1536-1540
Nucleic Acids Research, 1994, Vol. 22, No. 9
© 1994 Oxford University Press
Pokeweed antiviral protein (PAP) mutations which permit
E.coli growth do not eliminate catalytic activity towards
prokaryotic ribosomes
John A.Chaddock*, J.Michael Lord, Martin R.Hartley and Lynne M.Roberts
Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK
Received March 4, 1994; Revised and Accepted April 5, 1994
ABSTRACT
Pokeweed antiviral protein (PAP) has N-glycosidase
activity towards both eukaryotic and prokaryotic
ribosomes. This is in marked contrast with the A chains
of type 2 ribosome inactivating proteins (RIPs) such as
ricin and abrin, which inactivate only eukaryotic
ribosomes. A recent report described spontaneous
mutations in PAP that implicated specific amino acids
to be involved in determining the activity of PAP
towards prokaryotic ribosomes. As part of an ongoing
study into RIP - ribosome interactions these mutations
were specifically recreated in a PAP clone encoding the
mature 262 amino acid PAP sequence. Mutants were
tested for their N-glycosidase activity by analysing the
integrity of eukaryotic and prokaryotic ribosomes after
mutant protein expression. Mutations of F196Y and
K211R, either individually or within the same clone,
were active toward both classes of ribosome, indicating
that these amino acid positions are not involved in
differentiating ribosomal substrates. Mutation R68G led
to a protein that appeared to be inactive towards
prokaryotic ribosomes, but also very poorly active
towards eukaryotic ribosomes. This mutation is
currently under further investigation.
INTRODUCTION
Many plants produce ribosome inactivating proteins (RIPs) which
can attack and catalytically inactivate eukaryotic ribosomes and
thereby inhibit protein synthesis. It is widely believed that plant
RIPs play roles in plant defence, e.g. as potential antiviral or
antifungal agents (1). Pokeweed antiviral protein (PAP) from
Phytolacca americana is a representative of the type 1 family
of RIPs, all of which are single chain N-glycosidases with
molecular weights around 30,000. RIPs are characterised by their
ability to remove an invariant adenine base from a conserved
loop in 28S rRNA (2). This loop is involved in binding elongation
factors and its depurination leads to irreversible inactivation of
the 60S ribosomal subunit.
In addition to the type 1 class of RIPs, some plants produce
*To whom correspondence should be addressed
heterodimeric proteins termed type 2 RIPs. These have an A chain
that appears to be structurally and functionally related to the type
1 RIPs, joined to a sugar binding B chain. The type 2 RIPs, as
exemplified by the castor oil toxin ricin, are potent cytotoxins
owing to the cell binding ability of the B chain which promotes
the obligatory first step in toxin uptake. The type 1 RIPs, in
contrast, are not cytotoxic since they lack a means of initially
binding to the surface of cells.
A surprising finding in recent years has been that several type
1 RIPs, including PAP, show activity towards not only eukaryotic
ribosomes but also prokaryotic ribosomes (3). Depurination of
E. coli 23S rRNA occurs at A2660, in a functionally equivalent
position to the target adenine of eukaryotic 26/28S rRNA. The
location of the target adenine within the rRNA structure is
equivalent in both eukaryotic and prokaryotic ribosomes and lies
in a highly conserved 14 base purine rich sequence (a-sarcin
loop). The molecular basis of this difference in RIP specificity
is intriguing since, in addition to the rRNA sequence being highly
conserved, the three-dimensional structural alignments of PAP
and ricin A chain are very similar (4).
It was recently reported (5) that two mutant forms of
recombinant PAP had been produced, which, in contrast to native
PAP, did not inhibit the growth of the host E.coli, but which
did display catalytic activity when renatured from inclusion bodies
and presented to eukaryotic ribosomes in vitro. However, the
mutant proteins were not presented to E.coli ribosomes in vitro
nor were host ribosomes from the expression system analysed.
In case such mutants disrupt prokaryotic ribosomal recognition
and represent genuine ribosomal recognition mutants, as
suggested by Dore et al., we have recreated these point mutations
in a PAP cDNA for expression in E.coli in order to analyse
directly their N-glycosidase activities on both eukaryotic and
prokaryotic ribosomes. In contrast to the previously published
findings, our own results indicate that one of the mutants retains
its activity to prokaryotic ribosomes whilst the other is inactive
on prokaryotic ribosomes and very poorly active against
eukaryotic ribosomes. The implications of these results on
identifying a prokaryotic-ribosomal recognition domain are
discussed.
