MINIREVIEW
Minireview: Activin Signaling in Gonadotropes: What
Does the FOX say. . . to the SMAD?
Jérôme Fortin, Luisina Ongaro, Yining Li, Stella Tran, Pankaj Lamba, Ying Wang,
Xiang Zhou, and Daniel J. Bernard
Department of Pharmacology and Therapeutics (J.F., L.O., Y.L., S.T., P.L., Y.W., X.Z., D.J.B.), McGill
University, Montréal, Québec, Canada H3G 1Y6; The Campbell Family Cancer Research Institute (J.F.),
Ontario Cancer Institute, University Health Network, Toronto, Ontario, Canada M5G 2C1; Diabetes
Center (S.T.), Department of Medicine, University of California-San Francisco, San Francisco, California
94143; and Psychiatry (P.L.), St Mary Mercy Hospital, Livonia, Michigan 48154
The activins were discovered and named based on their abilities to stimulate FSH secretion and
FSH␤ (Fshb) subunit expression by pituitary gonadotrope cells. According to subsequent in vitro
observations, activins also stimulate the transcription of the GnRH receptor (Gnrhr) and the activin
antagonist, follistatin (Fst). Thus, not only do activins stimulate FSH directly, they have the potential to regulate both FSH and LH indirectly by modulating gonadotrope sensitivity to hypothalamic
GnRH. Moreover, activins may negatively regulate their own actions by stimulating the production of one of their principal antagonists. Here, we describe our current understanding of the
mechanisms through which activins regulate Fshb, Gnrhr, and Fst transcription in vitro. The activin
signaling molecules SMAD3 and SMAD4 appear to partner with the winged-helix/forkhead transcription factor, forkhead box L2 (FOXL2), to regulate expression of all 3 genes. However, in vivo
data paint a different picture. Although conditional deletion of Foxl2 and/or Smad4 in murine
gonadotropes produces impairments in FSH synthesis and secretion as well as in pituitary Fst
expression, Gnrhr mRNA levels are either unperturbed or increased in these animals. Surprisingly,
gonadotrope-specific deletion of Smad3 alone or with Smad2 does not impair FSH production or
fertility; however, mice harboring these mutations may express a DNA binding-deficient, but
otherwise functional, SMAD3 protein. Collectively, the available data firmly establish roles for
FOXL2 and SMAD4 in Fshb and Fst expression in gonadotrope cells, whereas SMAD3’s role requires
further investigation. Gnrhr expression, in contrast, appears to be FOXL2, SMAD4, and, perhaps,
activin independent in vivo. (Molecular Endocrinology 29: 963–977, 2015)
T
he activins are pleiotropic members of the TGF␤ superfamily but were discovered and named based on
their effects on FSH synthesis by pituitary gonadotrope
cells. Research groups led by Vale and Guillemin, fresh on
the heels of their successful purification of the inhibins
from porcine follicular fluid, identified 2 novel ligands
that we now call activin A and activin AB (1–3). These
proteins proved to be homo- or heterodimers of the newly
identified inhibin ␤-subunits. Despite (or perhaps because
of) their structural similarity, activins and inhibins re-
vealed themselves to be functionally antagonistic. That is,
when applied to rat pituitaries dispersed in culture, activins selectively stimulated FSH release with no effects on
LH, whereas inhibins suppressed FSH (2–5). Research
over the next decade established that activins produce
their effects, in large part, by stimulating expression of the
FSH␤ (Fshb) subunit gene (6 –9). Although inhibins function as bona fide endocrine hormones, activins appear to
act in autocrine or paracrine fashion, like most TGF␤
superfamily members.
ISSN Print 0888-8809 ISSN Online 1944-9917
Printed in USA
Copyright © 2015 by the Endocrine Society
Received December 29, 2014. Accepted April 29, 2015.
First Published Online May 5, 2015
Abbreviations: ACVR2, activin receptor type IIA; AP-1, activator protein-1; AR, androgen
receptor; BMPR2, bone morphogenetic protein receptor type II; BPES, blepharophimosisptosis-epicanthus-inversus syndrome; cKO, conditional knockout; DARE, downstream activin regulatory element; FBE, forkhead-binding element; FOXL2, forkhead box L2; Fshb,
FSH␤; Fst, follistatin; Gnrhr, GnRH receptor; GRAS, GnRHR-activating sequence; LHX,
LIM-homeodomain protein; MH, MAD homology domain; PTIX, paired-like homeodomain transcription factor; SBE, SMAD-binding element.
doi: 10.1210/me.2015-1004
Mol Endocrinol, July 2015, 29(7):963–977
press.endocrine.org/journal/mend
963
964
Fortin et al
Mechanisms of Activin Signaling in Gonadotropes
Activin B emerged as the gonadotrope cell-derived ligand most likely to stimulate FSH synthesis (10 –12). It
was also quickly appreciated that activins’ actions in gonadotropes were not limited to FSH synthesis. In particular, activins stimulated GnRH receptor (Gnrhr) expression (13, 14), suggesting a role for autocrine/paracrine
regulation of gonadotrope cell responsiveness to hypothalamic GnRH. At around the same time, activins were
observed to stimulate pituitary synthesis and secretion of
follistatin (Fst) (15, 16). Follistatins bind and bioneutralize activins (17, 18). Therefore, activins can stimulate the
Mol Endocrinol, July 2015, 29(7):963–977
production of their own endogenous antagonists via a
short feedback loop.
Research by many groups, predominantly using in vitro approaches, has uncovered candidate mechanisms through
which activins regulate transcription of the Fshb, Gnrhr, and
Fst genes. In this minireview, we first summarize these proposed mechanisms, particularly in rodents (Figure 1). Next, we
discuss more recent in vivo data from genetically modified mice
that both support and challenge current models of activin action in gonadotropes. Finally, we highlight new questions inspired by these and other in vivo observations.
Figure 1. Schematic representation of activin signaling in murine gonadotrope cells. Activin B (or a related ligand) produced by gonadotropes
acts in autocrine or paracrine fashion to stimulate Fshb, Gnrhr, and Fst transcription. The dimeric ligand binds complexes of type I/type II serine/
threonine receptor kinases. ACVR2 and perhaps BMPR2 are the most likely type II receptors in this system. ACVR1B (also known as ALK4) and
ACVR1C (ALK7) are the candidate type I receptors. Upon ligand binding, the type II receptors phosphorylate the type I receptors. The type I
receptors then phosphorylate the signaling molecules SMAD2 (S2) and SMAD3 (S3). These receptor-regulated SMADs then partner with the
common partner SMAD, SMAD4 (S4), and accumulate in the nucleus. According to in vitro models (pictured at the left of the nucleus), these
SMAD complexes partner with FOXL2 (F2) to regulate all 3 genes. Left top, In the murine Fshb promoter, SMAD3 partners with FOXL2 at a distal
FBE (FBE1); with SMAD2 and SMAD4 at a composite 8-bp SBE (SBEx2); with SMAD4 and FOXL2 at a proximal SBE/FBE3 composite element; and
perhaps with paired-like homeodomain transcription factors (PITX or P) at a proximal PITX-binding site. Also, pictured is the location of a
composite FBE2/SBE element, which may be unique to the porcine Fshb promoter (see Figure 2). Left middle, SMAD3 partners with DNA-bound
SMAD4 and FOXL2 at a composite response element referred to as GRAS to stimulate the murine Gnrhr promoter. An adjacent response element
called DARE, which binds LHXs, also mediates activin responsiveness but through currently unknown mechanisms. Left bottom, SMAD3 partners
with FOXL2 at an intronic enhancer in the rat Fst gene to mediate its activin induction. SMAD4’s role in the response is poorly defined. At the
right, The models have been revised to reflect the results of in vivo mouse knockout experiments. Right top, The model of Fshb regulation is largely
unchanged, with 2 exceptions: 1) SMAD2 has been removed, and 2) SMAD3 does not need to bind DNA to produce its effects, casting doubt on a
role for the 8-bp SBE (SBEx2). Right middle, SMAD4 and FOXL2 do not positively regulate murine Gnrhr. Whether the gene is activin regulated via
alternative mechanisms is unclear but appears doubtful. Right bottom, Both FOXL2 and SMAD4 regulate Fst transcription in gonadotropes. The
model has been revised to suggest that SMAD4 rather than SMAD3 binds the SBE in the enhancer and the relative location of the FBE is proposed
to be directly adjacent to, but 5⬘ of the SBE (see Figure 3).
doi: 10.1210/me.2015-1004
Activin Signaling In Vitro
Like other TGF␤ superfamily members, activins bind and
signal through heterotetrameric complexes of transmembrane type I and 2 type II serine/threonine kinase receptors (eg, Figure 1) (19, 20). Once activated (phosphorylated) by their type II partners, type I receptors
phosphorylate effector proteins in the homologs of Drosophila mothers against decapentaplegic (SMAD) family.
These so-called receptor-regulated SMADs then complex
with the common partner SMAD, SMAD4, and accumulate in the nucleus, where they act as transcription factors,
most often in association with DNA binding partners (21,
22). As reviewed in the next sections, this general model
seems to apply to activin regulation of Fshb, Gnrhr, and
Fst in immortalized gonadotrope-like cells. Moreover, the
same signaling proteins and DNA binding cofactor appear to mediate activin-induction of all 3 genes, at least in
vitro.
Activin induction of Fshb transcription
Activins can signal via either of 2 type II receptors,
activin receptor type IIA (ACVR2) or bone morphogenetic protein receptor type II (BMPR2), to stimulate Fshb
transcription in the immortalized murine gonadotropelike cell line, L␤T2 (23, 24). In contrast, the other canonical activin type II receptor, ACVR2B, appears dispensable for FSH synthesis (23, 24). It should be noted that
L␤T2 cells are the only differentiated gonadotrope cell
line available in any species (25) and have therefore provided the model for most research on Fshb transcriptional
regulation. Studies of Gnrhr and Fst have employed both
this and a second, less mature, murine gonadotrope-like
cell line, ␣T3-1 (25). Consistent with the cell line data,
FSH levels are reduced in Acvr2 knockout mice (26),
whereas BMPR2’s role in FSH synthesis in vivo has not
yet been reported.
Downstream of ACVR2A (and BMPR2?), activins can
signal through either of 2 type I receptors, ACVR1B or
ACVR1C, to regulate Fshb transcription (27). The relative importance of these receptors is presently unclear and
may be ligand specific, because activin B and AB can
engage both receptors, whereas activin A only signals via
ACVR1B (27, 28). Notably, activin A or B induction of
FSH secretion is preserved in cultured pituitaries of
Acvr1c knockout mice, suggesting that ACVR1B may be
the preferred type I receptor, or that it can compensate for
the loss of ACVR1C (29).
