This information is current as
of June 17, 2017.
Characterization of cis-Regulatory Elements and
Nuclear Factors Conferring Th2-Specific
Expression of the IL-5 Gene: A Role for a
GATA-Binding Protein
Hyun Jun Lee, Anne O'Garra, Ken-ichi Arai and Naoko Arai
J Immunol 1998; 160:2343-2352; ;
http://www.jimmunol.org/content/160/5/2343
Subscription
Permissions
Email Alerts
This article cites 51 articles, 36 of which you can access for free at:
http://www.jimmunol.org/content/160/5/2343.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 1998 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
References
Characterization of cis-Regulatory Elements and Nuclear
Factors Conferring Th2-Specific Expression of the IL-5 Gene:
A Role for a GATA-Binding Protein1
Hyun Jun Lee,* Anne O’Garra,† Ken-ichi Arai,‡ and Naoko Arai2*
I
nterleukin 5 is a key regulator of growth and differentiation of
eosinophils and thus is implicated in the pathogenesis of eosinophil-associated disorders such as asthma and allergy (1).
The critical role of IL-5 in the pathogenesis of allergic lung disease
has been demonstrated using a mouse asthma model with IL-5deficient mice (2). Thus, understanding the control mechanisms for
IL-5 production could provide important targets for the treatment
of allergic disease. IL-5 is produced mainly by T cells upon activation, and in mice, the expression of IL-5 is restricted to the Th2
subset of helper T cells (3).
The two types of major immune responses, cellular and humoral
immunity, are differentially regulated by distinct sets of cytokines
derived from Th1 and Th2 cells; Th1 cells produce IL-2, IFN-g,
and TNF-b and promote cellular immunity, whereas Th2 cells produce IL-4, IL-5, IL-6, and IL-10, help in B cell functioning, and
also are associated with allergic responses (4 –7). Thus, a proper
balance of Th1 and Th2 responses to a particular Ag or pathogen
is crucial, and dysregulation of Th1 and Th2 responses is often
related to disease states (6, 7). Evidence indicates that Th1 and Th2
cells differentiate from a common precursor (8, 9). Furthermore, it
has been shown that IL-12 and IL-4 play critical roles in Th1 and
Th2 differentiation, respectively (10). Recently, selective expres-
Departments of *Cell Signaling and †Immunobiology, DNAX Research Institute of
Molecular and Cellular Biology, Palo Alto, CA 94304; and ‡Department of Molecular
and Developmental Biology, Institute of Medical Science, University of Tokyo,
Minato-ku, Tokyo, Japan
Received for publication July 10, 1997. Accepted for publication November 6, 1997.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
sion of the IL-12Rb2 subunit on Th1 cells during Th1/Th2 differentiation has been demonstrated, and the regulatory role of IL-4
and IFN-g on this process has been shown (11–13).
The molecular mechanisms underlying differential cytokine production in Th1 and Th2 cells remain unclear. Differences in signal
transduction pathways between Th1 and Th2 cells could result in
differential cytokine production. Several reports have shown that
PGE2, which elevates the intracellular cAMP level, has different
effects on cytokine production in Th1 and in Th2 cells, i.e., it
inhibits cytokine production from Th1 cells but not from Th2 cells
(14, 15). There is also an indication that the cAMP level in Th2
cells is higher than in Th1 cells (16). Other reports suggest that
TCR-mediated calcium influx is selectively impaired in Th2 cells
(17, 18). Selective expression of transactivators or repressors in
Th1 and Th2 cells could also lead to differential cytokine production. However, the possibility of the existence of selective repressors has been refuted by a study showing that somatic cell fusion
of a Th1 and a Th2 clone gives rise to a cell type that produces
both Th1- and Th2-type cytokines (19).
To date, differential expression of two cytokine genes, IL-2 and
IL-4, has been shown to be regulated by differential transcriptional
activity of their promoters in Th1 and Th2 cells (20, 21). The
300-base pair (bp)3 region of the IL-2 promoter can mediate Th1specific expression of the gene (20, 21). However, no cis-regulatory element within this region has been shown to be involved in
differential regulation of the IL-2 gene in Th1 and Th2 cells. Although circumstantial evidence suggests that differential regulation
of NF-kB may be involved in Th1-specific expression of the IL-2
gene (21), no direct evidence has been provided. Extensive studies
have focused on the IL-4 gene, and it has been shown that the
control region of Th2-specific gene activity resides within the
1
DNAX Research Institute of Molecular and Cellular Biology is supported by the
Schering-Plough Corporation.
2
Address correspondence and reprint requests to Dr. Naoko Arai, Department of Cell
Signaling, DNAX Research Institute of Molecular and Cellular Biology, 901 California Avenue, Palo Alto, CA 94304.
Copyright © 1998 by The American Association of Immunologists
3
Abbreviations used in this paper: bp, base pair(s); EMSA, electrophoretic mobility
shift assay; kb, kilobase; Bt2cAMP, N6,O2-dibutyryl cAMP; HPRT, hypoxanthineguanine phosphoribosyltransferase.
0022-1767/98/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Expression of the IL-5 gene is restricted to the Th2 subset of helper T cells. We have previously defined four cis-regulatory
elements of the IL-5 promoter responding to PMA and cAMP in EL-4 cells. We now report that the 1.2-kb region of the IL-5
promoter directs expression of the IL-5 gene in a Th2 clone but not a Th1 clone, indicating that transcription from the IL-5
promoter is Th2 specific. For the functioning of the IL-5 promoter in a Th2 clone, IL-5C and IL-5CLE0 were critical. IL-5CLE0
interacted with both constitutive and inducible nuclear factors (designated NFIL-5CLE0), which existed in both Th1 and Th2
clones, whereas IL-5C interacted with a constitutive nuclear factor (designated NFIL-5C), which was found only in Th2 but not
in Th1 clones. Th2 specificity of NFIL-5C was also confirmed using in vitro-differentiated Th1 and Th2 cells derived from
TCR-transgenic mice. The sequence for NFIL-5C binding bears homology with GATA-binding sites. The NFIL-5C complex was
supershifted by an anti-GATA-3 Ab and inhibited by an oligonucleotide containing GATA-binding sites. We showed preferential
expression of GATA-3 in Th2 cells. Finally, we demonstrated that in vitro-translated GATA-3 bound to IL-5C and overexpression
of GATA-3 augmented stimulation-dependent IL-5 promoter activity in EL-4 cells. Taken together, our results provide evidence
that GATA-related factors may be involved in Th2-specific expression of the IL-5 gene. The Journal of Immunology, 1998, 160:
2343–2352.
2344
MECHANISMS FOR Th2-SPECIFIC EXPRESSION OF THE IL-5 GENE
proximal 800-bp IL-4 promoter (21, 22). Furthermore, the region
spanning 260 to 235 has been shown to confer Th2-specific promoter activity (20). This region has also been shown to interact
with Th2-specific transcription factor c-Maf, thereby controlling
tissue-specific expression of IL-4 (19).
On the other hand, the molecular mechanisms by which Th1 and
Th2 cells differentially express the IL-5 gene remain largely unknown. Using EL-4 cells, we have found that cAMP is essential
for PMA-dependent expression of the IL-5 gene, while it almost
completely inhibits that of the IL-2 gene (23). cAMP exerts its
differential effects on the expression of the IL-2 and IL-5 genes
through the promoter regions. We have previously identified four
cis-regulatory elements (designated IL-5A, IL-5P, IL-5C, and IL5CLE0) (24) that are necessary for full activity of the IL-5 promoter in response to PMA and cAMP signals.
In this study, we examined the cis-regulatory elements and nuclear factors that account for Th2-specific expression of the IL-5
gene, using Th1 and Th2 clones as well as in vitro-generated Th1
and Th2 cells from OVA-specific TCR-transgenic mice.
