests to Dr. Walter Reith, University of
Geneva Medical School, Centre Médical Universitaire, 1 rue Michel-Servet, CH1211, Geneva, Switzerland. E-mail address: [email protected]
3
Abbreviations used in this paper: MHC-II, MHC class II; ChIP, chromatin immunoprecipitation; Ii, invariant chain; LCR, locus control region; RFX, regulatory factor
X complex.
Copyright © 2004 by The American Association of Immunologists, Inc.
types can be induced to coexpress these genes by exposure to
IFN-␥ or other stimuli (7). Coordinate expression of MHC-II and
accessory genes is controlled at the level of transcription by a
shared 59- to 68-bp regulatory module situated within ⬃300 bp
upstream of the transcription initiation site of each gene (8). This
promoter-proximal regulatory module is a composite motif consisting of four well-defined sequence elements, the S, X, X2, and
Y boxes, present in a strictly constrained order, orientation, and
spacing (Fig. 1A). This characteristic architecture is essential for
function of the S-Y module (9, 10)
The S, X, X2, and Y boxes are the targets, respectively, of an as
yet unidentified S binding protein, the trimeric regulatory factor X
complex (RFX) (11–15), CREB (16), and NF-Y (17). These factors bind cooperatively to form the so-called MHC-II enhanceosome complex (18 –21). The well-defined architecture of the S-Y
module is believed to reflect spatial constraints imposed by the
formation of this enhanceosome. Assembly of the MHC-II enhanceosome generates a “landing pad” that serves to recruit the transcriptional coactivator CIITA (7, 18, 22–26).
RFX and CIITA are both essential and specific for activation of
MHC-II promoters. This is underlined by the fact that mutations in
CIITA or one of the three subunits of the RFX complex (RFXANK, RFX5, and RFXAP) are responsible for a severe hereditary
immunodeficiency disease characterized by a highly specific defect in MHC-II expression (7, 11–15, 27, 28).
There is no doubt that the promoter-proximal S-Y modules are
essential for the expression of MHC-II and accessory genes, and
research in the field has thus concentrated on these regions (7, 25,
26). However, there is growing evidence that additional distal regulatory elements also play a key role. First, a locus control region
(LCR) has been described upstream of the mouse H2-Ea gene (29,
30). Although a detailed dissection of this LCR is lacking, it is
clear that one of its key elements is an inverted copy of the S-Y
module (S⬘-Y⬘) situated ⬃1.3 kb upstream of the H2-Ea gene and
⬃2.3 kb upstream of the orthologous human HLA-DRA gene. We
have shown that this distal S⬘-Y⬘ enhancer is bound in vivo by
0022-1767/04/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
MHC class II (MHC-II) genes are regulated by an enhanceosome complex containing two gene-specific transcription factors,
regulatory factor X complex (RFX) and CIITA. These factors assemble on a strictly conserved regulatory module (S-X-X2-Y)
found immediately upstream of the promoters of all classical and nonclassical MHC-II genes as well as the invariant chain (Ii)
gene. To identify new targets of RFX and CIITA, we developed a computational approach based on the unique and highly
constrained architecture of the composite S-Y motif. We identified six novel Sⴕ-Yⴕ modules situated far away from the promoters
of known human RFX- and CIITA-controlled genes. Four are situated at strategic positions within the MHC-II locus, and two are
found within the Ii gene. These Sⴕ-Yⴕ modules function as transcriptional enhancers, are bona fide targets of RFX and CIITA in
B cells and IFN-␥-induced cells, and induce broad domains of histone hyperacetylation. These results reveal a hitherto unexpected
level of complexity involving long distance control of MHC-II expression by multiple distal regulatory elements. The Journal of
Immunology, 2004, 173: 6200 – 6210.
The Journal of Immunology
6201
RFX and CIITA and exhibits functional features strongly reminiscent of the LCR of the ␤-globin locus (31). Second, an enhancer
resembling the S-Y module has been described in the first intron of
the Ii gene (32).
With this in mind, we designed a computational approach relying on the unique architecture of the composite S-Y regulatory
module to identify novel target sites of RFX and CIITA. This led
to the unequivocal identification of six novel S-Y like (S⬘-Y⬘)
modules. These include four sites placed at strategic positions
within the MHC-II locus and two intronic enhancers in the Ii gene.
Formation of the MHC-II enhanceosome and recruitment of CIITA to these S⬘-Y⬘ modules mediates long-range chromatin remodeling, as indicated by the induction of global histone hyperacetylation over large domains. These findings reveal that the
regulation of MHC-II expression exhibits a previously unsuspected level of complexity, involving a combination of promoterproximal and -distal regulatory elements.
Materials and Methods
FIGURE 1. Identification of new S⬘-Y⬘ regulatory modules. A, Alignment of the S-Y modules from human MHC-II and related genes. Identical
residues are highlighted, and regions with ⬎50% identity are boxed. A
sequence logo for the S-Y region is shown below; the font size reflects the
frequency at which a nucleotide is found in the alignment. B and C, Results
of scans of the entire human genome with the MHC-II (B) and inverted (C)
profiles. S-Y-like sequences are plotted with respect to their position in the
genome and their score. Chromosomes were assembled into the genomic
sequence in the order 1 through 22, Y and X. Boxes show the positions of
chromosomes 5 and 6. S-Y sequences in the Ii, and MHC-II regions are
shown by arrows. An enlargement of the MHC-II region is shown below
the graph obtained with the MHC-II profile. MHC-II genes are represented
by arrowheads, and the solid box delimits the TAP/LMP region. New
S⬘-Y⬘ modules not corresponding to the promoters of MHC-II genes or
pseudogenes are shown by vertical lines. These include the distal enhancer
situated upstream of the HLA-DRA gene (DRAe) and the new motifs numbered 1 through 9. D, Densities of S-Y-like motifs in the entire genome and
in the MHC-II region. In the MHC-II region, the promoter S-Y modules of
functional MHC-II genes and pseudogenes were either included (all) or
The sequence alignment used to create the search profile was constructed
using promoter sequences from the following genes and alleles: DRA
(X83114), DRB1*0101 (M81172), DRB1*0102 (X64441), DRB1*0302
(X64440), DRB1*0405 (L07840), DRB1*0802 (X64442), DRB1*0803
(X64439), DRB1*1201 (X64438), DRB1*1301 (X65565), DRB1*1302
(X65564), DRB1*1401 (X65563), DRB1*1402 (X65562), DRB1*03011
(Z84489), DRB1*0802 (X64442), DRB1*0901 (L07839), DRB2
(S57469), DRB3 (S57471), DRB3*0101 (X65558), DRB3*0201
(X65559), DRB4 (S57473), DRB4*0101 (L07841), DRB5 (S57475),
DRB5*0101 (X64548), DRB5*02 (X64549), DRB-WS9009 (M81174),
DRB-WS9010 (M81171), DRB-WS9011 (M81180), DMA (AJ249712),
DMB (AJ249714), DQA1-DRw17-Dw3 (M97464), DQA1-DRw8-Dw8.3
(M97463), DQA1-DR4-DR5 (M97462), DQA1-DR4-Dw4 (M97461),
DQA1-DRw8-Dw8.1 (M97459), DQA1-DR9-Dw23 (M97458), DQA1DR7-DB1 (M97457), DQA1-DRw15-Dw2 (M97455), DQA1-DR1-Dw1
(M97454), DQB1*02 (U49059), DQB1*0201 (X74230), DQB1*0402
(Z80898), DQB1-Dw4-DR4 (K01499), DPA (X02228), DPB (X02228),
DOA (Z81310), DOB (L29472), and Ii (NT_029289). A frequency table
was established for the nucleotides at all positions, converted to a generalized profile (33), and modified to increase the weight of the core X and
Y boxes. The final search profile was the following:
ID MHC_CLASS_2_PRM; MATRIX.
AC NS00001;
DT OCT-2001 (CREATED).
