* Manuscript
Non-equivalence of embryonic and somatic cell nuclei
affecting spindle composition in clones
Faical Miyara1, Zhiming Han1, Shaorong Gao1,3,, Rita Vassena1, and Keith E. Latham1,2,4
1
The Fels Institute for Cancer Research and Molecular Biology and
Department of Biochemistry
Temple University School of Medicine
2
3
Present address: National Institute of Biological Sciences
#7 Science Park Road, Zhongguancun Life Science Park, Beijing, 102206, P.R.
China
4
Correspondence:
3307 North Broad Street
Philadelphia, PA 19140
Tel. 215-707-7577
Fax. 215-707-1454
email:[email protected]
Manuscript Information:
No. Figures in MS: 6
No. Tables: 1
No. Abstract Words: 153
No. Words: 5730, excluding references and figure legends
Abbreviations: SCC, Spindle Chromosome Complex; pmSCC, pseudo-meiotic spindle
chromosome complex; SCNT, somatic cell nuclear transfer; ECNT, embryonic cell
nuclear transfer.
Key Words: Cloning, Nuclear Transfer, Meiosis, Mitosis, Spindle, Calmodulin
1
ABSTRACT
Cloning by nuclear transfer remains inefficient, but is more efficient when nuclei from
embryonic cells or embryonic stem cells (ECNT) are employed as compared with
somatic cells (SCNT). The factors determining efficiency have not been elucidated. We
find that somatic and embryonic nuclei differ in their ability to organize meiotic and
mitotic spindles of normal molecular composition. Calmodulin, a component of meiotic
and mitotic spindle chromosome complexes (SCCs), displays sharply reduced association
with the SCC forming after SCNT, but not ECNT. This defect persists in mitotic
spindles at least through the second mitosis, despite abundant calmodulin expression in
the cell, and correlates with slow chromosome congression. We propose that somatic cell
nuclei lack factors needed to direct normal SCC formation in oocytes and early embryos.
These results reveal a striking control of SCC formation by the transplanted nucleus and
provide the first identified molecular correlate of donor stage-dependent restriction in
nuclear potency.
2
INTRODUCTION
The ability to produce genetically identical offspring by nuclear transfer has
existed for about five decades. The advent of techniques for successful cloning using
somatic cell nuclei from fetal or adult stages (SCNT) has given rise to the potential for
many benefits in basic and applied research, as well as new clinical approaches. The
combined data from both amphibian and mammalian nuclear transfer studies have
yielded three general observations. First, cloning using somatic cell nuclei from fetal or
adult stages is generally inefficient, typically in the range of 1-5% (Rhind et al., 2003).
Second, reprogramming appears to be slow and incomplete, so that donor cell nuclei
direct the expression of genes that are not normally expressed in the embryo, thereby
giving cloned embryos characteristics different from those of normal embryos (Chung et
al., 2002,2003; Gao et al., 2003a; Latham, 2004; Ng and Gurdon, 2005). Third, the
efficiency of cloning declines with the advancement of developmental stage from which
the donor nucleus is obtained (Tsunoda et al., 1987; First and Prather, 1991; DiBerardino,
1997; Rideout et al., 2000; Humpherys et al., 2002; Gao et al., 2003b; Latham, 2004,).
Among amphibians, embryonic nuclei progressively lose developmental potential after
the blastula stage (King and Briggs, 1955). In mammals, it has been possible to produce
multiple cloned offspring from the cells of a single preimplantation stage embryo using
2-cell blastomeres as recipients (Kono et al., 1991), whereas this procedure does not
produce offspring when somatic cell nuclei are employed. Moreover, a 10-20 fold
greater rate of development from blastocyst to term is seen for ECNT embryos prepared
with embryonic stem (ES) cell nuclei as compared with SCNT embryos (Rideout et al.,
2000; Eggan et al., 2001; Humpherys et al., 2002; Gao et al., 2003b).
3
These observations are most often attributed to effects of chromatin structure, and
how that chromatin structure changes during development of donor cell lineages. The
establishment of stable, transcriptionally active or inactive chromatin configurations
could inhibit reprogramming. Such chromatin structures may become increasingly
prevalent with developmental stage and during cellular differentiation. One example of
this is seen with X chromosome regulation, which is indeed defective in mouse SCNT
embryos, particularly for genes near Xist, suggesting that the stable heterochromatic state
of the inactive X chromosome is difficult to disrupt (Nolen et al., 2005).
Parameters other than chromatin structure and gene reprogramming may also
influence cloning outcome. In mammals, most cloning studies are performed using
mature metaphase II stage ovulated oocytes as recipients. The normal substrate for the
ooplasm is the incoming sperm nucleus, which the oocyte must merge with its own
chromosomes to create a totipotent embryonic genome. During this process, the sperm
DNA must be stripped of protamines, repackaged with histones, interact with the
ooplasm to form a pronucleus, undergo DNA replication and repair, and then participate
successfully in the process of mitosis. Cloning requires that the oocyte act upon a
different substrate than it would normally, and thus that this alternative substrate (the
donor nucleus) recapitulate all of these processes as closely as possible. Defects in any
of these processes could seriously compromise development.
4
The first step in the cloning procedure is removal of the meiotic spindle
chromosome complex (SCC) from the recipient oocyte, in order to remove the oocyte
chromosomes. The removal of the SCC may deprive the cloned constructs of essential
factors. Cloned rhesus monkey embryos made with somatic cell nuclei display
deficiencies in the association of several proteins (HSET, EG5, NuMA) with the spindle
chromosome complex (SCC) that forms after nuclear transfer (Simerly et al., 2003). This
led to the suggestion that primate clones may experience mitotic defects, preventing
cloning (Simerly et al., 2003). Defects in SCC formation following SCNT could
compromise successful mitotic division and thus compromise the genomic integrity of
cloned embryos. This problem may not be unique to primate cloning, as an increased
incidence of aneuploidy/polyploidy has been reported for cloned embryos in several
species (Booth et al., 2003; Shi et al., 2004; Nolen et al., 2005). It can be noted,
however, that the SCC contains many essential proteins with many different activities,
that only a few proteins have been examined in SCNT constructs, and that the degree of
depletion after SCC removal has not been examined by quantitative means.
Interestingly, some of the proteins believed to be depleted from the rhesus oocyte
by SCC removal actually persist in the ooplasm, but appear unable to assemble onto
spindles correctly after SCNT (Simerly et al., 2003). In addition, cloned rhesus embryos
produced using embryonic nuclei (ECNT) can develop to fetal stages and birth (Meng et
al., 1997; Mitalipov et al., 2002), again indicating a significant effect of nuclear donor
developmental stage. These observations raise the possibility that the defects in SCC
formation observed after SCNT in rhesus monkey may reflect deficiencies in the
5
interaction of somatic cell nuclei with the ooplasm, which might be shared with SCNT in
other species. Moreover, such observations raise the possibility that the differences in
success of SCNT and ECNT may be partly attributable to differences in the interactions
of these nuclei with the ooplasm, such as differences in the SCC formation and function.
