1536-1540 Nucleic Acids Research, 1994, Vol. 22, No. 9 © 1994 Oxford University Press Pokeweed antiviral protein (PAP) mutations which permit E.coli growth do not eliminate catalytic activity towards prokaryotic ribosomes John A.Chaddock*, J.Michael Lord, Martin R.Hartley and Lynne M.Roberts Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK Received March 4, 1994; Revised and Accepted April 5, 1994 ABSTRACT Pokeweed antiviral protein (PAP) has N-glycosidase activity towards both eukaryotic and prokaryotic ribosomes. This is in marked contrast with the A chains of type 2 ribosome inactivating proteins (RIPs) such as ricin and abrin, which inactivate only eukaryotic ribosomes. A recent report described spontaneous mutations in PAP that implicated specific amino acids to be involved in determining the activity of PAP towards prokaryotic ribosomes. As part of an ongoing study into RIP - ribosome interactions these mutations were specifically recreated in a PAP clone encoding the mature 262 amino acid PAP sequence. Mutants were tested for their N-glycosidase activity by analysing the integrity of eukaryotic and prokaryotic ribosomes after mutant protein expression. Mutations of F196Y and K211R, either individually or within the same clone, were active toward both classes of ribosome, indicating that these amino acid positions are not involved in differentiating ribosomal substrates. Mutation R68G led to a protein that appeared to be inactive towards prokaryotic ribosomes, but also very poorly active towards eukaryotic ribosomes. This mutation is currently under further investigation. INTRODUCTION Many plants produce ribosome inactivating proteins (RIPs) which can attack and catalytically inactivate eukaryotic ribosomes and thereby inhibit protein synthesis. It is widely believed that plant RIPs play roles in plant defence, e.g. as potential antiviral or antifungal agents (1). Pokeweed antiviral protein (PAP) from Phytolacca americana is a representative of the type 1 family of RIPs, all of which are single chain N-glycosidases with molecular weights around 30,000. RIPs are characterised by their ability to remove an invariant adenine base from a conserved loop in 28S rRNA (2). This loop is involved in binding elongation factors and its depurination leads to irreversible inactivation of the 60S ribosomal subunit. In addition to the type 1 class of RIPs, some plants produce *To whom correspondence should be addressed heterodimeric proteins termed type 2 RIPs. These have an A chain that appears to be structurally and functionally related to the type 1 RIPs, joined to a sugar binding B chain. The type 2 RIPs, as exemplified by the castor oil toxin ricin, are potent cytotoxins owing to the cell binding ability of the B chain which promotes the obligatory first step in toxin uptake. The type 1 RIPs, in contrast, are not cytotoxic since they lack a means of initially binding to the surface of cells. A surprising finding in recent years has been that several type 1 RIPs, including PAP, show activity towards not only eukaryotic ribosomes but also prokaryotic ribosomes (3). Depurination of E. coli 23S rRNA occurs at A2660, in a functionally equivalent position to the target adenine of eukaryotic 26/28S rRNA. The location of the target adenine within the rRNA structure is equivalent in both eukaryotic and prokaryotic ribosomes and lies in a highly conserved 14 base purine rich sequence (a-sarcin loop). The molecular basis of this difference in RIP specificity is intriguing since, in addition to the rRNA sequence being highly conserved, the three-dimensional structural alignments of PAP and ricin A chain are very similar (4). It was recently reported (5) that two mutant forms of recombinant PAP had been produced, which, in contrast to native PAP, did not inhibit the growth of the host E.coli, but which did display catalytic activity when renatured from inclusion bodies and presented to eukaryotic ribosomes in vitro. However, the mutant proteins were not presented to E.coli ribosomes in vitro nor were host ribosomes from the expression system analysed. In case such mutants disrupt prokaryotic ribosomal recognition and represent genuine ribosomal recognition mutants, as suggested by Dore et al., we have recreated these point