Nucleic Acids Research, 1994, Vol. 22, No. 9 1537
MATERIALS AND METHODS
Construction of template
The DNA sequence encoding 262 amino acids of mature PAP
was created by PCR manipulation of cDNA obtained from the
leaves of Phytolacca americana (6). Ing of pKKPAP cDNA (7)
was added to a reaction mix containing lOmM Tris-HCl pH9.0,
50mM KC1, 0.1% (v/v) Triton X-100, 0.2mM dNTPs, 1.5mM
MgCl2, 5U Taq polymerase and lOOpmoles of specific primers
GAATTCGCCATGGTGAATACAATCATC and GAAATCGGATCCATGGCTCAAGTTGTCTGACAGCTCCCACC
containing Nco\ sites to allow cloning into the expression vector
pETlld. The reaction cycle (repeated 25 times) consisted of
denaturation at 94°C for 2.5min, annealing at 52°C for lmin
and extension at 72°C for 1.5min.
PCR amplified DNA was purified by gel isolation, digested
with Nco\, and ligated into Ncol digested pETl Id using standard
techniques. A clone possessing the PAP cDNA in the correct
orientation (named pETl ldPAPSTOP) was digested with Xba\
and BamHl and the 839bp fragment containing the PAP sequence
excised and gel purified. This fragment was ligated into
XballBamHl digested M13mpl8 to create M13mpl8PAPSTOP.
A large preparation of single-stranded M13mpl8PAPSTOP was
produced from transformed E. coli TG2 cells and used as template
for mutagenesis.
Creation of mutants
Site-specific mutants of PAP were created using the USB
T7-GEN mutagenesis kit (8) following the manufacturers'
procedures. Mutagenesis of R68G, F196Y and K211R were
performed individually to create M13PAP17, 18 and 19
respectively. The entire mutated M13mpl8PAPSTOP sequence
was confirmed using the Sequenase system before the 839bp
XballBamHl fragments were cloned out of the M13 into suitably
digested pETlld. The resulting clones pETPAP17, 18 and 19
were analysed by restriction digests and plasmid sequencing of
the mutated area to confirm identity. To create pETPAP18+19,
a double mutant containing both F196Y and K211R, a 1017bp
DNA fragment produced by digestion of pETPAP19 with Seal
was ligated into similarly digested pETPAP18. The correct
pETPAP18 +19 was verified by restriction digestion and plasmid
sequencing of the mutated area.
Expression in vitro and assays of activity
In vitro transcription and translation reagents were prepared
essentially as described elsewhere (9). 4/ig of BamHl linearised
PAP and mutant PAP DNA in pETl Id were transcribed in vitro
with T7 RNA polymerase and the appropriate controls. The
resultant transcripts were translated in vitro in a wheatgerm cellfree system [prepared by standard protocols (10)] for visualisation
of the protein product. Five /d of translation product was analysed
by SDS-PAGE (11) and autoradiography of 15% (w/v)
polyacrylamide gels. In vitro generated transcripts were also
translated in non-nuclease treated rabbit reticulocyte lysate
(Promega) as previously described (12) to confirm N-glycosidase
activity of the mutant proteins toward eukaryotic ribosomes.
Transformation of PAP DNA into E.coli
pETPAP and mutant pETPAP species were transformed into
E.coli BL21(DE3)pLysS made competent for transformation by
CaCl2 treatment (13). Transformed cells were cultured in ZB
media [1% (w/v) bactotryptone, 0.5% (w/v) NaCl] or M9ZB
media [ZB media + 0.1 % (w/v) NH4C1, 0.3% (w/v) KH2PO4,
0.6% (w/v) Na2HPO4, 0.4% (w/v) glucose, lmM MgSO4] with
the addition of ampicilJin (to 100/ig/ml) and chloramphenicol (to
25/ig/ml).