SMAD2 and SMAD3 are the canonical receptor-regulated SMADs downstream of activin type I receptors (22),
and SMAD3 appears most critical for regulation of rodent, porcine, and ovine Fshb promoter reporters in im-
press.endocrine.org/journal/mend
965
mortalized gonadotropes (30 –38). SMAD2’s role is less
well defined (30, 32, 34, 35). Phosphorylated SMAD3
typically partners with SMAD4 and accumulates in the
nucleus to regulate transcription (22). As revealed by
RNA interference-mediated knockdown studies, SMAD4
is required for activin induction of the murine and ovine
Fshb promoters (38, 39). Thus, the available in vitro evidence indicates that activins stimulate Fshb gene expression through a canonical type I/II receptor-SMAD3/4mediated signaling cascade (Figure 1).
Once in the nucleus, SMAD proteins recognize specific, but low affinity 4-bp SMAD-binding elements
(SBEs) (GTCT) in target gene promoters (22). A rarer, but
higher affinity site is formed by a palindromic arrangement of 2 minimal SBEs (GTCTAGAC), which can accommodate the simultaneous binding of 2 SMAD proteins (40, 41). The proximal Fshb promoters in rats and
mice contain this 8-bp SBE (labeled SBEx2 in Figure 1),
but it is notably absent in the orthologous promoters in
humans, sheep, and pigs. This suggests a species-specific
role for this cis-element in rodents. Indeed, activin induction of rodent Fshb promoters is reduced (by ⬃50%), but
not lost, when this site is mutated (33, 35, 42). Therefore,
whereas the 8-bp SBE may play a role in the overall amplitude of the promoter response in rodents, it is not necessary for activin-mediated transcription in any mammalian species investigated to date.
These observations motivated the search for additional
response elements conferring activin sensitivity (32–35,
42, 43). As reviewed previously (44), a major breakthrough came through the comparison of activin responsiveness of the human and porcine Fshb promoters. In
brief, the porcine promoter contains a high-affinity binding element, hereafter forkhead-binding element (FBE),
for the transcription factor forkhead box L2 (FOXL2),
and this site is adjacent to a 4-bp SBE (43). This particular
FBE (labeled FBE2 in Figure 1), which is unique to the
porcine Fshb promoter (Figure 2), is required for its pronounced activin sensitivity (43). Nonetheless, FOXL2
knockdown experiments in L␤T2 cells indicate a role for
the protein in activin’s regulation of murine Fshb (43). In
silico analysis identified a second, more proximal FBE
(labeled FBE3 in Figure 1). Importantly, this element is
conserved in Fshb promoters of pigs, mice, rats, and humans and, in all cases, is 5⬘ flanked by a minimal SBE.
According to the current model (Figure 1), this composite
SBE/FBE3 binds SMAD4 and FOXL2, which are linked
through their shared physical interactions with SMAD3
(37, 45, 46). Although only explored thus far in the porcine and murine Fshb promoters, it seems likely that this
represents a common mechanism of activin-regulated
Fshb transcription across mammalian species. However,
966
Fortin et al
Mechanisms of Activin Signaling in Gonadotropes
Mol Endocrinol, July 2015, 29(7):963–977
it is presently unclear whether or how
functional PITX/SMAD complexes
are formed on the Fshb promoter as
there are no SBEs in immediate proximity to the PITX-binding site.
Overall, signaling through SMAD/
FOXL2 complexes and their cognate
binding sites appears to represent a
fundamental mechanism underlying
activin induced Fshb transcription.
The contributions, if any, of PITX
proteins and perhaps other factors
(53–55) require more investigation.
Activin induction of murine
Gnrhr transcription
GnRH is a necessary and potent
regulator of gonadotropin synthesis
and secretion (eg, Refs. 56 –59). Gonadotrope cell responsiveness to
GnRH, in turn, is regulated by relative GnRHR expression, which varies under a variety of physiological
conditions (eg, Refs. 60, 61). The
main drivers of Gnrhr expression
are
GnRH itself (62– 64), steroid
Figure 2. The high-affinity FBE2 is unique to the porcine Fshb promoter. Bottom, Fshb/FSHB
promoter sequences from pig, human, sheep, and mouse were aligned to show the similarities
hormones (64, 65), and activins
and differences in the composite FBE2/SBE response element. There is a single base pair
(14). GnRH and activin regulation
difference at the first position in pig (T) relative to the other species (C). As described in Ref. 43,
of GnRHR protein expression in
this enables high-affinity binding of FOXL2 to the porcine, but not human, promoter. Top,
primary rat pituitary cultures apReplacement of the C with a T (C3 T) in human, ovine, and murine FSHB/Fshb promoter reporters
confers enhanced activin sensitivity in L␤T2 cells. The murine promoter differs at 2 bp from that of the
pears to involve distinct, but compig in FBE2. Introduction of the porcine base pairs into the murine promoter (CA3 TG) confers even
plementary, mechanisms (13, 66,
greater activin sensitivity than the C3 T base pair change alone. The data reflect the means (⫾SD or
67). This has been substantiated by
SEM) of 2 (human and sheep; n ⫽ 2) or 3 (mouse; n ⫽ 3) independent experiments, with treatments
performed in duplicate or triplicate. Note the break in the y-axis.
mechanistic analyses of the murine
Gnrhr promoter in ␣T3-1 and L␤T2
cells (7, 65, 66, 68 –71).
the relative spacing of the SBE and FBE3 may contribute
A tripartite enhancer in the murine Gnrhr 5⬘-flanking
to interspecies differences in activin sensitivity (43) as
might the presence of additional nonconserved FBEs that region is critical for transcriptional activity in gonadohave thus far been described in the human, murine, and trope-like cells (69). The enhancer includes binding sites
porcine promoters (Figures 1 and 2) (36, 37, 43, 46 – 48; for steroidogenic factor 1 (also known as NR5A1) and
activator protein-1 (AP-1) complexes (69, 72). Gnrhr
reviewed in Ref. 44).
In addition to FBE and SBE, a conserved binding site mRNA levels are markedly reduced in Nr5a1 knockout
for paired-like homeodomain transcription factors, such mice (73) as well as in mice harboring a mutation in the
as PITX1 and PITX2, is present in the Fshb/FSHB pro- AP-1 site (74). Therefore, the extant data confirm roles
moters of several species, including rodents and humans for steroidogenic factor 1 and AP-1 proteins (or at least
(Figure 1) (49, 50). Mutations that block PITX1 and the AP-1-binding site) in Gnrhr expression in vivo. The
PITX2 protein binding impair both basal and activin- third essential element of the enhancer is referred to as
stimulated Fshb transcription (35, 49 –51). PITX1/2 and GnRHR-activating sequence (GRAS) (5⬘-CTAGTCASMAD proteins physically interact and cooperatively ac- CAACA-3⬘) (Figure 1), which mediates activin induction
tivate the Fshb promoter. Moreover, depletion of endog- of the murine Gnrhr promoter in vitro (67). Its role in
enous PITX proteins impairs activin-stimulated Fshb activin regulation of Gnrhr in other species is less clear
transcription in L␤T2 cells (35, 37, 50, 52). Nevertheless, (75).
doi: 10.1210/me.2015-1004
SMAD3 and SMAD4 associate with the 5⬘-end of
GRAS with SMAD4 brokering direct DNA binding to the
sequence CTAGTC (Figure 1) (71). The latter 4 bp (underlined) resemble the reverse-complement of a consensus
SBE (AGAC). According to crystallographic data, the
base pair at the third position (T in GRAS and A in the
consensus sequence) does not contribute to SMAD binding (40, 76) and therefore may tolerate sequence variation. Activin and GnRH synergistically regulate Gnrhr
expression (66, 70, 71), and their cooperation depends on
an AP-1 site in GRAS (not shown in Figure 1 and distinct
from the AP-1 site described above), which partly overlaps with the SBE (70, 71). Remarkably, the 3⬘-end of
GRAS binds FOXL2. Moreover, SMAD3 induction of a
GRAS reporter requires FOXL2 binding (71). The putative FOXL2-binding site (CACAACA), which has not yet
been thoroughly characterized, resembles FBE3 in the
proximal Fshb promoter (CTAAACA; base pair differences are underlined). Therefore, in both Gnrhr and Fshb,
composite SBE/FBE sites in the 5⬘-flanking region mediate
activin responsiveness. In both cases, SMAD4 and
FOXL2 are predicted to bind DNA directly, with SMAD3
mediating their interaction.
As mentioned, GRAS contains an AP-1 element between the SBE and FBE that plays a role in activin/GnRH
synergism. No such AP-1 site has been described within
the SBE/FBE3 of Fshb, but the promoter is similarly synergistically regulated by activin and GnRH (eg, Refs. 7,
32, 77, 78). In the case of the human FSHB promoter, this
involves cooperation between SMAD and AP-1 proteins
acting via an AP-1-binding site just 3⬘ of SBE/FBE3 (78).
A definitive role for the FOXL2 protein or FBE3 in activin
or activin/GnRH induction of human FSHB promoter
activity has yet to be established (43, 47). However,
SMADs, FOXL2, and AP-1 proteins, acting at least in
part via the SBE/FBE3, may mediate activin/GnRH synergistic regulation of murine Fshb (46). Thus, there appear to be similar mechanisms of activin action on the
murine Fshb and Gnrhr promoters.
Nonetheless, there are notable differences. Activins
regulate murine Fshb via an 8-bp SBE as well as a more
distal FBE (FBE1 in Figure 1), which lacks an adjacent
SBE (36, 46, 47). Moreover, although PITX proteins also
regulate Gnrhr gene transcription (79, 80), they have not
been implicated in activin induction. The murine Gnrhr
promoter contains an additional cis-element called downstream activin regulatory element (DARE), which is located 16-bp 3⬘ of GRAS (Figure 1). DARE is necessary for
activin induction of Gnrhr transcription in ␣T3-1 cells
(75). DARE contains 2 TAAT motifs, which can bind
LIM-homeodomain proteins (LHXs) 2 and 3 (LHX2/3)
(81). At present, it is unclear whether or how LHX pro-
press.endocrine.org/journal/mend
967
teins mediate activin responses. Interestingly, LHX3 can
also regulate the Fshb/FSHB promoters in pigs and humans, but its binding sites are not required for activin
induction of porcine Fshb (82).
Collectively, the data suggest that activin regulates murine Gnrhr promoter activity in ␣T3-1 cells via at least 2
promoter elements, GRAS and DARE (Figure 1). GRAS
binds complexes of SMAD3, SMAD4, and FOXL2,
whereas the specifics of DARE’s role in activin responsiveness are less clear. It is noteworthy that neither GRAS
nor DARE is conserved in other species, including rat.
Furthermore, activin negatively regulates Gnrhr expression in primary ovine pituitary cells (83– 85). Therefore,
the effects of activins on Gnrhr expression and their underlying regulatory mechanisms may be species specific.