mutations in a PAP cDNA for expression in E.coli in order to analyse directly their N-glycosidase activities on both eukaryotic and prokaryotic ribosomes. In contrast to the previously published findings, our own results indicate that one of the mutants retains its activity to prokaryotic ribosomes whilst the other is inactive on prokaryotic ribosomes and very poorly active against eukaryotic ribosomes. The implications of these results on identifying a prokaryotic-ribosomal recognition domain are discussed. Nucleic Acids Research, 1994, Vol. 22, No. 9 1537 MATERIALS AND METHODS Construction of template The DNA sequence encoding 262 amino acids of mature PAP was created by PCR manipulation of cDNA obtained from the leaves of Phytolacca americana (6). Ing of pKKPAP cDNA (7) was added to a reaction mix containing lOmM Tris-HCl pH9.0, 50mM KC1, 0.1% (v/v) Triton X-100, 0.2mM dNTPs, 1.5mM MgCl2, 5U Taq polymerase and lOOpmoles of specific primers GAATTCGCCATGGTGAATACAATCATC and GAAATCGGATCCATGGCTCAAGTTGTCTGACAGCTCCCACC containing Nco\ sites to allow cloning into the expression vector pETlld. The reaction cycle (repeated 25 times) consisted of denaturation at 94°C for 2.5min, annealing at 52°C for lmin and extension at 72°C for 1.5min. PCR amplified DNA was purified by gel isolation, digested with Nco\, and ligated into Ncol digested pETl Id using standard techniques. A clone possessing the PAP cDNA in the correct orientation (named pETl ldPAPSTOP) was digested with Xba\ and BamHl and the 839bp fragment containing the PAP sequence excised and gel purified. This fragment was ligated into XballBamHl digested M13mpl8 to create M13mpl8PAPSTOP. A large preparation of single-stranded M13mpl8PAPSTOP was produced from transformed E. coli TG2 cells and used as template for mutagenesis. Creation of mutants Site-specific mutants of PAP were created using the USB T7-GEN mutagenesis kit (8) following the manufacturers' procedures. Mutagenesis of R68G, F196Y and K211R were performed individually to create M13PAP17, 18 and 19 respectively. The entire mutated M13mpl8PAPSTOP sequence was confirmed using the Sequenase system before the 839bp XballBamHl fragments were cloned out of the M13 into suitably digested pETlld. The resulting clones pETPAP17, 18 and 19 were analysed by restriction digests and plasmid sequencing of the mutated area to confirm identity. To create pETPAP18+19, a double mutant containing both F196Y and K211R, a 1017bp DNA fragment produced by digestion of pETPAP19 with Seal was ligated into similarly digested pETPAP18. The correct pETPAP18 +19 was verified by restriction digestion and plasmid sequencing of the mutated area. Expression in vitro and assays of activity In vitro transcription and translation reagents were prepared essentially as described elsewhere (9). 4/ig of BamHl linearised PAP and mutant PAP DNA in pETl Id were transcribed in vitro with T7 RNA polymerase and the appropriate controls. The resultant transcripts were translated in vitro in a wheatgerm cellfree system [prepared by standard protocols (10)] for visualisation of the protein product. Five /d of translation product was analysed by SDS-PAGE (11) and autoradiography of 15% (w/v) polyacrylamide gels. In vitro generated transcripts were also translated in non-nuclease treated rabbit reticulocyte lysate (Promega) as previously described (12) to confirm N-glycosidase activity of the mutant proteins toward eukaryotic ribosomes. Transformation of PAP DNA into E.coli pETPAP and mutant pETPAP species were transformed into E.coli BL21(DE3)pLysS made competent for transformation by CaCl2 treatment (13). Transformed cells were cultured in ZB media [1% (w/v) bactotryptone, 0.5% (w/v) NaCl] or M9ZB media [ZB media + 0.1 % (w/v) NH4C1, 0.3% (w/v) KH2PO4, 0.6% (w/v) Na2HPO4, 0.4% (w/v) glucose, lmM MgSO4] with the addition of ampicilJin (to 100/ig/ml) and chloramphenicol (to 25/ig/ml). Assay of protein expression in E.coli Two colonies for each clone were used to inoculate 5ml ZB media containing ampicillin and chloramphenicol, the culture was incubated at 37°C until slightly turbid and then streaked out onto ZB plates containing ampicillin. A single colony was picked to inoculate 5ml M9ZB media containing ampicillin and cultured at 37°C/3OOrpm for 3.5 