Assay of protein expression in E.coli
Two colonies for each clone were used to inoculate 5ml ZB media
containing ampicillin and chloramphenicol, the culture was
incubated at 37°C until slightly turbid and then streaked out onto
ZB plates containing ampicillin. A single colony was picked to
inoculate 5ml M9ZB media containing ampicillin and cultured
at 37°C/3OOrpm for 3.5 hours. An aliquot of this subculture was
used to inoculate 50ml prewarmed M9ZB + ampicillin and
incubation continued at 3O°C/3OO rpm to an OD600nm of
approximately 0.6. The culture was induced to express protein
by the addition of IPTG to 0.4mM and incubation continued at
30°C for a further 3 hours. The cell pellet from 10ml of the
culture was isolated, washed with lml ice-cold T.E. buffer
(lOmM Tris-HCl pH7.5, lmM EDTA) and resuspended in
300/tl T.E. at 4°C. Nucleic acids were extracted by the addition
of 300/il 2xKirby reagent (14), extracted twice with a 1:1 mix
of phenol:chloroform and precipitated with 2M NaOAc pH6. The
nucleic acid pellet was resuspended in 200/tl MES/Mg2+ + 10U
DNase and incubated at 0°C for 30 minutes to remove
contaminating DNA. RNA was extracted twice with
phenol:chloroform before precipitation with 7M NH4OAc. The
pellet was resuspended in H2O and treated with acetic aniline
as described (12).
RESULTS
Creation of mutants
Four specific mutant PAP DNA sequences (containing R68G,
F196Y, K211R, F196Y + K211R) were successfully created and
cloned into the vector pETlld for in vitro expression and
transformation into suitable E.coli for cytoplasmic expression.
Mutant DNAs were fully sequenced in M13mpl8 to verify that
no additional mutations had been created and the mutant areas
in the pETPAP clones were plasmid sequenced to confirm mutant
identity. No additional mutations were found.
Activity of protein expressed in vitro
Since the pETlld vector possesses a T7 RNA polymerase
promoter for transcription, it makes a suitable vector for the in
vitro transcription/translation techniques used routinely in this
laboratory. pETPAP DNA was produced by standard techniques,
digested to completion to the 3' side of the PAP clone using
BamHl, and the linearised DNA isolated following extraction
with phenol/chloroform. Linearised DNA was quantified and 4/ig
used in an in vitro transcription reaction to produce PAP
transcripts. Although the transcripts were not quantified, mutant
DNA was treated in an identical fashion using identical reaction
constituents to maintain similar amounts of transcript.
Transcripts were translated in vitro in a wheatgerm cell-free
system to verify that the transcripts had the ability to direct protein
synthesis, and to confirm protein product size. Although it has
previously been observed (15) that wheatgerm extracts are
sensitive to PAP N-glycosidase activity, this translation system
has the ability to translate toxic RIPs for a period of time before
complete ribosome inactivation. Figure 1 shows the result of
SDS^PAGE and autoradiography of PAP and PAP mutant
1538 Nucleic Acids Research, 1994, Vol. 22, No. 9
1 2
3
4
5
6
7
kDa
^
69
^
46
3 4
30
14
Figure 1. Products from in vitro translation of PAP encoding transcripts in a
wheatgerm cell-free system after SDS-PAGE and fluorography. Translation
products from pETPAP, 17, 18, 19 and 18+19, encoding PAP (wild-type), PAP
with R68G, F196Y, K211R and F196Y + K211R respectively are shown in lanes
1 to 5. Lane 6 represents a control translation with no added transcript. Lane
7 is molecular weight markers, for which the approximate molecular weights
are indicated.
transcripts translated in a wheatgerm cell-free system in the
presence of 35S methionine. All the mutants translated efficiently
to the correct size (approx. 29kDa).
In order to assess the N-glycosidase activity of mutant PAP
protein toward eukaryotic ribosomes, transcripts were translated
in a non-nuclease treated rabbit reticulocyte cell-free translation
system for 60 minutes at 30°C. The rRNA was extracted, 5/ig
treated with acetic aniline and the RNA analysed by
electrophoresis. The use of this method to demonstrate Nglycosidase activity is well documented (3). It is based on the
observation that rRNA depurinated by RIPs is susceptible to
specific amine-base dependant cleavage leading to the release of
a 390b rRNA fragment from the 28S rRNA of eukaryotes. The
appearance of this fragment following electrophoresis is indicative
of RIP-catalysed depurination.
A specific cleavage product was clearly produced after
translation of pETPAP, pETPAP18, 19 and 18 + 19, but only
poorly visualised after translation of pETPAP17 (Figure 2). This
indicated that all the mutants (with the exception of pETPAP 17
which encodes PAP with R68G) possess activity toward
eukaryotic ribosomes to the same degree as wild type PAP
protein. With the exception of pETPAP17, this implies that the
specific mutations created in this study were not crucially involved
in the catalytic mechanism of PAP-catalysed depurination of
eukaryotic ribosomes.