Activin induction of rat Fst transcription
In the anterior pituitary, Fst is principally expressed by
2 cell types, gonadotropes and folliculostellate cells. Activin A stimulates Fst mRNA expression in cultured rat
pituitary cells and this effect appears to be specific to the
gonadotrope cell population (86, 87). Consistent with
this idea, activins stimulate Fst transcription in ␣T3-1
cells (88). This model has therefore been exploited to
decipher the underlying molecular mechanisms. Unlike
Fshb and Gnrhr, the primary activin-responsive element
in rat Fst, at least in the gonadotrope cell context, maps to
an enhancer at the 3⬘-end of intron 1 rather than in the
proximal promoter (Figure 1) (88, 89). Importantly, in
nongonadotropes (HepG2 and HEK293T cells), activin A
induces human FST and rat Fst transcription via the proximal promoter (45, 90). Therefore, activin’s actions on
Fst in gonadotropes may be via cell type-specific
mechanisms.
These mechanisms once again appear to involve
SMADs and FOXL2. The rat Fst intronic enhancer contains an SBE (88) and a nearby FBE (Figure 1) (45). The
precise location and nature of the latter has not yet been
characterized, but activin stimulates the recruitment of
both SMAD3 and FOXL2 to the enhancer in ␣T3-1 cells
(45, 88). According to both knockdown and overexpression analyses, SMAD3 but not SMAD2, mediates activin’s actions on Fst transcription. SMAD4’s role, if any,
has not been investigated thoroughly in vitro (Figure 1)
(45). Although mechanisms of murine Fst transcription
have not been reported, the high sequence identity of the
intronic enhancer suggests that they are likely to be conserved with those of rat.
In the Fshb and Gnrhr promoters, the SBEs and FBEs
are in close proximity. In contrast, the SBE is 17- to 24-bp
5⬘ of the putative FBE (ACATTGAT) in the Fst intronic
enhancer. This FBE was mapped computationally (rather
968
Fortin et al
Mechanisms of Activin Signaling in Gonadotropes
Mol Endocrinol, July 2015, 29(7):963–977
Figure 3. FOXL2 binds regulatory sequences in Fshb, Gnrhr, and Fst. Nuclear extracts from
heterologous Chinese hamster ovary cells expressing murine FLAG-FOXL2 were incubated with a
radiolabeled double-stranded probe corresponding to ⫺185/⫺145 of the porcine Fshb promoter,
which contains the high-affinity FBE2 (see Figure 2). As reported previously (43), FOXL2 forms a
specific complex with the probe when resolved on a nondenaturing polyacrylamide gel (lane 1;
labeled at extreme right). The complex contains FLAG-FOXL2 as indicated by the supershifted
complexes observed when antibodies against the FLAG tag (lane 18) or FOXL2 (lane 19) are
included in the mix (labeled at right). Binding is dose dependently competed when an unlabeled
form of the same probe is included at 50-, 100-, 500-, or 1000-fold molar excess relative to the
radiolabeled probe (lanes 2–5). Similarly, unlabeled double-stranded DNA probes containing FBE3
in pig (lanes 6 –9) or mouse (lanes 10 –13), GRAS from murine Gnrhr (lanes 21–24), the rat Fst
intronic enhancer (lanes 25–28), or the Fst enhancer containing mutations in the putative FBE
(lanes 33–36) also compete for binding, indicating that they too contain intact FOXL2-binding
sites. A probe containing the putative consensus FOXL2-binding site (lanes 14 –17) (Ref. 91) fails
to compete for binding, suggesting that it lacks a true FOXL2 binding sequence. A Fst
enhancer probe containing a mutation in what we predict to be the actual FBE is
impaired in its ability to compete for binding (lanes 29 –32). Probe sequences (sense
strand only) are shown, putative FBEs are underlined, and mutated base pairs are shown
in lower case: porcine FBE2, TTATTTTTCCTGTTCCACTGTGTTTAGACTACTTTAGTAAG;
porcine FBE3, CCTGTCTATCTAAACACTGATTCACTTACAG; murine FBE3,
GCTTGATCTCCCTGTCCGTCTAAACAATGATTCCCTTTCAG; consensus FBE,
CCTGTCACGGTCAAGGTCACTATCACTCAC; GRAS, TTTTGTATCTGTCTAGTCACAACAGTTTTT;
Fst, GCTGCACGTGTTGTGTCTGGGTCACTGGTAACTGACATTGATATGGCTAG; Fst T-⬎C,
GCTGCACGcGTTGTGTCTGGGTCACTGGTAACTGACATTGATATGGCTAG; and Fst FBEmut,
GCTGCACGTGTTGTGTCTGGGTCACTGGTAACTGACAcaGcTATGGCTAG.
than experimentally) based on its apparent similarity to a
recently described “consensus” FOXL2-binding site
(GT[c/g]AAGG) (91). This site bears little resemblance to
the FBEs in Fshb or Gnrhr, nor to other known forkhead
factor binding sequences. Mutations in the putative FBE
in Fst attenuate but do not block activin-induced reporter
activity in ␣T3-1 cells (45). Given the incomplete effects
of these mutations, the relative distance between the SBE
and the putative FBE, and concerns about the veracity of
the consensus FOXL2-binding site (91), we examined
FOXL2 binding to the putative Fst FBE by electrophoretic
mobility shift assays. As shown in Figure 3, a probe containing the consensus FOXL2-binding site from Ref (91).
was unable to compete for FOXL2 binding to a probe
containing FBE2 from the porcine Fshb promoter (lanes
14 –17) (43). This contrasts with porcine and murine Fshb
probes containing their respective FBE3 sequences (lanes
6 –13); a probe containing the FBE in GRAS (of murine
Gnrhr, lanes 21–24); and a probe containing the activin
responsive region of the rat Fst intron 1 (lanes 25–28),
which could all dose dependently compete for FOXL2
binding (Figure 3). A mutation (Mut#2 from Ref. 45) that
impairs activin responsiveness and is presumed to block
FOXL2 binding had no effect on the
Fst probe’s ability to compete for
binding to FOXL2 (lanes 33–36).
This suggests that FOXL2 binds the
Fst enhancer, but perhaps not via the
sequence presumed to be the FBE.
We noted that the sequence immediately 5⬘ of the SBE, TGTTGTG, resembles FBE3 in the Fshb promoter,
TGTTTAG (reverse complement of
CTAAACA), and therefore questioned whether it might actually mediate FOXL2 binding. Indeed, introduction of a mutation to the first
position (T to C) impaired competition and therefore FOXL2 binding
(Figure 3, lanes 29 –32). Clearly,
more work is needed to characterize
the mechanisms through which
FOXL2 binds and regulates the Fst
intronic enhancer, but the early indications are that it too may contain
a composite FBE/SBE element.
FOXL2/SMAD Regulation
of Activin Target Genes in
Mice
The 3 classic targets of activin signaling in gonadotropes (Fshb, Gnrhr, and Fst) appear to
share the same transcriptional regulators, in particular
FOXL2, SMAD4, and SMAD3 (Figure 1). It is important
to note, however, that the above described in vitro analyses were conducted principally in 2 cell lines, ␣T3-1 and
L␤T2, using promoters or enhancers from a relatively
small number of mammalian species. Although these reagents have enabled detailed analyses, their limited number and variety raises legitimate questions about how accurately they model transcriptional mechanisms in
nontransformed gonadotropes (eg, Refs. 92–96). Although not unique to this system, there are also concerns
that cultured cells might not accurately model cell function in the context of intact tissues and physiological systems (77, 97, 98). It is therefore imperative to probe the
involvement of FOXL2 and SMAD proteins in gonadotrope function in vivo.
FOXL2 regulates Fshb and Fst, but not Gnrhr,
expression in vivo
Humans harboring inactivating mutations in the
FOXL2 gene suffer from blepharophimosis-ptosis-epi-
doi: 10.1210/me.2015-1004
canthus-inversus syndrome (BPES), which is characterized by craniofacial defects with (type I) or without (type
II) premature ovarian failure (99, 100). Although FOXL2
is expressed in human gonadotrope cells (101, 102),
women with BPES type I typically exhibit elevated FSH
(eg, Refs. 100, 103). Although this might suggest that
FOXL2 is dispensable for FSH synthesis in humans, it is
important to note that only a single FOXL2 allele is affected in these patients. Therefore, the loss of both alleles
might be required to observe the predicted declines in FSH
synthesis. To our knowledge, only 2 families harboring
homozygous FOXL2 mutations have been described and
the particular mutations do not cause a complete loss of
protein function (104 –106). Therefore, in the absence of
human clinical insight into FOXL2’s role in FSH synthesis
in vivo, investigators have employed genetic mouse models. These mice not only provide the opportunity to assess
effects of loss of Foxl2 (and other gene) function on circulating FSH levels but also permit the investigation of the
corresponding consequences for pituitary Fshb, Gnrhr,
and Fst mRNA expression.
The single exon Foxl2 gene has been deleted in mice
using conventional and conditional gene targeting approaches. Homozygous Foxl2 knockout mice die soon
after birth (107, 108). Those that survive are generally
unhealthy, rarely live beyond 5 weeks postnatally, and
exhibit ovarian dysgenesis. Nonetheless, at embryonic
day 18.5, pituitary Fshb mRNA levels are significantly
reduced in knockouts relative to age-matched controls
(46). There is also a nonsignificant trend for reduced Gnrhr expression in these animals (Fst data were not reported). At 3 weeks of age, female Foxl2 knockouts exhibit significant reductions in pituitary expression of
Fshb, Gnrhr, and Fst (109). However, they also show
profound defects in Gh and prolactin (Prl) expression. As
neither somatotrope nor lactotrope cells express Foxl2, at
least some pituitary phenotypes in these mice may be noncell autonomous.
Indeed, the selective deletion of Foxl2 in gonadotropes
using a Cre/lox approach causes reductions in Fshb and
Fst, but not Gnrhr, Gh, or Prl, mRNA levels in both adult
males and females (110). These conditional knockout
(cKO) mice are subfertile, with females producing smaller
litters at reduced frequencies relative to controls. Circulating FSH levels are markedly reduced in both male and
female Foxl2 cKOs, whereas LH is reduced in males and
increased in females. Increased LH secretion in females
and normal Lhb expression in both sexes are consistent
with intact GnRH signaling in these mice. FSH and LH
secretion appear normal in mice in which only a single
Foxl2 allele is deleted in gonadotropes (Figure 4). These
observations are consistent with the absence of FSH de-
press.endocrine.org/journal/mend
969
Figure 4. Serum FSH is reduced in male mice lacking 2, but not 1,
Foxl2 allele in gonadotrope cells. Blood was collected from 8- to 10week-old males with 2 intact (floxed) Foxl2 alleles (fx/fx, n ⫽ 8), or 1
(Cre⫹;fx/⫹, n ⫽ 5) or 2 (Cre⫹;fx/fx, n ⫽ 10) Foxl2 alleles selectively
deleted in gonadotrope cells. GRIC mice were used as Cre drivers
(142). Serum FSH (green) and LH (red) were measured by ELISA at the
UVA Ligand Assay Core. Data are mean ⫾ SEM. Note the break in the
y-axis.
ficiency in BPES patients who, as noted above, usually
carry only 1 mutated FOXL2 allele.