Reagents
N6,O2-dibutyryl cAMP (Bt2cAMP) was purchased from Sigma Chemical
Co. (St. Louis, MO) and used at final concentrations of 1 mM. PMA,
A23187, and ionomycin were purchased from Calbiochem (La Jolla, CA)
and were used at final concentrations of 50 ng/ml, 0.5 mM, and 1 mM,
respectively.
In vitro synthesis of GATA-3 protein
The plasmid mc5b8 was transcribed from the T7 promoter and translated
in a wheat germ lysate using a TnT-Coupled Transcription/Translation Kit
(Promega) according to the manufacturer’s instruction.
Transfection into Th clones and EL-4 cells
Th clones were transfected with plasmid DNA by electroporation 4 days
after allogenic stimulation. The cells were washed once with serum-free
RPMI 1640, then resuspended at 2.5 3 107 cells/ml. Cell suspensions (0.4
ml, 1 3 107 cells) were incubated with 10 mg of reporter constructs and 1
mg of pRSV-LacZ for 10 min at room temperature and transferred to 0.4
cm electroporation cuvettes (Bio-Rad, Richmond, CA). The cells were
electrophorated using a Bio-Rad Gene Pulser at 310 V and 960 mF and
allowed to recover for 10 min at room temperature. After culture for 24 h
in the fresh medium, the cells were either unstimulated or stimulated with
PMA and A23187 for 16 h and harvested for luciferase as well as b-galactosidase assays.
EL-4 cells (1 3 107 cells) were transfected with 1 mg of reporter plasmid, 4 mg of activator plasmid, and 0.15 mg of pRSV-LacZ by the DEAEdextran method as described previously (23). At 36 h after transfection, the
cells were either unstimulated or stimulated with PMA and ionomycin for
12 h and assayed as above.
Antibodies
The mouse monoclonal anti-GATA-3 Ab (34) was provided by Dr. M.
Yamamoto (University of Tsukuba, Tsukuba, Japan), and the GATA-4 Ab,
GATA-4 (C20), a goat polyclonal Ab, was purchased from Santa Cruz
Biotechnology (Santa Cruz, CA).
Th clones
RNA extraction and RT-PCR analysis
Stimulation and maintenance of Th clones were as described (25).
D10.G4.1 (from Dr. C. Janeway, Yale University, New Haven, CT), a
conalbumin-specific Th2 clone derived from AKR/J mice, and HDK1 (26),
a keyhole limpet hemocyanin-specific Th1 clone derived from BALB/c
mice, were maintained in RPMI 1640 medium supplemented with 2 mM
glutamine, 100 U/ml penicillin, 100 mg/ml streptomycin, 50 mM 2-ME,
200 U/ml mouse rIL-2, and 10% FCS. Th clones were stimulated every 2
wk with irradiated splenic APCs from mice of appropriate haplotype and
specific Ags and cultured for 2 wk before preparation of RNA and nuclear
extracts.
Total cellular RNA was isolated from T cell clones or Th1 and Th2 cells
using a RNeasy kit (Qiagen, Chatsworth, CA). One microgram of total
RNA was reverse transcribed in a 20 ml reaction, and the cDNA samples
were diluted with sterile distilled water. An aliquot of this was used for a
PCR reaction using each pair of sense and antisense primers given in Table
I. The number of PCR cycles and the amount of cDNA were titrated for
each primer set, and then a condition that gave an optimal signal without
saturation was chosen. PCR conditions were 94°C for 2 min, followed by:
20 to 30 cycles of 94°C, 30 s; 60 to 65°C, 30 s; 72°C, 30 s. The PCR
products were separated on agarose gels, stained with CYBR Green (Molecular Probes, Eugene, Oregon), and were then visualized using ImageQuant (Molecular Dynamics, Sunnyvale, CA).
Cytokines, Abs for cytokines, and peptide
Mouse rIL-4 was from Dr. S. Menon (DNAX Research Institute). Mouse
rIL-12 was obtained from PharMingen (San Diego, CA). Purified rat antimouse IL-4, 11B11, (27) was supplied by Dr. J. Abrams (DNAX Research
Institute). Anti-IL-12 mAbs (C17.8) were as described (28). The antigenic
OVA peptide from chicken OVA (OVA323–339) was synthesized on an
Applied Biosystems model 430 peptide synthesizer (Foster City, CA.).
Preparation of nuclear extracts and EMSAs
Preparation and culture of polarized Th1 and Th2 populations from TCRtransgenic mice (D011.10 TCR-ab on a BALB/c genetic background) (29)
were as previously described (30). CD41 T cells were stimulated weekly
with OVA-peptide (OVA323–339, 0.3 mM) presented by irradiated BALB/c
splenic APCs in the presence of IL-12 (10 ng/ml) and anti-IL-4 (11B11, 10
mg/ml), to polarize toward the Th1 phenotype, or IL-4 (10 ng/ml) and
anti-IL-12 (C17.8, 10 mg/ml), to polarize toward the Th2 phenotype.
Cells were treated for 2 h with various reagents, as described in the figure
legends, and nuclear extracts were made as described (35). EMSAs were
performed using the double-stranded oligonucleotides given in Table II.
Each single-stranded oligonucleotide was purified on a denaturing polyacrylamide gel before annealing. The annealed oligonucleotides were 32P
labeled with Klenow fragment and purified on 12% polyacrylamide gels.
The DNA-binding reactions were performed at room temperature for 30
min with 2 to 5 mg of nuclear extracts, 0.5 mg of poly(dI-dC), 10 mM
HEPES (pH 7.9), 10% glycerol, 1 mM EDTA, 1 mM DTT, 100 mM KCl,
and 0.5 ng of probe in a total volume of 10 ml. The samples were resolved
on a 5% nondenaturing polyacrylamide gel at 120 V in 0.53 Tris-borateEDTA buffer, and the results were visualized by autoradiography. Protein
content was determined by the Bradford assay with a kit provided by
Bio-Rad.
Plasmids
Results
pmIL5Luc(1.2), which contains the mouse IL-5 promoter (21174 to 133)
fused to the luciferase gene, as well as the promoterless control pUC00Luc
have been described (23). pmoIL-2-321Luc containing the mouse IL-2
promoter (2327 to 146) fused to the luciferase gene is described in Tsuruta et al. (31), and the linker-scanning mutants of the IL-5 promoter,
LS939/933, LS103/97, LS69/63, and LS57/51, are as previously described
(24). The reference plasmid pRSV-LacZ in which the b-galactosidase gene
is under the control of the Rous sarcoma virus LTR was provided by Dr.
A. Tsuboi (National Institute for Basic Biology, Okazaki, Japan). The plasmid mc5b8 (32), containing the murine GATA-3 in pGEM7Zf (Promega
Corp., Madison, WI), was provided by Dr. D. Engel (Northwestern University, Chicago, IL). pMEGATA3 was prepared by sense insertion of the
Differential expression of the IL-2 and IL-5 genes in the Th1
clone, HDK1, and Th2 clone, D10.G4.1, cells
Transgenic CD41 T cells
The Th1 clone, HDK1, produces IL-2 in response to a T cell activation signal, whereas the Th2 clone, D10.G4.1, produces IL-5
(26). In addition, PMA and calcium ionophore stimulation can
induce IL-5 production to the same extent as anti-CD3 stimulation
in several Th2 clones, such as D10.G4.1 and CDC35 (25).
To verify exclusive expression of the IL-2 gene by HDK1 cells
and of IL-5 by D10.G4.1 cells, we performed sensitive RT-PCR
analysis using RNA from unstimulated and stimulated cells (Fig.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Materials and Methods
EcoRI fragment of GATA-3 cDNA from mc5b8 into the eukaryotic expression vector pME18S (33).