DE mammalian MHC class II promoter model
MA/GENERAL_SPEC: ALPHABET ⫽ ‘ACGT’; LENGTH ⫽ 68;
MA/DISJOINT: DEFINITION ⫽ PROTECT; N1 ⫽ 1; N2 ⫽ 68;
MA/NORMALIZATION: MODE ⫽ 1; FUNCTION ⫽ LINEAR; R1 ⫽
0.0; R2 ⫽ 0.01;
MA TEXT ⫽ ‘ru’;
MA/CUT_OFF: LEVEL ⫽ 0; SCORE ⫽ 500; N_SCORE ⫽ 10.0;
MODE ⫽ 1;
MA/DEFAULT: B0 ⫽ 0; B1 ⫽ *; E0 ⫽ 0; E1 ⫽ *; SY_M ⫽ ‘N⬘; II ⫽
*;
MA/I: B0 ⫽ 0; B1 ⫽ 0;
MA/M: SY ⫽ ‘G’; M ⫽ ⫺10, ⫺282, 50, ⫺142;
MA/M: SY ⫽ ‘R’; M ⫽ 12, 0, 22, ⫺142;
MA/M: SY ⫽ ‘R’; M ⫽ 28, 0, ⫺16, ⫺46;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺282, 42, ⫺282, 16;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺46, 42, ⫺46, ⫺16;
excluded (new). E, S⬘-Y⬘ motifs described in this study (sequences 2, 4,
H2-Ab distal, 6, 8, HSCD74 (Ii), and S⬘⬘-Y⬘⬘) and previously (HSCD74 (Ii)
S⬘-Y⬘, distal HLA-DRA and H-2E␣ motifs) are aligned with the classical
S-Y modules found in the promoter regions of MHC-II genes. Distances in
nucleotides among the S, X/X2, and Y sequences are indicated. Identical
residues are highlighted, and regions with ⬎50% identity are boxed. Boldface is used for the most frequent nucleotide. The consensus sequence
based on ⬎50% identity is shown below the alignment. HS, Homo sapiens;
MM, Mus musculus; RN, Rattus norvegicus.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Identification of new S⬘-Y⬘ modules
6202
LONG DISTANCE CONTROL OF MHC-II EXPRESSION
Scans of the Genomic Reference Sequence of Homo sapiens, build 29
(International Human Genome Sequencing Consortium), were performed
with the program pfscan from the pftools package (available at: ftp://ftp.
isrec.isb-sib.ch/pub/software/unix/pftools/), which is a software implementation of the generalized profile method (33).
Cell lines
RJ2.2.5 is a CIITA-deficient mutant derived from the wild-type human Raji
B cell line (27, 34). The RFXANK-deficient B cell line BLS1 was derived
from a BLS patient with a null mutation in the RFXANK gene (13, 35).
BLS1c is BLS1 complemented stably with a wild-type RFXANK cDNA
(36). ME67.8 is a human melanoma cell line previously used to study
IFN-␥-induced CIITA and MHC-II expression (37). Cells were grown in
RPMI 1640 and Glutamax medium (Invitrogen Life Technologies, Carlsbad, CA) supplemented with 10% FCS and antibiotics. Me67.8 cells were
induced with 200 U/ml human IFN-␥ (Invitrogen Life Technologies).
Chromatin immunoprecipitation (ChIP) assays
ChIP assays were performed as previously described (31) using polyclonal
rabbit anti-RFX and anti-CIITA antisera (11, 38); anti-histone H3 (ab1791;
Abcam, Cambridge, UK), anti-acetylated histone H3, 8, and histone H4
Abs (06-599 and 06-866; Upstate Biotechnology, Lake Placid, NY); and a
mixture of two anti-CREB Abs (sc-186 and sc-58; Santa Cruz Biotechnology, Santa Cruz, CA). Ten micrograms of chromatin (corresponding to
1.2 ⫻ 107 cells), fragmented by sonication to an average size of ⬃400 bp,
was used for each immunoprecipitation. All ChIP experiments were repeated at least twice with identical results. DNA sequences present in the
immunoprecipitates were quantified by real-time PCR using the primers
listed in Table I. To avoid cross-reactivity with different S-Y modules, at
least one of the primers in each pair was placed at unique sequences situated outside of the conserved S, X, X2, and Y boxes (Fig. 2D). PCR was
performed using the ABI PRISM 7700 Sequence Detection System (Applied Biosystems, Foster City, CA) and a SYBR Green-based kit for quantitative PCR (Eurogentec, Seraing, Belgium). The specificity of amplification was controlled by gel electrophoresis and dissociation curve analysis.
The amounts of immunoprecipitated DNA were calculated by comparison
with a standard curve generated with serial dilutions of input DNA. For
Table I. Primers used for ChIP experiments
Name
Forward Primer 5⬘-3⬘
Reverse Primer 5⬘-3⬘
1
2
3
4
DQBp (0)
DQB, ⫺1.1 kb
DQB, ⫺2.3 kb
DQB, ⫺3.1 kb
DQB, ⫺4.4 kb
5
6
7
8
8, ⫺1 kb
8, ⫺2 kb
8, ⫺4 kb
8, ⫹1 kb
8, ⫹2 kb
8, ⫹4 kb
9
DRAp (0)
DRA, ⫺1.3 kb
DRA, ⫺2.3 kb
DRA, ⫺3.5 kb
DRA, ⫺4.9 kb
Ch3
Ch5
Ch11
Ii S⬘-Y⬘
Ii S⬙-Y⬙
Ii between S-Y
AGTCCTAGCATTAGTCTGGTTTCGAG
CATCACTTGTCTCCAGCAGATATGTC
CCAGGAGTCCTTAACTATGTTCTTCG
GAGGCAACTGCTACGCCAGA
CTGCCCAGAGACAGCTGAGGT
GCAAAAGCTGTGGAGAAG
AAGGACCATCCAGGACCCTAC
CCTTGAAGACCGAAGAAGAC
AACTTTCCCTTGGCATAATGAG
AAGTGTGTACATGAAACTAGCAACCAA
AAGGTTACTAGGCAAGATTGTGATTGA
GGAGAAGTAGGTGCTTACAG
ACAGCTTCAGTTACACACATCCGT
ATCTGCTCTGGGACAGAAATC
AGTGTCCCGTATTTGCATGG
CAATTGCTTTGGCTATTCAAGG
ATCCTTAAATCCCAAGGAAGGGTATG
GCTTGTGTAAGGTTAGCAAATG
TTTCAACCTCTTTGTAACTTTGTATC
TCTCACTTCTATGTCCACGTGACAC
ATTTTTCTGATTGGCCAAAGAGTAATT
TCTGTGGAAAGAACTTAACATTCTCCT
CAGAGAAAGGGAACTGAAAGTCATTT
CTGCCCTAGCACATTTGTTAACG
AACCTTGCACAAGAGAAAAGCTTTAC
ACCGTGCCCAAATAAGG
GTTCCTGTAACAGCAACTTATTC
GAGCCTCCAGTATTTCAGAC
CCAGGCAGAAGCATTCAC
ACGCAGTCTGTGGTATTC
ACGAGACCACATAACCTGGATTG
ACAGCTATCACCTGTTTCTTTCGAC
CCGTGAAACTACATCGTAGCCA
TTTGGCCAACACTTGAACAATC
GCTAGCTGAAAAGTCTGTGCGAA
TGATGTACCTGGCAGAAAGAATAAAAA
TTTAGGGCTGGCACAGTA
GGGGCAGCATTTCTAGTTATATTACC
AATGCGTGGATGAGGAGAC
TTCCATGTCTGGCTTATTTCAC
TTTTTTAAAGCAGCATCCCGTATT
TGACTCTGCCTCATCATATGCTTC
GCATGAGACGGGAAAGTG
TGTCACTAGTTTCTGGCAGACTAAGC
TGACTGCCTTCCTTATCACTC
AGTTGCTCTGGGCGAATGG
AAATGTCTGTACTACCCAAAGTG
AGGAACCTGGTTTACCCAAATACAC
CACAAAGAAATCTGTAGGCAAAGATG
TTCAATTTAGACAGGTTAGCAGAATG
AAGGGAGAGGTATGGCATGCTA
AAAAGAAAAGAGAATGTGGGGTGTAA
GATGTTCAACATAGACACTCCTGAAA
TTATGACACTGTTTAGTCCTAGAACACTGA
GCTGGTCTGCTGGAATAGATCC
GGAAGAGAAAAAGACCAGAAACGTC
CCCAGCAATGTAGACAGAC
CTCACAATGCACATATGGTTTC
GAGCAGGAGGCAAATTAGTG
GTGCTTAGGCCATTCCAG
TCCTTGCAGTTCCCAATG
CAACTTAGATGGTCCCAGAACTAAC
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺46, 12, ⫺142, 36;
MA/M: SY ⫽ ‘T’; M ⫽ ⫺46, ⫺142, ⫺46, 52;
MA/M:/M:/M:/M:/M:/M:/M:/M:/M:
