scientific
report
scientificreport
Transcriptional regulation of the Neurospora circadian
clock gene wc-1 affects the phase of circadian output
Krisztina Káldi, Beatriz Herreros González & Michael Brunner+
Biochemie-Zentrum der Universität Heidelberg, Heidelberg, Germany
WHITE COLLAR-1 (WC-1) is the limiting component of the White
Collar Complex (WCC) controlling expression of the Neurospora
circadian clock protein Frequency (FRQ). Accumulation of WC-1
is supported by FRQ on a post-transcriptional level. Here, we
show that transcription of wc-1 is organized in a complex way.
Three promoters drive transcription of wc-1. Pdist is dependent
on WCC. Pprox is independent of WCC in darkness, but inducible
by light in a WCC-dependent manner. A third promoter, Pint, is
located in the wc-1 open reading frame and promotes expression
of an amino-terminally truncated WC-1 isoform of unknown
function. Expression of wc-1 by Pdist or Pprox alone, or by a
heterologous promoter, affects the entrained phase of circadian
conidiation and the response of Neurospora to light. Our results
indicate that transcriptional regulation of wc-1 is required to
modulate the circadian phase of clock output.
Keywords: circadian rhythms; White Collar Complex; FRQ;
feedback regulation; Neurospora
EMBO reports (2006) 7, 199–204. doi:10.1038/sj.embor.7400595
INTRODUCTION
Most organisms have evolved circadian clocks to adapt their
physiology to the daily changes in the environment. On the
molecular level, circadian clocks are composed of positive and
negative elements that form interlocked transcriptional and
translational feedback loops (Stanewsky, 2003; Dunlap & Loros,
2004; Gachon et al, 2004). In Neurospora, the White Collar
Complex (WCC), composed of WHITE COLLAR (WC)-1 and
WC-2, activates transcription of the clock gene frequency (frq;
Linden & Macino, 1997; Froehlich et al, 2002). Two isoforms of
FREQUENCY (FRQ) protein are expressed, which are crucial for
temperature compensation and resetting of the clock (Liu et al,
1997; Diernfellner et al, 2005). FRQ promotes phosphorylation of
WCC, leading to its inactivation (Schafmeier et al, 2005), and thus
to negative feedback on frq transcription (Froehlich et al, 2003;
Dunlap & Loros, 2004). FRQ is then degraded through a
Biochemie-Zentrum der Universität Heidelberg, Im Neuenheimer Feld 328,
69120 Heidelberg, Germany
+Corresponding author. Tel: þ 49 6221 544783; Fax: þ 49 6221 545586;
E-mail: [email protected]
Received 17 May 2005; revised 29 September 2005; accepted 10 November 2005;
published online 23 December 2005
&2006 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION
phosphorylation- and proteasome-dependent pathway (Görl et al,
2001; He et al, 2003). FRQ also supports expression of WC-1 and
WC-2 (Lee et al, 2000; Cheng et al, 2001), and WC-1 represses wc2 transcription (Cheng et al, 2003). These interconnected positive
and negative feedback loops lead to rhythmic expression of FRQ
and thus to rhythmic activity of WCC. WCC serves as a blue-light
receptor required for resetting and entrainment of the clock (Linden
& Macino, 1997; Cheng et al, 2003; Lee et al, 2003). FRQ and
WCC regulate circadian expression of clock-controlled genes and
thereby determine rhythmicity of physiological processes.
Activation of the frq promoter by WCC has been characterized in
detail (Froehlich et al, 2002, 2003). Two WCC-binding elements
within the promoter are necessary to maximally induce frq transcription in response to light. The distal element (C-box) is necessary and
sufficient to promote rhythmic frq expression in darkness.
Here, we characterized transcription of wc-1. We identified
three distinct promoters. Pdist and Pprox give rise to transcripts with
long 50 -untranslated regions (50 -UTRs). Pdist is activated by WCC,
whereas Pprox is independent of WCC in darkness but transiently
induced by light in a WCC-dependent manner. The third
promoter, Pint, is located in the wc-1 open reading frame (ORF).
Although the physiological relevance of Pint is not clear, it has the
potential to drive the expression of an amino-terminally truncated,
partially functional WC-1 isoform. Our results indicate that WC-1
positively regulates its own expression and thus forms another
feedback loop, stabilizing the Neurospora clockwork. Complex
transcriptional regulation of wc-1 seems to be required to adjust
the circadian phase of conidiation.