The Journal of Immunology
2345
Table I. Primer sequences used in PCR
Gene
IL-2
IL-5
HPRT
GATA-3
IL-12Rb2
a
b
Stranda
Sequence (59 to 39)
Size of PCR Productb
S
A
S
A
S
A
S
A
S
A
TGATGGACCTACAGGAGCTCCTGAG
GAGTCAAATCCAGAACATGCCGCAG
CCGAGCTCTGTTGACAAGCAATGAGACGAT
CCGTCTCTCCTCGCCACACTTCTCTTTTTG
GTAATGATCAGTCAACGGGGGAC
CCAGCAAGCTTGCAACCTTAACCA
TCTCACTCTCGAGGCAGCATGA
GGTACCATCTCGCCGCCACAG
CGAAATTCAGTACCGACGCTCTCA
GCTGTTTGCTGGATCTGGAATGGT
167
211
214
246
301
S indicates sense strand; A, antisense strand.
The primers have been designed to lie on different exons so that priming of genomic DNA will give products of distinct sizes.
Differential activity of the IL-2 and IL-5 promoters in HDK1
and D10.G4.1 cells
To assess whether the Th2-specific expression of the IL-5 gene is
directly associated with the promoter activity, an IL-5 promoterreporter gene construct was introduced into HDK1 and D10.G4.1
cells by transient transfection, as described in Materials and Methods. An IL-2 promoter construct was also tested in parallel, as a
Th1-specific control. We previously showed that the 1.2-kb promoter region of mouse IL-5 gene was sufficient to induce promoter
activity in EL-4 cells. When introduced into the Th2 clone
D10.G4.1 cells, pmIL5Luc(1.2) containing the 1.2-kb mouse IL-5
promoter showed a substantial inducible luciferase activity in response to PMA and calcium ionophore A23187. In contrast,
pmoIL-2-321Luc containing the 321 bp mouse IL-2 promoter
showed no significant activity relative to that of control pGL2promoter (Promega) in D10.G4.1 cells (Fig. 2).
The reverse was observed when the same constructs were introduced into the Th1 clone HDK1; the IL-2 promoter but not the
IL-5 promoter responded to PMA and A23187. Consistent with the
results obtained with the endogenous IL-5 genes, the HDK1 cells
failed to induce any IL-5 promoter activity, not only when stimulated with PMA and A23187 but also even when stimulated with
a combination of PMA, A23187, and Bt2cAMP (data not shown).
These results suggest that the 300-bp region of the IL-2 promoter
and the 1.2-kb region of the IL-5 promoter can mediate the transcriptional specificity of their respective genes in Th1 and
Th2 cells.
IL-5C and IL-5CLE0 are critical for promoter activity in
D10.G4.1 cells
The differential ability of D10.G4.1 and HDK1 cells to induce IL-5
promoter activity may result from selective expression of an essential positive factor(s) or a repressor(s) in respective cell types.
To address this hypothesis, we investigated possible positive or
negative elements in the IL-5 promoter by mutation analysis. We
had previously defined four cis-regulatory elements—IL-5A, IL5P, IL-5C, and IL-5CLE0 — of the IL-5 promoter responding to
PMA and Bt2cAMP in EL-4 cells (Fig. 3A). To examine whether
any of these cis elements was responsible for Th2-specific activation of the IL-5 promoter, four luciferase reporter plasmids, each
carrying a mutation in one of the four elements, i.e., IL-5A
(LS939/933), IL-5P (LS103/97), IL-5C (LS69/63), and IL-5CLE0
(LS57/51) (Fig. 3A), were transiently transfected into HDK1 and
D10.G4.1 cells. Constructs containing a mutation in either IL-5A
or IL-5P still retained IL-5 promoter activity, albeit at a reduced
level, whereas mutations in either IL-5C or IL-5CLE0 abrogated
IL-5 promoter activity in response to PMA and A23187 in
D10.G4.1 cells (Fig. 3B). Thus, both IL-5C and IL-5CLE0 are
essential for promoter activity in D10.G4.1 cells, while the IL-5A
and IL-5P are required for optimal activity. On the other hand,
none of these constructs was activated in HDK1 cells, suggesting
that cis-acting repressor elements may not reside within these
four sites.
Table II. Oligonucleotide probes used in EMSAa
Name
74-38
IL-5C
IL-5CLE0
NF-kB (31)c
TaGATA (39)
Sp1 (52)
a
b
c
Sequenceb
59-tcgaCCTCTATCTGATTGTTAGCAATTATTCATTTCCTCAG-39
59-tcgaGGTGTCCTCTATCTGATTGTT-39
59-tcgaGTTAGCAATTATTCATTTCCTCAGA-39
59-gatcAAGAGGGATTTCACCTAAATg-39
59-GTTAGAGATAGCATCGCCCCA-39
59-ggATTCGATCGGGGCGGGGCGAGC-39
Uppercase nucleotides are derived from the promoter sequence, and lowercase nucleotides indicate overhang sequences, respectively.
Only the sense strands are depicted.
Numbers in parentheses are references.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
1). The Th1 clone, HDK1, expressed IL-2 but not IL-5 in response
to PMA and ionomycin stimulation, whereas the Th2 clone,
D10.G4.1, expressed IL-5 and a barely detectable amount of IL-2.
We have previously reported that cAMP activated the IL-5 gene
synergistically with PMA, whereas it suppressed PMA-induced
IL-2 transcription in EL-4 cells (23). There are also other indications suggesting involvement of the cAMP signal in IL-5 production (14, 15, 25, 36, 37). However, HDK1 (Th1) cells did not
transcribe the IL-5 gene even in the presence of cAMP, although
its inhibitory effect on IL-2 gene expression could be detected.
Unlike EL-4 cells in which the cAMP signal is essential for IL-5
expression, D10.G4.1 (Th2) cells expressed a considerable amount
of IL-5 with PMA and calcium ionophore stimulation alone, and
cAMP had only an augmenting effect.
2346
MECHANISMS FOR Th2-SPECIFIC EXPRESSION OF THE IL-5 GENE
FIGURE 1. RT-PCR analysis of IL-2 and IL-5 gene expression in
HDK1 and D10.G4.1 cells. HDK1 and D10.G4.1 cells were either unstimulated (2) or stimulated for 6 h with PMA and ionomycin (1) or PMA
and ionomycin plus Bt2cAMP (11). Total RNA was prepared, and RTPCR analysis was performed as described in Materials and Methods. Amplification products corresponding to IL-2, IL-5, and HPRT are indicated.
The data are representative of three separate experiments using at least two
independent cDNA preparations.