MA/I: MD ⫽ 0;/I: MD ⫽ 0;/I: MD ⫽ 0;/I: MD ⫽ 0;/I: DM ⫽ 0;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺141, 16, ⫺141, 16;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺141, 16, ⫺141, 16;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺141, 16, ⫺141, 16;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺141, 16, ⫺141, 16;
MA/M: SY ⫽ ‘R’; M ⫽ 16, ⫺8, 16, ⫺71;
MA/M: SY ⫽ ‘C’; M ⫽ ⫺9, 26, ⫺56, ⫺71;
MA/M: SY ⫽ ‘C’; M ⫽ ⫺71, 28, ⫺56, ⫺23;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺23, 17, ⫺71, 8;
MA/M: SY ⫽ ‘A’; M ⫽ 112, ⫺282, ⫺222, ⫺282;
MA/M: SY ⫽ ‘G’; M ⫽ ⫺282, ⫺282, 118, ⫺282;
MA/M: SY ⫽ ‘Y’; M ⫽ 24, 46, ⫺282, 40;
MA/M: SY ⫽ ‘R’; M ⫽ 92, ⫺282, 4, ⫺282;
MA/M: SY ⫽ ‘A’; M ⫽ 110, ⫺92, ⫺282, ⫺282;
MA/M: SY ⫽ ‘C’; M ⫽ ⫺222, 110, ⫺92, ⫺282;
MA/M: SY ⫽ ‘W’; M ⫽ 11, ⫺19, ⫺71, 14;
MA/M: SY ⫽ ‘G’; M ⫽ ⫺7, ⫺71, 23, ⫺23;
MA/M: SY ⫽ ‘A’; M ⫽ 32, ⫺222, 32, ⫺282;
MA/M: SY ⫽ ‘T’; M ⫽ ⫺282, ⫺282, ⫺42, 104;
MA/M: SY ⫽ ‘G’; M ⫽ ⫺10, ⫺282, 94, ⫺162;
MA/M: SY ⫽ ‘A’; M ⫽ 108, ⫺74, ⫺282, ⫺282;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺23, 0, ⫺23, 18;
MA/M: SY ⫽ ‘G’; M ⫽ ⫺19, ⫺71, 23, ⫺8;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺23, 11, ⫺71, 15;
MA/M: SY ⫽ ‘Y’; M ⫽ ⫺8, 11, ⫺23, 6;
MA/M: SY ⫽ ‘R’; M ⫽ 21, ⫺23, ⫺8, ⫺23;
MA/M:/M:/M:/M:/M:/M:/M:/M:/M:/M:/M:
MA/I: MD ⫽ 0;/I: MD ⫽ 0;/I: MD ⫽ 0;/I: MD ⫽ 0;/I: DM ⫽ 0;
MA/M: SY ⫽ ‘C’; M ⫽ ⫺71, 23, ⫺23, ⫺8;
MA/M: SY ⫽ ‘T’; M ⫽ ⫺71, ⫺8, ⫺71, 26;
MA/M: SY ⫽ ‘G’; M ⫽ ⫺11, ⫺23, 24, ⫺71;
MA/M: SY ⫽ ‘A’; M ⫽ 118, ⫺282, ⫺282, ⫺282;
MA/M: SY ⫽ ‘T’; M ⫽ ⫺282, ⫺282, ⫺282, 108;
MA/M: SY ⫽ ‘T’; M ⫽ ⫺92, ⫺282, ⫺92, 102;
MA/M: SY ⫽ ‘G’; M ⫽ ⫺220, ⫺142, 106, ⫺90;
MA/M: SY ⫽ ‘G’; M ⫽ ⫺282, ⫺282, 118, ⫺282;
MA/I: E0 ⫽ 0; E1 ⫽ 0;//
The Journal of Immunology
6203
global acetylation patterns, the signals were corrected for nucleosome density by dividing signals obtained with anti-acetylated histone Abs by signals obtained with Abs directed against unmodified histone H3.
All PCRs were repeated at least three times. In all figures the results are
shown relative to the values observed at the HLA-DRA promoter in wildtype cells unless stated otherwise; error bars represent the SD from the
mean obtained from two independent ChIP experiments performed in duplicate or triplicate.
Plasmids and reporter gene assays
Promoter pull-down assays
Promoter pull-down assays with whole cell extracts prepared from BLS1
(RFXANK⫺/⫺) and BLS1c (wild-type) cell lines were performed as described previously (18).
Results
Identification of novel S-Y regulatory modules
A sequence alignment of the S-Y modules from all classical and
nonclassical MHC-II genes, including allelic variants, was used to
calculate nucleotide frequencies at all positions in the S, X, X2,
and Y boxes. These frequencies together with the S-X and X2-Y
spacing constraints were used to create a generalized profile, which
is represented graphically by the sequence logo in Fig. 1A.
The MHC-II profile was used to scan the entire human genome
using the pfscan program (33). This program assigns scores proportional to the similarity between the hits and the search profile.
The hits with scores ⬎10 are plotted in the human genome in Fig.
1B. As expected, the search identified the promoters of the Ii gene
on chromosome 5 and all classical and nonclassical MHC-II genes
on chromosome 6 (Fig. 1B). These sequences were assigned scores
ranging from 12.5–17.3 (with the exception of HLA-DQA, where
the score was 7.6). In addition, the search found a background of
FIGURE 2. Occupation of S⬘-Y⬘ modules in the MHC-II locus by the
enhanceosome and CIITA. Abs directed against RFX (A), CIITA (B), and
CREB (C) were used to immunoprecipitate cross-linked chromatin fragments prepared from Raji (wild-type), RJ2.2.5 (CIITA⫺/⫺), and BLS-1
(RFXANK⫺/⫺) cells. Immunoprecipitates were analyzed by real-time PCR
for the abundance of S-Y sequences from the MHC-II locus and randomly
selected sequences from chromosomes 3, 5, and 11. A map of the MHC-II
region is shown below B. The new S⬘-Y⬘ sequences are indicated by vertical lines (sequences 1–9). Of these new motifs, only 2, 4, 6, and 8 exhibit
specific binding of all three factors. DRAp, HLA-DRA promoter; DRAe,
HLA-DRA distal enhancer; drb6, S-Y module situated upstream of the drb6
pseudogene. D, Positions of the primers (arrows) used for real-time PCR
amplification of the new 2, 4, 6, and 8 motifs. The S, X/X2, and Y boxes
are indicated. E, Promoter pull-down experiment performed with extracts
prepared from BLS1 cells or BLS1 cells complemented with wild-type
RFXANK (BLS1c). MHC-II enhanceosomes were assembled on the HLADRA promoter, purified, and analyzed by Western blotting for the presence
of three RFX subunits. Equal amounts of BLS1 and BLS1c extracts were
used. Input lanes, 5% of input extract; pull down lanes, purified enhanceosome complexes.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
The pDRAprox contains an HLA-DRA promoter fragment (from ⫺151 to
⫹10) inserted upstream of a firefly luciferase reporter gene in the pGL3Basic vector (Promega, Madison, WI) (31). The pDRAmin contains only
the HLA-DRA core promoter (from ⫺60 to ⫹10) in the same reporter
plasmid (31). Plasmids containing the 4, 5, 8, and Ii S⬘⬘-Y⬘⬘ sequences
were created by replacing the MluI-BglII fragment spanning the S-Y region
of pDRAprox with the corresponding 4, 5, 8, and S⬘⬘-Y⬘⬘ motifs amplified
by PCR from genomic DNA. Primers used to generate these constructs are
listed in Table II. Raji, RJ2.2.5, BLS1c, and BLS1 cells were cotransfected
(in a 10:1 ratio) with the firefly reporter plasmids containing the S-Y sequences and a control Renilla luciferase plasmid (pRL-TK). Transfections
were performed by electroporation (950 ␮F, 0.21– 0.25 V in 4-mm cuvettes). Dual luciferase reporter gene assays were performed according to
the manufacturer’s instructions (Promega).