To investigate these possibilities, we examined in mouse cloned constructs the
effects of SCC removal on SCC-associated protein content, assembly of these proteins
onto the newly formed pseudo-meiotic SCC, their association with the first mitotic SCC,
and the relative effects of employing donor nuclei from somatic cells versus embryonic
cells on SCC composition. We find that somatic and embryonic nuclei differ in their
abilities to direct the formation of SCC with correct molecular compositions. This
reveals a novel interaction between nucleus and ooplasm that controls SCC formation in
a nucleus origin-dependent manner. The possible significance of this to SCNT biology is
discussed.
MATERIALS AND METHODS
Cloning and Embryo Culture
Ovulated oocytes were obtained from adult (B6D2)F1 females 8-12 weeks of age
by superovulation as described (Chung et al., 2002, 2003; Gao et al., 2003a, 2004a,b).
Adherent cumulus cells were removed by hyaluronidase treatment (120 IU/ml, SigmaAldrich, St. Louis, MO) and the oocytes were cultured in CZB medium supplemented
with glucose (Chung et al., 2002). Adult SCNT was performed as described (Chung et
al., 2002, 2003; Gao et al., 2003a, 2004a). Cloned constructs were cultured in minimal
6
essential medium alpha formulation (MEMα) medium as described (Gao et al., 2004b).
For SCNT, adherent adult cumulus cells (presumably G1 phase) from ovulated oocytes,
or fibroblasts from day 14 fetuses (a generous gift from Chris Carbone) were employed
as nuclear donors. Embryonic stem cells (ESCs) were of the R1 line, and were generous
gifts from Dr. Tom Misteli, National Cancer Institute, NIH, and J. Richard Chaillet, of
the University of Pittsburgh. For both ESC and fibroblasts, only cells of the smallest
sizes, and thus of G1 stage, were selected as nuclear donors. Embryos used as donors of
early 8-cell stage nuclei (G1 phase) were obtained from crosses between (B6D2)F1 males
and females.
RT-PCR Analysis
Quantitative RT-PCR was performed using the Quantitative Amplification and
Dot Blotting (QADB) method as described (Rambhatla et al., 1995). The quantitative
aspects of this method have been documented and the method applied in numerous
studies (reviewed, Zheng et al., 2004). Between 3 and 6 samples of 8-10 embryos each
were collected for each stage analyzed for the developmental time series. cDNA probes
were produced by RT-PCR from ovary RNA. Primers employed to obtain the cDNAs
are given in Table 1. The identities of cDNA probes were confirmed by DNA
sequencing.
Embryo Fixation and Confocal Microscopic Analysis
Mouse oocytes, embryos, clones and tetraploids were incubated for 2-3 min in
acidic tyrode solution (pH 2.5-2.7; Sigma, St. Louis, MO) to remove the zona pellucida,
7
then in M2 medium for 10 min at 37 0C, and then fixed in 4% paraformaldehyde (Sigma,
St. Louis, MO) in PBS for 30 min at 37 0C. The fixed cells were permeabilized with 1%
Triton X-100 (Sigma, St. Louis, MO) in PBS for 20 min, and placed in two successive
blocking solutions in PBS: 15 min in 3 mg/ml ammonium chloride (NH4Cl; Sigma, St.
Louis, MO), followed by 45 min in 0.5% Tween-20 and 2% BSA in PBS. They were then
incubated overnight at 40 C with mouse anti-calmodulin (1:50; Upstate Biotechnology,
lake Placid, NY), mouse anti-PLK 1 (1:100; Zymed, San Francisco, CA), or rabbit antiTCTP (1:100; Abcam, Cambridge, MA) diluted in the second blocking solution, washed
several times, and immunostained for 1 h with donkey anti-mouse or anti-rabbit IgG
(H+L) secondary antibody, FITC-conjugated (1:200; Jackson ImmunoResearch
Laboratories). Samples were treated for 30 min with propidium iodide to stain the DNA
(PI; Trevigen, Gainthersburg, MD), deposited on slides and mounted in citifluor (AF1,
Citifluor Products, Canterbury, UK). Confocal microscopy was performed on an inverted
Olympus (Olympus America Inc.) microscope equipped with the fluoview confocal
lasers scanning software (Olympus). The objective was an Olympus Fluor oil-immersion
100x (NA 1.35). The 488 nm (Argon) and 568 nm (Krypton) wavelengths of the laser
were used for excitation of fluorescein (FITC) and Propidium Iodide (PI) fluorescence,
respectively. Optical sections were imaged at 2 µm intervals. Image analysis was
performed using the NIH Image J program. Mean intensities of the ooSCC and pmSCC
were measured, and compared to the mean intensity of the entire remaining ooplasm, to
calculate the SCC:ooplasm ratio. This permitted comparisons of ratios between different
planes of focus, and between different constructs. Measurements were performed on a
minimum of three separate constructs, and the mean ratios calculated. Mouse fetal
8
fibroblasts were cultured on glass slides, and then fixed and processed as described
above. To obtain M-phase fibroblasts, cultures were treated for 6 h with 50 ng/ml
nocadazole (Sigma).
Western Blot Analysis
After collection, embryos, clones, MII stage oocytes, and ooplasts were rapidly
washed with ice-chilled PBS. After addition of 2x Laemmli’s buffer (Laemmli, 1970) and
heating for 5 min at 100 0C, lysates prepared from 100 oocytes/embryos of each stage
were subjected to SDS-PAGE electrophoresis in 15% polyacrylamide gels (29/1; Biorad
Laboratories, Hercules, CA) and blotted onto a hydrophobic polyvinylidene difluoride
(PVDF) transfer membrane (Amersham Biosciences, Piscataway, NJ) for 1 h at 50 V.
The membrane was blocked with Tris buffered saline (TBS; 20 mM Tris-HCl, pH 7.6,
137 mM NaCl, 0.05% Tween-20) containing 5% nonfat dry milk for 1 h at room
temperature. Incubations with mouse anti-calmodulin (1:500), mouse anti-PLK1
(1:1000), or rabbit anti-TCTP (1:1000) were performed overnight at 4 0C; this was
followed by 1 h incubation in a horseradish peroxidase-conjugated anti-mouse or antirabbit (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA), and enhanced
chemiluminescent detection (Supersignal Pierce, Rockford, IL). The Western blot
experiments were repeated three times. For quantitation, scanned images were evaluated
using the Fuji Photo Film Co. Image Guage 4.0 program (Fujifilm Medical Systems,
U.S.A.). Average ratios were calculated from three independent measurements and the
standard error of mean calculated (except for cytoplast, where only two measurements
were obtained).
9
RESULTS
Our objective in this study was to evaluate the consequences of SCC removal and
cloning on subsequent SCC formation, both before oocyte activation and as the cloned
constructs progress into the early mitotic divisions. We employed a combination of
Western blotting and indirect immunofluorescence to examine SCC formation and
composition during this series of events.
Effects of SCC removal on oocyte composition
To determine whether SCC removal might deplete the oocyte of SCC-associated
proteins, and thereby affect SCC formation, we first examined the effects of SCC
removal on calmodulin content. Calmodulin is a key transducer of intracellular signals
and a regulator of cellular and genetic functions. While most widely thought of as a
cytoplasmic or membrane-associated signaling molecule, calmodulin associates with both
meiotic and mitotic SCC, and calmodulin-dependent proteins play key roles in both
mitosis and meiosis (Welsh et al., 1979; Sun et al., 1992; Moser et al., 1997; Johnson et
al., 1998; Yin et al., 1998; Elliott et al., 1999; Li et al., 1999; Stirling and Stark, 2000;
Cyert, 2001; Gonczy et al., 2001; Moisoi et al., 2002; Takahashi et al., 2002; Su and
Eppig, 2002; Fan et al., 2003; Flory et al., 2003; Yu et al., 2004; Muller et al., 2005;
Holmfeldt et al., 2005; Yoder et al., 2005).