RESULTS
The wc-1 gene contains three promoters
Expression levels of wc-1 RNA do not show circadian rhythmicity
(Lee et al, 2000; Merrow et al, 2001). In accordance, expression of
WC-1 under the control of the inducible quinic acid-2 (qa-2)
promoter was shown to restore free-running rhythmicity in a wc-1
null strain (Cheng et al, 2001). WC-1 levels in a Dwc-1, qa-wc-1
are similar to those in a bd A control strain (supplementary Fig 1
online), henceforth referred to as wc-1 þ . However, we observed
that the phase of circadian conidiation of Dwc-1, qa-wc-1 was
delayed by B30 min compared with wc-1 þ (Table 1). This
difference was even more pronounced when strains were
entrained to light:dark (LD) cycles (Fig 1A; Table 1). In 12 h:12 h,
6 h:18 h and 1 h:23 h LD cycles, the phase of Dwc-1, qa-wc-1 was
EMBO reports VOL 7 | NO 2 | 2006 1 9 9
scientific report
Positive feedback loop of the Neurospora clock gene wc-1
K. Káldi et al
Table 1 | Altered entrainment of conidiation rhythm in Dwc-1, qa-wc-1
Period (h; mean7s.e.m.)
Peak of conidiation (h; mean7s.e.m.)
DD
wc-1+
Dwc-1, qa-wc-1
21.8370.17
21.4470.26
22.2870.15 (CT)
22.8170.32 (CT)
LD (12:12)
wc-1+
Dwc-1, qa-wc-1
24.370.32
24.0670.024
22.8170.31 (ZT)
1.5070.59 (ZT)
LD (6:18)
wc-1+
Dwc-1, qa-wc-1
24.0170.32
24.4570.13
18.770.34 (ZT)
21.8470.5 (ZT)
LD (1:23)
wc-1+
Dwc-1, qa-wc-1
23.6270.005
24.0770.09
8.3270.20 (ZT)
12.7070.27 (ZT)
Race tubes were inoculated with the indicated strains and after incubation in constant light for 2 days transferred to DD or LD cycles at 25 1C as indicated (n ¼ 5–14). CT,
circadian time; DD, constant darkness; LD, light:dark; ZT, zeitgeber time.
2 0 0 EMBO reports
VOL 7 | NO 2 | 2006
A
wc-1+
Δwc-1, qa-wc-1
1
B
2
3
Days
4
5
6
5
4
Phase shift (h)
delayed by 2 h 40 min, 3 h 6 min and 4 h 12 min, respectively. Thus,
expression of WC-1 from a heterologous promoter affects the
response of Neurospora to light. We therefore investigated resetting
of the phase of the circadian clock by 20 min light pulses received
at different time points throughout a circadian period (Fig 1B).
In Neurospora, conidiation is initiated in the second half of the
night. Light signals received before the initiation of conidiation
delay the phase and suppress formation of conidia, whereas light
signals received close to and after the onset advance the phase.
Thus, the largest difference in phase response is observed between
light pulses given shortly before and after the initiation of
conidiation. As expected, light pulses towards the end of the
subjective night and during the early subjective morning evoked
advances of the phase of conidiation in wc-1 þ , whereas light
pulses towards the end of the subjective day and during the first half
of the night delayed the phase (Fig 1B). The maximal differences
between phase delays and advances were about 8 h in the quinic
acid medium used (Fig 1B). Even larger phase shifts were observed
under different growth conditions (Heintzen et al, 2001). The phase
response of Dwc-1, qa-wc-1 to light pulses during the subjective
day was similar to that of wc-1 þ . However, Dwc-1, qa-wc-1 was
less responsive to light signals during the subjective night. In
particular, the maximal differences in phase shifts were less than
3 h. The observations suggest that transcriptional control of wc-1 is
crucial for resetting of the circadian clock by light pulses received
during the subjective night. Thus, the wc-1 gene might be regulated
in a more complex manner than anticipated hitherto.
Therefore, we mapped the 50 ends of wc-1 transcripts of lightgrown wild type (wt) by RNA ligase-mediated rapid amplification
of complementary DNA ends (50 RLM-RACE). We identified two
putative transcription starts at positions –1222 and 924 with
respect to the wc-1 ORF and one at position þ 175, suggesting a
promoter within the wc-1 ORF (Fig 1C). Sequence analysis and
diagnostic PCR (not shown) showed a 420 nt intron between
positions 866 and 445.