Activity of protein expressed in E.coli
pETPAP and variants were transformed in the host E.coli strain
BL21(DE3)pLysS for the protein expression studies. This system
of expression, based of the use of T7 RNA polymerase promoters
in the pET vector, has been reported to give extremely tight
regulation of protein expression (16). The system was chosen
to study PAP expression since it allows the E.coli to grow without
suffering a toxic effect of cytoplasmically expressed PAP prior
Figure 2. Analysis of activity towards eukaryotic ribosomes in vitro in nonnuclease-treated reticulocyte lysates. rRNA was extracted from reticulocyte
ribosomes which had translated PAP transcripts, treated with acetic-aniline and
analysed by agarose \ formamide gel electrophoresis. Lanes identified with +
were treated with aniline, those with - were untreated control rRNA samples.
Lanes 1 and 7 refer to translation of wild-type PAP encoding transcripts, lanes
5 and 9 are no transcript controls, lane 6 shows the addition of lOOng purified
PAP protein to the translation mix, and lanes 2, 3, 4 and 8 represent PAP variants
with R68G, F196Y, K211R and F196Y + K211R respectively. Arrow indicates
rRNA fragment released.
to the induction of PAP expression with the addition of IPTG.
After 3 hours induction, large amounts (greater than lmg/litre
of culture) of PAP protein have been expressed as visualised by
SDS-PAGE and Western blotting (data not shown). At this stage
in the present study the rRNA from the host E.coli was extracted
and assessed for depurination to investigate whether the
cytoplasmically expressed PAP had depurinated the ribosomes.
Depurination assays give a definitive assessment of the activity
of the expressed protein for the host ribosomes.
It was shown that in the cases of pETPAP, pETPAP 18, 19
and 18+19 a specific cleavage product could be visualised,
indicating that these protein products still retained prokaryotic
ribosome depurination activity (Figure 3). No such band was
visualised for pETPAP 17 suggesting this mutant was inactive
toward the host ribosomes within the limits of the assay.
DISCUSSION
Results in the present study reveal that the mutant PAPs
containing F196Y and K211R, either singly or in combination,
are still catalytically active to prokaryotic ribosomes. The mutant
R68G has no apparent N-glycosidase activity towards prokaryotic
ribosomes and a reduced activity towards eukaryotic ribosomes.
These results conflict with conclusions drawn from the original
study where the variant forms above were first reported (5). In
this earlier study, the variant forms were believed to have arisen
through PCR amplification of proPAP (mature PAP with a 29
amino acid C-terminal extension) cDNAs. Those clones which
were expressed in E.coli and which permitted bacterial growth
were assumed to be inactive towards the host ribosomes, though
this was never directly tested. The assumption appeared
reasonable since forms of PAP possessing no mutations did not
allow bacterial growth, as might be expected for a type 1 RIP
with known bacterial killing properties. Previous attempts to
express PAP (17) and Mirabilis antiviral protein (18) in E.coli
have been largely unsuccessful because the activities of the RIPs
against the host ribosomes have proved to be toxic. However,
these problems can now be overcome by using tightly regulated
expression systems and short induction times (15).
Nucleic Acids Research, 1994, Vol. 22, No. 9 1539
B
PAP
1U
-R68G-
-F196Y-
I U I U I U I U
-K21IR—
I U I U
PAP
F196Y
RTA -+K211R—
I I
I I I I
PAP
RTA
F196Y
-+K211R-
I I U U U U U U U U
Figure 3. Analysis of host E.coli nbosomes. RIP catalysed modification of host E.coli ribosomes were assayed by extracting rRNA from E.coli expression cultures
and treating with acetic-aniline. Analysis of the RNA was by agarose \ formamide gel electrophoresis. Samples are from induced (I) or uninduced (U) cultures that
have been treated (+) or not treated ( - ) with aniline. A. Results of expression of PAP, R68G, F196Y and K211R. B. Results of expression of PAP, RTA and
F196Y + K211R.
We are interested in studying the molecular basis for the
differences in ribosome specificity exhibited by various RIPs.