The essential role of IL-5C and IL-5CLE0 for IL-5 promoter activity suggests that in Th1 cells, the lack of IL-5 promoter activity
FIGURE 3. Mutation analysis of the 59-upstream region of the IL-5 promoter. A, Schematic representation of the murine IL-5 promoter. The 1.2-kb
promoter region and the positions of the functional cis elements, IL-5A, IL-5P, IL-5C, and IL-5CLE0, are shown as solid boxes. The nucleotide sequence
of the IL-5 gene from 21174 to 133 is depicted. The IL-5 promoter constructs LS939/933, LS103/97, LS69/63, and LS57/51 contain mutations on the
positions of IL-5A, IL-5P, IL-5C, and IL-5CLE0, respectively, in the context of the 1.2-kb promoter. B, Effect of mutation on the cis-regulatory elements
of the IL-5 promoter on the promoter activity. HDK1 and D10.G4.1 cells were transiently transfected with the IL-2 promoter-luciferase construct and the
IL-5 promoter-luciferase constructs depicted in A. After a 24-h incubation, cells were either untreated (open bars) or stimulated for 16 h with PMA and
A23187 (solid bars), then harvested for luciferase assays. The activity of pUC00Luc without stimulation was assigned a value of 1.0; promoter activity was
expressed as relative fold increase over pUC00Luc activity after normalization for b-galactosidase activity of pRSV-LacZ. The results are typical of at least
three independent experiments.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Differential binding of nuclear factors to the 274 to 238 region
in HDK1 (Th1) and D10.G4.1 (Th2) cells
FIGURE 2. Analysis of IL-2 and IL-5 promoter activity in the Th1 and
Th2 cells. HDK1 and D10.G4.1 cells were transiently transfected with
control plasmid pUC00Luc, IL-5 promoter construct pmIL5Luc(1.2), or
IL-2 promoter construct pmoIL-2-321Luc and then were split into three
groups. After a 24-h incubation, cells were either unstimulated (open bars)
or stimulated for 16 h with PMA and A23187 (solid bars), then harvested
for luciferase assays. The activity of pGL2-promoter without stimulation
was assigned a value of 1.0; promoter activity was expressed as relative
fold increase over pGL2-promoter activity after normalization for b-galactosidase activity of pRSV-LacZ. The results are typical of at least three
independent experiments.
The Journal of Immunology
may be due to the absence of factors operating on these sites.
Since, in many cases, cell type-specific gene expression is controlled by cell type-specific transcription factors, we examined
whether IL-5C and IL-5CLE0 interact with DNA-binding proteins in a Th2-specific manner. Since no clear boundary between these two elements has been identified, we initially used
the 274 to 238 region, which includes both IL-5C and IL5CLE0 (74 –38, Fig. 4A), as a probe in EMSA. Nuclear extracts
from D10.G4.1 cells stimulated with PMA and ionomycin
formed four principal complexes with the 74 –38 probe (I, II,
III, and IV, Fig. 4B, lane 4). Comparing the electrophoretic
profile of unstimulated (lane 3) and stimulated (lane 4)
D10.G4.1 nuclear extracts, the amount of complex II and III
was increased in stimulated D10.G4.1 cells (lane 4), whereas
the amount of complex I and IV was not changed upon stimulation. In HDK1 cells, which did not express the IL-5 gene (Fig.
1), formation of complex I, II, and III and the inducibility of
complex II and III were also detected (lanes 1 and 2). Interestingly, however, complex IV was not detected in HDK1 cell
nuclear extracts, raising the possibility that a component(s) of
the complex is Th2 specific. Other minor complexes with different mobility could be detected, but their appearance was
variable depending on the different nuclear extract preparations.
NF-kB binding, as a control, was detected in both cell types
(lanes 5– 8). Consistent with previous reports, the ratio of the
p65/50 form to p50/50 is higher in HDK1 cells than D10.G4.1
cells (21).
FIGURE 5. Localization of the binding site for complex I, II, III, and
IV. A, Alignment and sequences of the probes. mutIL-5C and mutIL5CLE0 mutant forms of the 74 –38 probe, which contain 3-bp mutations in
IL-5C and IL-5CLE0, respectively. Sequences are aligned with the wildtype, and identical bases are denoted by dashes. B, Competition of nuclear
factors binding to the 274 to 238 region. EMSAs were performed with
PMA-ionomycin-stimulated D10.G4.1 extracts in the absence (2) or presence of a 100-fold molar excess of indicated unlabeled oligonucleotides. C,
NFIL-5C and NFIL-5CLE0 bind to IL-5C and IL-5CLE0, respectively.
EMSAs were performed with PMA-ionomycin-stimulated D10.G4.1 extracts and the 74 –38, IL-5C, or IL-5CLE0 probes in the absence (2) or
presence of a 100-fold molar excess of indicated unlabeled oligonucleotides. The positions of four complexes that bind to the 74 –38 probe and of
the NFIL-5C and NFIL-5CLE0 complexes are indicated.
NFIL-5C and NFIL-5CLE0 bind to IL-5C and IL-5CLE0,
respectively
To check the sequence specificity for each complex, segments of
the sequence of the 74 –38 probe were mutated and tested for their
effects on complex formation (Fig. 5A). All four complexes were
effectively inhibited by the addition of unlabeled wild-type 74 –38
oligonucleotide (Fig. 5B, lane 2). Interestingly, addition of mutIL5C, which contains a 3-bp substitution on the IL-5C element, inhibited complex I, II, and III but not IV (lane 3). On the other
hand, addition of mutIL-5CLE0, which contains a 3-bp substitution on IL-5CLE0, inhibited complex IV but not I, II, and III (lane
4). The control NF-kB oligonucleotide did not affect any of these
complexes (lane 5). Thus, it appeared that complex I, II, and III
bound to IL-5CLE0, whereas complex IV bound to IL-5C. To
further confirm this conclusion, we next used two smaller overlapping oligonucleotides for the binding competition assay. As expected, the IL-5C oligonucleotide (Fig. 5A, residues 274 to 254)
was able to inhibit complex IV as effectively as the 74 –38 oligonucleotide, but not complex I, II, and III (Fig. 5C, lane 3), whereas
the IL-5CLE0 oligonucleotide (Fig. 5A, residues 261 to 236) inhibited complex I, II, and III but not complex IV (lane 4). A direct
binding assay also showed that the IL-5C probe formed a complex
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 4. Cell type-specific nuclear factor binding to the 274 to 238
region. A, Sequences of 274 to 238 region. IL-5C and IL-5CLE0 are
boxed. Nucleotides are numbered relative to the transcriptional start site. B,
EMSAs using nuclear extracts from Th1 and Th2 clones. Nuclear extracts
from HDK1 and D10.G4.1 cells either unstimulated (2) or stimulated for
2 h with PMA and ionomycin (1) were incubated with the 74 –38 and
NF-kB probes. The resulting DNA-protein complexes were resolved from
free probes by electrophoresis. The positions of complex I, II, III, and IV,
which bound to the 74 –38 probe, and the NF-kB complexes p65/p50 and
p50/p50 are indicated.
2347
2348
MECHANISMS FOR Th2-SPECIFIC EXPRESSION OF THE IL-5 GENE
FIGURE 6. NFIL-5C-binding activity is Th2
specific. A, NFIL-5C-binding activity in T cell
clones. Nuclear extracts from HDK1 and
D10.G4.1 cells either unstimulated (2) or stimulated with PMA and ionomycin (1) were incubated with the IL-5C probe. The position of the
NFIL-5C complex is indicated by an arrow. B,
NFIL-5C-binding activity in Th1 and Th2 cells.
Nuclear extracts prepared from 1-wk polarized
Th1 and Th2 cells either unstimulated (2) or stimulated with PMA and A23187 (1) were incubated
with the IL-5C or Sp1 probes. The positions of the
NFIL-5C and Sp1 complexes are indicated by arrows. Consistent results were obtained with 2-wk
polarized Th1 and Th2 cells.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
with a nuclear factor(s) (designated NFIL-5C) that migrated with
mobility similar to complex IV (lane 5), whereas the IL-5CLE0
probe formed complexes with nuclear factors (designated NFIL5CLE0) that migrated with mobility similar to complex I, II, and
III (lane 6). The slight difference in mobility between the complex
IV and NFIL-5C may be caused by the different configuration of
protein-DNA complexes between the probes, since a similar difference was also observed in EMSA using in vitro-translated
GATA-3 proteins (data not shown). The difference in mobility of
the protein-DNA complex, depending on the location of the binding site on DNA, has been demonstrated in a GATA protein (38).