We tested the promoter activity of different wc-1 gene segments
using firefly luciferase (luc) as reporter (Fig 2A). The strains PdistPprox-luc, Pdist-luc and Pprox-luc contain in front of the luc gene
fragments corresponding to 2223 to 1, 2223 to 1212 and
1179 to 1 of the wc-1 gene, respectively. The reporter strains
were grown in constant light (LL). Total protein extracts were
prepared and luc activity was measured. Luc activity in Pdist-Pproxluc extracts was about 200 times higher than that in extracts of a
3
2
1
0
30
−1
36
42
Hours in DD
−2
−3
C
4
3
2
1
Pdist Pprox
Pint
Fig 1 | Complex control of wc-1 transcription. (A) Entrainment of
circadian conidiation depends on the wc-1 promoter. Race tubes,
inoculated with the indicated strains, were exposed to 1 h:23 h light:dark
cycles at 25 1C. Averaged conidial densities (n ¼ 3) were plotted versus
time. (B) Resetting of the clock by light is altered in the Dwc-1, qa-wc-1
(dotted grey line) strain compared with wc-1 þ (black line). Race tubes
were exposed to 20 min light pulses at the indicated time in constant
darkness (DD). The phase shift of conidial bands (compared with control
strains kept in DD) was blotted versus time when the light pulse was
given. Black and dotted bars at the bottom indicate subjective night and
day, respectively. (C) The transcription of wc-1 is initiated at various
sites. The wc-1 gene is schematically outlined. The positions of four
amplicons generated by RNA ligase-mediated rapid amplification of
complementary DNA ends are indicated above. The putative promoters
Pdist, Pprox and Pint are indicated by arrows.
&2006 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION
scientific report
Positive feedback loop of the Neurospora clock gene wc-1
K. Káldi et al
−2.2
Pdist-Pprox-luc
−1.2
Pdist-luc
luc
Pprox-luc
luc
C
+
F
OR
ΔQ
.N
.
-1
-1
wc
B 100
luc
Luciferase activity (%)
A
-1
60
40
20
0
wc
wc
80
c
c
lu
-t
c
c
-lu
ox
r
Pp
WC-1
-lu
-lu
st
i
Pd
ox
r
Pp
is
Pd
E
D
wc-1+
FRQ
LL
14
23
wc-1+
LL
14
23
wc-1.ORF
30
wc-1.ORF
wc-1+
20
10
0
LL
DD14
DD23
Relative density of conidia
FRQ levels (a.u.)
wc-1.ORF
0
2
Days
4
6
Fig 2 | Characterization of the promoter activity of different wc-1 gene segments. (A) Schematic outline of luciferase (luc) reporter constructs.
(B) Different wc-1 gene segments exert promoter activity. wc-1 þ ,his3 was transformed with the indicated constructs and luc activity was measured in
total cell extracts of light-grown cells. Enzyme activity measured in extracts of wc-1 þ , Pdist-Pprox-luc was set to 100%. Data are means7s.e.m. of five to
eight experiments. (C) The wc-1.ORF strain expresses an amino-terminally truncated version of WC-1. wc-1 þ and the strains wc-1.ORF and Dwc-1,
qa-wc-1.NDQ were grown in constant light (LL). Expression of WC-1.NDQ (amino acids 67–1,167) was induced with quinic acid. Total cell extracts
were analysed by SDS–polyacrylamide gel electrophoresis and immunoblotting with anti-WC-1 antibody. (D) Frequency (FRQ) levels in wc-1.ORF are
high in LL but reduced in constant darkness (DD). A representative western blot analysis of total cell extract and quantification by densitometry
(n ¼ 3) is shown. (E) The conidiation rhythm of wc-1.ORF is dampened. Two representative race tubes and the averaged conidial densities are shown.
control strain transformed with a promoterless luc gene (Fig 2B). Luc
activity of Pdist-luc and Pprox-luc extracts was 40- and 100-fold
higher than control levels, respectively. The data indicate that the
wc-1 gene contains two promoters, Pdist and Pprox, initiating
transcripts 1,222 and 924 bp upstream of the wc-1 ORF, respectively. About half of the transcriptional activity of wc-1 can be
attributed to Pprox, suggesting that Pdist is of equal strength. However,
Pdist-luc activity was only 20% of the activity of Pdist-Pprox-luc. As the
50 UTRs of the two constructs are different, luc activity may not
accurately reflect the strength of Pprox in the wc-1 gene.