Western blot analysis (Fig. 1A) revealed that SCC removal led to a partial
depletion of calmodulin content to 34% of the starting value for intact MII stage oocytes.
10
By 1 h after SCC removal, much of the calmodulin content appeared to have recovered in
both ooplasts and SCNT constructs (not activated). For ooplasts, which did not receive
nuclei and were incubated for 1 h post-SCC, we observed ooplast:MII oocyte ratios of
0.69. 0.83, and 1.41 (average 99+23% of the original MII stage oocyte value), indicating
an ability of the ooplasts to restore calmodulin expression in all three experiments . In all
three experiments, calmodulin content in ooplasts then declined slightly between 1 and 3
h post-SCC, falling to an average value of 66+23% of the MII stage. This decline
between 1h and 3h may reflect a reduced rate of calmodulin synthesis, enhanced rate of
calmodulin degradation, or both, as time progresses without oocyte activation. In SCNT
constructs, calmodulin content was still slightly reduced at 1 h post-SCNT (77+19% of
MII value, total elapsed time is 2h post-SCC removal), but then in contrast to 3h ooplasts,
continued to increase, recovering to 90+16% of the MII stage level by 3h post-SCNT (4 h
post-SCC removal). Thus, although SCC removal initially reduced total calmodulin
content of the cell, the ooplasts and SCNT constructs were nevertheless able to restore a
substantial amount of what was lost by SCC removal, and this proceeded more efficiently
in SCNT constructs than in ooplasts. In all three experiments, calmodulin persisted at a
high level through the late 1-cell stage in SCNT embryos, although its abundance was
consistently lower than that in MII oocytes and fertilized late 1-cell stage embryos
(75+5% and 68+6%, respectively) (Fig. 1A). Consistent with the recovery of calmodulin
content following SCC removal and after SCNT, maternally-derived expression of
calmodulin types 1, 2, and 3 mRNAs was observed in the murine oocyte and early
embryo (Fig. 1B). The three calmodulin mRNAs displayed different temporal patterns of
expression during subsequent cleavage development in fertilized embryos, with the
11
calmodulin 1 and 2 mRNAs being expressed more highly at early stages, and the
calmodulin 3 mRNA being upregulated at later stages.
We also observed by Western blotting recovery of other SCC proteins after SCC
removal, including PLK1, TCTP, HSET, EG5, RAN, Aurora A, GSKα, and GSKβ.
Western blot data for two of these proteins, Polo-like kinase 1 (PLK1) and translationally
controlled tumor protein (TCTP), are shown as examples (Fig. 1A). There was again a
reduction in the apparent amount of TCTP and PLK1 present after SCC removal. Both
proteins recovered partially in abundance by 3 h post-SCC removal and by 1 or 3 h post
SCNT (equivalent to 2 or 4 h post-SCC removal, respectively), and both proteins were
fully replenished in abundance by the late 1-cell stage (Fig. 1A, compare lanes 7 and 8).
Thus, all SCC proteins examined thus far can be restored either partially or entirely in
abundance following SCC removal.
Deficient assembly of calmodulin onto the pseudo-meiotic spindle following SCNT
Although Western blotting revealed substantial expression of calmodulin in the
SCNT constructs, immunocytochemistry and confocal imaging revealed that calmodulin
association with the pmSCC was greatly reduced at both 1 and 3 h post-SCNT in the vast
majority of diploid constructs prepared with cumulus cell nuclei (Fig. 2A). The same
result was obtained using 14 day fetal fibroblasts as nuclear donors (Fig. 3B), indicating
that this result was not unique to cumulus cell nuclei. A small proportion of SCNT
embryos displayed significant calmodulin association with the pmSCC at 3 h post-SCNT,
but these were not observed at the late 1-cell stage, indicating that this association was
12
likely not stable (Fig. 2B). Examination of tetraploid SCNT embryos (produced by
performing SCNT without SCC removal) revealed that calmodulin association with the
pmSCC was also reduced even when the oocyte (oo)SCC was not removed (Fig. 4,
columns 1 and 2). The clear difference between the ooSCC (distinguishable by position
and tightly packed chromosomes) and pmSCC (characterized by more loosely packed
chromosomes) within the same cell illustrates the calmodulin deficiency in the pmSCC
formed after SCNT. Quantitative image analysis revealed that the intensity of calmodulin
staining of the pmSCC at 1 h post-NT in tetraploid constructs prepared with cumulus cell
nuclei was only 20% above the intensity of the surrounding ooplasm, whereas the
intensity of ooSCC staining was nearly 3 times the value of the surrounding ooplasm,
indicating a nearly ten-fold lower enrichment of calmodulin in the pmSCC than in the
ooSCC. By contrast, staining intensities for two other spindle-associated proteins, PLK1
and TCTP (Tong et al., 2002; Yarm, 2002) were each only ~25-30% greater in the
ooSCC than the pmSCC, confirming the specificity of the effect for calmodulin. It may
be noted that for tetraploid embryos the ooSCC and pmSCC often merged into a single
SCC by 3h post-SCNT. For a minority of constructs in which the two SCCs remained
separate, a slight recovery in calmodulin association with the pmSCC was evident by 3h
post-SCNT, but this did not attain an intensity comparable to that seen with the ooSCC.
Thus, even within the same ooplasm, the ooSCC differs compositionally from the
pmSCC with respect to calmodulin association.
The defect observed with calmodulin localization to the pmSCC of SCNT
embryos is not indicative of a generalized failure of a spindle to form. The SCC in fact
13
forms, and in addition to PLK1 and TCTP (Figs. 2 and 4), we also observed apparently
normal association of β-tubulin, NuMA, ATRX, Aurora A, RAN, HSET, EG5, and
kendrin with the pmSCC of SCNT embryos (not shown). The efficient association of
these proteins with the pmSCC indicates that the SCCs assemble in these oocytes, and
that a majority of proteins associates with the SCC as expected.
Published studies revealed calmodulin association with the SCC of M phase
somatic cells (Welsh et al., 1979; Li et al., 1999; Yu et al., 2004). Nevertheless, to
address further the possibility that the failure to see calmodulin association with the
pmSCC in cloned constructs was related to an inability of calmodulin to associate with
somatic cell mitotic SCCs, we examined calmodulin expression in cultures of
proliferating untreated and nocadazole-treated fibroblasts (because cumulus cell donors
were not cultured and were not in M phase, these cells were not examined) (Fig. 5). We
observed that in the fibroblasts, calmodulin was expressed throughout the cell cycle, and
was associated with the SCC as seen in published studies for fibroblasts and other cell
types (Welsh et al., 1979; Li et al., 1999; Yu et al., 2004). Western blot analysis also
revealed calmodulin expression in cumulus cells and 3T3 cells (data not shown). Thus,
neither a lack of calmodulin expression nor a lack of association with the SCC in the
somatic cells can account for the observed lack of calmodulin association with the
pmSCC in SCNT embryos.