NFIL-5C-binding activity is Th2 cell specific
We next examined the Th1 and Th2 specificity of NFIL-5C by
EMSAs using nuclear extracts from HDK1 and D10.G4.1 cells
either unstimulated or stimulated with PMA and ionomycin. The
NFIL-5C complex appeared constitutively only in nuclear extracts
from D10.G4.1 cells but not from HDK1 cells (Fig. 6A). To confirm that these were not artifacts instilled by long-term culture, we
further verified the Th2 specificity of NFIL-5C using freshly generated Th1 and Th2 cells. Th1 and Th2 cells were generated in
vitro from CD41 T cells derived from OVA-specific transgenic
mice as described in Materials and Methods. EMSAs using nuclear extracts from Th1 and Th2 cells revealed that the appearance
of the NFIL-5C complex is restricted to Th2 cells (Fig. 6B, lanes
4 and 5) and absent from Th1 cells (lanes 2 and 3) regardless of
stimulation. Sp1 binding was detected in both cell types (lanes
6 –9). These results demonstrated that NFIL-5C is a Th2-specific
factor(s) and also strongly suggested that NFIL-5C plays a role in
regulating the expression of the IL-5 gene in a Th2 cell-specific
manner.
NFIL-5C contains a GATA protein
To identify specific bases critical for NFIL-5C complex formation,
serial 3-bp mutations were introduced in the IL-5C site (Fig. 7A)
and tested for effects on complex formation by binding competition analysis. Addition of Cm1, Cm2, and IL-5CLE0 oligonucleotides failed to inhibit binding (Fig. 7B, lanes 4 –7 and 12),
whereas addition of Cm3 and Cm4 oligonucleotides inhibited
binding as effectively as the wild-type IL-5C oligonucleotide (Fig.
FIGURE 7. Identification of the protein-binding sequence. A, Location
of the nucleotides substituted in Cm1 to Cm4. The sequences are aligned
with the wild-type IL-5C sequence, and identical bases are denoted by
dashes. The double GATA sequences and bases critical for NFIL-5C binding are indicated by boxes and a solid bar, respectively. B, Competition
assays with mutant oligonucleotides. Nuclear extracts from D10.G4.1 cells
stimulated with PMA and ionomycin were incubated with the IL-5C probe
in the absence (2) or presence of a 25- or 100-fold molar excess of unlabeled wild-type (WT) or mutant IL-5C, as depicted in A.
The Journal of Immunology
2349
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
7B, compare lanes 2 and 3 with lanes 8 –11). Similarly, the oligonucleotide containing the mutations at position 273 to 271 inhibited the binding (data not shown). These results indicate that
residues 269 through 263 were essential for NFIL-5C binding. It
is important to note that these sequences contain overlapping binding sites for GATA proteins (Fig. 7A).
Thus, we examined whether NFIL-5C is related to GATA proteins by competition EMSAs with an oligonucleotide (TaGATA)
containing a GATA-3 binding site from the human T cell receptor
a-chain gene enhancer (39). NFIL-5C complex formation was inhibited by addition of excess TaGATA as well as IL-5C oligonucleotides (Fig. 8A, lanes 2 and 3), but not by the IL-5CLE0 oligonucleotide (lane 4). Conversely, the unlabeled IL-5C
oligonucleotide was able to inhibit the formation of the DNAprotein complex when the labeled TaGATA probe was used
(lane 7).
It has been shown that the oligonucleotides containing IL-5C
interact with GATA-3 in EL-4 cells (40) and GATA-4 in ATL-16T
cells (41), a T cell line derived from an adult T cell leukemia
patient. We examined whether the NFIL-5C complex contains
GATA-3 or GATA-4 by supershift EMSAs (Fig. 8B). The
NFIL-5C complex from both D10.G4.1 and in vitro-generated Th2
cell nuclear extracts was supershifted by an Ab specific for
GATA-3 (34) (lanes 2 and 5), but not by an Ab raised against
GATA-4 (lanes 3 and 6). Another GATA-4 antiserum that does
not cross-react with GATA-1, -2, or -3 (42) did not supershift the
NFIL-5C complex (data not shown). Similar results were obtained
with the TaGATA probe (data not shown). These Abs did not
supershift the NF-kB complexes (lanes 8 and 9).
Differential expression of GATA-3 in Th1 and Th2 cells
Supershift EMSA results indicated that the Th2-specific nuclear
factor NFIL-5C is GATA-3 or a related protein(s). Thus, we next
examined whether GATA-3 is differentially expressed in Th1 and
Th2 cells. RT-PCR analysis was performed using RNA from unstimulated and stimulated Th1 and Th2 clones as well as in vitrogenerated TCR-transgenic Th1 and Th2 cells (Fig. 9A). GATA-3
expression was detected only in the Th2 clone, D10.G4.1 cells, but
not in the Th1 clone, HDK1 cells. To compare the level of
GATA-3 transcripts in HDK1 and D10.G4.1 cells, we titrated the
amount of cDNA in PCR reactions. As shown in Figure 9B,
D10.G4.1 cells express a significantly higher level of GATA-3
than HDK1 cells, while both cells express a comparable level of
HPRT transcripts. This differential expression of GATA-3 was
also observed in Ag-specific Th2 and Th1 cells obtained from the
TCR-transgenic mice (Fig. 9A). These data are in keeping with
recent findings from Zheng and Flavell (43). In contrast, IL-12Rb2
transcripts were detected in HDK1 and Th1 cells but not in
D10.G4.1 and Th2 cells, as previously reported (12, 13). As expected, IL-5 expression was restricted to D10.G4.1 and Th2 cells.
GATA-3 binds the IL-5C element and directly regulates the IL-5
promoter via the IL-5C element
We next asked whether GATA-3 directly regulates IL-5 promoter
activity through the IL-5C element. First, we determined whether
recombinant GATA-3 can bind to IL-5C. We prepared murine
GATA-3 proteins by in vitro transcription and translation using a
wheat germ system and tested their ability to bind IL-5C. The
IL-5C probe formed a DNA-protein complex with wheat germ
extracts from in vitro transcription and translation reactions programmed with recombinant GATA-3, but not with those programmed with the control vector (Fig. 10A, lanes 1 and 2). The
complex formation was inhibited by addition of the wild-type
(WT) IL-5C oligonucleotide (lane 3) but not by the Cm1 oligo-
FIGURE 8. Component of the NFIL-5C complex. A, Cross-competition
assays. Nuclear extract D10.G4.1 cells stimulated with PMA and ionomycin were incubated with the IL-5C and TaGATA probes in the absence (2)
or presence of a 100-fold molar excess of unlabeled competitor nucleotides
as indicated. B, The NFIL-5C complex contains GATA-3. Nuclear extracts
prepared from D10.G4.1 cells treated with PMA and ionomycin and from
in vitro-differentiated TCR-transgenic Th2 cells stimulated with PMA and
A23187 (1) were preincubated with specific Abs to GATA-3 and GATA-4
for 1 h, followed by binding assays with IL-5C and NF-kB probes. Supershifted complexes are indicated by an asterisk (*).
nucleotide (lane 4), which failed to bind NFIL-5C (Fig. 7B). Thus,
we concluded that GATA-3 binds to the IL-5C site in a sequencespecific manner.
2350
MECHANISMS FOR Th2-SPECIFIC EXPRESSION OF THE IL-5 GENE
We next investigated whether GATA-3 can directly activate the
IL-5 promoter. EL-4 cells were cotransfected with an expression
plasmid containing the murine GATA-3 cDNA and the IL-5 promoter construct. Overexpression of GATA-3 per se, without stimulation, did not activate the IL-5 promoter. However, overexpression of GATA-3 augmented stimulation-dependent IL-5 promoter
activity as much as sixfold as compared with cotransfection of
control plasmid pME18S (Fig. 10B). The transactivation of the
IL-5 promoter by GATA-3 required the IL-5C element, since
GATA-3 did not transactivate LS69/63, which contains a mutation
in IL-5C. Taken together with the results from the in vitro binding
assay, these result suggest that GATA-3 regulates the IL-5 promoter by direct interaction with the IL-5C site, but is not sufficient
by itself to activate the IL-5 promoter.