To investigate the physiological relevance of the 50 RLM-RACE
products starting within the wc-1 coding region, the ORF was
inserted without additional regulatory sequences into the his-3 locus
of Dwc-1, resulting in the strain wc-1.ORF. A shorter version of
WC-1 was detected with an antibody directed against the carboxyl
terminus of WC-1, indicating that an N-terminally truncated version
of WC-1 was expressed in this strain (Fig 2C). The electrophoretic
mobility of the truncated WC-1 species was similar to that of
&2006 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION
WC-1.NDQ, a recombinant version, in which the N-terminal
polyglutamine (poly(Q)) stretch of WC-1 was deleted and which
starts at methionine 67. We estimated that the WC-1.NDQ level
directed by the ORF reached more than 25% of the WC-1 level in
wt. This indicates that the wc-1 ORF contains a promoter that drives
expression of a truncated WC-1 protein lacking the N-terminal
poly(Q) stretch. Despite the presence of Pint RNA, the truncated
WC-1 species seems to be expressed only at a low level in wt, but
accumulates to significant amounts when expression of full-size
WC-1 is compromised. The physiological role of the truncated
WC-1 is not clear. In LL, the wc-1.ORF strain expressed wt levels of
FRQ, whereas FRQ levels were reduced at DD14 (14 h after LD
transfer) and at DD23 (23 h after LD transfer; Fig 2D). When
analysed on race tubes, wc-1.ORF was initially rhythmic in constant
darkness (DD), but the rhythm dampened after 3 days (Fig 2E).
Taken together, the above data indicate that wc-1 transcription
is controlled by several promoter elements allowing production of
different messenger RNA and also different protein species.
EMBO reports VOL 7 | NO 2 | 2006 2 0 1
scientific report
Positive feedback loop of the Neurospora clock gene wc-1
K. Káldi et al
2 0 2 EMBO reports
VOL 7 | NO 2 | 2006
B 10
Luciferase activity (%)
A 100
wc-1 +
Δwc-1
80
60
40
20
0
o
-P pr
ist
Pd
-lu
-lu
ist
8
6
4
2
0
c
c
c
-lu
x
wc-1 + wc-1
RIP
Δwc-2
rox
Pp
Pd
C
30
RNA levels (a.u.)
FRQ regulates WC-1 expression, at least in part, on a posttranscriptional level (Lee et al, 2000; Cheng et al, 2001).
Conversely, the level of wc-1 RNA is transiently induced by light
and then adapts in LL to levels similar to those in DD (Ballario
et al, 1996; Merrow et al, 2001; Lee et al, 2003). This suggests
that wc-1, like other light-induced genes, is controlled by WC-1
and VIVID, the blue-light photoreceptors of Neurospora (Dunlap
& Loros, 2004).
To investigate whether expression of wc-1 in darkness is
dependent on WC-1, we transformed a Dwc-1 strain with PdistPprox-luc. luc activity was about 50% lower than that in wt
transformed with Pdist-Pprox-luc (Fig 3A), suggesting a role of
WC-1 in the regulation of its own transcription even in DD.
In accordance, we found that wc-1 transcript levels were
reduced in Dwc-2 and wc-1RIP strains, which lack functional
WCC (Fig 3B).
To analyse which promoter is controlled by WC-1, Dwc-1 was
transformed with Pdist-luc and Pprox-luc constructs. Pdist-luc activity
in DD was significantly lower in Dwc-1 than that in transformed wc1 þ , whereas Pprox-luc showed comparable activities in both strains
(Fig 3A). This indicates that Pdist transcription in DD is supported by
WC-1, whereas Pprox transcription is independent of WC-1.
Using specific real-time PCR (RT-PCR) probes, we measured
total wc-1 RNA and transcripts of Pdist in LL and DD during the
course of two circadian cycles (Fig 3C). Transcript levels were
variable in DD but did not show apparent circadian rhythmicity.
The average level of Pdist-specific RNA in DD was similar to the
level in LL, whereas total wc-1 RNA levels were about twofold
higher in LL than those in DD.