6204
LONG DISTANCE CONTROL OF MHC-II EXPRESSION
Table II. Primers used to make luciferase reporter gene constructs
Name
Forward Primer 5⬘-3⬘
Reverse Primer 5⬘-3⬘
4
5
8
Ii S⬙-Y⬙
atgcacgcgtCTCAGTCTCACAGGCCTCTTC
atgcacgcgtTTTTCTGTAACAGACTTACTGGCTC
atgcacgcgtAGCTTCAGTTACACACATCCGTG
atgcacgcgtCAACCAGCAAGGATGGTTTAG
tggtagatctTAGCCAATCAGAAAAAGGCTC
tggaagatctCAGCCAATGAGAAGAAGTGAAG
tggaagatctCTCTCTATCCAATAAAAAGTGGGTG
tggtagatctGCAGCAAGCCAATGAGAATG
Novel target sites of RFX and CIITA in the MHC-II locus
We performed ChIP experiments to determine whether the new
S⬘-Y⬘ modules in the MHC-II locus represent true targets of RFX
and CIITA. Binding specificity was controlled by comparing wildtype B cells with mutant B cells lacking CIITA (RJ2.2.5 cells) or
the RFXANK subunit of RFX (BLS1 cells). As a reference we
used the promoter-proximal region of the HLA-DRA gene, which
is the most well-studied target of RFX and CIITA (36, 40). Four of
the S⬘-Y⬘ modules (2, 4, 6, and 8; scores 10.1, 10.1, 11.3, and 11.9,
respectively) are bound efficiently by RFX and CIITA in vivo in
wild-type cells (Fig. 2). Binding of RFX at these sites ranges from
50 –100% of that observed at the HLA-DRA promoter. Binding of
CIITA ranges from 20 –100%. This is highly significant because it,
in fact, exceeds that observed at the drb6 pseudogene. The specificity of RFX and CIITA association with the new S⬘-Y⬘ motifs is
emphasized by their lack of binding to randomly chosen sequences
situated outside the MHC locus (Fig. 2). Therefore, S⬘-Y⬘ sequences 2, 4, 6, and 8 can be unambiguously defined as new RFX
and CIITA target sites in vivo. The remaining candidates (1, 3, 5,
7, and 9; scores 9.9, 9.7, 14.1, 9.2, and 9.4, respectively) do not
show significant binding and can be classified as false positives
(Fig. 2). No obvious defects were pinpointed in candidate sequences that are not bound in vivo by RFX, CREB, or CIITA. The
failure of these sequences to be bound could be due either to an
accumulation of several minor deviations from the permissive con-
sensus sequence or to chromatin interference at the loci containing
these sites.
Binding of RFX and assembly of the MHC-II enhanceosome at
the HLA-DRA promoter in B cells are independent of CIITA (36).
Binding of RFX5 at the HLA-DRA promoter is thus normal in
CIITA-deficient cells (Fig. 2A). In contrast, mutations in RFXANK
abrogate formation of the RFX complex, which eliminates both
enhanceosome assembly and CIITA recruitment at the HLA-DRA
promoter (36). Occupation of the HLA-DRA promoter by both RFX5
and CIITA is thus lost in RFXANK-deficient cells (Fig. 2, A and B).
A very similar pattern is observed at the S⬘-Y⬘ sites (Fig. 2). It should
be noted, however, that two of the sites exhibit minor, but notable,
differences. First, at sequence 8, binding of RFX5 is partially dependent on CIITA, indicating that CIITA association has a stabilizing
effect on the enhanceosome complex. This is reminiscent of the
situation in IFN-␥-induced cells, where full MHC-II promoter occupancy requires CIITA (see below). Secondly, at sequence 2, significant levels of RFX5, CREB, and CIITA association are detected in the
BLS1 mutant, indicating that a partial enhanceosome complex can
form in the absence of RFXANK. A similar observation has been
made for certain other target sites, such as the promoter of the Ii gene
(see below) (36). To confirm that partial enhanceosomes can form in
the absence of RFXANK, we performed promoter pull-down assays
in vitro. DNA fragments containing HLA-DRA promoter region were
incubated with extracts obtained from BLS1 and BLS1c cells, and
DNA-bound complexes were eluted and analyzed by Western blotting. As shown in Fig. 2E, a partial complex containing RFX5 and
RFXAP can indeed assemble on the promoter in the absence of
RFXANK. It should also be noted that the formation of a dimeric
complex between RFX5 and RFXAP has recently been reported in
vivo (41).
CREB binds to the X2 box of the HLA-DRA gene (16). However, it has not been shown that CREB also associates with other
S-Y modules. We therefore performed ChIP experiments to examine whether the enhanceosome complexes formed at the S⬘-Y⬘
motifs contain CREB. At the HLA-DRA promoter, CREB binding
is, as expected, reduced 10-fold in the RFXANK mutant (Fig. 2C).
A strong reduction in CREB association is also observed at the
new target sites (Fig. 2C). At sequences 4, 6, and 8, this reduction
is of the same order of magnitude as at the HLA-DRA promoter. As
observed for RFX5, binding of CREB at sequence 2 is lost only
partially in the BLS1 cells, confirming that a partial enhanceosome
complex can form at this sequence in the absence of RFXANK. As
expected, sequences that are not occupied by RFX or CIITA (such
as sequence 3) are also not bound by CREB. Taken together, these
results confirm that binding of CREB to the X2 box of the S⬘-Y⬘
modules is strictly dependent on the cooperative binding interactions that mediate stable MHC-II enhanceosome assembly.
The new S⬘-Y⬘ motifs in the MHC-II locus function as enhancers
To evaluate whether the S⬘-Y⬘ motifs can function as transcription
control elements, we performed luciferase reporter gene assays. As
done previously for the distal S⬘-Y⬘ enhancers situated upstream of
the HLA-DRA and E␣ genes (31), we determined whether the new
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
low scoring sequences (scores 10 –13) spread throughout the genome at an average density of roughly one per million base pairs.
Subsequent ChIP experiments demonstrated that three randomly
chosen hits on chromosomes 3, 5, and 11 are not bound by RFX or
CIITA despite the fact that they were assigned scores of 13.0, 10.2,
and 11.2, respectively (Fig. 2, A and B). Moreover, a control scan
performed with a meaningless profile consisting of an inverted
MHC-II profile containing G/C and A/T transversions resulted in
a similar number of hits spread throughout the genome (Fig. 1C).
Therefore, the vast majority of these background hits probably
represent fortuitous similarities to the MHC-II profile (see
Discussion).
Interestingly, the density of hits within the MHC-II locus was
found to be ⬎10-fold higher than elsewhere in the genome, even
after eliminating the distal HLA-DRA enhancer and the promoter
regions of all known MHC-II genes and pseudogenes (Fig. 1D).
This is due to the presence of nine potential S-Y modules (Fig. 1B;
hits 1–9) found in two clusters situated in the DQ region and adjacent to the DP region. These sequences are henceforth referred to
as S⬘-Y⬘ modules.