Collectively, these data indicate that FOXL2 is required for Fshb and Fst mRNA expression in murine gonadotropes in vivo. A single functional copy of the gene is
sufficient to maintain FSH synthesis in mice (Gnrhr and
Fst were not measured in these animals). This might explain the absence of FSH deficiency in humans with loss
of function mutations in only 1 FOXL2 allele. In contrast
to the in vitro data (see above), gonadotrope Gnrhr expression may be FOXL2 independent in vivo.
SMAD4 is required for Fshb and Fst, but not
Gnrhr, expression in vivo
As reviewed above, SMAD4 mediates activin-regulated Fshb and Gnrhr, but perhaps not Fst, transcription
in vitro. Data from mice with a conditional deletion of
Smad4 specifically in gonadotropes (Smad4 cKO) both
support and challenge these observations (111). Smad4
cKO mice are hypogonadal and females are subfertile.
Both male and female cKOs exhibit markedly reduced
circulating FSH levels and pituitary Fshb mRNA expression (111). Serum LH is reduced in Smad4 cKO males, but
not females, which is similar to the phenotype of Foxl2
cKO mice. Counter to the a priori prediction, pituitary
Gnrhr mRNA levels were actually increased in Smad4
cKOs relative to controls. Originally, we reported no effect of the Smad4 deletion on Fst expression in pituitaries
of males and only a small decrease in females. Although
these observations were seemingly consistent with the in
970
Fortin et al
Mechanisms of Activin Signaling in Gonadotropes
vitro data, we subsequently discovered a technical problem with the Fst primers used in the mRNA analysis.
When the assays were repeated with new primers and
archival material, we observed marked reductions in Fst
mRNA expression in both male and female Smad4 cKO
mice relative to controls. Therefore, loss of SMAD4 impairs both Fshb and Fst, but not Gnrhr, mRNA expression in vivo.
At present, the mechanisms mediating the nearly
2-fold increase in pituitary Gnrhr mRNA levels in Smad4
cKO mice are unclear. It seems unlikely that SMAD4
actively represses Gnrhr expression in vivo, although no
existing data formally reject this possibility. Perhaps increased Gnrhr reflects enhanced GnRH release and signaling due to reduced steroid negative feedback. Female
Smad4 cKOs show impaired ovarian follicle development. Because FSH stimulates granulosa cell proliferation
and estradiol production, one might expect these animals
to be hypoestrogenemic. However, neither uterine
weights nor serum estradiol levels (on metestrus/diestrus)
differ between cKOs and controls. Perhaps analyses on
other days of the estrous cycle, particularly when estradiol levels are normally elevated (afternoon of proestrus)
might reveal estrogen deficiency in these animals.
The data in males are more difficult to reconcile at
present. Both serum testosterone and seminal vesicle
weights appear normal in Smad4 cKOs relative to controls. Therefore, it is not clear that a loss of testosterone
negative feedback on GnRH secretion explains the increase in Gnrhr expression. However, endocrine regulatory mechanisms are clearly altered in these mice. First,
testosterone levels are normal in the face of reduced serum
LH. Second, LH secretion is reduced, even though Gnrhr
expression (and presumably GnRH signaling?) is increased. Male, but not female, Smad4 cKO mice exhibit
reduced gonadotropin ␣-subunit (Cga) expression, which
could explain their reduced LH secretion. SMAD4’s role
in gonadotrope Cga expression has not been explored to
our knowledge; however, activin A suppresses murine
Cga promoter activity in ␣T3-1 cells (112). If this reflects
activin action in vivo, then it would appear to be independent of, if not impaired by, SMAD4. Along these lines,
SMAD3 potentiates the actions of the androgen receptor
(AR) in prostate cancer cells, but this synergism is antagonized by SMAD4 coexpression (113). Androgens also
repress CGA transcription in ␣T3-1 cells (114). It is therefore possible that SMAD3 and the AR cooperatively inhibit Cga expression and that this activity is normally
attenuated by SMAD4. In the absence of SMAD4,
SMAD3/AR could repress Cga expression more readily.
The effect might be sex specific, in turn, because of higher
androgen levels in males than females. Although such a
Mol Endocrinol, July 2015, 29(7):963–977
mechanism might explain Cga suppression in male
Smad4 cKO mice, the mechanism of their enhanced Gnrhr remains a mystery.
The combined activities of FOXL2 and SMAD4 are
required for pituitary Fshb, but not Gnrhr,
expression in vivo
Based on in vitro analyses of activin-regulated Fshb,
Gnrhr, and Fst, the phenotypes of gonadotrope-specific
Foxl2 or Smad4 knockout mice have been eye opening.
First, Foxl2 cKO and Smad4 cKO mice have greatly reduced FSH as expected, but they do not lack FSH entirely
and females remain (sub)fertile in most cases. Second,
Smad4 cKO mice have reduced Fst expression, although
SMAD4 was not previously implicated in activin regulation of this gene in gonadotrope-like cell lines. Third,
neither the loss of Foxl2 nor Smad4 causes decreases in
Gnrhr expression, as would be expected based on their
cooperative actions at the GRAS element in vitro (Figure
1). In the case of Fst, more mechanistic research will be
needed to identify how and where SMAD4 produces its
action(s). For both Fshb and Gnrhr, residual or maintained expression could reflect compensatory mechanisms. That is, in the murine Fshb promoter, there are
cis-elements where FOXL2 can act independently of
SMAD4 (FBE1 in Figure 1) and at least 1 where SMAD4
might function independently of FOXL2 (SBEx2 in Figure 1). These residual actions may be sufficient to maintain some activin-stimulated Fshb expression. In the case
of the Gnrhr promoter, it is possible that SMAD3 might
compensate for the absence of SMAD4 at the 5⬘-end of
GRAS in Smad4 cKO mice. In Foxl2 cKO mice, SMADs
and AP-1 proteins might compensate for the absence of
FOXL2 binding at the 3⬘-end of GRAS. The simultaneous
deletion of Foxl2 and Smad4 in gonadotropes should,
therefore, preclude these compensatory/redundant
mechanisms.
Indeed, the reproductive phenotype of Smad4/Foxl2
cKO mice is more dramatic than that of either Smad4
cKO or Foxl2 cKO mice (111). In many ways, these mice
resemble Fshb knockouts (115). Female Smad4/Foxl2
cKOs are sterile, lack estrous cyclicity, and exhibit an
arrest in ovarian follicle development at the early antral
stage. Their FSH deficiency is also more pronounced than
in the single knockout mice lines. Once again, however,
these animals fail to show any impairment in Gnrhr
mRNA levels, raising serious doubts about a role for
GRAS in receptor expression. A more definitive conclusion regarding GRAS’s role in vivo could be obtained by
disrupting the element in transgenic mice.
Notably, the double knockout mice have a pituitary
Gnrhr phenotype (ie, no change relative to control) more
doi: 10.1210/me.2015-1004
similar to single Foxl2 than Smad4 cKOs. Smad4/Foxl2
cKO females have thread-like uteri suggestive of hypoestrogenemia. They also do not ovulate and lack corpora
lutea, suggesting that their progesterone levels are also
low. In mice, GnRHR levels depend on both GnRH and
gonadal steroids (62, 63, 116). Therefore, loss of steroid
negative feedback and consequent increased GnRH release will not lead to up-regulated GnRHR levels (as they
do in rats), if steroid levels are below a certain threshold
level. Therefore, we postulate that in Smad4 cKO mice,
steroid levels are reduced, but sufficient to synergize with
enhanced GnRH release to drive increases in Gnrhr expression. In Foxl2 or Foxl2/Smad4 cKO mice, steroid
levels may be below the threshold required for these synergistic actions. The increased Lhb mRNA expression in
Smad4/Foxl2 cKOs, however, is consistent with enhanced GnRH secretion. We acknowledge that these explanations are speculative and that other possibilities
must also be considered.
An uncertain role for SMAD3 in Fshb expression in
vivo
SMAD3 is arguably the linchpin in activin-regulated gene
expression in gonadotropes. It is the protein that most
clearly links activin receptor binding to transcriptional activation. SMAD3 is phosphorylated by the type I receptor and
then accumulates in the nucleus where it binds DNA either
directly (eg, at the 8-bp SBE in the Fshb promoter) or via its
interactions with SMAD4 and/or FOXL2 (in Fshb, GRAS in
Gnrhr, and the Fst intronic enhancer) (Figure 1). Without
SMAD3, there is no (obvious) link between receptor complex activation and SMAD4 or FOXL2, because there is no
evidence that either protein is directly regulated by activin
receptors. Therefore, a priori, one would predict that the
loss of Smad3 in gonadotropes should produce effects comparable with, if not more extreme than, the combined deletion of Smad4 and Foxl2.
Surprisingly, however, circulating FSH levels, pituitary
Fshb expression, and fertility are unimpaired in mice with
a targeted deletion of Smad3 in gonadotropes, either
alone or in combination with Smad2 (Smad2/3 cKO)
(117). Cre-mediated recombination removes exons 2 and
3 of the 9 exon Smad3 gene in these mice. However, they
exhibit a 2-fold up-regulation of a Smad3 transcript,
which contains exon 1 spliced to exons 4 through 9. Although translation starting in exon 1 should cause a
frame-shift mutation and the absence of most of the
SMAD3 protein, alternative translation can commence
from a consensus Kozak sequence in exon 4. The resulting
protein lacks the N-terminal MAD homology domain
(MH)1, which binds DNA, but contains the entirety of
the C-terminal MH2 domain. The SMAD3 MH2 domain
press.endocrine.org/journal/mend
971
is phosphorylated by the type I receptor (118) and mediates the interactions with SMAD4 (119 –121) and
FOXL2 (45, 71). Although we do not yet known whether
a truncated SMAD3 protein is expressed in gonadotropes
of these mice or whether it actually reflects a naturally
occurring variant of the protein (122), it can activate the
Fshb promoter equivalently to full-length SMAD3 in
vitro (117). These data indicate that, in mice, SMAD2 is
dispensable for FSH synthesis and that, if required,
SMAD3 does not need to bind DNA directly to regulate
Fshb transcription. This result is somewhat surprising, as
stimulation of the murine Fshb promoter through the
8-bp SBE requires direct binding of both SMAD3 and
SMAD4 and this element contributes to overall activin
sensitivity in vitro (33). In contrast, regulation through
the composite SBE/FBE3, which preferentially binds
SMAD4, should be maintained in Smad2/3 cKO mice, as
the truncated SMAD3 would still be activated by the type
I receptor and interact with SMAD4 and FOXL2.