To address whether the two promoters are transiently induced
by light, we measured wc-1 RNA in wc-1 þ and luc RNA in
transformed wc-1 þ reporter strains. Cultures were grown in DD
and then exposed to light. wc-1 and luc RNA levels were
determined by quantitative RT-PCR (Fig 4A). Pdist-specific wc-1
RNA was only moderately induced by light. Following dark-tolight transfer, total wc-1 RNA level increased by about fivefold in
20 min and adapted in 60 min to levels about twofold higher than
those in DD (Fig 4A, upper panel). As Pint is not light responsive
(not shown), the data indicate that Pprox is induced by light. In
support of this, we found that Pprox-luc transcription was induced
by light, whereas Pdist-luc transcription was essentially unaffected
by light (Fig 4A, lower panel). This suggests that Pprox contains a
light-responsive element (LRE). To confirm these results, we
compared the amount of Pdist- and Pprox-dependent transcripts by
semiquantitative PCR using cDNA of light-induced and darkgrown wt strains (Fig 4B). Two forward primers were used to
detect Pdist transcripts alone or Pdist þ Pprox transcripts together.
Total wc-1 RNA, driven by Pdist þ Pprox, was transiently induced by
light, whereas Pdist-specific transcripts were not induced by light,
indicating that Pprox responds to light.
To investigate how expression of WC-1 under the control of
Pprox or Pdist alone would affect free-running rhythmicity and
entrained phase of conidiation, we constructed the strains Dwc-1,
Pprox-wc-1 and Dwc-1, Pdist-wc-1. Expression levels of WC-1 were
slightly reduced in these strains (supplementary Fig 2 online). Both
strains were rhythmic in DD (supplementary table online). The
free-running period of Dwc-1, Pprox-wc-1 was 24.8 h and the peak
of conidiation (phase) was at circadian time (CT23.5). The
wc-1 RNA levels (a.u.)
WC-1 controlled activity of the wc-1 promoter segments
20
10
0
0
10
20
30
40
Hours in dark
Fig 3 | Expression of wc-1 in constant darkness is dependent on the
White Collar Complex. (A) WC-1 regulates distinct promoter segments of
wc-1 in constant darkness (DD). Indicated constructs (see Fig 2) were
integrated into the his3 locus of wc-1 þ and of Dwc-1. Luciferase (luc)
activity was measured in total cell extracts prepared from cultures
collected at DD23. 100%, enzyme activity measured in wc-1 þ , Pdist-Pproxluc. Data are means7s.e.m. of four experiments. (B) wc-1 expression is
reduced in the White Collar Complex-deficient strains wc-1RIP and Dwc2. Cells were collected at DD24. wc-1 RNA was analysed by quantitative
real-time PCR (RT-PCR). Data are means7s.e.m. of three experiments,
each carried out in duplicate. (C) Activity of Pdist and Pprox in constant
light (LL) and DD. wc-1 þ was grown in LL (0) and then transferred to
DD. Samples were collected at the indicated time points and total wc-1
RNA (solid black line) and Pdist-specific RNA (dotted grey line) were
measured by RT-PCR (supplementary information online).
free-running period of Dwc-1, Pdist-wc-1 was 22.4 h and the
phase of conidiation was at CT21.1. When exposed to 12 h:12 h
LD cycles, the phase of conidiation of Dwc-1, Pdist-wc-1 was
advanced by B1 h and the phase of Dwc-1, Pprox-wc-1 was
delayed by B1.5 h, compared with the phase of wc-1 þ (Fig 5A).
DISCUSSION
The Neurospora blue-light photoreceptor WC-1 assembles with its
partner WC-2, forming the WCC, which regulates expression of the
circadian oscillator protein FRQ and several light-induced and
clock-controlled genes (Roenneberg & Merrow, 2001; Dunlap &
Loros, 2004). As WC-2 is present in excess, levels of WC-1
determine the concentration of WCC. WC-1 and WC-2 are GATAtype transcription factors (Ballario et al, 1996; Linden & Macino,
1997), and WCC binds to direct GATN repeats with variable
spacing. In the al-3 promoter, WCC binds to GATA repeats (lower
strand) spaced by 15 bp (Linden & Macino, 1997), and in the frq
promoter, it binds to a distal and a proximal LRE that contain direct
GATG repeats (upper strand) spaced by 13 bp and GATC repeats
spaced by 5 bp, respectively (Froehlich et al, 2002; Fig 5).