14
Calmodulin association with the SCC following ECNT
In contrast to results obtained with SCNT embryos, diploid cloned ECNT
constructs prepared with embryonic blastomere nuclei (Fig. 3C) or embryonic stem cell
nuclei (Fig 3D) displayed abundant calmodulin association with the pmSCC. Cloned
tetraploid constructs made with early eight-cell stage embryonic nuclei displayed strong
calmodulin association with both the ooSCC and the pmSCC at 1h and 3h post-SCNT
(Fig. 4, columns 3-6), further indicating a difference between ECNT and SCNT. This
occurred when nuclei were introduced by either electrofusion or piezo-assisted
microinjection (method identical to that employed for adult cumulus cell nuclei). Image
analysis revealed that the accumulations of calmodulin on the pmSCC and ooSCC were
nearly equal, differing by only ~7% at 1 h post-NT, and that PLK1 and TCTP again
displayed very similar accumulations between the ooSCC and pmSCC. These results,
combined with the Western blot data, further indicate that the deficiency of calmodulin
association following SCNT was not a result of depletion of the protein from the
ooplasm, but rather a specific deficiency related to the somatic cell origin of the donor
nucleus.
No apparent differences in cytoplasmic localization of calmodulin were observed
in our analyses (Fig. 2), and the diffuse cytoplasmic distribution observed here for MII
stage oocytes and one-cell embryos was similar to that shown previously for MI and
anaphase stage pig oocytes (Fan et al., 2003) and early mouse embryos (Sobel et al.,
1998). Thus, the difference observed between ECNT and SCNT indicates an effect on
calmodulin association specifically with the SCC.
15
Continued deficiency of SCC-associated calmodulin at the first and second mitosis
Absence of calmodulin from the pmSCC might be of no consequence, because the
cloning procedure routinely involves suppression of polar body extrusion, thus
preventing any loss of chromosomes during oocyte activation. Only defects in the
mitotic spindles forming during cleavage should produce genetic defects. Examination of
SCNT embryos revealed that calmodulin remained largely absent from the first mitotic
SCC in late one-cell SCNT embryos (Fig. 2). Similarly, at the late two-cell stage we
again observed a calmodulin deficiency on the spindle at the second mitosis of a majority
(13 of 14 examined, 93%) of SCNT embryos (Fig. 6). Thus, the molecular defects
responsible for reduced calmodulin association with the pmSCC continue in a majority of
embryos at least through the second mitotic division. Unlike calmodulin, PLK1 and
TCTP were associated abundantly with the first mitotic spindle (Fig. 2). In contrast, to
embryos obtained by SCNT, calmodulin associated efficiently with the mitotic SCC of
late 1-cell embryos prepared by ECNT (Fig 3E), indicating once again a difference
between SCNT and ECNT.
Chromosome congression in cloned constructs
The foregoing observations indicated that the differences between ECNT and
SCNT embryos with respect to calmodulin association with the SCC persisted at least
into the second mitosis. A deficiency of SCC formation could lead to defects in assembly
of chromosomes onto the spindle after SCNT. It is thus noteworthy that the pmSCC
formed following ECNT consistently displayed much greater congression of
16
chromosomes on the metaphase plate than the pmSCC formed with SCNT, in both
diploid and tetraploid constructs (Figs. 3 and 4). We also observed lagging chromosomes
at the first and second mitotic divisions (Figs. 2 and 6). These observations indicate
some impairment of chromosome attachment to the spindle following SCNT, but this was
not observed with ECNT.
DISCUSSION
The data presented here reveal a striking interaction between nucleus and ooplasm
that affects SCC formation and composition. This interaction is donor cell typedependent, indicating that factors associated with nuclei from different cell types can
direct the formation of qualitatively different SCC. The data also reveal for the first time
a specific molecular difference that may help to explain both the low efficiency of SCNT,
and the stage-dependent restriction in success that distinguishes ECNT from SCNT.
The differential effects of SCNT and ECNT on SCC composition persist in a
majority of embryos at least until the second mitosis, and could thus affect genome
stability. We note that SCNT embryos display a deficiency in the timely congression of
chromosomes to the metaphase II plate and also a delay in chromosome congression at
the first and second mitosis. These defects were not observed in ECNT embryos. It is
intriguing that enhanced calmodulin association with the pmSCC in ECNT embryos
relative to SCNT embryos correlates with improved congression of chromosomes, and
with the 10-20 fold greater success of term development reported for ECNT blastocysts
(Rideout et al., 2000; Eggan et al., 2001; Humpherys et al., 2002; Gao et al., 2003b).
17
Defining the specific roles of calmodulin in spindle formation and function
remains an active and dynamic area of study. Published studies from a variety of
organisms indicate that calmodulin-binding proteins may regulate multiple process
during meiosis and mitosis, including microtubule nucleation and spindle formation,
spindle positioning, progression from metaphase to anaphase, correct timing of separation
of homologues and chromatids, and regulation of cleavage furrow formation (Johnson et
al., 1998; Elliott et al., 1999; Stirling and Stark, 2000; Cyert 2001; Gonczy et al., 2001;
Su and Eppig, 2002; Fan et al., 2003; Holmfeldt et al., 2005; Yoder et al., 2005). It is
intriguing that SCNT embryos, despite the substantial reduction in calmodulin
association with the SCC, nevertheless undergo cleavage. This suggests that other
proteins may substitute at least partially for calmodulin, and indeed other calmodulinrelated, calcium-binding proteins (e.g., centrin) exist on spindles (Hu et al., 2004).
Interestingly, oocytes treated with diazepam (a calmodulin inhibitor) display meiotic
delay and aneuploidy, but can nevertheless progress through meiotic divisions (Yin et al.,
1998). While such inhibitor-based studies are complicated by the need to discriminate
between effects on cytoplasmic versus SCC-associated calmodulin, such results indicate
that the observed calmodulin deficiency on the SCC in SCNT embryos may not be
expected to cause an obligate arrest, but rather may predispose SCNT embryos to mitotic
defects. Accordingly, karyotype analyses have revealed a dramatically increased
incidence of aneuploidy/polyploidy (75% or more of embryos, and 10% or more of cells)
in SCNT blastocysts, but these embryos nevertheless contain a significant proportion of
euploid cells (Booth et al., 2003; Shi et al., 2004; Nolen et al., 2005). Thus, mitotic
18
errors indeed appear to occur at increased rates in SCNT embryos, but such errors likely
arise on a stochastic basis during any cleavage division. The observed persistence of
calmodulin deficiency through at least the first two mitoses in a majority of SCNT
embryos supports a model in which molecular deficiencies in the mitotic SCC of SCNT
embryos predisposes the individual blastomeres of these embryos to an increased risk of
mitotic errors at each cleavage division.
How can one explain an effect of nuclear origin on spindle formation and
composition? One possibility is that donor cell centrioles differ between embryonic and
somatic cells. Because both ES and somatic cells possess typical centrioles
(Sathananthan et al., 2002; Baharvand and Matthei, 2003), however, this explanation
seems unlikely to account for the differences in SCC formation. Another possibility is
that, just as chromatin structure affects gene transcription, it also affects SCC formation.
Although mouse oocytes can form spindles without chromatin (Brunet et al., 1998;
Woods et al., 1999), chromatin plays an essential organizing role by harnessing the innate
spindle forming potential of the oocyte and stabilizing the spindle (Brunet et al., 1998).