Neither pituitary Fst nor Gnrhr expression were measured in Smad2/3 cKO mice. According to in vitro observations, however, one would predict impaired Fst expression, as SMAD3 binds the intronic enhancer. Regardless,
Fst deficiency in Smad4 cKO mice suggests that SMAD4
might be the preferred DNA binding partner for FOXL2
in Fst as it is in Fshb. Here too, the truncated SMAD3
could provide a bridge between the DNA-bound SMAD4
and FOXL2. This idea can be tested readily in vitro (45),
although it would also be valuable to assess Fst expression
in pituitaries of these mice. It seems unlikely that Gnrhr
expression is impaired in Smad2/3 cKOs in light of the
observations in Foxl2 and Smad4 cKOs. Moreover, LH
secretion is normal in Smad2/3 cKO females and is rapidly inhibited by a GnRHR antagonist (Figure 5A), indicating intact GnRHR signaling.
Collectively, these data show that SMAD2 is dispensable for murine Fshb expression in vivo, contrary to earlier in vitro results (30). Moreover, if SMAD3 does mediate activin induction of the Fshb and Fst genes in
gonadotropes, it can do so via protein-protein interactions rather than through direct DNA binding. This too is
inconsistent with current in vitro models. It seems unlikely that SMAD2 or SMAD3 plays a significant role, if
any, in pituitary Gnrhr expression. Definitive conclusions
regarding SMAD3 function in gonadotropes must await
the development of a new model that effectively and completely silences the gene.
Summary and Future Directions: The
Known Knowns and Known Unknowns
As summarized in Figure 1, the results of recent in vivo
experiments in genetically modified mice require us to
972
Fortin et al
Mechanisms of Activin Signaling in Gonadotropes
Figure 5. GnRHR signaling and expression are activin independent.
A, Intact adult female wild-type or gonadotrope-specific Smad2/3
knockout (S2/3 cKO) mice were treated sc with 3-mg/kg body weight
of the GnRHR antagonist, Antide, or with vehicle. After 8 hours, blood
was collected and serum LH measured by ELISA. Antide potently
suppressed LH release in both genotypes. B, Pituitaries from adult wildtype male and female mice were dispersed and cultured. The next day,
cells were treated with the indicated ligands or inhibitors in low serum
(2%) medium overnight. RNA was collected; Fshb and Gnrhr mRNA
concentrations were determined by RT-qPCR. Data are from a single
experiment with treatments performed in quadruplicate (mean ⫾
SEM). Male and female data were comparable and therefore pooled
for analysis. Both exogenous activin A and B stimulated Fshb mRNA
levels, whereas follistatin-288 and the type I receptor inhibitor,
SB431542, abolished Fshb expression. The latter results suggest that
an endogenous TGF␤ superfamily ligand that signals via ACVR1B,
ACVR1C, or TGFBR1 is the main driver of Fshb expression in cultured
murine gonadotropes. None of the treatments affected Gnrhr mRNA
levels, suggesting that receptor expression is independent of activin
signaling, at least in culture and under these experimental conditions.
Mol Endocrinol, July 2015, 29(7):963–977
genes in adulthood should address this concern, it remains possible (if not probable) that FOXL2 and SMAD4
directly and indirectly regulate Fshb and Fst expression
via mechanisms we have yet to discover. Systems level
analyses (eg, chromatin immunoprecipitation-sequencing) could undercover novel binding sites through which
the proteins independently and cooperatively regulate
transcription of these or upstream genes. Such analyses
may also reveal how SMAD4 regulates the Fst gene, if not
through the intronic enhancer. Combined with expression analyses (123), we are poised to identify networks of
activin-, FOXL2-, and SMAD4-regulated genes that go
well beyond the currently appreciated short list of targets
in gonadotropes.
modify existing models of activin signaling in gonadotrope cells. The extant data allow us to reach the following firm conclusions: 1) FOXL2 and SMAD4 are essential
regulators of Fshb and Fst, but not Gnrhr, expression by
gonadotropes; 2) SMAD2 is dispensable for Fshb, Gnrhr,
and Fst expression by gonadotropes; 3) if SMAD3 regulates Fshb, Gnrhr, or Fst expression in vivo, it can do so
independently of its DNA binding activity; 4) at least 1
TGF␤ superfamily ligand (activin B?) is an essential regulator of FSH synthesis in mice; and 5) this ligand may
play a more fundamental role than GnRH in FSH regulation. Below, we briefly elaborate on a few of these conclusions and consider some additional questions they
raise.
Is Gnrhr an activin target gene in gonadotropes?
Although in vitro data indicate that murine Gnrhr is a
bona fide activin target gene, the in vitro data suggest
otherwise. At a minimum, the normal, if not enhanced,
Gnrhr expression in Foxl2- and Smad4-deficient mice indicate that the GRAS regulatory sequence is unlikely to
play a major role in transcription of this gene. Although
activins might signal independently of FOXL2 or
SMAD4, this possibility is undermined by the phenotype
of Acvr2 knockout mice, which show reduced Fshb but
normal Gnrhr expression (124). Moreover, in cultured
murine pituitary cells, activin B or a related ligand is the
principal driver of Fshb expression. As we showed previously (24), antagonism of this ligand with either follistatin-288 or an inhibitor of activin type I receptors,
SB431542 (125), abolishes Fshb expression (Figure 5B).
The same treatments, however, have no effect on Gnrhr
expression. Exogenous activin A or activin B, at concentrations sufficient to stimulate Fshb, also fail to alter Gnrhr expression in these cultures (Figure 5B). These latter
experiments, which were performed on pituitaries of
wild-type mice, rule out compensatory mechanisms that
might occur in the existing knockout models. Therefore,
we conclude that Gnrhr is not an activin response gene in
murine gonadotropes.
Do FOXL2 and SMAD4 play necessary roles in
activin signaling in vivo?
Although it is clear that Fshb and Fst expression are
impaired in gonadotropes of Foxl2 or Smad4 cKO mice,
these results raise more questions than they answer. For
example, can we assume that the observed results derive
from specific impairments in activin-induced gene transcription? It is important to remember that both genes
were deleted during embryonic life, which could have
affected gonadotrope development in ways we do not
currently appreciate. Although conditional deletion of the
Is activin B the relevant TGF␤ ligand regulating
Fshb (and Fst) in gonadotropes?
FSH deficiency in Acvr2 (26) and gonadotrope-specific
Smad4 knockout mice (111) suggests an essential role for
TGF␤ superfamily signaling in Fshb expression. These
results alone, however, do not implicate activin B as the
relevant ligand. 1) Several TGF␤ ligands bind ACVR2
(eg, Refs. 126 –128), and SMAD4 mediates the actions of
all ligands in the family. 2) Mice deficient in activin B have
increased, rather than reduced FSH levels (129). 3) And
pituitaries from mice lacking 1 of the 2 activin type I
doi: 10.1210/me.2015-1004
receptors, ACVR1C, show normal basal and activin Bstimulated FSH release in culture (29). Thus, either activin B is not the primary ligand driving FSH synthesis in
vivo, or there are additional ligands that compensate in its
absence or act redundantly. The identities of these ligands
(and their type I receptor[s]) are presently unknown; however, they would clearly depend on ACVR2 and SMAD4
to mediate their actions. The results of experiments such
as those in Figure 5B also indicate that the ligand(s) can be
antagonized by follistatin-288 and signal(s) through one
(or more) of type I receptors blocked by SB431542. An
important challenge for the field will be to identify the
relevant ligand(s) and corresponding type I receptor(s).
What are the relative roles of activins (or activinlike ligands) and GnRH in FSH synthesis?
The recent cKO data in mice force us to revisit questions regarding the relative roles of TGF␤ superfamily
and GnRH signaling in FSH synthesis. Hpg mice (which
lack GnRH) and Gnrhr knockout mice are gonadotropin
deficient (130 –132), clearly indicating that GnRH signaling is required for FSH synthesis in this species. At the
same time, FSH deficiency in Smad4/Foxl2 cKO mice suggests a vital role for activin (TGF␤ superfamily) signaling
(110, 111). How can we reconcile these observations?
There is no clear answer at present. It is possible that
GnRH signaling is critical during reproductive development, but FSH becomes more dependent on activin-like
signaling later in life. Consistent with this idea, GnRHR
antagonists are more effective in inhibiting LH than FSH
secretion in adulthood (eg, Refs. 133, 134). Another possibility is that GnRH regulates Fshb transcription via
FOXL2 and SMAD4. To our knowledge, however, there
is no evidence that GnRH signals directly to the Fshb
promoter via either of these proteins (39, 43). This said,
both newer and older data suggest that GnRH may stimulate FSH indirectly via regulation of TGF␤ superfamily
ligands and/or their antagonists (135–139). Future efforts, particularly in vivo, should be committed to determining the extent to which GnRH regulation of FSH depends on activins or other members of the TGF␤
superfamily.
Overall, accumulating evidence from experiments in
model cell lines and genetically modified mice indicate a
prominent role for activin-like signaling in the regulation
of FSH synthesis and fertility. Assuming the underlying
mechanisms are conserved in humans, it is tempting to
speculate that components of the activin signaling cascade may represent promising targets for the selective
regulation of FSH in the treatment of reproductive disorders, including anovulation and polycystic ovary syndrome (140, 141).
press.endocrine.org/journal/mend
973
Acknowledgments
We thank Dr Ulrich Boehm, Dr Mathias Treier, Dr Chu-Xia
Deng, Dr Jonathan Graff, and Dr Michael Weinstein for their
collaboration on the various conditional knockout studies.
Address all correspondence and requests for reprints to:
Daniel J. Bernard, PhD, Department of Pharmacology and
Therapeutics, McGill University, McIntyre Medical Building,
Room 1315, 3655 Promenade Sir William Osler, Montréal,
Québec, Canada H3G 1Y6. E-mail: [email protected].
This work was supported by Canadian Institutes of Health
Research Operating Grants MOP-89991, MOP-123447, and
MOP-238760 (to D.J.B.).
Disclosure Summary: The authors have nothing to disclose.
References
1. Ling N, Ying SY, Ueno N, et al. A homodimer of the ␤-subunits of
inhibin A stimulates the secretion of pituitary follicle stimulating
hormone. Biochem Biophys Res Commun. 1986;138:1129 –1137.
2. Ling N, Ying SY, Ueno N, et al. Pituitary FSH is released by a
heterodimer of the ␤-subunits from the two forms of inhibin. Nature. 1986;321:779 –782.
3. Vale W, Rivier J, Vaughan J, et al. Purification and characterization
of an FSH releasing protein from porcine ovarian follicular fluid.
Nature. 1986;321:776 –779.
4. Ling N, Ying SY, Ueno N, Esch F, Denoroy L, Guillemin R. Isolation and partial characterization of a Mr 32,000 protein with inhibin activity from porcine follicular fluid. Proc Natl Acad Sci USA.
1985;82:7217–7221.
5. Rivier J, Spiess J, McClintock R, Vaughan J, Vale W. Purification
and partial characterization of inhibin from porcine follicular fluid.
Biochem Biophys Res Commun. 1985;133:120 –127.
6. Weiss J, Guendner MJ, Halvorson LM, Jameson JL. Transcriptional activation of the follicle-stimulating hormone ␤-subunit gene
by activin. Endocrinology. 1995;136:1885–1891.