hours. An aliquot of this subculture was used to inoculate 50ml prewarmed M9ZB + ampicillin and incubation continued at 3O°C/3OO rpm to an OD600nm of approximately 0.6. The culture was induced to express protein by the addition of IPTG to 0.4mM and incubation continued at 30°C for a further 3 hours. The cell pellet from 10ml of the culture was isolated, washed with lml ice-cold T.E. buffer (lOmM Tris-HCl pH7.5, lmM EDTA) and resuspended in 300/tl T.E. at 4°C. Nucleic acids were extracted by the addition of 300/il 2xKirby reagent (14), extracted twice with a 1:1 mix of phenol:chloroform and precipitated with 2M NaOAc pH6. The nucleic acid pellet was resuspended in 200/tl MES/Mg2+ + 10U DNase and incubated at 0°C for 30 minutes to remove contaminating DNA. RNA was extracted twice with phenol:chloroform before precipitation with 7M NH4OAc. The pellet was resuspended in H2O and treated with acetic aniline as described (12). RESULTS Creation of mutants Four specific mutant PAP DNA sequences (containing R68G, F196Y, K211R, F196Y + K211R) were successfully created and cloned into the vector pETlld for in vitro expression and transformation into suitable E.coli for cytoplasmic expression. Mutant DNAs were fully sequenced in M13mpl8 to verify that no additional mutations had been created and the mutant areas in the pETPAP clones were plasmid sequenced to confirm mutant identity. No additional mutations were found. Activity of protein expressed in vitro Since the pETlld vector possesses a T7 RNA polymerase promoter for transcription, it makes a suitable vector for the in vitro transcription/translation techniques used routinely in this laboratory. pETPAP DNA was produced by standard techniques, digested to completion to the 3' side of the PAP clone using BamHl, and the linearised DNA isolated following extraction with phenol/chloroform. Linearised DNA was quantified and 4/ig used in an in vitro transcription reaction to produce PAP transcripts. Although the transcripts were not quantified, mutant DNA was treated in an identical fashion using identical reaction constituents to maintain similar amounts of transcript. Transcripts were translated in vitro in a wheatgerm cell-free system to verify that the transcripts had the ability to direct protein synthesis, and to confirm protein product size. Although it has previously been observed (15) that wheatgerm extracts are sensitive to PAP N-glycosidase activity, this translation system has the ability to translate toxic RIPs for a period of time before complete ribosome inactivation. Figure 1 shows the result of SDS^PAGE and autoradiography of PAP and PAP mutant 1538 Nucleic Acids Research, 1994, Vol. 22, No. 9 1 2 3 4 5 6 7 kDa ^ 69 ^ 46 3 4 30 14 Figure 1. Products from in vitro translation of PAP encoding transcripts in a wheatgerm cell-free system after SDS-PAGE and fluorography. Translation products from pETPAP, 17, 18, 19 and 18+19, encoding PAP (wild-type), PAP with R68G, F196Y, K211R and F196Y + K211R respectively are shown in lanes 1 to 5. Lane 6 represents a control translation with no added transcript. Lane 7 is molecular weight markers, for which the approximate molecular weights are indicated. transcripts translated in a wheatgerm cell-free system in the presence of 35S methionine. All the mutants translated efficiently to the correct size (approx. 29kDa). In order to assess the N-glycosidase activity of mutant PAP protein toward eukaryotic ribosomes, transcripts were translated in a non-nuclease treated rabbit reticulocyte cell-free translation system for 60 minutes at 30°C. The rRNA was extracted, 5/ig treated with acetic aniline and the RNA analysed by electrophoresis. The use of this method to demonstrate Nglycosidase activity is well documented (3). It is based on the observation that rRNA depurinated by RIPs is susceptible to specific amine-base dependant cleavage leading to the release of a 390b rRNA fragment from the 28S rRNA of eukaryotes. The appearance of this fragment following electrophoresis is indicative of RIP-catalysed depurination. A specific cleavage product was clearly produced after translation of pETPAP, pETPAP18, 19 and 18 + 19, but only poorly visualised after translation of pETPAP17 (Figure 2). This indicated that all the mutants (with the