We propose that the oocyte chromatin is endowed with one or more specific factors that
direct correct spindle formation, and that this represents a specific requirement of spindle
formation within the ooplasm. The mRNAs for these factors are likely absent from the
mature oocyte, so that SCC removal irreversibly depletes the ooplasm of these proteins.
These factors are likewise present on the chromatin of embryonic nuclei, which must
express the corresponding genes, given the ability of ES cell nuclei to behave similarly to
blastomere nuclei. As development progresses, and somatic cell characteristics diverge
19
progressively from embryonic cell characteristics, these factors become dispensable, and
somatic cell nuclei no longer possess or require these factors for mitosis. Our
observations are consistent with the hypothesis that somatic cell nuclei lack factors that
are needed in the oocyte for efficient calmodulin association with the SCC.
A possible difference in the timing of post-nuclear transfer events with ECNT
versus SCNT should be considered. The pace of histone H1 transitions can vary in a
subtle manner with different donor cell types (Becker et al., 2005). For example, SCNT
with cumulus cell nuclei and myoblast nuclei is followed by an immediate binding of the
oocyte specific histone H1 variant H1FOO, and then complete removal of detectable
somatic type H1 by 1 h after SCNT. Following SCNT with fetal fibroblasts or ECNT
with ES cell nuclei, immediate binding of H1FOO is again observed, along with rapid
depletion of somatic H1, but a low level of somatic H1 can persist for slightly longer,
being completely removed within 3 h (Gao et al., 2004a; Teranishi et al., 2004). It is thus
important to note that the subtle difference observed for removal of the last vestige of
somatic H1 after nuclear transfer does not follow a clear delineation between somatic and
embryonic donor cell types, and thus does not follow the same pattern observed here,
wherein a clear distinction between ECNT and SCNT is observed for calmodulin binding
in the SCC.
We examined the presence and pmSCC association of two proteins that could be
related to calmodulin localization (kendrin, TCTP), and neither appeared depleted or
absent. Thus, the identity of the depleted factor(s) remains unknown. Specific chromatin-
20
associated proteins, centromeric proteins, or kinetochore proteins (Dogterom et al., 1996;
Heald, 1996; Maiato et al., 2004; Maiato and Sunkel, 2004; Sullivan and Karpen, 2004;
Varmark, 2004;) are interesting possibilities. These proteins may direct essential
interactions with oocyte-specific factors to support normal SCC formation during Mphase. These interactions may be related to meiosis in the absence of centrosomes. The
absence of these factors in somatic cell nuclei could lead to SCC defects and aneuploidy
after SCNT.
A small fraction of SCNT embryos acquired calmodulin association with the
pmSCC by 3 h post-SCNT. This early association appeared to be lost by the late 1-cell
stage. Although a small proportion of SCNT embryos may form pmSCC with normal
characteristics, this appears to be quite rare. This could contribute to the poor efficiency
(1-5%) of term development following SCNT. Those rare cloned embryos that can form
compositionally normal SCC at mitosis may correspond to those clones of greatest
developmental potential.
The failure of calmodulin to recover entirely in abundance following SCC
removal, its slight diminishment between 1 and 3 h post-SCC removal in ooplasts, and its
failure to recover completely by the late one-cell stage indicate that calmodulin content in
the oocyte and early embryo is likely limited by protein stability. We have noted
previously that a delay in activation of cloned constructs compromises viability, and that
treatment of cloned constructs with the proteasome inhibitor, MG132, overcomes this
effect of delayed activation (Gao et al., 2005). The protective effect of MG132 may thus
21
be partly due to promoting the recovery of proteins like calmodulin that are partially
depleted by SCC removal and that are difficult to replenish due to limited stability. It is
also interesting to note that the rate of decline in calmodulin content appeared to be less
in SCNT embryos than in ooplasts, as 3h SCNT embryos contained about 66% more
calmodulin than 3h ooplasts. This indicates that the presence of chromosomes within the
oocyte may affect protein stability, possibly by facilitating pmSCC formation.
SCNT in the rhesus monkey can deplete the oocyte of some proteins (Simerly et
al., 2003, 2004). Our data reveal an initial depletion of calmodulin and other proteins,
followed by substantial recovery of abundance within hours of SCC removal. The
proteins we examined include essential regulatory proteins such as PLK1, a regulator of
spindle assembly and TCTP function (Tong et al., 2002; Yarm et al., 2002). These data
thus indicate that SCC removal likely does not lead to permanent depletion of a majority
of essential SCC-associated proteins. Long-term and extensive depletion of proteins by
SCC removal would likely require that such proteins be encoded by mRNAs that are
absent from the maternal mRNA pool or otherwise not translatable within the oocyte,
which would preclude these proteins from being restored soon after SCC removal.
Additionally, in order for SCC removal to deplete SCC-associated proteins from the
whole oocyte significantly, such proteins would have to be very highly partitioned to the
SCC, with little or no exchange to the ooplasmic compartment. While the
aforementioned results indicate that, for most proteins, this does not occur during mouse
cloning, the failure of calmodulin to associate with the SCC indicates that SCC removal
must result in a permanent depletion of one or more proteins responsible for this
22
localization. This indicates that SCC deficiencies such as those observed with primate
cloning (Simerly et al., 2003, 2004) are not unique to primates.
Cloning by SCNT with non-human primates appears to be more difficult as
compared to other mammals, a result that may relate to depletion of SCC proteins and
subsequent aneuploidy (Simerly et al., 2003, 2004). The development of cloned rhesus
monkeys to advanced stages of pregnancy or to birth (Meng et al., 1997; Mitalipov et al.,
2002) and the establishment of pregnancies in long-tailed macaques (Ng et al., 2004)
indicate that mitotic errors may not pose an absolute barrier to cloning in primates.
Additionally, the first human embryonic stem cells (ESCs) derived from a cloned human
embryo were euploid (Hwang et al., 2004), further suggesting that at least some primate
cloned constructs can complete cleavage development without mitotic errors. Our data
indicate that cloning in both primate and non-primate species may be subject to an
increased risk of mitotic errors related to depletion of SCC-associated proteins, and a
deficiency of proteins specifically in somatic cell nuclei. Do our results imply that an
improvement in cloning efficiency will be impossible? To the contrary, the results
presented here point to a new direction of study that will help us to understand some of
the molecular barriers to successful cloning. Restoring the ability to form an SCC of
normal composition could provide one avenue for improving the cloning process,
together with other strategies to address other deficiencies in the cloning process.
Additionally, such studies could shed new light on the roles of SCC-associated proteins
in the normal embryo.
23
ACKNOWLEGEMENTS
We thank John Eppig and Davor Solter for early comments on the manuscript. We also
thank Tom Misteli and J. Richard Chaillet for the generous gifts of R1 ES cells and Chris
Carbone for providing mouse fetal fibroblasts. This work was supported by a grant from
the National Institutes of Health, National Institute of Child Health and Human
Development (HD43092) and a Shared Resources Grant from the National Cancer
Institute (CA088261).
24
REFERENCES
Baharvand, H., Matthaei, K. I. (2003). The ultrastructure of mouse embryonic stem cells.
Reprod. Biomed. Online. 7:330-335.