7. Pernasetti F, Vasilyev VV, Rosenberg SB, et al. Cell-specific transcriptional regulation of follicle-stimulating hormone-␤ by activin
and gonadotropin-releasing hormone in the L␤T2 pituitary gonadotrope cell model. Endocrinology. 2001;142:2284 –2295.
8. Attardi B, Miklos J. Rapid stimulatory effect of activin-A on messenger RNA encoding the follicle-stimulating hormone ␤-subunit in
rat pituitary cell cultures. Mol Endocrinol. 1990;4:721–726.
9. Carroll RS, Corrigan AZ, Vale W, Chin WW. Activin stabilizes
follicle-stimulating hormone-␤ messenger ribonucleic acid levels.
Endocrinology. 1991;129:1721–1726.
10. Corrigan AZ, Bilezikjian LM, Carroll RS, et al. Evidence for an
autocrine role of activin B within rat anterior pituitary cultures.
Endocrinology. 1991;128:1682–1684.
11. Roberts V, Meunier H, Vaughan J, et al. Production and regulation
of inhibin subunits in pituitary gonadotropes. Endocrinology.
1989;124:552–554.
12. DePaolo LV, Bald LN, Fendly BM. Passive immunoneutralization
with a monoclonal antibody reveals a role for endogenous activin-B
in mediating FSH hypersecretion during estrus and following ovariectomy of hypophysectomized, pituitary-grafted rats. Endocrinology. 1992;130:1741–1743.
13. Braden TD, Conn PM. Activin-A stimulates the synthesis of gonadotropin-releasing hormone receptors. Endocrinology. 1992;130:
2101–2105.
14. Fernández-Vázquez G, Kaiser UB, Albarracin CT, Chin WW.
Transcriptional activation of the gonadotropin-releasing hormone
receptor gene by activin A. Mol Endocrinol. 1996;10:356 –366.
974
Fortin et al
Mechanisms of Activin Signaling in Gonadotropes
15. Bilezikjian LM, Corrigan AZ, Vaughan JM, Vale WM. Activin-A
regulates follistatin secretion from cultured rat anterior pituitary
cells. Endocrinology. 1993;133:2554 –2560.
16. DePaolo LV, Mercado M, Guo Y, Ling N. Increased follistatin
(activin-binding protein) gene expression in rat anterior pituitary
tissue after ovariectomy may be mediated by pituitary activin. Endocrinology. 1993;132:2221–2228.
17. Nakamura T, Takio K, Eto Y, Shibai H, Titani K, Sugino H. Activin-binding protein from rat ovary is follistatin. Science. 1990;
247:836 – 838.
18. Thompson TB, Lerch TF, Cook RW, Woodruff TK, Jardetzky TS.
The structure of the follistatin:activin complex reveals antagonism
of both type I and type II receptor binding. Dev Cell. 2005;9:535–
543.
19. Wrana JL, Attisano L, Cárcamo J, et al. TGF ␤ signals through a
heteromeric protein kinase receptor complex. Cell. 1992;71:1003–
1014.
20. Wrana JL, Attisano L, Wieser R, Ventura F, Massagué J. Mechanism of activation of the TGF-␤ receptor. Nature. 1994;370:341–
347.
21. Chen Y, Lebrun JJ, Vale W. Regulation of transforming growth
factor ␤- and activin-induced transcription by mammalian Mad
proteins. Proc Natl Acad Sci USA. 1996;93:12992–12997.
22. Shi Y, Massagué J. Mechanisms of TGF-␤ signaling from cell membrane to the nucleus. Cell. 2003;113:685–700.
23. Rejon CA, Hancock MA, Li YN, Thompson TB, Hébert TE, Bernard DJ. Activins bind and signal via bone morphogenetic protein
receptor type II (BMPR2) in immortalized gonadotrope-like cells.
Cell Signal. 2013;25:2717–2726.
24. Rejon CA, Ho CC, Wang Y, Zhou X, Bernard DJ, Hébert TE.
Cycloheximide inhibits follicle-stimulating hormone ␤ subunit
transcription by blocking de novo synthesis of the labile activin type
II receptor in gonadotrope cells. Cell Signal. 2013;25:1403–1412.
25. Alarid ET, Windle JJ, Whyte DB, Mellon PL. Immortalization of
pituitary cells at discrete stages of development by directed oncogenesis in transgenic mice. Development. 1996;122:3319 –3329.
26. Matzuk MM, Kumar TR, Bradley A. Different phenotypes for mice
deficient in either activins or activin receptor type II. Nature. 1995;
374:356 –360.
27. Bernard DJ, Lee KB, Santos MM. Activin B can signal through both
ALK4 and ALK7 in gonadotrope cells. Reprod Biol Endocrinol.
2006;4:52.
28. Tsuchida K, Nakatani M, Yamakawa N, Hashimoto O, Hasegawa
Y, Sugino H. Activin isoforms signal through type I receptor serine/
threonine kinase ALK7. Mol Cell Endocrinol. 2004;220:59 – 65.
29. Sandoval-Guzmán T, Göngrich C, Moliner A, et al. Neuroendocrine control of female reproductive function by the activin receptor
ALK7. FASEB J. 2012;26:4966 – 4976.
30. Bernard DJ. Both SMAD2 and SMAD3 mediate activin-stimulated
expression of the follicle-stimulating hormone ␤ subunit in mouse
gonadotrope cells. Mol Endocrinol. 2004;18:606 – 623.
31. Dupont J, McNeilly J, Vaiman A, Canepa S, Combarnous Y, Taragnat C. Activin signaling pathways in ovine pituitary and L␤T2
gonadotrope cells. Biol Reprod. 2003;68:1877–1887.
32. Gregory SJ, Lacza CT, Detz AA, Xu S, Petrillo LA, Kaiser UB.
Synergy between activin A and gonadotropin-releasing hormone in
transcriptional activation of the rat follicle-stimulating hormone-␤
gene. Mol Endocrinol. 2005;19:237–254.
33. Lamba P, Santos MM, Philips DP, Bernard DJ. Acute regulation of
murine follicle-stimulating hormone ␤ subunit transcription by activin A. J Mol Endocrinol. 2006;36:201–220.
34. Suszko MI, Balkin DM, Chen Y, Woodruff TK. Smad3 mediates
activin-induced transcription of follicle-stimulating hormone
␤-subunit gene. Mol Endocrinol. 2005;19:1849 –1858.
35. Suszko MI, Lo DJ, Suh H, Camper SA, Woodruff TK. Regulation of
the rat follicle-stimulating hormone ␤-subunit promoter by activin.
Mol Endocrinol. 2003;17:318 –332.
Mol Endocrinol, July 2015, 29(7):963–977
36. Tran S, Lamba P, Wang Y, Bernard DJ. SMADs and FOXL2 synergistically regulate murine FSH␤ transcription via a conserved
proximal promoter element. Mol Endocrinol. 2011;25:1170 –
1183.
37. Lamba P, Wang Y, Tran S, et al. Activin A regulates porcine folliclestimulating hormone ␤-subunit transcription via cooperative actions of SMADs and FOXL2. Endocrinology. 2010;151:5456 –
5467.
38. Wang Y, Bernard DJ. Activin A induction of murine and ovine
follicle-stimulating hormone ␤ transcription is SMAD-dependent
and TAK1 (MAP3K7)/p38 MAPK-independent in gonadotropelike cells. Cell Signal. 2012;24:1632–1640.
39. Wang Y, Libasci V, Bernard DJ. Activin A induction of FSH␤
subunit transcription requires SMAD4 in immortalized gonadotropes. J Mol Endocrinol. 2010;44:349 –362.
40. Shi Y, Wang YF, Jayaraman L, Yang H, Massagué J, Pavletich NP.
Crystal structure of a Smad MH1 domain bound to DNA: insights
on DNA binding in TGF-␤ signaling. Cell. 1998;94:585–594.
41. Zawel L, Dai JL, Buckhaults P, et al. Human Smad3 and Smad4 are
sequence-specific transcription activators. Mol Cell. 1998;1:611–
617.
42. McGillivray SM, Thackray VG, Coss D, Mellon PL. Activin and
glucocorticoids synergistically activate follicle-stimulating hormone ␤-subunit gene expression in the immortalized L␤T2 gonadotrope cell line. Endocrinology. 2007;148:762–773.
43. Lamba P, Fortin J, Tran S, Wang Y, Bernard DJ. A novel role for the
forkhead transcription factor FOXL2 in activin A-regulated follicle-stimulating hormone ␤ subunit transcription. Mol Endocrinol.
2009;23:1001–1013.
44. Bernard DJ, Tran S. Mechanisms of activin-stimulated FSH synthesis: the story of a pig and a FOX. Biol Reprod. 2013;88:78.
45. Blount AL, Schmidt K, Justice NJ, Vale WW, Fischer WH,
Bilezikjian LM. FoxL2 and Smad3 coordinately regulate follistatin
gene transcription. J Biol Chem. 2009;284:7631–7645.
46. Roybal LL, Hambarchyan A, Meadows JD, et al. Roles of binding
elements, FOXL2 domains, and interactions with cJUN and
SMADs in regulation of FSH␤. Mol Endocrinol. 2014;28:1640 –
1655.
47. Corpuz PS, Lindaman LL, Mellon PL, Coss D. FoxL2 Is required for
activin induction of the mouse and human follicle-stimulating hormone ␤-subunit genes. Mol Endocrinol. 2010;24:1037–1051.
48. Ghochani Y, Saini JK, Mellon PL, Thackray VG. FOXL2 is involved in the synergy between activin and progestins on the folliclestimulating hormone ␤-subunit promoter. Endocrinology. 2012;
153:2023–2033.
49. Lamba P, Khivansara V, D’Alessio AC, Santos MM, Bernard DJ.
Paired-like homeodomain transcription factors 1 and 2 regulate
follicle-stimulating hormone ␤-subunit transcription through a
conserved cis-element. Endocrinology. 2008;149:3095–3108.
50. Zakaria MM, Jeong KH, Lacza C, Kaiser UB. Pituitary homeobox
1 activates the rat FSH␤ (rFSH␤) gene through both direct and
indirect interactions with the rFSH␤ gene promoter. Mol Endocrinol. 2002;16:1840 –1852.
51. Han SO, Miller WL. Activin A induces ovine follicle stimulating
hormone ␤ using ⫺169/⫺58 bp of its promoter and a simple TATA
box. Reprod Biol Endocrinol. 2009;7:66.
52. Suszko MI, Antenos M, Balkin DM, Woodruff TK. Smad3 and
Pitx2 cooperate in stimulation of FSH␤ gene transcription. Mol Cell
Endocrinol. 2008;281:27–36.
53. Charles MA, Saunders TL, Wood WM, et al. Pituitary-specific
Gata2 knockout: effects on gonadotrope and thyrotrope function.
Mol Endocrinol. 2006;20:1366 –1377.