The scan with the MHC-II profile failed to pick up any of the
S-Y motifs found in the promoters of MHC-I genes, which were
shown previously to be targets of RFX and CIITA (39). This was
expected, because the MHC-II and MHC-I promoter consensus
sequences differ at several critical positions within the conserved
S, X, X2, and Y boxes. A separate search based on the MHC-I
profile correctly identified all classical MHC-I genes, but did not
find any new candidate sequences (data not shown).
The Journal of Immunology
6205
S⬘-Y⬘ motifs could replace the S-Y module of the HLA-DRA promoter (Fig. 3). For this analysis we chose two representative sequences, sequence 4 from the DQ region and sequence 8 from the
DP region. As negative control we chose sequence 5, which is not
occupied significantly by RFX and CIITA. We found that sequences 4 and 8 can substitute very efficiently for the HLA-DRA
S-Y module in the wild-type B cell lines (Raji and BLS1c; Fig. 3).
Transactivation by the new S⬘-Y⬘ motifs is fully dependent on both
CIITA and RFX, because it is completely abolished in the mutant
cell lines lacking CIITA (RJ2.2.5) and RFXANK (BLS1). This
confirms that activation by the new S⬘-Y⬘ modules involves the
same transcriptional machinery controlling the classical S-Y elements of MHC-II genes.
Binding of RFX and CIITA to the S⬘-Y⬘ modules is induced by
IFN-␥
FIGURE 4. Occupation of the S⬘-Y⬘ enhancers by RFX and CIITA is
induced by IFN-␥. ChIP experiments with anti-RFX (A) and anti-CIITA
(B) Abs were performed with chromatin harvested from Me67.8 melanoma
cells that were either unstimulated or treated for 12 h with IFN-␥. Immunoprecipitates were analyzed for the presence of the HLA-DRA promoter
(DRAp) and S⬘-Y⬘ sequences 2, 4, 6, 8, and 3. The occupation of sequences
2, 4, 6, and 8 by RFX and CIITA is enhanced by IFN-␥.
Binding of RFX is also enhanced by IFN-␥, achieving levels
varying from ⬃10 to 50% of that observed at the HLA-DRA promoter (Fig. 4A). At sequences 2, 4, and 8, this induction (ratio of
induced to noninduced) is similar to (sequence 2) or even greater
than (sequences 4 and 8) that observed at the HLA-DRA promoter.
Sequence 6 differs from the others in that occupation by RFX is
not induced by IFN-␥, although a clear (albeit weak) increase in
occupation by CIITA is observed. At this point we have no explanation for this difference between sequence 6 and the others.
We also do not know why a high background level of RFX binding
is observed at the negative control sequence 3 in the cells used for
the IFN-␥ induction. This high background was not observed in B
cells (Fig. 2).
S⬘-Y⬘ modules induce global histone acetylation
FIGURE 3. The new S⬘-Y⬘ modules function as CIITA- and RFX-dependent enhancers. Luciferase reporter gene constructs containing the
HLA-DRA promoter proximal region (⫺150 to ⫹10) or hybrid promoters
in which the S-Y region from HLA-DRA was replaced with S⬘-Y⬘ sequences 4, 8 (binders), or 5 (a nonbinder) were transfected into Raji (wildtype), RJ2.2.5 (CIITA⫺/⫺), BLS1c (wild-type), and BLS1 (RFXANK⫺/⫺)
cells. A construct containing the basal HLA-DRA promoter lacking the S-Y
module (minimal) was used as a negative control. Activities are shown
relative to the HLA-DRA promoter-proximal region (DRAp) in wild-type
(Raji or BLS1c) cells. The averages and SDs of three transfection experiments are shown.
Assembly of the enhanceosome complex and the recruitment of
CIITA enhances histone acetylation at the promoter proximal S-Y
modules of MHC-II genes (36, 40). We therefore examined
whether the newly identified S⬘-Y⬘ modules also induce histone
hyperacetylation in an RFX- and CIITA-dependent manner. ChIP
experiments were first performed with Abs directed against panacetylated histone H3. At all four new S⬘-Y⬘ modules, H3 acetylation is significantly greater in wild-type cells than in RFXANKdeficient cells (Fig. 5A). This is mainly due to the recruitment of
CIITA, because a very similar reduction in H3 acetylation is observed in CIITA-deficient cells (see Fig. 5B).
Certain regulatory elements establish large, open chromatin domains characterized by the spreading of histone hyperacetylation
over long distances (43– 45). We recently demonstrated that binding of CIITA and RFX to the S⬘-Y⬘ motif in the LCR of the HLADRA gene induces global histone hyperacetylation extending up to
⬃25 kb upstream of the gene (Fig. 5B) (31). We therefore determined whether occupation of the newly identified S⬘-Y⬘ modules
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Expression of MHC-II genes can be induced in MHC-II-negative
cell lines by stimulation with IFN-␥. This is mediated by the activation of CIITA expression and its recruitment to the enhanceosome assembled on MHC-II promoters (23, 40, 42). We therefore
investigated whether occupation of the new S⬘-Y⬘ modules by the
enhanceosome and CIITA is also induced by IFN-␥ (Fig. 4).
Association of CIITA is increased significantly at all new S⬘-Y⬘
modules, whereas no increase is observed at the control 3 sequence
(Fig. 4B). As observed in B cells (Fig. 2B), the level of occupation
by CIITA varies between the motifs ranging from ⬃10 to 100% of
that observed at the control HLA-DRA promoter.
6206
LONG DISTANCE CONTROL OF MHC-II EXPRESSION
by RFX and CIITA is also accompanied by the spreading of hyperacetylation to adjacent regions. For this analysis we chose two
S⬘-Y⬘ modules: site 4 located upstream of the HLA-DQB gene, and
the isolated enhancer 8 situated ⬎30 kb away from the DP region.
We examined H3 and H4 acetylation in wild-type and mutant cell
lines lacking RFXANK or CIITA (Fig. 5B). As observed in the
HLA-DRA upstream region, RFX- and CIITA-dependent histone
hyperacetylation at the HLA-DQB locus is not restricted to the
proximal S-Y and distal S⬘-Y⬘ modules, but is evident over the
entire ⬃5-kb upstream domain examined. At sequence 8, the hyperacetylation extends in both directions, spanning a region of at
least 5 kb. These results demonstrate that RFX and CIITA induce
broad patterns of histone hyperacetylation not only in the vicinity
of the upstream S⬘-Y⬘ modules in the HLA-DRA and HLA-DQB
genes, but also at the isolated motif 8. The latter is an important
observation because it demonstrates that a single S⬘-Y⬘ motif not
closely associated with a promoter proximal S-Y module can induce hyperacetylation over a broad domain. The establishment of
large open chromatin domains thus appears to be a general mechanism by which RFX and CIITA regulate genes in the MHC-II
locus.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 5. The S⬘-Y⬘ modules induce global histone hyperacetylation.
A, Abs against pan-acetylated H3 were
used to immunoprecipitate chromatin
fragments from Raji (wt) and BLS-1
(RFXANK⫺/⫺) cells. Immunoprecipitates were analyzed for the presence of
the new S⬘-Y⬘ modules. Sequence 5, to
which RFX and CIITA do not bind,
was used as a negative control. B, RFX
and CIITA establish broad hyperacetylated chromatin domains. Abs directed
against acetylated H3 (six top panels)
or H4 (six bottom panels) were used to
immunoprecipitate chromatin from two
pairs of B cell lines: Raji (wt) and
RJ2.2.5 (CIITA⫺/⫺), BLS1c (wt, BLS1
cells complemented with RFXANK),
and BLS1 (RFXANK⫺/⫺). Immunoprecipitates were analyzed for the presence of upstream sequences from the
HLA-DRA (left panels) and HLA-DQB
(middle panels) genes and from the region containing sequence 8 (right panels). At HLA-DRA and enhancer 8, the
values were corrected for variations in
nucleosome density. Maps indicating
the positions of the S-Y and S⬘-Y⬘ motifs are shown below.