Discussion
The molecular mechanisms by which Th1 and Th2 cells produce
different cytokines remain largely unknown. Extensive studies
have focused on the IL-4 gene (20 –22, 44, 45). The proto-oncogene c-maf, which has been shown to be selectively expressed in
Th2 cells (19), transactivates the IL-4 promoter through the Maf
recognition element (MARE). However, the Th2-specific association of c-Maf with this element was not demonstrated. More recently, Zheng and Flavell have shown that GATA-3 is selectively
expressed in Th2 cells (43) and is involved in Th2 cytokine gene
expression. However, they did not define any functional cis-regulatory elements of the Th2 cytokine genes with which GATA-3
might interact.
FIGURE 10. GATA-3 binds to the IL-5C element and transactivates the
IL-5 promoter. A, Recombinant GATA-3 binds to the IL-5C element. The
IL-5C probe was incubated with wheat germ extracts from in vitro transcription, and translation reactions were programmed with either mc5b8
containing recombinant GATA-3 (rGATA-3) or with the control vector
pGEM7Zf (CTR) in the absence (2) or presence of 50-fold molar excess
of the unlabeled wild-type (WT) or mutant (Cm1) IL-5C oligonucleotides
depicted in Figure 7A. The position of the GATA-3 complex is indicated.
B, Overexpression of GATA-3-augmented stimulation-dependent IL-5 promoter activity. The IL-5 promoter constructs pmIL5Luc(1.2), wild-type,
and LS69/63, which contains a mutation in IL-5C, were cotransfected with
either the expression vector pMEGATA3 containing the murine GATA-3
cDNA or the control pME18S into EL-4 cells. After a 36-h incubation, the
cells were either unstimulated (2) or stimulated for 12 h with PMA and
ionomycin (1), then assayed for luciferase activity. The result represents
the mean value of duplicated transfections and is typical of three independent experiments.
Here, we provide strong evidence that Th2-specific expression
of the IL-5 gene is controlled by the interaction of a Th2-specific
transcription factor with the critical cis element of the gene. Using
Th1 clone HDK1 and Th2 clone D10.G4.1 as a model system, we
explored the molecular mechanisms underlying differential expression of the IL-5 gene in Th1 and Th2 cells. First, we confirmed, by
sensitive RT-PCR assays, that induction of IL-5 gene transcription
was restricted to D10.G4.1 cells and that cell type-specific expression of the IL-5 gene was directly associated with the inducibility
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 9. Expression of GATA-3 in Th1 and Th2 cells. A, Total RNA
was isolated from HDK1, D10.G4.1, Th1, and Th2 cells unstimulated (2)
or stimulated for 6 h with PMA and ionomycin (1). RT-PCR analysis was
performed using the primers listed in Table II, as described in Materials
and Methods. Amplification products corresponding to GATA-3, IL-5, IL12bR2, and HPRT are indicated. The data are representative of three separate occasions using at least two independent cDNA preparations. B, PCR
amplification was done with serially diluted cDNA derived from HDK1
and D10.G4.1 cells using GATA-3 and HPRT primers.
The Journal of Immunology
FIGURE 11. Model for the involvement of NFIL-5C and NFIL-5CLE0
in Th2-specific transcription of the IL-5 gene. Distribution of NFIL-5C is
restricted to Th2 cells during Th1 and Th2 development. The TCR signal
can induce NFIL-5CLE0 in both Th1 and Th2 cells. As both IL-5C and
IL-5CLE0 are essential for IL-5 promoter activity, the IL-5 gene can be
expressed in Th2 cells only upon stimulation.
closely related but not identical to GATA-3. Further in vivo and in
vitro experiments will be required to clarify this question.
Mutational analysis indicated that not only IL-5C but also IL5CLE0 was indispensable for IL-5 promoter activity. In contrast to
NFIL-5C, NFIL-5CLE0 was induced by stimulation in both HDK1
and D10.G4.1 cells. However, we cannot rule out the possibility
that the components and/or modification status of the NFIL5CLE0 complex may not be exactly the same between Th1 and
Th2 cells, resulting in differential IL-5 gene transcription. Interestingly, Naora et al. reported that the oligonucleotide containing
IL-5CLE0 interacted with an inducible nuclear factor present in
D10.G4.1 cells but not in HDK1 cells, using their specific stimulation and binding conditions (51). Thus, it may be possible to
distinguish the Th2-specific component(s), if any, within the
NFIL-5CLE0 complex under the conditions they used. Further biochemical analysis will be required to clarify the components of
NFIL-5CLE0 and its role in Th2-specific expression of IL-5.
Since both IL-5C and IL-5CLE0 are essential for the functioning of the IL-5 promoter, cells that have both NFIL-5C and NFIL5CLE0 can support promoter activation (Fig. 11). Unstimulated
Th1 cells in which neither IL-5C nor IL-5CLE0 is occupied are
unable to induce IL-5 promoter activity. Upon stimulation, NFIL5CLE0 complex formation is induced, but is still insufficient for
IL-5 promoter activation. Similarly, occupation of IL-5C by
NFIL-5C in unstimulated Th2 cells is not sufficient for promoter
activity. Further occupation of IL-5CLE0 by NFIL-5CLE0 after
stimulation is needed to trigger promoter activation. This notion is
in good agreement with the expression profile of the GATA-3 and
IL-5 as well as the result from cotransfection of GATA-3, indicating that both GATA-3 and stimulation-dependent factors are
required to activate the IL-5 gene. Currently, we do not know how
NFIL-5C and NFIL-5CLE0 cooperate to activate the IL-5 promoter. It is possible that binding of both sites may trigger the
recruitment of additional factors, such as coactivator and/or transcription initiation machinery, to turn on the IL-5 promoter. Further studies will be required to address this hypothesis.
It is important to note that the cis-regulatory elements that are
essential for the IL-5 promoter to respond to PMA and cAMP in
EL-4 cells (24) are also critical in D10.G4.1 cells. The sequences
within the IL-5CLE0 and IL-5C are highly conserved between
human and mouse IL-5 genes, and these elements are also important for the functioning of the human promoter when assessed in
EL-4 cells (24). Thus, it appears that the principal regulatory elements of the IL-5 gene are conserved between the human and
mouse.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
of the promoter in D10.G4.1 cells but not HDK1 cells. We further
demonstrated that IL-5C and IL-5CLE0 were critical for the function of the IL-5 promoter in D10.G4.1 cells. Moreover, IL-5C
interacts with the D10.G4.1 cell-specific nuclear factor (NFIL-5C),
which is related to GATA-3. Finally, we show that GATA-3 is
preferentially expressed in D10.G4.1 (Th2) cells. Importantly,
these findings were not limited to HDK1 and D10.G4.1 cells. We
further confirmed our results using freshly generated TCR-transgenic Th1 and Th2 cells (30), which strongly suggests that this is
not a phenomenon restricted to Th clones carried long-term
in vitro.