Becker, M., Becker, A., Miyara, F., Han, Z., Kihara, M., Brown, D. T., Hager, G. L.,
Latham, K., Adashi, E. Y., Misteli, T. (2005). Differential in vivo binding
dynamics of somatic and oocyte-specific linker histones in oocytes and during ES
cell nuclear transfer. Mol. Biol. Cell. 16, 3887-3895.
Booth, P. J., Viuff, D., Tan, S., Holm, P., Greve, T., Callesen, H. (2003). Numerical
chromosome errors in day 7 somatic nuclear transfer bovine blastocysts. Biol.
Reprod. 68, 922-928.
Brunet, S., Polanski, Z., Verlhac, M. H., Kubiak, J. Z., Maro, B. (1998). Bipolar meiotic
spindle formation without chromatin. Curr. Biol. 8, 1231-1234.
Chung, Y. G., Mann, M. R., Bartolomei, M. S., Latham, K. E. (2002). Nuclearcytoplasmic "tug of war" during cloning: effects of somatic cell nuclei on culture
medium preferences of preimplantation cloned mouse embryos. Biol. Reprod. 66,
1178-1184.
Chung, Y. G., Ratnam, S., Chaillet, J. R., Latham, K. E. (2003). Abnormal regulation of
DNA methyltransferase expression in cloned mouse embryos. Biol. Reprod. 69,
146-153.
Cyert, M. S. (2001). Genetic analysis of calmodulin and its targets in Saccharomyces
cerevisiae. Annu. Rev. Genet. 35, 647-672.
25
DiBerardino. M. A., Genomic potential of differentiated cells. Columbia University
Press, New York. pp. 28-102 (1997).
Dogterom, M., Felix, M. A., Guet, C. C., Leibler, S. (1996). Influence of M-phase
chromatin on the anisotropy of microtubule asters. J. Cell Biol. 133, 125-140.
Eggan, K., Akutsu, H., Loring, J., Jackson-Grusby, L., Klemm, M., Rideout, W. M. 3rd,
Yanagimachi, R., Jaenisch, R. (2001). Hybrid vigor, fetal overgrowth, and
viability of mice derived by nuclear cloning and tetraploid embryo
complementation. Proc. Natl. Acad. Sci., U. S. A. 98, 6209-14.
Elliott, S., Knop, M., Schlenstedt, G., Schiebel, E. (1999). Spc29p is a component of the
Spc110p subcomplex and is essential for spindle pole body duplication. Proc.
Natl. Acad. Sci. U. S. A. 96, 6205-6210.
Fan, H. Y., Huo, L. J., Meng, X. Q., Zhong, Z. S., Hou, Y., Chen, D. Y., Sun, Q. Y.
(2003). Involvement of calcium/calmodulin-dependent protein kinase II
(CaMKII) in meiotic maturation and activation of pig oocytes. Biol. Reprod. 69,
1552-1564.
First, N. L., Prather, R. S. (1991). Genomic potential in mammals.Differentiation. 48, 18.
Flory, M. R., Davis, T. N. (2003). The centrosomal proteins pericentrin and kendrin are
encoded by alternatively spliced products of one gene. Genomics. 82, 401-405.
Gao, S., Chung, Y. G., Parseghian, M. H., King, G. J., Adashi, E. Y., Latham, K. E.
(2004a). Rapid H1 linker histone transitions following fertilization or somatic cell
nuclear transfer: evidence for a uniform developmental program in mice. Dev.
Biol. 266, 62-75.
26
Gao, S., Chung, Y. G., Williams, J. W., Riley, J., Moley, K., Latham, K. E. (2003a)
Somatic cell-like features of cloned mouse embryos prepared with cultured
myoblast nuclei. Biol. Reprod. 69, 48-56.
Gao, S., Czirr, E., Chung, Y. G., Han, Z., Latham, K. E. (2004b). Genetic variation in
oocyte phenotype revealed through parthenogenesis and cloning: correlation with
differences in pronuclear epigenetic modification. Biol. Reprod. 70, 1162-1170.
Gao, S., Han, Z., Kihara, M., Adashi, E., Latham, K. E. (2005). Protease inhibitor
MG132 in cloning: no end to the nightmare. Trends Biotechnol. 23, 66-68.
Gao, S., McGarry, M., Ferrier, T., Pallante, B., Priddle, H., Gasparrini, B., Fletcher, J.,
Harkness, L., De Sousa, P., McWhir, J., Wilmut, I. (2003b). Effect of cell
confluence on production of cloned mice using an inbred embryonic stem cell
line. Biol. Reprod. 68, 595-603.
Gonczy, P., Grill, S., Stelzer, E. H., Kirkham, M., Hyman, A. A. (2001). Spindle
positioning during the asymmetric first cell division of Caenorhabditis elegans
embryos. Novartis Found. Symp. 237, 164-175.
Heald, R., Tournebize, R., Blank, T., Sandaltzopoulos, R., Becker, P., Hyman, A.,
Karsenti, E. (1996). Self-organization of microtubules into bipolar spindles
around artificial chromosomes in Xenopus egg extracts. Nature. 382, 420-425.
Holmfeldt, P., Zhang, X., Stenmark, S., Walczak, C. E., Gullberg, M. (2005).
CaMKIIgamma-mediated inactivation of the Kin I kinesin MCAK is essential for
bipolar spindle formation. EMBO J. 24, 1256-1266.
27
Hu, H., Sheehan, J. H., Chazin, W. J. (2004). The mode of action of centrin. Binding of
Ca2+ and a peptide fragment of Kar1p to the C-terminal domain. J. Biol. Chem.
279, 50895-50903.
Humpherys, D., Eggan, K., Akutsu, H., Friedman, A., Hochedlinger, K., Yanagimachi,
R., Lander, E. S., Golub, T. R., Jaenisch, R. (2002). Abnormal gene expression in
cloned mice derived from embryonic stem cell and cumulus cell nuclei. Proc.
Natl. Acad. Sci. U. S. A. 99, 12889-12894.
Hwang, W. S., Ryu, Y. J., Park, J. H., Park, E. S., Lee, E. G., Koo, J. M., Jeon, H. Y.,
Lee, B. C., Kang, S. K., Kim, S. J., Ahn, C., Hwang, J. H., Park, K. Y., Cibelli, J.
B., Moon, S. Y. (2004). Evidence of a pluripotent human embryonic stem cell line
derived from a cloned blastocyst. Science. 303, 1669-1674.
Johnson, J., Bierle, B. M., Gallicano, G. I., Capco, D. G. (1998). Calcium/calmodulindependent protein kinase II and calmodulin: regulators of the meiotic spindle in
mouse eggs. Dev. Biol. 204, 464-477.
King, T. J., Briggs, R. (1955). Changes in the nuclei of differentiating gastrula cells, as
demonstrated by nuclear transplantation. Proc. Natl. Acad. Sci. U. S. A. 41, 321325.
Kono, T., Tsunoda, Y., Nakahara, T. (1991). Production of identical twin and triplet mice
by nuclear transplantation. J. Exp. Zool. 257, 214-219.
Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature. 227, 680-685.
Latham, K. E. (2004). Cloning: questions answered and unsolved. Differentiation. 72, 1122.
28
Li CJ, Heim R, Lu P, Pu Y, Tsien RY, Chang DC. (1999). Dynamic redistribution of
calmodulin in HeLa cells during cell division as revealed by a GFP-calmodulin
fusion protein technique. J. Cell Sci. 112, 1567-1577.