&2006 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION
scientific report
Positive feedback loop of the Neurospora clock gene wc-1
K. Káldi et al
A
A
6
Phase
Strain
+
wc-1 RNA levels (a.u.)
wc-1
4
2
B
0
0
20
dist
60 min
0
20
total
60 min
6
22.58 ± 0.42
Δwc-1,
Pdist-wc-1
21.62 ± 0.35
Δwc-1,
Pprox-wc-1
0.10 ± 0.19
1
2
3
ORFwc-1
PProx
(−924)
Pdist
(−1222)
5′-CCAATT...159...CCAGCCA -3′
Inr
5′-TAATTA...23...GCAGCAT-3′
TATA
Inr
wc-1 Box 1: TCCATCCCGTCTTCCACTTTCCCATCCCGT
wc-1 Box 2: CACATCGATGCCATCCATCCC
luc RNA levels (a.u.)
wc-1 Box 3: CACATCACATCTACCTTATCC
4
2
0
0
20
60 min
wc-1+, Pdist-luc
B Pdist
0
20 60 min
wc-1+, Pprox-luc
Pprox
ORFwc-1
F−1168
F−907
R
Pdist + Pprox
Pdist
Actin
0
20
60 min
Time of light exposure
Fig 4 | Localization of the light-inducible promoter element of the wc-1
gene. (A) Pprox contains a light-responsive element (LRE). wc-1 þ (upper
panel), wc-1 þ , Pdist-luc and wc-1 þ , Pprox-luc (lower panel) were
incubated in constant darkness for 24 h and then transferred to light for
the indicated periods. Upper panel: total wc-1 RNA and Pdist-specific
RNA were measured by quantitative real-time PCR. Lower panel: luc
RNA expressed by the indicated strains was determined by quantitative
RT-PCR. RNA levels before light induction were set equal to unity.
(B) Pprox transcripts are light inducible. Upper panel: schematic outline
showing forward (F) and reverse (R) primers with respect to Pdist and
Pprox. Numbers (907 and 1168) indicate the distance in base pairs
from the AUG. Lower panel: semiquantitative PCR (23 cycles) was
carried out on complementary DNAs prepared from wc-1 þ after light
exposure for the indicated time periods. Actin was used as a control.
In this study, we addressed the transcriptional regulation of
wc-1. We identified three transcription initiation sites in the wc-1
gene. Two sites are located 1,222 and 924 bp upstream of the
&2006 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION
al-3 :
frqdist :
GGTATCGTCATAGCGTGCGGGTATCGAA
frqprox :
TGGATCCGCTCGATCCCC
CTGATGCCGCTCGAAGACCGATGACGC
Fig 5 | Complex transcriptional control of wc-1. (A) Expression of wc-1 by
Pdist and Pprox is required for entrainment. Race tubes were inoculated
with the indicated strains and exposed to 12 h:12 h light:dark cycles.
Conidial densities were plotted versus time. Phases of conidiation peaks
were calculated as zeitgeber time (h; mean7s.e.m.). (B) Regulation of
Pdist and Pprox by the WCC. Upper panel: schematic outline of the wc-1
gene. Pdist and Pprox are indicated. A putative CAAT box, TATA box and
initiator sequences are shown. The grey boxes (Box 1–3) indicate
putative GATN-type binding sites for WCC. Lower panel: sequence
comparison of wc-1 (Box 1–3) and the light-responsive elements of frq
(Froehlich et al, 2002) and al-3 (Carattoli et al, 1994). The arrows
indicate the orientation of GATN elements.
wc-1 ORF and the third site is located within the wc-1 ORF (Fig 5).
Luc reporter assays and analysis of WC-1 expression driven by
different wc-1 gene segments confirmed that the sequences
located upstream of the identified transcriptional start sites exert
promoter activity in vivo. All three transcripts were expressed
under dark and light conditions.
Pdist transcription is strongly dependent on WC-1 in LL and DD,
but is not induced by light. A putative CCAAT box is located
159 bp upstream of the transcription initiation site of Pdist, but no
apparent TATA box is present. A potential GATA-type binding site
for WCC, Box 1, is located 49 bp upstream of the mRNA start (Fig 5).