exception of pETPAP 17 which encodes PAP with R68G) possess activity toward eukaryotic ribosomes to the same degree as wild type PAP protein. With the exception of pETPAP17, this implies that the specific mutations created in this study were not crucially involved in the catalytic mechanism of PAP-catalysed depurination of eukaryotic ribosomes. Activity of protein expressed in E.coli pETPAP and variants were transformed in the host E.coli strain BL21(DE3)pLysS for the protein expression studies. This system of expression, based of the use of T7 RNA polymerase promoters in the pET vector, has been reported to give extremely tight regulation of protein expression (16). The system was chosen to study PAP expression since it allows the E.coli to grow without suffering a toxic effect of cytoplasmically expressed PAP prior Figure 2. Analysis of activity towards eukaryotic ribosomes in vitro in nonnuclease-treated reticulocyte lysates. rRNA was extracted from reticulocyte ribosomes which had translated PAP transcripts, treated with acetic-aniline and analysed by agarose \ formamide gel electrophoresis. Lanes identified with + were treated with aniline, those with - were untreated control rRNA samples. Lanes 1 and 7 refer to translation of wild-type PAP encoding transcripts, lanes 5 and 9 are no transcript controls, lane 6 shows the addition of lOOng purified PAP protein to the translation mix, and lanes 2, 3, 4 and 8 represent PAP variants with R68G, F196Y, K211R and F196Y + K211R respectively. Arrow indicates rRNA fragment released. to the induction of PAP expression with the addition of IPTG. After 3 hours induction, large amounts (greater than lmg/litre of culture) of PAP protein have been expressed as visualised by SDS-PAGE and Western blotting (data not shown). At this stage in the present study the rRNA from the host E.coli was extracted and assessed for depurination to investigate whether the cytoplasmically expressed PAP had depurinated the ribosomes. Depurination assays give a definitive assessment of the activity of the expressed protein for the host ribosomes. It was shown that in the cases of pETPAP, pETPAP 18, 19 and 18+19 a specific cleavage product could be visualised, indicating that these protein products still retained prokaryotic ribosome depurination activity (Figure 3). No such band was visualised for pETPAP 17 suggesting this mutant was inactive toward the host ribosomes within the limits of the assay. DISCUSSION Results in the present study reveal that the mutant PAPs containing F196Y and K211R, either singly or in combination, are still catalytically active to prokaryotic ribosomes. The mutant R68G has no apparent N-glycosidase activity towards prokaryotic ribosomes and a reduced activity towards eukaryotic ribosomes. These results conflict with conclusions drawn from the original study where the variant forms above were first reported (5). In this earlier study, the variant forms were believed to have arisen through PCR amplification of proPAP (mature PAP with a 29 amino acid C-terminal extension) cDNAs. Those clones which were expressed in E.coli and which permitted bacterial growth were assumed to be inactive towards the host ribosomes, though this was never directly tested. The assumption appeared reasonable since forms of PAP possessing no mutations did not allow bacterial growth, as might be expected for a type 1 RIP with known bacterial killing properties. Previous attempts to express PAP (17) and Mirabilis antiviral protein (18) in E.coli have been largely unsuccessful because the activities of the RIPs against the host ribosomes have proved to be toxic. However, these problems can now be overcome by using tightly regulated expression systems and short induction times (15). Nucleic Acids Research, 1994, Vol. 22, No. 9 1539 B PAP 1U -R68G- -F196Y- I U I U I U I U -K21IR— I U I U PAP F196Y RTA -+K211R— I I I I I I PAP RTA F196Y -+K211R- I I U U U U U U U U Figure 3. Analysis of host E.coli nbosomes. RIP catalysed modification of host E.coli ribosomes were assayed by extracting rRNA from E.coli expression cultures and treating with acetic-aniline. Analysis of the RNA was by agarose \ formamide gel electrophoresis. Samples are from induced (I) or uninduced (U) cultures that have been treated (+) or not treated ( - ) with aniline. A. Results of expression of PAP, R68G, F196Y and K211R. B. Results of expression of PAP, RTA and F196Y + K211R. We are interested in studying the molecular basis for the differences in ribosome specificity exhibited by various RIPs. We chose to recreate the mutations in the framework of a mature PAP-encoding cDNA and to test the PAP forms as potential ribosome-recognition mutants. After mutagenesis, the entire PAP coding sequences were sequenced prior to recloning into the pETlld expression vector. This was done to ensure that the mutagenesis had been successful and to confirm the absence of spurious mutations. The pETl Id vector and its compatible host strain, E.coli BL21(DE3)pLysS, were chosen because they have been demonstrated to be capable of expressing proteins that are toxic to the host cell (16). By utilising T7 RNA polymerase promoters on the expression vector in conjunction with an IPTGinducible T7 RNA polymerase gene integrated into the host chromosome, regulation of expression from the pETl Id vector is tightly controlled. The system allows the expression of approximately lmg of soluble purified PAP per 1 litre of expression culture after a 3 hour induction period (data not shown). The rRNA, when extracted from E.coli cells expressing all but the R68G mutant, was modified in the manner typical of RIPcatalysed inactivation of ribosomes (3) The presence or absence of ribosome modification was tested by assaying the susceptibility of the phosphodiester backbone of the extracted rRNA to sitespecific cleavage using acetic-aniline. Release of a fragment (ca. 240b from E.coli 23S rRNA and 390b from mammalian 28S rRNA) is diagnostic of RIP-catalysed depurination (9). Control cells expressing ricin A-chain, which has no activity towards prokaryotic ribosomes, did not possess depurinated RNAs, indicating that depurination was specific to expression cultures containing PAP-derived constructs (Figure 3). We have not quantified the activities of the PAP forms with F196Y and K211R (singly or in combination), since to obtain kinetic parameters a purified preparation of each RIP is required. The finding that host ribosomes are sensitive to these PAP constructs is however unambiguous. How then can the discrepancy with the previous work be explained? It is known that in the earlier study, the bacterial cells contained inclusions of all the PAP forms expressed. It is possible that those mutant PAPs permitting bacterial growth were so severely aggregated the cells could simply survive their expression. Only after renaturation were the expressed protein products shown to have N-glycosidase activity towards eukaryotic ribosomes. The vector—host systems utilised are also different and whereas we have used a PAP construct which does not encode the C-terminal propeptide, the proteins in the previous study clearly had this extension (5). When RNA transcripts were prepared from the pETlld constructs in vitro and translated in a non-nuclease treated reticulocyte lysate, the 28S rRNA was clearly modified (Figure 2) in agreement with the earlier findings. Preliminary analysis indicates that they have activities towards mammalian ribosomes equivalent to wild-type PAP. Perhaps of greater interest in the present study is the R68G mutation. Ribosomes from E.coli expressing this particular mutant were clearly not modified (Figure 3). Transcripts translated in vitro in a cell-free rabbit reticulocyte lysate system, modified the rRNA but to a reduced extent. Without purifying the mutant to homogeneity, we can estimate that the mutant appeared to have approximately 10% of the activity of wild-type PAP. It has been shown that wild-type PAP is approximately 100 to 500 fold more active towards non-salt washed reticulocyte ribosomes than it is towards E.coli ribosomes (3). Therefore it is possible that the lack of activity of R68G towards prokaryotic ribosomes in our assay is due to the poor activity of R68G in general. R68 is located in the C-strand of the 6-stranded /3-sheet of PAP in a C a position that is highly conserved with the equivalent residue in ricin A-chain, which is D75 (4). From examination of the X-ray structure of PAP, R68 has the potential to H-bond with Y72, a highly conserved residue