Novel target sites of RFX and CIITA in the invariant chain gene
The promoter-proximal region of the Ii gene contains a typical S-Y
module that is bound in vivo by RFX and CIITA (36). Our search
with the MHC-II profile consequently picked up the Ii gene (Fig.
1B). Interestingly, we also identified two S-Y motifs, referred to
here as S⬘-Y⬘ and S⬘⬘-Y⬘⬘, in the first intron of the Ii gene (Fig. 6).
Both motifs are conserved at equivalent positions in the mouse and
rat Ii genes (Fig. 1E).
Although the S⬘⬘-Y⬘⬘ motif has not been described previously,
the S⬘-Y⬘ motif lies within a region exhibiting enhancer activity
(32). This raised the possibility that the Ii gene might contain two
intronic enhancers controlled by CIITA and the MHC-II enhanceosome complex. We therefore performed ChIP experiments to
determine whether the S⬘-Y⬘ and S⬘⬘-Y⬘⬘ motifs are indeed occupied in vivo by RFX, CREB, and CIITA (Fig. 6). As positive
controls we examined occupation of the S-Y motifs of the HLADRA and Ii promoters. The results demonstrate that all three S-Y
modules of the Ii gene are indeed bound, albeit with variable efficiencies, by RFX and CIITA. RFX is detected most efficiently at
the intronic S⬘-Y⬘ motif (Fig. 6A), whereas CIITA association is
The Journal of Immunology
6207
A deficiency in CIITA does not abolish enhanceosome assembly
at the S⬘-Y⬘ and S⬘⬘-Y⬘⬘ motifs, as revealed by normal binding of
RFX and CREB in cells lacking CIITA (Figs. 6, A and B). In
contrast, binding of RFX5, CREB, and CIITA is strongly reduced
in cells lacking RFXANK (Fig. 6, A–C). The S⬘-Y⬘ and S⬘⬘-Y⬘⬘
sequences are thus typical target sites for assembly of the MHC-II
enhanceosome complex and recruitment of CIITA. However, as
observed for the Ii promoter (36), a partial enhanceosome complex
can form at the intronic sites in cells lacking RFXANK (Fig. 6, A
and B). This is particularly evident at the S⬘-Y⬘ sequence, where
residual binding of RFX5 and CREB is clearly detected in the
RFXANK-deficient cells.
To assess the functional importance of the new intronic S⬘⬘-Y⬘⬘
motif, we performed a luciferase reporter gene assay. The S⬘⬘-Y⬘⬘
module drives expression of the reporter gene with an efficiency
attaining 50 – 80% that of the S-Y module of the HLA-DRA
promoter (Fig. 7). This enhancer activity is strictly dependent on
CIITA and RFX, because the construct is not active in the mutant
cells lacking CIITA or RFXANK.
This aim of this study was to identify new regulatory regions controlled by the MHC-II-specific regulatory factors RFX and CIITA.
To achieve this, we used a computational method permitting the
direct identification of regions to which RFX and CIITA are likely
to bind in vivo. We designed a search profile based on the alignment of all known S-Y modules found in MHC-II and related
genes. The strength of this profile is that it combines the consensus
sequence for 36 nucleotides spanning the four individual subelements with positional information reflecting their precise arrangement with respect to order, orientation, and spacing. The unique
FIGURE 6. RFX, CIITA, and CREB occupy three S-Y modules in the
Ii gene. Chromatin immunoprecipitates obtained with anti-RFX5 (A), antiCREB (B), and anti-CIITA (C) Abs were analyzed for various Ii gene
sequences: the promoter S-Y module, the intronic S⬘-Y⬘, and Y⬘⬘-S⬘⬘ motifs, and a sequence situated between these two motifs. The map indicates
the positions and orientations of the three S-Y motifs and the first two
exons. D, Positions of the primers (arrows) used for real-time PCR amplification of the new Ii S⬘-Y⬘ and Ii Y⬘⬘-S⬘⬘ motifs. The S, X/X2, and Y
boxes are indicated.
most evident at the promoter S-Y motif (Fig. 6C). CREB is also
associated with both intronic motifs (Fig. 6B). Because the two
intronic modules are positioned relatively close to one another (0.8
kb), we made sure that the signals observed at the Y⬘⬘-S⬘⬘ sequence
are not due to a spillover resulting from incompletely fragmented
chromatin. This is not the case, because weaker RFX5 signals are
observed at a sequence located in between the two intronic elements (Fig. 6A).
FIGURE 7. The intronic S⬘⬘-Y⬘⬘ module of the Ii gene functions as a
CIITA- and RFX-dependent enhancer. The intronic S⬘⬘-Y⬘⬘ motif of the Ii
gene was tested for its ability to function as a CIITA- and RFX-dependent
enhancer as described in Fig. 3.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Discussion
6208
FIGURE 8. Correlation between the score
and binding of RFX and CIITA. The S⬘-Y⬘
sequences (no. 1–9; DRA distal enhancer, Ii
S⬘-Y⬘, and Ii Y⬘⬘-S⬘⬘) were plotted with respect to their score (x-axis) and binding
(y-axis) of RFX (top) or CIITA (bottom).
Binding values are expressed relative to the
HLA-DRA promoter. Results obtained with
the original (left) and improved (right) profiles
are shown. Linear regression curves are
shown, and r2 values are given for each curve.
Our scan identified four new S⬘-Y⬘ motifs in the MHC-II locus
that are bound in vivo by the MHC-II enhanceosome and CIITA in
both B cells and IFN-␥-induced cells. These S⬘-Y⬘ motifs function
as CIITA- and RFX-dependent enhancers and induce RFX- and
CIITA-dependent histone hyperacetylation in vivo. Together with
the S⬘-Y⬘ motif present upstream of the HLA-DRA gene, the human MHC-II locus thus contains at least five distal regulatory
modules that are controlled by the same transcription machinery
that is recruited to the proximal S-Y modules of MHC-II promoters. Interestingly, we also identified two S-Y-like motifs (S⬘-Y⬘
and S⬘⬘-Y⬘⬘) in the first intron of the Ii gene, which is, for the
moment, the only direct target gene of RFX and CIITA that is
situated outside the MHC. Both intronic motifs are occupied by
RFX, CREB, and CIITA in vivo and function as enhancers in B
cells (Fig. 7) (32). Taken together, these results suggest that RFX
and CIITA control their target genes via a combination of multiple
homologous enhancer modules situated both near (S-Y) and far
from (S⬘-Y⬘) the promoters.
The S⬘-Y⬘ motif of the H-2Ea gene lies at one end of a large
region that has been shown to exhibit functions characteristic of a
LCR in transgenic mouse experiments. These functions include
cell type-specific, copy number-dependent, and position-independent transgene expression (29, 30). Moreover, binding of RFX and
CIITA to the S⬘-Y⬘ motif of the HLA-DRA gene establishes a
broad hyperacetylated chromatin domain, promotes the recruitment of RNA polymerase II, and induces the synthesis of extragenic transcripts (31). These features are strongly reminiscent of
the LCR of the ␤-globin locus, where long-range chromatin remodeling associated with the synthesis of intergenic transcripts has
also been documented (51, 52). Taken together, these features suggest that the distal S⬘-Y⬘ motifs are likely to influence MHC-II
gene expression by a mode of action akin to that of LCRs. This
hypothesis is sustained by our analysis of the new S⬘-Y⬘ motifs,
which, like the HLA-DRA S⬘-Y⬘ motif, induce RFX- and CIITAdependent histone hyperacetylation over a broad domain that
spreads upstream and downstream for several kilobases. It is therefore tempting to speculate that the S⬘-Y⬘ motifs found in the
MHC-II locus control the expression of MHC-II genes from a
distance. Individual S⬘-Y⬘ motifs could in this way regulate a specific gene or a defined subset of genes. This would be consistent
with the strategic positions occupied by the S⬘-Y⬘ sequences: one
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
nature of the MHC-II regulatory module thus permits the integration of a large amount of information despite the fact that the
individual subelements are relatively variable in sequence. To our
knowledge, the use of such a large amount of sequence information has not yet led to the description of new, in vivo-verified
targets despite the recent development of computational tools capable of identifying clusters of transcription factor binding sites in
genome-wide scans (46 – 49). The success of our approach validates the idea that true targets of higher order transcriptional complexes can be identified by searching for composite regulatory
modules. This is likely to prove particularly powerful for systems
in which well-defined multiprotein enhanceosomes have been described (50).