Sequence similarity between the binding sequence of NFIL-5C
and GATA protein consensus and cross-competition for binding
between IL-5C and TaGATA suggest that the NFIL-5C complex
contains GATA proteins. Involvement of GATA proteins in IL-5
gene transcription through IL-5C has also been shown in other
systems using tumor cell lines (40, 41). GATA-3 seems to be the
major component of the NFIL-5C complex, since most of the complex was supershifted by anti-GATA-3 Ab. This notion is in good
agreement with our RT-PCR results showing that the expression
profile of GATA-3 in these cells was closely correlated with the
appearance of the NFIL-5C complex. Indeed, recombinant
GATA-3 could bind to IL-5C specifically and activated the IL-5
promoter via the IL-5C element. These results, together with the
overlapping expression profile of the GATA-3 and the IL-5 genes,
suggest that GATA-3 may control Th2-specific expression of the
IL-5 gene through IL-5C. GATA proteins are a group of transcription factors with a C4 zinc finger DNA-binding domain that recognizes the consensus sequence A/TGATAG/A as well as some
related sequences (46). GATA-3 is preferentially expressed in the
T cell hemopoietic lineage and plays an important role in T cell
development (47). Functional GATA sites have been identified on
the enhancers of several T cell-specific genes including the
TCR (48).
Our results are in agreement with the recent report by Zheng and
Flavell that identified GATA-3 as a gene selectively expressed in
Th2 cells by cDNA subtraction between in vitro-generated Th1
and Th2 cells (43). Their antisense as well as transgenic results
suggest clear involvement of GATA-3 in the expression of Th2
cytokine genes such as IL-4, IL-6, IL-10, and IL-13, but the effect
of a reduced level of GATA-3 on IL-5 expression was minimal in
the antisense GATA-3-expressing D10 cells. However, our results
suggest that IL-5C is absolutely required for the IL-5 promoter
activity in D10 cells. The results from Zheng and Flavell (43)
indicate that the difference in the level of GATA-3 in the control
D10 cells and the antisense GATA-3-expressing D10 cells is not as
dramatic as that seen in Th1 and Th2 clones. Their results also
clearly showed increased expression of the IL-5 gene, albeit to a
lesser extent than IL-4, IL-6, or IL-10, in IL-12-driven Th1 cells
obtained from GATA-3-transgenic mice. Zheng and Flavell (43)
also demonstrated that TCR expression levels were not altered by
a reduced expression of GATA-3 and that the extent of inhibition
was different among Th2 cytokines. Thus, the GATA site of each
of these genes may have a different affinity for GATA-3, and the
range of the GATA sites being occupied may depend on the level
of GATA-3 expression. In this respect, it is interesting to note that
the IL-5C sequence comprises the inverted overlapping GATA-3binding sites with high affinity (39 part) and intermediate affinity
(59 part) (49). It has been reported that double GATA sites often
have higher affinity for GATA proteins (50). In addition, chromatin accessibility and interaction with other factors could also affect
preferential association of GATA-3 with each target site in vivo.
Alternatively, the NFIL-5C complex may consist of other factors
2351
2352
MECHANISMS FOR Th2-SPECIFIC EXPRESSION OF THE IL-5 GENE
Taken together, our studies dissect the critical regulatory mechanisms for IL-5 expression, which may provide not only an insight
into the pathogenesis of IL-5-associated allergic diseases but also
the potential for alternative approaches to therapy. Furthermore,
this system will provide a useful tool for studying the mechanisms
for differential regulation of cytokine genes in Th1 and Th2 cells.
Acknowledgments
We thank Drs. Esteban S. Masuda, Dan Chen, Alice Mui, and Douglas
Robinson for critical reading of the manuscript and for helpful discussions;
Drs. Yumiko Kamogawa and Lisako Tsuruta for helpful discussions; and
Debra Ligget for synthesizing oligonucleotides. We thank Drs. Hideharu
Endo, Akio Tsuboi, Douglas Engel, Masayuki Yamamoto, and David Wilson for generous gifts of the nuclear extracts, pRSV-LacZ, mc5b8, antiGATA-3 Ab, and anti-GATA-4 Ab, respectively. We also thank Dr. Dovie
Wylie for reading the manuscript.
25.
26.
27.
28.
29.
30.
31.
References
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
1. Sanderson, C. J. 1992. Interleukin-5, eosinophils, and disease. Blood 79:3101.
2. Foster, P. S., S. P. Hogan, A. J. Ramsay, K. I. Matthaei, and I. G. Young. 1996.
Interleukin 5 deficiency abolishes eosinophilia, airways hyperreactivity, and lung
damage in a mouse asthma model. J. Exp. Med. 183:195.
3. Mosmann, T. R., H. Cherwinski, M. W. Bond, M. A. Giedlin, and R. L. Coffman.
1986. Two types of murine helper T cell clone. I. Definition according to profiles
of lymphokine activities and secreted proteins. J. Immunol. 136:2348.
4. Mosmann, T. R., and R. L. Coffman. 1989. TH1 and TH2 cells: different patterns
of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7:145.
5. Mosmann, T. R., and K. W. Moore. 1991. The role of IL-10 in cross-regulation
of Th1 and Th2 responses. Immunol. Today 12:A49.
6. Romagnani, S. 1994. Lymphokine production by human T cells in disease states.
Annu. Rev. Immunol. 12:227.
7. Abbas, A. K., K. M. Murphy, and A. Sher. 1996. Functional diversity of helper
T lymphocytes. Nature 383:787.
8. Rocken, M., J. H. Saurat, and C. Hauser. 1992. A common precursor for CD41
T cells producing IL-2 or IL-4. J. Immunol. 148:1031.
9. Kamogawa, Y., L.-A. E. Minasi, S. R. Carding, K. Bottomly, and R. A. Flavell.
1993. The relationship of IL-4 and IFN-g-producing T cells studied by lineage
ablation of IL-4 producing cells. Cell 75:985.
10. O’Garra, A., and K. Murphy. 1994. Role of cytokines in determining T-lymphocyte function. Curr. Opin. Immunol. 6:458.
11. Szabo, S. J., N. G. Jacobson, A. S. Dighe, U. Gubler, and K. M. Murphy. 1995.
Developmental commitment to the Th2 lineage by extinction of IL-12 signaling.
Immunity 2:665.
12. Szabo, S. J., A. S. Dighe, U. Gubler, and K. M. Murphy. 1997. Regulation of the
interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Th1) and
Th2 cells. J. Exp. Med. 185:817.
13. Rogge, L., M. L. Barberis, M. Biffi, N. Passini, D. H. Presky, U. Gubler, and
F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component
by human T helper 1 cells. J. Exp. Med. 185:825.
14. Betz, M., and B. S. Fox. 1991. Prostaglandin E2 inhibits production of Th1
lymphokines but not of Th2 lymphokines. J. Immunol. 146:108.
15. Snijdewint, F. G., P. Kalinski, E. A. Wierenga, J. D. Bos, and M. L. Kapsenberg.
1993. Prostaglandin E2 differentially modulates cytokine secretion profiles of
human T helper lymphocytes. J. Immunol. 150:5321.
16. Novak, T. J., and E. V. Rothenberg. 1990. cAMP inhibits induction of interleukin
2 but not of interleukin 4 in T cells. Proc. Natl. Acad. Sci. USA 87:9353.
17. Gajewski, T. F., S. R. Schell, and F. W. Fitch. 1990. Evidence implicating utilization of different T cell receptor-associated signaling pathways by TH1 and
TH2 clones. J. Immunol. 144:4110.
18. Gajewski, T. F., D. W. Lancki, R. Stack, and F. W. Fitch. 1994. “Anergy” of TH0
helper T lymphocytes induces downregulation of TH1 characteristics and a transition to a TH2-like phenotype. J. Exp. Med. 179:481.
19. Ho, I. C., M. R. Hodge, J. W. Rooney, and L. H. Glimcher. 1996. The protooncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell
85:973.
20. Bruhn, K. W., K. Nelms, J. L. Boulay, W. E. Paul, and M. J. Lenardo. 1993.
Molecular dissection of the mouse interleukin-4 promoter. Proc. Natl. Acad. Sci.