in RIPs and one that has been postulated to be critically involved in the catalytic mechanism (19). When RNA substrates are modelled into the PAP and RTA structures, Y72 (or Y80 in RTA) alters orientation about the backbone to allow efficient catalysis. It is possible that mutation of R68G causes perturbation of the positioning of Y72 leading to decreased catalytic activity. It is therefore too early to say whether R68G is a genuine ribosomerecognition mutant or whether it represents a catalytic or misfolding mutant. Certainly the discrepancy between our own findings of very weak activity towards eukaryotic ribosomes and 1540 Nucleic Acids Research, 1994, Vol. 22, No. 9 the previous finding that the R68G-containing PAP was only about two fold less active than native PAP requires further clarification. Of the other two mutations F196 is located between helix F and G in the PAP tertiary structure in an area of poor primary sequence conservation. It is unclear from the tertiary structure how mutation of Phe to the aromatic Tyr would affect activity and this is reflected in our experimental observations. K211 is part of helix H and lies in a conserved sequence. Examination of the contacts made by PAP and a hypothetical RNA tetraloop substrate (C1G2A3G4A5G6) modelled into the active site, showed that K211 donates a H-bond to the adenine nucleotide A5. The conserved substitution of R for K211 may be able to mimic this potential H-bond and so maintain catalytic activity. This study has highlighted the difficulties involved in examining theribosome-inactivatingproperties of RIPs. Proteins which were apparently non-toxic to E.coli have been shown to retain Nglycosidase activity toward prokaryotic ribosomes and therefore retain the ability to recognise, and inactivate, prokaryotic ribosomes. One of the mutants, R68G, appeared to have decreased activity and must be studied further before it can be determined whether this mutant has merely reduced catalytic activity or true differences in ribosome recognition. It is hoped that by studying the properties of mutants such as these, we will be able to delineate the activities of different RIPs. ACKNOWLEDGEMENTS We would like to thank Z.C.Chen for the generous gift of the PAP clone and J.D.Robertus and colleagues for helpful discussion regarding the structure of PAP and for supplying PAP and antiPAP antibodies. We acknowledge the support of the AFRC with grant PG88/520. REFERENCES 1. Lord,J.M., Hartley,MR. and Roberts,L.M. (1991) Seminars in Cell Biology, 2, 15-22. 2. Endo.Y. and Tsurugi,K. (1987) J. Biol. Chem., 263, 8735-8739. 3. Hartley.M.R., Legname.G., Osborn.R., Chen,Z. and Lord,J.M. (1991) FEBS Lett., 290, 65-68. 4. Monzingo,A.F., Collins,E.J., Ernst, S.R., lrvin,J.D. and Robertas,.!.D. (1993) J. Mol. Biol, 233, 705-715. 5. Dore,J-M., Gras,E., Depierre.F. and Wijdenes,J. (1993) Nucleic Acids Res., 21, 4200-4205. 6. Lin,Q., Chen,Z.C, Antoniw, J.F. and White, R.F. (1991) Plant Mol. Biol., 17, 609-614. 7. Chen,Z.C, Amoniw,J.F., Lin,Q. and White, R.F. (1993) Physiol & Mol. Plant Path., 42, 237-247. 8. Vandeyar,M., Weiner,M., Hutton,C. and Batt.C. (1988) Gene, 65, 129-133. 9. May.M.J., Hartley,M.R., Roberts,L.M., Kreig.P.A., Osborn,R.W. and Lord.J.M. (1989) EMBO J., 8, 301-308. 10. Anderson,C.W., StrausJ.W. and Dudock.B.S. (1983) Methods in Enzymology 101, Academic Press. New York, pp 635-644. 11. Laemmli.U.K. (1970) Nature, 270, 680-685. 12. Chaddock,J.A. and Roberts,L.M. (1993) Protein Engineering, 6, 425-431. 13. Sambrook.J., Fritsch.E.F. and Maniatis.T. (1989) Molecular Cloning : A laboratory Manual. Second edition. Cold Spring Harbor Laboratory Press. Cold Spring Habor, New York. 14. Kirby.K.S. (1968) In Grossman.L. and Moldave,K. (eds), Methods in Enzymology XIIB. Academic Press, New York, pp. 87-110. 15. Kataoka,J., Ago.H., Habuka,N., Furuno,M., Masuta,C, Miyano,M. and Koiwai,A. (1993) FEBS Lett., 320, 31-34. 16. Studier,F.W. and Moffatt,B.A. (1986) J. Mol. Biol., 189, 113-130. 17. Kataoka,J., Habuka.N., Masuta.C, Miyano.M. and Koiwai.A. (1992) Plant Mol. Biol, 20, 879-886. 18. Habuka.N., Murakami,Y., Noma,M.. Kudo,T. and Horikoshi,K. (1989) J. Biol. Chem., 264, 6629-6637. 19. Kim,Y. and Robertus.J.D. (1992) Protein Engineering, 5, 775-779.
© Copyright 2026 Paperzz