Maiato, H., Rieder, C. L., Khodjakov, A. (2004). Kinetochore-driven formation of
kinetochore fibers contributes to spindle assembly during animal mitosis. J. Cell
Biol. 167, 831-840.
Maiato, H., Sunkel, C. E. (2004). Kinetochore-microtubule interactions during cell
division. Chromosome Res. 12, 585-597.
Meng, L., Ely, J. J., Stouffer, R. L., Wolf, D. P. (1997). Rhesus monkeys produced by
nuclear transfer. Biol. Reprod. 57, 454-9.
Mitalipov, S. M., Yeoman, R. R., Nusser, K. D., Wolf, D. P. (2002). Rhesus monkey
embryos produced by nuclear transfer from embryonic blastomeres or somatic
cells. Biol. Reprod. 66, 1367-1373.
Moisoi, N., Erent, M., Whyte, S., Martin, S., Bayley, P. M. (2002). Calmodulincontaining substructures of the centrosomal matrix released by microtubule
perturbation. J. Cell Sci. 115, 2367-2379.
Moser, M. J., Flory, M. R., Davis, T. N. (1997). Calmodulin localizes to the spindle pole
body of Schizosaccharomyces pombe and performs an essential function in
chromosome segregation. J. Cell Sci. 110, 1805-1812.
Muller, E. G., Snydsman, B. E., Novik, I., Hailey, D. W., Gestaut, D. R., Niemann, C. A.,
O'Toole, E. T., Giddings, T. H., Jr., Sundin, B. A., Davis, T. N. (2005). The
organization of the core proteins of the yeast spindle pole body. Mol. Biol. Cell.
16, 3341-3352.
29
Ng, S. C., Chen, N., Yip, W. Y., Liow, S. L., Tong, G. Q., Martelli, B., Tan, L. G.,
Martelli, P. (2004). The first cell cycle after transfer of somatic cell nuclei in a
non-human primate. Development. 131, 2475-2484.
Ng, R. K., Gurdon, J. B. (2005). Epigenetic memory of active gene transcription is
inherited through somatic cell nuclear transfer. Proc. Natl. Acad. Sci. U. S. A. 102,
1957-1962.
Nolen, L. D., Gao, S., Han, Z., Mann, M. R., Chung, Y. G., Otte, A. P., Bartolomei, M.
S., Latham, K. E. (2005). X chromosome reactivation and regulation in cloned
embryos. Dev. Biol. 279, 525-540.
Rambhatla, L., Patel, B., Dhanasekaran, N., Latham, K. E. (1995). Analysis of G protein
alpha subunit mRNA abundance in preimplantation mouse embryos using a rapid,
quantitative RT-PCR approach. Mol. Reprod. Dev. 41, 314-324.
Rhind, S. M., Taylor, J. E., De Sousa, P. A., King, T. J., McGarry, M., Wilmut, I. (2003).
Human cloning: can it be made safe? Nat. Rev. Genet. 4, 855-864.
Rideout, W. M., 3rd, Wakayama, T., Wutz, A., Eggan, K., Jackson-Grusby, L., Dausman,
J., Yanagimachi, R., Jaenisch, R. (2000). Generation of mice from wild-type and
targeted ES cells by nuclear cloning. Nat. Genet. 24, 109-110.
Sathananthan, H., Pera, M., Trounson, A. (2002). The fine structure of human embryonic
stem cells. Reprod. Biomed. Online. 4, 56-61
Simerly, C., Dominko, T., Navara, C., Payne, C., Capuano, S., Gosman, G., Chong, K.
Y., Takahashi, D., Chace, C., Compton, D., Hewitson, L., Schatten, G. (2003).
Molecular correlates of primate nuclear transfer failures. Science. 300, 297.
30
Simerly, C., Navara, C., Hyun, S. H., Lee, B. C., Kang, S. K., Capuano, S., Gosman, G.,
Dominko, T., Chong, K. Y., Compton, D., Hwang, W. S., Schatten, G. (2004).
Embryogenesis and blastocyst development after somatic cell nuclear transfer in
nonhuman primates: overcoming defects caused by meiotic spindle extraction.
Dev. Biol. 276, 237-252.
Shi, W., Dirim, F., Wolf, E., Zakhartchenko, V., Haaf, T. (2004). Methylation
reprogramming and chromosomal aneuploidy in in vivo fertilized and cloned
rabbit preimplantation embryos. Biol. Reprod. 71, 340-347.
Sobel, J. S., Goldstein, E. G., Venuti, J. M., Welsh, M. J. (1998). Spectrin and calmodulin
in spreading mouse blastomeres. Dev. Biol. 126, 47-56.
Su, Y. Q., Eppig, J. J. (2002). Evidence that multifunctional calcium/calmodulindependent protein kinase II (CaM KII) participates in the meiotic maturation of
mouse oocytes. Mol. Reprod. Dev. 61, 560-569.
Sullivan, B. A., Karpen, G. H. (2004). Centromeric chromatin exhibits a histone
modification pattern that is distinct from both euchromatin and heterochromatin.
Nat. Struct. Mol. Biol. 11, 1076-1083.
Sun GH, Hirata A, Ohya Y, Anraku Y. (1992). Mutations in yeast calmodulin cause
defects in spindle pole body functions and nuclear integrity. J. Cell Biol. 119,
1625-1639.
Stirling, D. A., Stark, M. J. (2000). Mutations in SPC110, encoding the yeast spindle pole
body calmodulin-binding protein, cause defects in cell integrity as well as spindle
formation. Biochim. Biophys. Acta. 1499, 85-100.
31
Takahashi, M., Yamagiwa, A., Nishimura, T., Mukai, H., Ono, Y. (2002). Centrosomal
proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring
gamma-tubulin ring complex. Mol. Biol. Cell. 13, 3235-3245.
Teranishi, T., Tanaka, M., Kimoto, S., Ono, Y., Miyakoshi, K., Kono, T., Yoshimura, Y.
(2004). Rapid replacement of somatic linker histones with the oocyte-specific
linker histone H1foo in nuclear transfer. Dev. Biol. 266, 76-86.
Tong, C., Fan, H. Y., Lian, L., Li, S. W., Chen, D. Y., Schatten, H., Sun, Q. Y. (2002).
Polo-like kinase-1 is a pivotal regulator of microtubule assembly during mouse
oocyte meiotic maturation, fertilization, and early embryonic mitosis. Biol.
Reprod. 67, 546-554.
Tsunoda, Y., Yasui, T., Shioda, Y., Nakamura, K., Uchida, T., Sugie, T. (1987) Full-term
development of mouse blastomere nuclei transplanted into enucleated two-cell
embryos. J. Exp. Zool. 242, 147-151.
Varmark, H. (2004). Functional role of centrosomes in spindle assembly and
organization. J. Cell Biochem. 91, 904-914.
Welsh, M. J., Dedman, J. R., Brinkley, B. R., Means, A. R. (1979). Tubulin and
calmodulin. Effects of microtubule and microfilament inhibitors on localization in
the mitotic apparatus. J. Cell Biol. 81, 624-634.
Woods, L. M., Hodges, C. A., Baart, E., Baker, S. M., Liskay, M., Hunt, P. A. (1999).
Chromosomal influence on meiotic spindle assembly: abnormal meiosis I in
female Mlh1 mutant mice. J. Cell Biol. 145, 1395-406.