The spacing of the two CATC repeats comprises 16 bp. The same
repeats with a similar spacing (13 bp) are present in opposite
orientation in the distal LRE of the frq promoter (Froehlich et al,
2002). Although it remains to be investigated whether these
elements are WCC-binding sites, our data show that WC-1
supports its own expression directly or indirectly by Pdist.
The second transcription initiation site, Pprox, is located only
298 bp downstream of Pdist. No additional CCAAT box is present
in Pprox, but the sequence motif TAATTA, 27 bp upstream of the
transcription initiation site, could function as a TATA box. Two
putative WCC-binding sites, Box 2 and Box 3, are located 261 and
184 bp upstream of the initiation site of Pprox. As Box 2 is located
close to the transcription initiation site of Pdist, the two promoters
EMBO reports VOL 7 | NO 2 | 2006 2 0 3
scientific report
may not function completely independent of each other.
Transcription directed by Pprox is independent of WC-1 in DD
but is induced when Neurospora is transferred to light. Light
induction and adaptation of wc-1 are dependent on WCC and the
second Neurospora blue-light photoreceptor Vivid, respectively
(Ballario et al, 1996; Schwerdtfeger & Linden, 2003).
The third promoter, Pint, directs transcription of a message that
starts 175 bp within the wc-1 ORF and encodes an N-terminally
truncated version of WC-1. No consensus promoter elements are
found in the 50 region of the RNA start. Yet, in the absence of Pdist
and Pprox, Pint-specific transcription leads to accumulation of
significant levels of the truncated WC-1 version. In the presence of
Pdist and Pprox, Pint-specific transcripts are detected, but the
truncated WC-1 version does not accumulate in high amounts,
suggesting that it has a reduced stability or is less competent in
WCC assembly. The truncated version of WC-1 is at least partially
functional. wc-1.ORF shows a dampened rhythmicity on race
tubes in DD and synthesis of FRQ is light inducible.
Why is wc-1 transcribed in an apparently complex way using
three differentially regulated promoters? The physiological role of
Pint is obscure. Pprox seems to supply basal levels of wc-1 RNA, and
thus of WC-1, independent of WCC levels. Pprox and Pdist are both
required for adjusting the entrained phase of conidiation. Strains
expressing WC-1 from Pprox or from Pdist alone are rhythmic, but
the entrained phase of conidiation is delayed or advanced,
respectively. Pdist is directly or indirectly activated by WCC. The
physiological significance of this positive feedback of WCC on Pdist
might be to balance WCC and FRQ levels. It has been shown that
such balance is required to ensure robust circadian rhythmicity
(Cheng et al, 2001). Thus, when high levels of FRQ accumulate,
which efficiently repress frq, high levels of WCC seem to be
required to overcome the negative feedback and induce a new
cycle of frq transcription. As FRQ supports accumulation of WCC
on a post-transcriptional level, WCC is an indicator of FRQ
abundance. Thus, a positive feedback regulation of Pdist may allow
accumulation WCC according to FRQ levels.
METHODS
Strains and growth conditions. All strains carried the bd mutation
(Loros et al, 1986). Plasmid constructs were inserted into the his-3
locus and strains were grown as described in the supplementary
information online.
Protein analysis and luciferase activity assay. Extraction of
Neurospora protein and western blotting were carried out as
described (Görl et al, 2001). Conditions of luc assay are given in
the supplementary information online.
RNA analysis. RNA was prepared and analysed by quantitative
RT-PCR or by semiquantitative PCR (Görl et al, 2001). 50 RLMRACE was carried out according to the manufacturer’s instructions
(Ambion Inc., Austin, TX, USA).
Supplementary information is available at EMBO reports online
(http://www.emboreports.org).
ACKNOWLEDGEMENTS
We thank J.J. Loros and J.C. Dunlap for Dwc-2, G. Macino for qa-2pWC-1
and D. Bell-Pedersen for pLUC6dBs. We thank J. Payk and I. Wörz
for excellent assistance. This work was supported by grants from
Deutsche-Forschungsgemeinschaft (BR 1375-1 and SFB 638) and Fonds
der Chemischen Industrie. K.K. was supported by Alexander
von Humboldt-Stiftung and the Hungarian Scholarship Board.