USA 90:9707.
21. Lederer, J. A., J. S. Liou, M. D. Todd, L. H. Glimcher, and A. H. Lichtman. 1994.
Regulation of cytokine gene expression in T helper cell subsets. J. Immunol. 152:77.
22. Wenner, C. A., S. J. Szabo, and K. M. Murphy. 1997. Identification of IL-4
promoter elements conferring Th2-restricted expression during T helper cell subset development. J. Immunol. 158:765.
23. Lee, H. J., N. Koyano-Nakagawa, Y. Naito, J. Nishida, N. Arai, K. Arai, and
T. Yokota. 1993. cAMP activates the IL-5 promoter synergistically with phorbol
ester through the signaling pathway involving protein kinase A in mouse thymoma line EL-4. J. Immunol. 151:6135.
24. Lee, H. J., E. S. Masuda, N. Arai, K. Arai, and T. Yokota. 1995. Definition of
cis-regulatory elements of the mouse interleukin-5 gene promoter: involvement
of nuclear factor of activated T cell-related factors in interleukin-5 expression.
J. Biol. Chem. 270:17541.
Naito, Y., H. Endo, K. Arai, R. L. Coffman, and N. Arai. 1996. Signal transduction in Th clones: target of differential modulation by PGE2 may reside downstream of the PKC-dependent pathway. Cytokine 8:346.
Cherwinski, H. M., J. H. Schumacher, K. D. Brown, and T. R. Mosmann. 1987.
Two types of mouse helper T cell clone. III. Further differences in lymphokine
synthesis between Th1 and Th2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies. J. Exp. Med. 166:1229.
Ohara, J., and W. E. Paul. 1985. Production of a monoclonal antibody to and
molecular characterization of B cell stimulatory factor-1. Nature 315:333.
Ozmen, L., M. Pericin, J. Hakimi, R. A. Chizzonite, M. Wysocka, G. Trinchieri,
M. Gately, and G. Garotta. 1994. Interleukin 12, interferon-g, and tumor necrosis
factor a are the key cytokines of the generalized Shwartzman reaction. J. Exp.
Med. 180:907.
Hsieh, C.-S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, and
K. M. Murphy. 1993. Development of Th1 CD41 T cells through IL-12 produced
by Listeria-induced macrophages. Science 260:547.
Murphy, E., K. Shibuya, N. Hosken, P. Openshaw, V. Maino, K. Davis,
K. Murphy, and A. O’Garra. 1996. Reversibility of T helper 1 and 2 populations
is lost after long-term stimulation. J. Exp. Med. 183:901.
Tsuruta, L., H. J. Lee, E. S. Masuda, N. N. Koyano, N. Arai, K. Arai, and
T. Yokota. 1995. Cyclic AMP inhibits expression of the IL-2 gene through the
nuclear factor of activated T cells (NF-AT) site, and transfection of NF-AT cDNAs abrogates the sensitivity of EL-4 cells to cyclic AMP. J. Immunol. 154:5255.
Ko, L. J., M. Yamamoto, M. W. Leonard, K. M. George, P. Ting, and J. D. Engel.
1991. Murine and human T-lymphocyte GATA-3 factors mediate transcription
through a cis-regulatory element within the human T-cell receptor delta gene
enhancer. Mol. Cell. Biol. 11:2778.
Kitamura, T., K. Hayashida, K. Sakamaki, T. Yokota, K. Arai, and A. Miyajima.
1991. Reconstitution of functional receptors for human granulocyte/macrophage
colony-stimulating factor (GM-CSF): evidence that the protein encoded by the
AIC2B cDNA is a subunit of the murine GM-CSF receptor. Proc. Natl. Acad. Sci.
USA 88:5082.
Yang, Z., L. Gu, P. H. Romeo, D. Bories, H. Motohashi, M. Yamamoto, and
J. D. Engel. 1994. Human GATA-3 trans-activation, DNA-binding, and nuclear
localization activities are organized into distinct structural domains. Mol. Cell.
Biol. 14:2201.
Masuda, E. S., H. Tokumitsu, A. Tsuboi, J. Shlomai, P. Hung, K. Arai, and
N. Arai. 1993. The granulocyte-macrophage colony-stimulating factor promoter
cis-acting element CLE0 mediates induction signals in T cells and is recognized
by factors related to AP1 and NFAT. Mol. Cell. Biol. 13:7399.
Munoz, E., U. Beutner, A. Zubiaga, and B. T. Huber. 1990. IL-1 activates two
separate signal transduction pathways in T helper type II cells. J. Immunol. 144:964.
Naora, H., J. G. Altin, and I. G. Young. 1994. TCR-dependent and -independent
signaling mechanisms differentially regulate lymphokine gene expression in the
murine T helper clone D10.G4.1. J. Immunol. 152:5691.
Crossley, M., and S. H. Orkin. 1994. Phosphorylation of the erythroid transcription factor GATA-1. J. Biol. Chem. 269:16589.
Ho, I. C., P. Vorhees, N. Marin, B. K. Oakley, S. F. Tsai, S. H. Orkin, and
J. M. Leiden. 1991. Human GATA-3: a lineage-restricted transcription factor that
regulates the expression of the T cell receptor alpha gene. EMBO J. 10:1187.
Siegel, M. D., D. H. Zhang, P. Ray, and A. Ray. 1995. Activation of the interleukin-5 promoter by cAMP in murine EL-4 cells requires the GATA-3 and
CLE0 elements. J. Biol. Chem. 270:24548.
Yamagata, T., J. Nishida, R. Sakai, T. Tanaka, H. Honda, N. Hirano, H. Mano,
Y. Yazaki, and H. Hirai. 1995. Of the GATA-binding proteins, only GATA-4
selectively regulates the human interleukin-5 gene promoter in interleukin-5producing cells which express multiple GATA-binding proteins. Mol. Cell. Biol.
15:3830.
Bielinska, M., and D. B. Wilson. 1995. Regulation of J6 gene expression by
transcription factor GATA-4. Biochem. J.
Zheng, W., and R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89:587.
Todd, M. D., M. J. Grusby, J. A. Lederer, E. Lacy, A. H. Lichtman, and
L. H. Glimcher. 1993. Transcription of the interleukin 4 gene is regulated by
multiple promoter elements. J. Exp. Med. 177:1663.
Rooney, J. W., M. R. Hodge, P. G. McCaffrey, A. Rao, and L. H. Glimcher. 1994.
A common factor regulates both Th1- and Th2-specific cytokine gene expression.
EMBO J. 13:625.
Orkin, S. H. 1992. GATA-binding transcription factors in hematopoietic cells.
Blood 80:575.
Ting, C. N., M. C. Olson, K. P. Barton, and J. M. Leiden. 1996. Transcription factor
GATA-3 is required for development of the T-cell lineage. Nature 384:474.
Leiden, J. M. 1993. Transcriptional regulation of T cell receptor genes. Annu.
Rev. Immunol. 11:539.
Merika, M., and S. H. Orkin. 1993. DNA-binding specificity of GATA family
transcription factors. Mol. Cell. Biol. 13:3999.
Ko, L. J., and J. D. Engel. 1993. DNA-binding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13:4011.
Naora, H., L. B. van, P. F. Bourke, and I. G. Young. 1994. Functional role and
signal-induced modulation of proteins recognizing the conserved TCATTT-containing promoter elements in the murine IL-5 and GM-CSF genes in T lymphocytes. J. Immunol. 153:3466.
Briggs, M. R., J. T. Kadonaga, S. P. Bell, and R. Tjian. 1986. Purification and
biochemical characterization of the promoter-specific transcription factor, Sp1.
Science 234:47.