We chose to recreate the mutations in the framework of a mature
PAP-encoding cDNA and to test the PAP forms as potential
ribosome-recognition mutants. After mutagenesis, the entire PAP
coding sequences were sequenced prior to recloning into the
pETlld expression vector. This was done to ensure that the
mutagenesis had been successful and to confirm the absence of
spurious mutations. The pETl Id vector and its compatible host
strain, E.coli BL21(DE3)pLysS, were chosen because they have
been demonstrated to be capable of expressing proteins that are
toxic to the host cell (16). By utilising T7 RNA polymerase
promoters on the expression vector in conjunction with an IPTGinducible T7 RNA polymerase gene integrated into the host
chromosome, regulation of expression from the pETl Id vector
is tightly controlled. The system allows the expression of
approximately lmg of soluble purified PAP per 1 litre of
expression culture after a 3 hour induction period (data not
shown).
The rRNA, when extracted from E.coli cells expressing all
but the R68G mutant, was modified in the manner typical of RIPcatalysed inactivation of ribosomes (3) The presence or absence
of ribosome modification was tested by assaying the susceptibility
of the phosphodiester backbone of the extracted rRNA to sitespecific cleavage using acetic-aniline. Release of a fragment (ca.
240b from E.coli 23S rRNA and 390b from mammalian 28S
rRNA) is diagnostic of RIP-catalysed depurination (9). Control
cells expressing ricin A-chain, which has no activity towards
prokaryotic ribosomes, did not possess depurinated RNAs,
indicating that depurination was specific to expression cultures
containing PAP-derived constructs (Figure 3).
We have not quantified the activities of the PAP forms with
F196Y and K211R (singly or in combination), since to obtain
kinetic parameters a purified preparation of each RIP is required.
The finding that host ribosomes are sensitive to these PAP
constructs is however unambiguous. How then can the
discrepancy with the previous work be explained? It is known
that in the earlier study, the bacterial cells contained inclusions
of all the PAP forms expressed. It is possible that those mutant
PAPs permitting bacterial growth were so severely aggregated
the cells could simply survive their expression. Only after
renaturation were the expressed protein products shown to have
N-glycosidase activity towards eukaryotic ribosomes. The
vector—host systems utilised are also different and whereas we
have used a PAP construct which does not encode the C-terminal
propeptide, the proteins in the previous study clearly had this
extension (5).
When RNA transcripts were prepared from the pETlld
constructs in vitro and translated in a non-nuclease treated
reticulocyte lysate, the 28S rRNA was clearly modified (Figure
2) in agreement with the earlier findings. Preliminary analysis
indicates that they have activities towards mammalian ribosomes
equivalent to wild-type PAP.
Perhaps of greater interest in the present study is the R68G
mutation. Ribosomes from E.coli expressing this particular
mutant were clearly not modified (Figure 3). Transcripts
translated in vitro in a cell-free rabbit reticulocyte lysate system,
modified the rRNA but to a reduced extent. Without purifying
the mutant to homogeneity, we can estimate that the mutant
appeared to have approximately 10% of the activity of wild-type
PAP. It has been shown that wild-type PAP is approximately
100 to 500 fold more active towards non-salt washed reticulocyte
ribosomes than it is towards E.coli ribosomes (3). Therefore it
is possible that the lack of activity of R68G towards prokaryotic
ribosomes in our assay is due to the poor activity of R68G in
general. R68 is located in the C-strand of the 6-stranded /3-sheet
of PAP in a C a position that is highly conserved with the
equivalent residue in ricin A-chain, which is D75 (4). From
examination of the X-ray structure of PAP, R68 has the potential
to H-bond with Y72, a highly conserved residue in RIPs and
one that has been postulated to be critically involved in the
catalytic mechanism (19). When RNA substrates are modelled
into the PAP and RTA structures, Y72 (or Y80 in RTA) alters
orientation about the backbone to allow efficient catalysis. It is
possible that mutation of R68G causes perturbation of the
positioning of Y72 leading to decreased catalytic activity. It is
therefore too early to say whether R68G is a genuine ribosomerecognition mutant or whether it represents a catalytic or
misfolding mutant. Certainly the discrepancy between our own
findings of very weak activity towards eukaryotic ribosomes and
1540 Nucleic Acids Research, 1994, Vol. 22, No. 9
the previous finding that the R68G-containing PAP was only
about two fold less active than native PAP requires further
clarification.