2 0 4 EMBO reports
VOL 7 | NO 2 | 2006
Positive feedback loop of the Neurospora clock gene wc-1
K. Káldi et al
REFERENCES
Ballario P, Vittorioso P, Magrelli A, Talora C, Cabibbo A, Macino G (1996)
White collar-1, a central regulator of blue light responses in Neurospora,
is a zinc finger protein. EMBO J 15: 1650–1657
Carattoli A, Cogoni C, Morelli G, Macino G (1994) Molecular
characterization of upstream regulatory sequences controlling the
photoinduced expression of the albino-3 gene of Neurospora crassa.
Mol Microbiol 13: 787–795
Cheng P, Yang Y, Liu Y (2001) Interlocked feedback loops contribute to the
robustness of the Neurospora circadian clock. Proc Natl Acad Sci USA
98: 7408–7413
Cheng P, Yang Y, Wang L, He Q, Liu Y (2003) WHITE COLLAR-1, a
multifunctional Neurospora protein involved in the circadian feedback
loops, light sensing, and transcription repression of wc-2. J Biol Chem
278: 3801–3808
Diernfellner AC, Schafmeier T, Merrow MW, Brunner M (2005) Molecular
mechanism of temperature sensing by the circadian clock of Neurospora
crassa. Genes Dev 19: 1968–1973
Dunlap JC, Loros JJ (2004) The neurospora circadian system. J Biol Rhythms
19: 414–424
Froehlich AC, Liu Y, Loros JJ, Dunlap JC (2002) White Collar-1, a circadian
blue light photoreceptor, binding to the frequency promoter. Science
297: 815–819
Froehlich AC, Loros JJ, Dunlap JC (2003) Rhythmic binding of a
WHITE COLLAR-containing complex to the frequency promoter
is inhibited by FREQUENCY. Proc Natl Acad Sci USA 100:
5914–5919
Gachon F, Nagoshi E, Brown SA, Ripperger J, Schibler U (2004) The
mammalian circadian timing system: from gene expression to physiology.
Chromosoma 113: 103–112
Görl M, Merrow M, Huttner B, Johnson J, Roenneberg T, Brunner M
(2001) A PEST-like element in FREQUENCY determines the length
of the circadian period in Neurospora crassa. EMBO J 20:
7074–7084
He Q, Cheng P, Yang Y, He Q, Yu H, Liu Y (2003) FWD1-mediated
degradation of FREQUENCY in Neurospora establishes a
conserved mechanism for circadian clock regulation. EMBO J
22: 4421–4430
Heintzen C, Loros JJ, Dunlap JC (2001) The PAS protein VIVID defines
a clock-associated feedback loop that represses light input,
modulates gating, and regulates clock resetting. Cell 104:
453–464
Lee K, Dunlap JC, Loros JJ (2003) Roles for WHITE COLLAR-1 in circadian
and general photoperception in Neurospora crassa. Genetics 163:
103–114
Lee K, Loros JJ, Dunlap JC (2000) Interconnected feedback loops
in the Neurospora circadian system. Science 289:
107–110
Linden H, Macino G (1997) White collar-2, a partner in blue-light signal
transduction, controlling expression of light-regulated genes in
Neurospora crassa. EMBO J 16: 98–109
Liu Y, Garceau NY, Loros JJ, Dunlap JC (1997) Thermally regulated
translational control of FRQ mediates aspects of temperature responses in
the Neurospora circadian clock. Cell 89: 477–486
Loros JJ, Richman A, Feldman JF (1986) A recessive circadian mutation
at the frq locus of Neurospora crassa. Genetics 114:
1095–1110
Merrow M, Franchi L, Dragovic Z, Görl M, Johnson J, Brunner M, Macino G,
Roenneberg T (2001) Circadian regulation of the light input pathway in
Neurospora crassa. EMBO J 20: 307–315
Roenneberg T, Merrow M (2001) Seasonality and photoperiodism in fungi.
J Biol Rhythms 16: 403–414
Schafmeier T, Haase A, Káldi K, Scholz J, Fuchs M, Brunner M (2005)
Transcriptional feedback of Neurospora circadian clock gene by
phosphorylation-dependent inactivation of its transcription factor.
Cell 122: 235–246
Schwerdtfeger C, Linden H (2003) VIVID is a flavoprotein and serves as a
fungal blue light photoreceptor for photoadaptation. EMBO J 22:
4846–4855
Stanewsky R (2003) Genetic analysis of the circadian system in Drosophila
melanogaster and mammals. J Neurobiol 54: 111–147
&2006 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION