Am J Physiol Heart Circ Physiol
281: H1657–H1666, 2001.
Evidence supporting the Nucleotide Axis Hypothesis:
ATP release and metabolism by coronary endothelium
IAIN L. O. BUXTON, ROBERT A. KAISER, BRIAN C. OXHORN, AND DENNIS J. CHEEK
Department of Pharmacology, University of Nevada School of Medicine, Reno, Nevada 89557
Received 12 March 2001; accepted in final form 13 June 2001
release of vasoactive factors; ectoenzyme; ecto-Nm23
ATP is, despite its ubiquitous role in
fueling cellular processes, strictly an intracellular petroleuse is invalid. It is now well established that both
nucleosides and nucleotides, released as local hormones and neurotransmitters (35), act as extracellular
signaling molecules in many parts of the body (16, 26).
Extracellularly directed receptors for ATP exist as both
ion channels (P2x) and G protein-coupled receptors
(P2Y) and are ubiquitously expressed in all mammalian tissues examined to date (26). Indeed, the extracellular role of nucleotides in the regulation of multicellular communication is evident as early in the
passage of evolution as the Protista (29). In the ischemic heart, adenosine released from myocytes augments blood flow (3), and ATP may play a role in the
regulation of cardiac blood flow in nonpathological
THE NOTION THAT
Address for reprint requests and other correspondence: I. L. O.
Buxton, Univ. of Nevada School of Medicine, Howard Research Bldg.,
Laboratory Suite 216, Reno, NV 89557.
http://www.ajpheart.org
states (8). We (37) and others (4) have shown that
endothelial cells release ATP in response to numerous
stimuli, such as shear stress and vasoactive agonists,
including ATP itself. Furthermore, ATP acting at the
endothelial cell P2y1 receptor, stimulates the release of
the endothelium-dependent vasodilators nitric oxide
(NO) and prostacyclin I2 (PGI2) (26). We have hypothesized that the release of ATP by coronary endothelium
and its subsequent actions at ATP receptors on nearby
endothelial cells and downstream from the site of release where it acts as the ATP metabolites (ADP and
adenosine) constitute fundamental elements of an intravascular axis that serves to regulate vascular tone
(37).
The Nucleotide Axis Hypothesis proposes that in
response to discrete stimuli, such as the action of
vasoactive agonists on endothelium or acute changes in
shear stress, ATP is released from endothelium and
acts as an autocrine and paracrine hormone able to do
the following. First, it may cause receptor-mediated
release of vasoactive factors such as NO, PGI2, and
ATP from endothelium. Second, it may act in the blood
vessel lumen at P2y1 and P2y2 receptors on nearby
endothelium downstream from the site of release to
amplify the ATP and vasoactive factor release response. Third, it may act on platelets in the bloodstream adjacent to endothelium as an antagonist at the
thrombocyte P2t receptor to block platelet aggregation.
Fourth, once dephosphorylated to ADP by ecto-ADPase
of endothelium, it may act again at P2Y1 receptors and
be (in part) converted back to ATP by the endothelial
ectonucleoside diphosphate kinase (NDPK) to act
again, thus propagating the actions of ATP in time and
space within the blood vessel. Fifth, it may eventually
break down to adenosine downstream from the site of
release/conversion in the coronary artery, resulting in
continued inhibition of platelet aggregation, vasodilation of resistance vessels, and growth maintenance/
promotion of endothelium.
Whereas the documented release of ATP by endothelial cells in tissue culture is suggestive of a physiological role for ATP release in vivo, it is possible that such
release is the result of the alteration or activation of
endothelium during cell isolation or is a result of the
The costs of publication of this article were defrayed in part by the
payment of page charges. The article must therefore be hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
0363-6135/01 $5.00 Copyright © 2001 the American Physiological Society
H1657
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
Buxton, Iain L. O., Robert A. Kaiser, Brian C. Oxhorn, and Dennis J. Cheek. Evidence supporting the Nucleotide Axis Hypothesis: ATP release and metabolism by
coronary endothelium. Am J Physiol Heart Circ Physiol 281:
H1657–H1666, 2001.—The Nucleotide Axis Hypothesis, defined and supported herein, proposes that ATP stimulates
the release of vasoactive mediators from endothelium, including ATP itself. Here, we show rapid endothelium-dependent, agonist-stimulated ATP elaboration in coronary vessels
of guinea pigs. Measurement of extracellular ADP metabolism in intact vessels results in the time- and substratedependent formation of ATP in the coronary perfusate in
amounts greater than can be accounted for by release from
endothelium alone. ATP formation by endothelial cells is
saturable (KM ⫽ 38.5 ␮mol/l, where KM is substrate concentration at which rate is half-maximal.) and trypsin-sensitive,
membranes from [␥-32P]ATP-labeled cells support ADP-dependent transphosphorylation by a 20-kDa protein, Western
blots reveal the presence of a nucleoside diphosphate kinase
(NDPK) of ⬃20 kDa in endothelial membranes, and analysis
of NDPK antibody binding by flow cytometry is consistent
with the presence of an ecto-NDPK on cardiac endothelial
cells. Sequencing of the endothelial cell ecto-NDPK reveals a
predicted amino acid sequence with 85% identity to human
Nm23-H1 and consistent with a protein whose properties
may confer membrane association as well as sites of regulation of activity. Our data underscore the potential importance of a nucleotide axis in cardiac blood vessels.