54. Jacobs SB, Coss D, McGillivray SM, Mellon PL. Nuclear factor Y
and steroidogenic factor 1 physically and functionally interact to
contribute to cell-specific expression of the mouse follicle-stimulating hormone-␤ gene. Mol Endocrinol. 2003;17:1470 –1483.
55. Bailey JS, Rave-Harel N, McGillivray SM, Coss D, Mellon PL.
doi: 10.1210/me.2015-1004
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
Activin regulation of the follicle-stimulating hormone ␤-subunit
gene involves Smads and the TALE homeodomain proteins Pbx1
and Prep1. Mol Endocrinol. 2004;18:1158 –1170.
Cattanach BM, Iddon CA, Charlton HM, Chiappa SA, Fink G.
Gonadotrophin-releasing hormone deficiency in a mutant mouse
with hypogonadism. Nature. 1977;269:338 –340.
Mason AJ, Hayflick JS, Zoeller RT, et al. A deletion truncating the
gonadotropin-releasing hormone gene is responsible for hypogonadism in the hpg mouse. Science. 1986;234:1366 –1371.
Chan YM, de Guillebon A, Lang-Muritano M, et al. GNRH1 mutations in patients with idiopathic hypogonadotropic hypogonadism. Proc Natl Acad Sci USA. 2009;106:11703–11708.
Bouligand J, Ghervan C, Tello JA, et al. Isolated familial hypogonadotropic hypogonadism and a GNRH1 mutation. N Engl J Med.
2009;360:2742–2748.
Savoy-Moore RT, Schwartz NB, Duncan JA, Marshall JC. Pituitary
gonadotropin-releasing hormone receptors during the rat estrous
cycle. Science. 1980;209:942–944.
Bauer-Dantoin AC, Hollenberg AN, Jameson JL. Dynamic regulation of gonadotropin-releasing hormone receptor mRNA levels in
the anterior pituitary gland during the rat estrous cycle. Endocrinology. 1993;133:1911–1914.
Naik SI, Saade G, Detta A, Clayton RN. Homologous ligand regulation of gonadotrophin-releasing hormone receptors in vivo: relationship to gonadotrophin secretion and gonadal steroids. J Endocrinol. 1985;107:41– 47.
Naik SI, Young LS, Saade G, Kujore A, Charlton HM, Clayton RN.
Role of GnRH in the regulation of pituitary GnRH receptors in
female mice. J Reprod Fertil. 1985;74:605– 614.
Kaiser UB, Jakubowiak A, Steinberger A, Chin WW. Regulation of
rat pituitary gonadotropin-releasing hormone receptor mRNA levels in vivo and in vitro. Endocrinology. 1993;133:931–934.
Seong JY, Kang SS, Kam K, et al. Differential regulation of gonadotropin-releasing hormone (GnRH) receptor expression in the posterior mediobasal hypothalamus by steroid hormones: implication
of GnRH neuronal activity. Brain Res Mol Brain Res. 1998;53:
226 –235.
Norwitz ER, Xu S, Jeong KH, et al. Activin A augments GnRHmediated transcriptional activation of the mouse GnRH receptor
gene. Endocrinology. 2002;143:985–997.
Duval DL, Ellsworth BS, Clay CM. Is gonadotrope expression of
the gonadotropin releasing hormone receptor gene mediated by
autocrine/paracrine stimulation of an activin response element? Endocrinology. 1999;140:1949 –1952.
Albarracin CT, Kaiser UB, Chin WW. Isolation and characterization of the 5⬘-flanking region of the mouse gonadotropin-releasing
hormone receptor gene. Endocrinology. 1994;135:2300 –2306.
Duval DL, Nelson SE, Clay CM. The tripartite basal enhancer of the
gonadotropin-releasing hormone (GnRH) receptor gene promoter
regulates cell-specific expression through a novel GnRH receptor
activating sequence. Mol Endocrinol. 1997;11:1814 –1821.
Norwitz ER, Xu S, Xu J, et al. Direct binding of AP-1 (Fos/Jun)
proteins to a SMAD binding element facilitates both gonadotropinreleasing hormone (GnRH)- and activin-mediated transcriptional
activation of the mouse GnRH receptor gene. J Biol Chem. 2002;
277:37469 –37478.
Ellsworth BS, Burns AT, Escudero KW, Duval DL, Nelson SE, Clay
CM. The gonadotropin releasing hormone (GnRH) receptor activating sequence (GRAS) is a composite regulatory element that
interacts with multiple classes of transcription factors including
Smads, AP-1 and a forkhead DNA binding protein. Mol Cell Endocrinol. 2003;206:93–111.
Norwitz ER, Cardona GR, Jeong KH, Chin WW. Identification and
characterization of the gonadotropin-releasing hormone response
elements in the mouse gonadotropin-releasing hormone receptor
gene. J Biol Chem. 1999;274:867– 880.
Ingraham HA, Lala DS, Ikeda Y, et al. The nuclear receptor ste-
press.endocrine.org/journal/mend
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
975
roidogenic factor 1 acts at multiple levels of the reproductive axis.
Genes Dev. 1994;8:2302–2312.
Noel SD, Martin C, Muyide T, et al. A proximal AP-1 site in the
Gnrhr gene promoter is critical for normal pubertal and reproductive development in female mice. ICE/ENDO2014, Chicago, IL,
2014;pp OR30 –5.
Cherrington BD, Farmerie TA, Lents CA, Cantlon JD, Roberson
MS, Clay CM. Activin responsiveness of the murine gonadotropinreleasing hormone receptor gene is mediated by a composite enhancer containing spatially distinct regulatory elements. Mol Endocrinol. 2005;19:898 –912.
Chai J, Wu JW, Yan N, Massagué J, Pavletich NP, Shi Y. Features
of a Smad3 MH1-DNA complex. Roles of water and zinc in DNA
binding. J Biol Chem. 2003;278:20327–20331.
Huang HJ, Sebastian J, Strahl BD, Wu JC, Miller WL. Transcriptional regulation of the ovine follicle-stimulating hormone-␤ gene
by activin and gonadotropin-releasing hormone (GnRH): involvement of two proximal activator protein-1 sites for GnRH stimulation. Endocrinology. 2001;142:2267–2274.
Wang Y, Fortin J, Lamba P, et al. Activator protein-1 and smad
proteins synergistically regulate human follicle-stimulating hormone ␤-promoter activity. Endocrinology. 2008;149:5577–5591.
Jeong KH, Chin WW, Kaiser UB. Essential role of the homeodomain for pituitary homeobox 1 activation of mouse gonadotropinreleasing hormone receptor gene expression through interactions
with c-Jun and DNA. Mol Cell Biol. 2004;24:6127– 6139.
Tremblay JJ, Goodyer CG, Drouin J. Transcriptional properties of
Ptx1 and Ptx2 isoforms. Neuroendocrinology. 2000;71:277–286.
McGillivray SM, Bailey JS, Ramezani R, Kirkwood BJ, Mellon PL.
Mouse GnRH receptor gene expression is mediated by the LHX3
homeodomain protein. Endocrinology. 2005;146:2180 –2185.
West BE, Parker GE, Savage JJ, et al. Regulation of the folliclestimulating hormone ␤ gene by the LHX3 LIM-homeodomain transcription factor. Endocrinology. 2004;145:4866 – 4879.
Wu JC, Sealfon SC, Miller WL. Gonadal hormones and gonadotropin-releasing hormone (GnRH) alter messenger ribonucleic acid
levels for GnRH receptors in sheep. Endocrinology. 1994;134:
1846 –1850.
Sealfon SC, Laws SC, Wu JC, Gillo B, Miller WL. Hormonal regulation of gonadotropin-releasing hormone receptors and messenger RNA activity in ovine pituitary culture. Mol Endocrinol. 1990;
4:1980 –1987.
Gregg DW, Schwall RH, Nett TM. Regulation of gonadotropin
secretion and number of gonadotropin-releasing hormone receptors by inhibin, activin-A, and estradiol. Biol Reprod. 1991;44:
725–732.
Prendergast KA, Burger LL, Aylor KW, Haisenleder DJ, Dalkin AC,
Marshall JC. Pituitary follistatin gene expression in female rats:
evidence that inhibin regulates transcription. Biol Reprod. 2004;
70:364 –370.
Bilezikjian LM, Leal AM, Blount AL, Corrigan AZ, Turnbull AV,
Vale WW. Rat anterior pituitary folliculostellate cells are targets of
interleukin-1␤ and a major source of intrapituitary follistatin. Endocrinology. 2003;144:732–740.
Blount AL, Vaughan JM, Vale WW, Bilezikjian LM. A Smad-binding element in intron 1 participates in activin-dependent regulation
of the follistatin gene. J Biol Chem. 2008;283:7016 –7026.
Winters SJ, Dalkin AC, Tsujii T. Evidence that pituitary adenylate
cyclase activating polypeptide suppresses follicle-stimulating hormone-␤ messenger ribonucleic acid levels by stimulating follistatin
gene transcription. Endocrinology. 1997;138:4324 – 4329.
Bartholin L, Maguer-Satta V, Hayette S, et al. Transcription activation of FLRG and follistatin by activin A, through Smad proteins,
participates in a negative feedback loop to modulate activin A function. Oncogene. 2002;21:2227–2235.
Benayoun BA, Caburet S, Dipietromaria A, et al. The identification
and characterization of a FOXL2 response element provides in-
976
Fortin et al
Mechanisms of Activin Signaling in Gonadotropes
sights into the pathogenesis of mutant alleles. Hum Mol Genet.
2008;17:3118 –3127.
92. Boerboom D, Kumar V, Boyer A, et al. ␤-Catenin stabilization in
gonadotropes impairs follicle-stimulating hormone synthesis in
male mice in vivo. Endocrinology. 2014;en20141296.
93. Fortin J, Kumar V, Zhou X, et al. NR5A2 regulates Lhb and Fshb
transcription in gonadotrope-like cells in vitro, but is dispensable
for gonadotropin synthesis and fertility in vivo. PLoS One. 2013;
8:e59058.
94. Wang Q, Chikina M, Zaslavsky E, Pincas H, Sealfon SC. ␤-Catenin
regulates GnRH-induced FSH␤ gene expression. Mol Endocrinol.
2013;27:224 –237.
95. Salisbury TB, Binder AK, Nilson JH. Welcoming ␤-catenin to the
gonadotropin-releasing hormone transcriptional network in gonadotropes. Mol Endocrinol. 2008;22:1295–1303.
96. Zheng W, Yang J, Jiang Q, He Z, Halvorson LM. Liver receptor
homologue-1 regulates gonadotrope function. J Mol Endocrinol.
2007;38:207–219.
97. Strahl BD, Huang HJ, Pedersen NR, Wu JC, Ghosh BR, Miller WL.
Two proximal activating protein-1-binding sites are sufficient to
stimulate transcription of the ovine follicle-stimulating hormone-␤
gene. Endocrinology. 1997;138:2621–2631.