Our search with the MHC-II profile proved to be quite stringent.
The scan of the entire genome produced only a very low background (approximately one hit per million base pairs). Four lines
of evidence suggest that most of these hits represent nonrelevant
sequences. First, the majority are assigned relatively modest
scores. Second, a similar background was obtained with a meaningless profile consisting of an inverted MHC-II profile containing
G/C and A/T transversions at all positions (Fig. 1C). Third, several
randomly chosen hits turned out to be false positives, as assessed
by ChIP experiments (Fig. 2). Fourth, restricting the search to the
upstream regions of known and predicted genes drastically reduces
the number of hits (data not shown).
On the basis of the results obtained with the initial scan, we
created a more discriminative profile that generates an improved
correlation between the score and the binding data (Fig. 8). This
emphasizes another strong aspect of our approach: as the knowledge of valid RFX and CIITA binding sites grows, we can reiterate
searches with progressively improved profiles, thereby increasing
the chances of identifying novel sites. If a sufficiently large set of
binding sites can be identified, it may eventually become possible
to incorporate parameters that have currently not been defined.
Examples include preferential combinations of or incompatibilities
between certain S, X, X2, and Y sequences; particular spacing
requirements imposed by certain S, X, X2, or Y sequences; and
influences of the sequences situated between the S and X or X2
and Y boxes. Taking such parameters into account would facilitate
the identification of true target sites and reduce the frequency of
false positive hits.
LONG DISTANCE CONTROL OF MHC-II EXPRESSION
The Journal of Immunology
Acknowledgments
We are grateful to M. Tompa for help in the initial stages of the project, and
we thank M. Strubin and E. Dermitzakis for helpful discussions.
References
1. Cresswell, P. 1994. Assembly, transport, and function of MHC class II molecules.
Annu. Rev. Immunol. 12:259.
2. Viret, C., and C. A. J. Janeway. 1999. MHC and T cell development. Rev. Immunogenet. 1:91.
3. Alfonso, C., and L. Karlsson. 2000. Nonclassical MHC class II molecules. Annu.
Rev. Immunol. 18:113.
4. Beck, S., and J. Trowsdale. 1999. Sequence organisation of the class II region of
the human MHC. Immunol. Rev. 167:201.
5. Kumnovics, A., T. Takada, and K. F. Lindahl. 2003. Genomic organization of the
mammalian MHC. Annu. Rev. Immunol. 21:629.
6. Boss, J. M. 1997. Regulation of transcription of MHC class II genes. Curr. Opin.
Immunol. 9:107.
7. Reith, W., and B. Mach. 2001. The bare lymphocyte syndrome and the regulation
of mhc expression. Annu. Rev. Immunol. 19:331.
8. Benoist, C., and D. Mathis. 1990. Regulation of major histocompatibility complex class II genes: X, Y and other letters of the alphabet. Annu. Rev. Immunol.
8:681.
9. Vilen, B. J., J. P. Cogswell, and J. P. Ting. 1991. Stereospecific alignment of the
X and Y elements is required for major histocompatibility complex class II DRA
promoter function. Mol. Cell. Biol. 11:2406.
10. Vilen, B. J., J. F. Penta, and J. P. Ting. 1992. Structural constraints within a
trimeric transcriptional regulatory region: constitutive and interferon-␥-inducible
expression of the HLA-DRA gene. J. Biol. Chem. 267:23728.
11. Steimle, V., B. Durand, E. Barras, M. Zufferey, M. R. Hadam, B. Mach, and
W. Reith. 1995. A novel DNA binding regulatory factor is mutated in primary
MHC class II deficiency (bare lymphocyte syndrome). Genes Dev. 9:1021.
12. Durand, B., P. Sperisen, P. Emery, E. Barras, M. Zufferey, B. Mach, and
W. Reith. 1997. RFXAP, a novel subunit of the RFX DNA binding complex is
mutated in MHC class II deficiency. EMBO J. 16:1045.
13. Masternak, K., E. Barras, M. Zufferey, B. Conrad, G. Corthals, R. Aebersold,
J. C. Sanchez, D. F. Hochstrasser, B. Mach, and W. Reith. 1998. A gene encoding
a novel RFX-associated transactivator is mutated in the majority of MHC class II
deficiency patients. Nat. Genet. 20:273.
14. Nagarajan, U. M., P. Louis-Plence, A. DeSandro, R. Nilsen, A. Bushey, and
J. M. Boss. 1999. RFX-B is the gene responsible for the most common cause of
the bare lymphocyte syndrome, an MHC class II immunodeficiency. Immunity
10:153.
15. Nekrep, N., N. Jabrane-Ferrat, H. M. Wolf, M. M. Eibl, M. Geyer, and
B. M. Peterlin. 2002. Mutation in a winged-helix DNA-binding motif causes
atypical bare lymphocyte syndrome. Nat. Immunol. 3:1075.
16. Moreno, C. S., G. W. Beresford, P. Louis-Plence, A. C. Morris, and J. M. Boss.
1999. CREB regulates MHC class II expression in a CIITA-dependent manner.
Immunity 10:143.
17. Mantovani, R. 1999. The molecular biology of the CCAAT-binding factor NF-Y.
Gene 239:15.
18. Masternak, K., A. Muhlethaler-Mottet, J. Villard, M. Zufferey, V. Steimle, and
W. Reith. 2000. CIITA is a transcriptional coactivator that is recruited to MHC
class II promoters by multiple synergistic interactions with an enhanceosome
complex. Genes Dev. 14:1156.
19. Reith, W., M. Kobr, P. Emery, B. Durand, C. A. Siegrist, and B. Mach. 1994.
Cooperative binding between factors RFX and X2bp to the X and X2 boxes of
MHC class II promoters. J. Biol. Chem. 269:20020.
20. Reith, W., C. A. Siegrist, B. Durand, E. Barras, and B. Mach. 1994. Function of
major histocompatibility complex class II promoters requires cooperative binding
between factors RFX and NF-Y. Proc. Natl. Acad. Sci. USA 91:554.
21. Louis-Plence, P., C. S. Moreno, and J. M. Boss. 1997. Formation of a regulatory
factor X/X2 box-binding protein/nuclear factor-Y multiprotein complex on the
conserved regulatory regions of HLA class II genes. J. Immunol. 159:3899.
22. Zhu, X. S., M. W. Linhoff, G. Li, K. C. Chin, S. N. Maity, and J. P. Ting. 2000.
Transcriptional scaffold: CIITA interacts with NF-Y, RFX, and CREB to cause
stereospecific regulation of the class II major histocompatibility complex promoter. Mol. Cell Biol. 20:6051.
23. Spilianakis, C., A. Kretsovali, T. Agalioti, T. Makatounakis, D. Thanos, and
J. Papamatheakis. 2003. CIITA regulates transcription onset via Ser5-phosphorylation of RNA Pol II. EMBO J. 22:5125.
24. Jabrane-Ferrat, N., N. Nekrep, G. Tosi, L. Esserman, and B. M. Peterlin. 2003.
MHC class II enhanceosome: how is the class II transactivator recruited to DNAbound activators? Int. Immunol. 15:467.
25. Boss, J. M., and P. E. Jensen. 2003. Transcriptional regulation of the MHC class
II antigen presentation pathway. Curr. Opin. Immunol. 15:105.
26. Ting, J. P., and J. Trowsdale. 2002. Genetic control of MHC class II expression.
Cell 109(Suppl.):S21.