Yarm, F. R. (2002). Plk phosphorylation regulates the microtubule-stabilizing protein
TCTP. Mol. Cell. Biol. 22, 6209-6221.
32
Yin, H., Baart, E., Betzendahl, I., Eichenlaub-Ritter, U. (1998). Diazepam induces
meiotic delay, aneuploidy and predivision of homologues and chromatids in
mammalian oocytes. Mutagenesis. 13, 567-580.
Yoder, T. J., McElwain, M. A., Francis, S. E., Bagley, J., Muller, E. G., Pak, B., O'Toole,
E. T., Winey, M., Davis, T. N. (2005). Analysis of a spindle pole body mutant
reveals a defect in biorientation and illuminates spindle forces. Mol. Biol. Cell.
16, 141-52.
Yu, Y. Y., Chen, Y., Dai, G., Chen, J., Sun, X. M., Wen, C. J., Zhao, D. H., Chang, D.
C., Li, C. J. (2004). The association of calmodulin with central spindle regulates
the initiation of cytokinesis in HeLa cells. Int. J. Biochem. Cell Biol. 36, 15621572.
Zheng, P., Patel, B., McMenamin, M., Reddy, S. E., Paprocki, A. M., Schramm, R. D.,
Latham, K. E. (2004). The primate embryo gene expression resource: a novel
resource to facilitate rapid analysis of gene expression patterns in non-human
primate oocytes and preimplantation stage embryos. Biol. Reprod. 70, 1411-1418.
33
Figure Legends
Figure 1. (A) Western blot analysis of PLK1, TCTP, and calmodulin in oocytes,
fertilized embryos, and cloned constructs. Each lane received 100 oocytes/embryos of
the indicated type. The position and molecular weight of calmodulin are indicated. For
comparisons between ooplasts and SCNT constructs, it should be noted that time shown
for SCNT constructs is the time elapsed post-SCNT plus 1h recovery post-SCC removal.
Note: longer exposure revealed TCTP present at all stages, including 1h ooplasts. (B)
Expression profiles of calmodulin transcripts in mouse embryos. Embryos were obtained
from superovulated (B6D2)F1 females mated to (B6D2)F1 males, cultured in vitro from
the 1-cell stage, and lysed at different times post hCG. The corresponding developmental
stages, including germinal vesicle intact oocyte (GVOOC), MII stage oocyte (egg), 1-, 2-,
4-, and 8-cell stages, morula and blastocyst, are indicated above the graph. The bar
labeled “vivo” corresponds to 2-cell stage embryos flushed from the oviduct and lysed
without further culture. Hybridization signals were normalized to the amount of DNA
bound to each dot, and then expressed in units of bound counts per minute (cpm) after
conversion of phosphorimager data using a dot with a known quantity of 32P for
calibration. Bars indicate the mean value and s.e.m. obtained for the stages or times
indicated (between 3 and 8 samples per stage).
Figure 2. Confocal microscopic imaging of proteins associated with the SCC of oocytes,
fertilized embryos, and cloned embryos. Stages, from left to right, correspond to
ovulated MII stage oocyte, diploid cloned constructs at 1h and 3 h post-SCNT, late (M-
34
phase) 1-cell stage cloned construct, and late (M-phase) 1-cell fertilized embryo. Data
are shown for three proteins, top to bottom, Polo-like kinase (PLK1), Translationally
Controlled Tumor Protein (TCTP), and calmodulin (CaM) (green fluorescence).
Corresponding panels showing DNA stained with propidium iodide (PI) in each imaged
oocyte are provided (red fluorescence). The proportions of embryos displaying no, weak,
or strong fluorescence for calmodulin on the pmSCC for each column is indicated by the
pie graphs at the bottom, with total number of embryos examined indicated. Negative
controls processed without primary antibody displayed no significant fluorescence. The
scale bar = 17 µm, except for rows 5 and 6, column 4, which show 1.5x greater
magnification for clarity. The arrows indicate lagging chromosomes at the first mitosis in
SCNT embryos.
Figure 3. Confocal microscopic imaging and comparison of calmodulin association with
the SCC of diploid cloned constructs prepared with different donor cell nuclei. Diploid
cloned constructs were prepared with (A) Cumulus cell nuclei, (B) Fetal fibroblast nuclei,
(C) G1 phase 8-cell stage embryonic nuclei, (D) Embryonic stem cell nuclei, and fixed at
1 and 3 h post-NT, or (E) Embryonic stem cell nuclei, and fixed at the late 1-cell stage as
embryos were undergoing cleavage to the early 2-cell stage. Corresponding panels
showing staining for DNA are shown. The scale bar = 13 µm.
Figure 4. Confocal microscopic imaging of proteins associated with the SCC of
tetraploid constructs. Constructs were prepared with adult somatic cell (cumulus) nuclei
using piezo injection, and with G1 phase 8-cell stage embryonic nuclei either by
35
electrofusion or by piezo injection. Constructs were fixed at either 1 h or 3 h post-SCNT
and then processed for immunofluorescence and confocal microscopy to detect PLK1,
TCTP, and calmodulin. Corresponding panels showing DNA are provided for each
embryo. The spindles corresponding to the original oocyte SCC (ooSCC) and pseudomeiotic SCC (pmSCC) are indicated.
Figure 5. Calmodulin expression in cultured fetal fibroblasts. Cells were fixed and
calmodulin visualized at the G1, G2, prometaphase (PM), metaphase (M), anaphase (A),
telophase (T), and late telophase (LT) stages of the cell cycle. First column shows
localization of calmodulin (CaM), second column shows DNA labeling with propidium
iodide, and the third column shows merged images.
Figure 6. Deficiency of calmodulin association with the SCC at the second mitotic
division in SCNT embryos. The first two columns show two examples of SCNT
embryos undergoing the second mitosis. The third column shows a fertilized embryo
also undergoing the second mitosis (54 h post-hCG injection) for comparison. The top
row shows calmodulin localization, middle row shows DNA labeling with propidium
iodide, and the bottom row shows the merged images. Note the deficient calmodulin
association with the pmSCC of SCNT embryos, but intense association with the SCC on
the fertilized embryo. Note also the lagging chromosomes evident in the SCNT embryos
(arrows). The scale bar = 8 µm.
36
Table
Table 1. Primer sequences used for cDNA probe preparation.
Gene
Plk-1
GeneBank accession n.
BC006880
Calmodulin-1
NM_009790
Calmodulin-2
BC051444
Calmodulin-3
BC050926
Primer sequence
Up5’GCTGCCCTACCTACGAACGTG3’
Low5’GAGGGCAGGGAAGCAGATGTAAAC3’
Up5’CCCGGTAGGCCTAGTGTTATGTCA3’
Low5’CCCCGTCAGAGAGGTGGTTAAATC3’
Up5’GCATTCCGTTTTGATAAGG3’
Low5’GTCCACAGTCCACGCAGAGTTACA3’
Up5’CGCTGTGTAATGTGCCGGTGATCT3’
Low5’AACCAAAATAAAACCCCGAAACA3’
Figure
Click here to download high resolution image
Figure
Click here to download high resolution image
Figure
Click here to download high resolution image
Figure
Click here to download high resolution image
Figure
Click here to download high resolution image
Figure
Click here to download high resolution image