Of the other two mutations F196 is located between helix F
and G in the PAP tertiary structure in an area of poor primary
sequence conservation. It is unclear from the tertiary structure
how mutation of Phe to the aromatic Tyr would affect activity
and this is reflected in our experimental observations. K211 is
part of helix H and lies in a conserved sequence. Examination
of the contacts made by PAP and a hypothetical RNA tetraloop
substrate (C1G2A3G4A5G6) modelled into the active site, showed
that K211 donates a H-bond to the adenine nucleotide A5. The
conserved substitution of R for K211 may be able to mimic this
potential H-bond and so maintain catalytic activity.
This study has highlighted the difficulties involved in examining
theribosome-inactivatingproperties of RIPs. Proteins which were
apparently non-toxic to E.coli have been shown to retain Nglycosidase activity toward prokaryotic ribosomes and therefore
retain the ability to recognise, and inactivate, prokaryotic
ribosomes. One of the mutants, R68G, appeared to have
decreased activity and must be studied further before it can be
determined whether this mutant has merely reduced catalytic
activity or true differences in ribosome recognition. It is hoped
that by studying the properties of mutants such as these, we will
be able to delineate the activities of different RIPs.
ACKNOWLEDGEMENTS
We would like to thank Z.C.Chen for the generous gift of the
PAP clone and J.D.Robertus and colleagues for helpful discussion
regarding the structure of PAP and for supplying PAP and antiPAP antibodies. We acknowledge the support of the AFRC with
grant PG88/520.
REFERENCES
1. Lord,J.M., Hartley,MR. and Roberts,L.M. (1991) Seminars in Cell Biology,
2, 15-22.
2. Endo.Y. and Tsurugi,K. (1987) J. Biol. Chem., 263, 8735-8739.
3. Hartley.M.R., Legname.G., Osborn.R., Chen,Z. and Lord,J.M. (1991) FEBS
Lett., 290, 65-68.
4. Monzingo,A.F., Collins,E.J., Ernst, S.R., lrvin,J.D. and Robertas,.!.D.
(1993) J. Mol. Biol, 233, 705-715.
5. Dore,J-M., Gras,E., Depierre.F. and Wijdenes,J. (1993) Nucleic Acids Res.,
21, 4200-4205.
6. Lin,Q., Chen,Z.C, Antoniw, J.F. and White, R.F. (1991) Plant Mol. Biol.,
17, 609-614.
7. Chen,Z.C, Amoniw,J.F., Lin,Q. and White, R.F. (1993) Physiol & Mol.
Plant Path., 42, 237-247.
8. Vandeyar,M., Weiner,M., Hutton,C. and Batt.C. (1988) Gene, 65, 129-133.
9. May.M.J., Hartley,M.R., Roberts,L.M., Kreig.P.A., Osborn,R.W. and
Lord.J.M. (1989) EMBO J., 8, 301-308.
10. Anderson,C.W., StrausJ.W. and Dudock.B.S. (1983) Methods in Enzymology
101, Academic Press. New York, pp 635-644.
11. Laemmli.U.K. (1970) Nature, 270, 680-685.
12. Chaddock,J.A. and Roberts,L.M. (1993) Protein Engineering, 6, 425-431.
13. Sambrook.J., Fritsch.E.F. and Maniatis.T. (1989) Molecular Cloning : A
laboratory Manual. Second edition. Cold Spring Harbor Laboratory Press.
Cold Spring Habor, New York.
14. Kirby.K.S. (1968) In Grossman.L. and Moldave,K. (eds), Methods in
Enzymology XIIB. Academic Press, New York, pp. 87-110.
15. Kataoka,J., Ago.H., Habuka,N., Furuno,M., Masuta,C, Miyano,M. and
Koiwai,A. (1993) FEBS Lett., 320, 31-34.
16. Studier,F.W. and Moffatt,B.A. (1986) J. Mol. Biol., 189, 113-130.
17. Kataoka,J., Habuka.N., Masuta.C, Miyano.M. and Koiwai.A. (1992) Plant
Mol. Biol, 20, 879-886.
18. Habuka.N., Murakami,Y., Noma,M.. Kudo,T. and Horikoshi,K. (1989)
J. Biol. Chem., 264, 6629-6637.
19. Kim,Y. and Robertus.J.D. (1992) Protein Engineering, 5, 775-779.