98. Strahl BD, Huang HJ, Sebastian J, Ghosh BR, Miller WL. Transcriptional activation of the ovine follicle-stimulating hormone
␤-subunit gene by gonadotropin-releasing hormone: involvement
of two activating protein-1-binding sites and protein kinase C. Endocrinology. 1998;139:4455– 4465.
99. Strømme P, Sandboe F. Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). Acta Ophthalmol Scand. 1996;74:45– 47.
100. Crisponi L, Deiana M, Loi A, et al. The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/
epicanthus inversus syndrome. Nat Genet. 2001;27:159 –166.
101. Chesnokova V, Zonis S, Wawrowsky K, et al. Clusterin and
FOXL2 act concordantly to regulate pituitary gonadotroph adenoma growth. Mol Endocrinol. 2012;26:2092–2103.
102. Egashira N, Takekoshi S, Takei M, Teramoto A, Osamura RY.
Expression of FOXL2 in human normal pituitaries and pituitary
adenomas. Mod Pathol. 2011;24:765–773.
103. Amati P, Gasparini P, Zlotogora J, et al. A gene for premature
ovarian failure associated with eyelid malformation maps to chromosome 3q22– q23. Am J Hum Genet. 1996;58:1089 –1092.
104. Nallathambi J, Moumné L, De Baere E, et al. A novel polyalanine
expansion in FOXL2: the first evidence for a recessive form of the
blepharophimosis syndrome (BPES) associated with ovarian dysfunction. Hum Genet. 2007;121:107–112.
105. Kaur I, Hussain A, Naik MN, Murthy R, Honavar SG. Mutation
spectrum of fork-head transcriptional factor gene (FOXL2) in
Indian Blepharophimosis Ptosis Epicanthus Inversus Syndrome
(BPES) patients. Br J Ophthalmol. 2011;95:881– 886.
106. Dipietromaria A, Benayoun BA, Todeschini AL, Rivals I, Bazin C,
Veitia RA. Towards a functional classification of pathogenic
FOXL2 mutations using transactivation reporter systems. Hum
Mol Genet. 2009;18:3324 –3333.
107. Schmidt D, Ovitt CE, Anlag K, et al. The murine winged-helix
transcription factor Foxl2 is required for granulosa cell differentiation and ovary maintenance. Development. 2004;131:933–
942.
108. Uda M, Ottolenghi C, Crisponi L, et al. Foxl2 disruption causes
mouse ovarian failure by pervasive blockage of follicle development. Hum Mol Genet. 2004;13:1171–1181.
109. Justice NJ, Blount AL, Pelosi E, Schlessinger D, Vale W,
Bilezikjian LM. Impaired FSH␤ expression in the pituitaries of
Foxl2 mutant animals. Mol Endocrinol. 2011;25:1404 –1415.
110. Tran S, Zhou X, Lafleur C, et al. Impaired fertility and FSH
synthesis in gonadotrope-specific Foxl2 knockout mice. Mol Endocrinol. 2013;27:407– 421.
111. Fortin J, Boehm U, Deng CX, Treier M, Bernard DJ. Follicle-
Mol Endocrinol, July 2015, 29(7):963–977
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.
126.
127.
128.
129.
130.
stimulating hormone synthesis and fertility depend on SMAD4
and FOXL2. FASEB J. 2014;28:3396 –3410.
Attardi B, Klatt B, Little G. Repression of glycoprotein hormone
␣-subunit gene expression and secretion by activin in ␣ T3-1 cells.
Mol Endocrinol. 1995;9:1737–1749.
Kang HY, Huang KE, Chang SY, Ma WL, Lin WJ, Chang C.
Differential modulation of androgen receptor-mediated transactivation by Smad3 and tumor suppressor Smad4. J Biol Chem.
2002;277:43749 – 43756.
Heckert LL, Wilson EM, Nilson JH. Transcriptional repression of
the ␣-subunit gene by androgen receptor occurs independently of
DNA binding but requires the DNA-binding and ligand-binding
domains of the receptor. Mol Endocrinol. 1997;11:1497–1506.
Kumar TR, Wang Y, Lu N, Matzuk MM. Follicle stimulating
hormone is required for ovarian follicle maturation but not male
fertility. Nat Genet. 1997;15:201–204.
Naik SI, Young LS, Charlton HM, Clayton RN. Evidence for a
pituitary site of gonadal steroid stimulation of GnRH receptors in
female mice. J Reprod Fertil. 1985;74:615– 624.
Fortin J, Boehm U, Weinstein MB, Graff JM, Bernard DJ. Folliclestimulating hormone synthesis and fertility are intact in mice lacking SMAD3 DNA binding activity and SMAD2 in gonadotrope
cells. FASEB J. 2014;28:1474 –1485.
Liu X, Sun Y, Constantinescu SN, Karam E, Weinberg RA, Lodish
HF. Transforming growth factor ␤-induced phosphorylation of
Smad3 is required for growth inhibition and transcriptional induction in epithelial cells. Proc Natl Acad Sci USA. 1997;94:
10669 –10674.
Chacko BM, Qin B, Correia JJ, Lam SS, de Caestecker MP, Lin K.
The L3 loop and C-terminal phosphorylation jointly define Smad
protein trimerization. Nat Struct Biol. 2001;8:248 –253.
Chacko BM, Qin BY, Tiwari A, et al. Structural basis of heteromeric smad protein assembly in TGF-␤ signaling. Mol Cell. 2004;
15:813– 823.
Correia JJ, Chacko BM, Lam SS, Lin K. Sedimentation studies
reveal a direct role of phosphorylation in Smad3:Smad4 homoand hetero-trimerization. Biochemistry. 2001;40:1473–1482.
Kim SY, Zhu J, Woodruff TK. A truncated, activin-induced
Smad3 isoform acts as a transcriptional repressor of FSH␤ expression in mouse pituitary. Mol Cell Endocrinol. 2011;342:64 –72.
Zhang H, Bailey JS, Coss D, et al. Activin modulates the transcriptional response of L␤T2 cells to gonadotropin-releasing hormone
and alters cellular proliferation. Mol Endocrinol. 2006;20:2909 –
2930.
Kumar TR, Agno J, Janovick JA, Conn PM, Matzuk MM. Regulation of FSH␤ and GnRH receptor gene expression in activin
receptor II knockout male mice. Mol Cell Endocrinol. 2003;212:
19 –27.
Inman GJ, Nicolás FJ, Callahan JF, et al. SB-431542 is a potent
and specific inhibitor of transforming growth factor-␤ superfamily type I activin receptor-like kinase (ALK) receptors ALK4,
ALK5, and ALK7. Mol Pharmacol. 2002;62:65–74.
Nishitoh H, Ichijo H, Kimura M, et al. Identification of type I and
type II serine/threonine kinase receptors for growth/differentiation factor-5. J Biol Chem. 1996;271:21345–21352.
Yamashita H, ten Dijke P, Huylebroeck D, et al. Osteogenic protein-1 binds to activin type II receptors and induces certain activinlike effects. J Cell Biol. 1995;130:217–226.
Vitt UA, Mazerbourg S, Klein C, Hsueh AJ. Bone morphogenetic
protein receptor type II is a receptor for growth differentiation
factor-9. Biol Reprod. 2002;67:473– 480.
Vassalli A, Matzuk MM, Gardner HA, Lee KF, Jaenisch R. Activin/inhibin ␤ B subunit gene disruption leads to defects in eyelid
development and female reproduction. Genes Dev. 1994;8:414 –
427.
McDowell IF, Morris JF, Charlton HM, Fink G. Effects of lutein-
doi: 10.1210/me.2015-1004
131.
132.
133.
134.
135.
136.
izing hormone releasing hormone on the gonadotrophs of hypogonadal (hpg) mice. J Endocrinol. 1982;95:331–340.
Charlton HM, Halpin DM, Iddon C, et al. The effects of daily
administration of single and multiple injections of gonadotropinreleasing hormone on pituitary and gonadal function in the hypogonadal (hpg) mouse. Endocrinology. 1983;113:535–544.
Wu S, Wilson MD, Busby ER, Isaac ER, Sherwood NM. Disruption of the single copy gonadotropin-releasing hormone receptor
in mice by gene trap: severe reduction of reproductive organs and
functions in developing and adult mice. Endocrinology. 2010;
151:1142–1152.
Grady RR, Shin L, Charlesworth MC, et al. Differential suppression of follicle-stimulating hormone and luteinizing hormone secretion in vivo by a gonadotropin-releasing hormone antagonist.
Neuroendocrinology. 1985;40:246 –252.
Kartun K, Schwartz NB. Effects of a potent antagonist to gonadotropin-releasing hormone on male rats: luteinizing hormone is
suppressed more than follicle-stimulating hormone. Biol Reprod.
1987;36:103–108.
Besecke LM, Guendner MJ, Schneyer AL, Bauer-Dantoin AC,
Jameson JL, Weiss J. Gonadotropin-releasing hormone regulates
follicle-stimulating hormone-␤ gene expression through an activin/follistatin autocrine or paracrine loop. Endocrinology. 1996;
137:3667–3673.
Choi SG, Jia J, Pfeffer RL, Sealfon SC. G proteins and autocrine
press.endocrine.org/journal/mend
137.
138.
139.
140.
141.
142.
977
signaling differentially regulate gonadotropin subunit expression
in pituitary gonadotrope. J Biol Chem. 2012;287:21550 –21560.
Choi SG, Wang Q, Jia J, Pincas H, Turgeon JL, Sealfon SC.
Growth differentiation factor 9 (GDF9) forms an incoherent feedforward loop modulating follicle-stimulating hormone ␤-subunit
(FSH␤) gene expression. J Biol Chem. 2014;289:16164 –16175.
Pincas H, Choi SG, Wang Q, Jia J, Turgeon JL, Sealfon SC. Outside the box signaling: secreted factors modulate GnRH receptormediated gonadotropin regulation. Mol Cell Endocrinol. 2014;
385:56 – 61.
Dalkin AC, Haisenleder DJ, Gilrain JT, Aylor K, Yasin M, Marshall JC. Gonadotropin-releasing hormone regulation of gonadotropin subunit gene expression in female rats: actions on folliclestimulating hormone ␤ messenger ribonucleic acid (mRNA)
involve differential expression of pituitary activin (␤-B) and follistatin mRNAs. Endocrinology. 1999;140:903–908.
Goodarzi MO, Dumesic DA, Chazenbalk G, Azziz R. Polycystic
ovary syndrome: etiology, pathogenesis and diagnosis. Nat Rev
Endocrinol. 2011;7:219 –231.
Rebar R, Judd HL, Yen SS, Rakoff J, Vandenberg G, Naftolin F.
Characterization of the inappropriate gonadotropin secretion in
polycystic ovary syndrome. J Clin Invest. 1976;57:1320 –1329.
Wen S, Schwarz JR, Niculescu D, et al. Functional characterization of genetically labeled gonadotropes. Endocrinology. 2008;
149:2701–2711.