27. Steimle, V., L. A. Otten, M. Zufferey, and B. Mach. 1993. Complementation
cloning of an MHC class II transactivator mutated in hereditary MHC class II
deficiency. Cell 75:135.
28. DeSandro, A., U. M. Nagarajan, and J. M. Boss. 1999. The bare lymphocyte
syndrome: molecular clues to the transcriptional regulation of major histocompatibility complex class II genes. Am. J. Hum. Genet. 65:279.
29. Carson, S., and M. V. Wiles. 1993. Far upstream regions of class II MHC Ea are
necessary for position-independent, copy-dependent expression of Ea transgene.
Nucleic Acids Res. 21:2065.
30. Dorn, A., H. J. Fehling, W. Koch, M. Lemeur, P. Gerlinger, C. Benoist, and
D. Mathis. 1988. B cell control region at the 5⬘ end of a major histocompatibility
complex class II gene: sequences and factors. Mol. Cell. Biol. 8:3975.
31. Masternak, K., N. Peyraud, M. Krawczyk, E. Barras, and W. Reith. 2003. Chromatin remodeling and extragenic transcription at the MHC class II locus control
region. Nat. Immunol. 4:132.
32. Moore, B. B., Z. A. Cao, T. L. McRae, C. H. Woo, S. Conley, and P. P. Jones.
1998. The invariant chain gene intronic enhancer shows homology to class II
promoter elements. J. Immunol. 161:1844.
33. Bucher, P., K. Karplus, N. Moeri, and K. Hofmann. 1996. A flexible motif search
technique based on generalized profiles. Comput. Chem. 20:3.
34. Accolla, R. S. 1983. Human B cell variants immunoselected against a single Ia
antigen subset have lost expression in several Ia antigen subsets. J. Exp. Med.
157:1053.
35. Hume, C. R., L. A. Shookster, N. Collins, R. O’Reilly, and J. S. Lee. 1989. Bare
lymphocyte syndrome: altered HLA class II expression in B cell lines derived
from two patients. Hum. Immunol. 25:1.
36. Masternak, K., and W. Reith. 2002. Promoter-specific functions of CIITA and the
MHC class II enhancesosome in transcriptional activation. EMBO J. 21:1379.
37. Muhlethaler-Mottet, A., L. A. Otten, V. Steimle, and B. Mach. 1997. Expression
of MHC class II molecules in different cellular and functional compartments is
controlled by differential usage of multiple promoters of the transactivator CIITA.
EMBO J. 16:2851.
38. Bontron, S., C. Ucla, B. Mach, and V. Steimle. 1997. Efficient repression of
endogenous major histocompatibility complex class II expression through dominant negative CIITA mutants isolated by a functional selection strategy. Mol.
Cell. Biol. 17:4249.
39. van den Elsen, P. J., T. M. Holling, H. F. Kuipers, and N. van der Stoep. 2004.
Transcriptional regulation of antigen presentation. Curr. Opin. Immunol. 16:67.
40. Beresford, G. W., and J. M. Boss. 2001. CIITA coordinates multiple histone
acetylation modifications at the HLA-DRA promoter. Nat. Immunol. 2:652.
41. Nagarajan, U. M., A. B. Long, M. T. Harreman, A. H. Corbett, and J. M. Boss.
2004. A hierarchy of nuclear localization signals governs the import of the regulatory factor X complex subunits and MHC class II expression. J. Immunol.
173:410.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
is found upstream of the HLA-DRA gene, three (sequences 2, 4,
and 6) flank the central DQ region, and one (sequence 8) is present
at the other end of the locus, near the DP region.
An alternative possibility is that the S⬘-Y⬘ motifs exert a global
influence over the whole MHC-II locus, for instance by generating
a large (⬃700 kb) open chromatin domain spanning all the coregulated MHC-II genes. Such broad domains have been documented in several systems, where they correlate with transcriptional competence and gene activation (43– 45). The latter is an
attractive model, because MHC-II genes have been maintained
clustered together (5). Numerous rearrangements and duplications
have occurred within the MHC-II locus to a much greater extent
than in the flanking regions, yet in all species analyzed to date,
except bony fishes, all MHC-II genes are present in the same region (5). This arrangement may have been maintained because
there has been a selective pressure against rearrangements that
translocate MHC-II genes outside of a globally regulated domain.
In this context it should be noted that the MHC is indeed subjected
to global regulatory events; the entire MHC locus undergoes
changes in subnuclear localization in response to IFN-␥
induction (53).
The DR-DQ region of the human MHC-II locus contains a particularly high density of S⬘-Y⬘ motifs (Fig. 1). Moreover, as a
consequence of the relative positions and orientations of the HLADRA (⌯-2⌭␣) and HLA-DQB (H-2A␤) genes, the DR-DQ (H-2EH-2A) region is bracketed by two highly conserved S⬘-Y⬘ enhancers (Fig. 1). This arrangement is particularly intriguing, because all
vertebrate species have retained genes encoding the DR and DQ
isotypes, whereas many have lost functional genes in the DP region (5). It is also striking that the DR-DQ region is separated from
the DP region by a large domain containing the HLA-DO and
HLA-DM genes, which are less tightly coregulated with the classical MHC-II genes, and genes that are not required for MHC-IIrestricted Ag presentation. This prompts us to speculate that the
S⬘-Y⬘ enhancers in the DR-DQ region may define a more tightly
coregulated subdomain within the MHC-II locus.
6209
6210
42. Steimle, V., C.-A. Siegrist, A. Mottet, B. Lisowska-Grospierre, and B. Mach.
1994. Regulation of MHC class II expression by interferon-␥ mediated by the
transactivator gene CIITA. Science 265:106.
43. Elefant, F., N. E. Cooke, and S. A. Liebhaber. 2000. Targeted recruitment of
histone acetyltransferase activity to a locus control region. J. Biol. Chem.
275:13827.
44. Litt, M. D., M. Simpson, F. Recillas-Targa, M. N. Prioleau, and G. Felsenfeld.
2001. Transitions in histone acetylation reveal boundaries of three separately
regulated neighboring loci. EMBO J. 20:2224.
45. Chowdhury, D., and R. Sen. 2001. Stepwise activation of the immunoglobulin ␮
heavy chain gene locus. EMBO J. 20:6394.
46. Krivan, W., and W. W. Wasserman. 2001. A predictive model for regulatory
sequences directing liver-specific transcription. Genome Res. 11:1559.
47. Werner, T., S. Fessele, H. Maier, and P. J. Nelson. 2003. Computer modeling of
promoter organization as a tool to study transcriptional coregulation. FASEB J.
17:1228.
LONG DISTANCE CONTROL OF MHC-II EXPRESSION
48. Aerts, S., G. Thijs, B. Coessens, M. Staes, Y. Moreau, and B. De Moor. 2003.
Toucan: deciphering the cis-regulatory logic of coregulated genes. Nucleic Acids
Res. 31:1753.
49. GuhaThakurta, D., and G. D. Stormo. 2001. Identifying target sites for cooperatively binding factors. Bioinformatics 17:608.
50. Merika, M., and D. Thanos. 2001. Enhanceosomes. Curr. Opin. Genet. Dev.
11:205.
51. Plant, K. E., S. J. Routledge, and N. J. Proudfoot. 2001. Intergenic transcription
in the human ␤-globin gene cluster. Mol. Cell. Biol. 21:6507.
52. Gribnau, J., K. Diderich, S. Pruzina, R. Calzolari, and P. Fraser. 2000. Intergenic
transcription and developmental remodeling of chromatin subdomains in the human ␤-globin locus. Mol. Cell 5:377.
53. Volpi, E. V., E. Chevret, T. Jones, R. Vatcheva, J. Williamson, S. Beck,
R. D. Campbell, M. Goldsworthy, S. H. Powis, J. Ragoussis, et al. 2000. Largescale chromatin organization of the major histocompatibility complex and other
regions of human chromosome 6 and its response to interferon in interphase
nuclei. J. Cell Sci. 113:1565.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017