Venue Application University of Science and Technology of Hanoi 18 Hoàng Quốc Việt, Hanoi, Vietnam Application is online and requires a registration form, a motivation letter, a one-page CV and one reference letter. Applicants must rank the thematic group they wish to follow, in order of preference www.usth.edu.vn Online application: www.cbid.asia Accommodation Closing date: 30 June 2016, 23:59pm ICT Somerset Hoa Binh Hanoi 106 Hoàng Quốc Việt, Hanoi, Vietnam Results of selection: 14 July 2016 Contact: [email protected] CAGCCTATAGTGGGTAAACCGTGCTAGTTT TGCCGTCCTTAGTGCCCATGAATGTGGAGC GGAGGAACGAGAAGTCATAACACGTGCTTC CCTCGCAGTTCCTCCTATCACGATACCGAT TCGAAACGGGCCATGCGGCCGGGTCCTCAT TCTGACTCAAATAGCCTTGCTGGATACTTC CTCGGGGCCTGTACCACACGGCCGATAGAG CGAGCTGACAATGGGCGGTCTCCGTTGACG AGTAAGATCAACCCGCCCACTACCCTGCAG TGTACTCTCATAGGTGGATTGAATTCCTCA TAGTGTAGTTGGGCTACTCAGTATTCAAAC GGCTGTTCCCAGGGGCTTAGGCGGCGCCCA CCGTACCATACCGTCACCGACGCTAATCAT TTGCGTTAGTTCGCAGAAATGCCAGCTGGC AGAAATCCGAGTTCACAGAGACTACTAGTT GTGAACCTGCAACATTGCGTCAGTGGAATT TGTAACCGACGGGCCGGAGTGCAACATCTT TCCAAAGGTCCTGTTCCTACGGCTCGGTAA ACTATAAAACCCTGTTATCCGACCATGGGC ATTGGTATTCATGATGGAAGTCTG1TAAC0 GACGCAGA0AGACAC1TTGACACAAAGCTA ACGGAA0TTACACCATAAGTA10ACCAAAA ACAAT1AAGCGAGGATA0TCGACTT0CGTC TGTCAG1CGTAGCTACATA1CAC1GC0AGA 0G000G0GAC0TT11ATAG1TT0T0CCAAT 0TC0CG1T1G0GTGGTAG0CGAGT1G0GG0 C0A10AT1000ACAACGGT0TG0TA1G11G AGTA01AT1GT0C11AAAG0C110G10TC0 AAA0GCCG00ATC0CGACG0G0T01ACA11 A0101CGG11G10C10T1C00C1010TTGA A1G01C000T0TT0GATGT0T1C010G001 G001AAG0TAT1GTC0A10C0T0111001T G0011G00100110G01TT11TC10111C1 0111110GAG11A11101111001000010 0111111A11101C110T11101110010A 0010A0G000T1110C001111000G1110 01T10011C111110010100101011000 101000100110001110101101001010 Computational Biology for Infectious Diseases Summer School 18-25 September 2016 Hanoi, Vietnam Ambassade de France au Vietnam Summer School in Computational Biology for Infectious Diseases 18-25 September 2016 Hanoi, Vietnam About: The CBID summer school is designed to provide students, researchers and professionals with basic concepts and hands-on experience in quantitative analyses of high throughput data. The school is organized in 5 parallel thematic groups for 6 days, preceded by 1 day of plenaries and followed by 1 day of review and practice sessions. The trainings will be given by leading experts in their fields, with strong teaching experience for beginners. For: students and health professionals from Asian countries Level: beginner/ intermediate Fee: free, accommodation is covered by the school. Travel grants available upon application Language: English, good level required Five parallel thematic groups: Softwares: Teaching faculty: Molecular phylogeny (Meta)genomics Population genetics Transmission dynamics Disease forecasting Sequences alignments, models of molecular evolution, phylogeny reconstruction by maximum-likelihood and Bayesian methods of estimation Next-generation sequencing, whole community analysis, exploratory data analysis, multiple testing, clustering, classification, longitudinal analyses Genetic markers, HardyWeinberg equilibrium, F statistics, linkage disequilibrium, population structure, Wahlund effect, Mantel test, statistical tests Time series analysis, compartmental models, R0 estimation, control policies, agent-based models, parameters estimation, data visualization Bias/variance trade-off, cross-validation, ROC/ AUC, tree regressions, ensemble methods, ARIMA models, MSE/MAE SeaView, BLAST, PhyML, Muscle, MrBayes, BEAST R/RStudio, Bioconductor Fstat, Genepop, Genetix, Easypop, MEGA, Excel Epipoi, R/RStudio, GAMA R/RStudio, caret package Olivier Gascuel, Institut Pasteur, Paris, France Jean-Daniel Zucker, IRD, Paris, France Thierry de Meeûs, IRD, Montpellier, France Cécile Viboud, NIH/ Fogarty, Bethesda, USA Michael Johansson, USCDC, Puerto-Rico, USA Guy Baele, University of Leuven, Belgium Edi Prifti, ICAN, PitiéSalpêtrière, Paris, France Franck Prugnolle, CNRS, Montpellier, France Nicolas Marilleau, IRD, Paris, France Matthew Graham, John Hopkins, Baltimore, USA Veronika Bošková, ETH Zurich, Switzerland Hồ Bích Hải, VAST/IOIT, Hanoi, Vietnam Virginie Rougeron, CNRS, Montpellier, France Wladimir Alonso, NIH/ Fogarty, Bethesda, USA Lê Viết Thanh, OUCRU, Hanoi, Vietnam Maria Anisimova, Zurich University, Switzerland Eugeni Belda, Institut Pasteur, Paris, France Anne-Laure Bañuls, IRD, Montpellier, France Alex Becker, Princeton university, USA Hannah Clapham, OUCRU, HCM, Vietnam Joseph N. Paulson, Harvard SPH, USA Alexis Drogoul, IRD, Hanoi, Vietnam
© Copyright 2026 Paperzz