H1658
NUCLEOTIDE AXIS IN CARDIAC BLOOD VESSELS
conditions of cell culture. Thus we have employed both
primary cultures of endothelial cells as well as a modified perfused heart model to determine whether ATP
release occurs in intact coronary arteries of guinea pigs
and to investigate the likely fate of purine nucleotides
in the coronary circulation. Here we demonstrate a role
for nucleotides and the peptide bradykinin in the moment-to-moment regulation of ATP release by endothelium and offer evidence for the extracellular production
of ATP from ADP by endothelium in a heretofore unappreciated manner.
METHODS
AJP-Heart Circ Physiol • VOL
281 • OCTOBER 2001 •
www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
Coronary artery perfusion. Hearts, removed from CO2asphyxiated female guinea pigs (300–350 g) under an institutionally approved protocol, were cannulated via the aorta
and perfused with 37°C heart perfusion buffer (HPM) at pH
7.2 (37). In Ca2⫹-free HPM buffer, the right and left epicardial coronary vessels could be cut 10 mm from their origin
and cannulated with polyethelene tubing for collection of the
perfusate. The preparation was then perfused at 4 ml/min
with buffer as described above containing CaCl2 at 1.8
mmol/l. In some experiments, the right coronary artery was
perfused with distilled H2O for 3 min to remove a functional
endothelium (9) and was verified microscopically (17). Experiments performed in this way were unaffected by treatments
altering flow because the perfusion was controlled at a constant rate and only the epicardial portion of the vessel was
employed.
Preparation of endothelial cells. Guinea pig hearts (6 females/prep) were perfused with Ca2⫹-free HPM containing 1
mg/ml collagenase (Worthington, type II) and purified as
previously described (37). Endothelial cells liberated in this
manner were grown to confluence on polymer (F-5147, Sigma)-coated plastic for 5 to 7 days. Cells were subcultured and
employed as first (P-1) through third passage. In flow cytometry studies, freshly isolated cells were first labeled with a
mouse anti-human monoclonal antibody (IgG1) directed
against the endothelial marker CD31 (clone EN4) and positive cells retrieved by fluorescence-activated cell sorting (10).
CD31⫹ cells were grown as above and employed for detection
of Nm23-H1 as described. In studies not described here,
RT-PCR studies of RNA from cells as early as the fifth
passage were found to loose expression of P2 receptors.
Measurement of ATP by chemiluminescence. The presence
of ATP in the coronary perfusate or cell culture incubation
media was determined using luciferin-luciferase chemiluminescence (37). Effects of all treatments on the assay were
always carefully controlled, such as the use of ADP at concentrations employed in our experiments, which produces a
small signal in the assay.
Measurement of purines by HPLC. Metabolism of [2,83
H]ADP sodium salt, and [8,5⬘-3H] GDP sodium salt by cells
and coronary vessels was determined by injecting filtered
control or experimental buffer solutions (400 ␮l) over a
100-mm Whatman Partisil SAX (5 ␮m) HPLC column. Purines were separated by a linear gradient of NH4PO4 (pH 3.8)
from 0 to 2 M. Radioactivity was measured continuously
using an INUS ␤-RAM pumping flow scintillation cocktail at
a ratio of 3:1 resulting in an efficiency for tritium of 36%. The
identity of peaks for adenine and guanine nucleoside and
nucleotides were determined by separation of bona fide standards.
Western blots. Endothelial cells were removed from the
growth surface with PBS (pH 7.2) containing 1 mmol/l EGTA
without trypsin. The employment of trypsin to remove cells
markedly reduced the density of bands that stained with
antibodies for NDPK in immunoblots. Cell pellets were homogenized on ice in Kontes 1-ml glass-glass homogenizers in
PBS containing leupeptin (1 ␮mol/l). Membrane and cytosolic
fractions were prepared by a slow-speed initial centrifugation
of the cell homogenate (⫻1 K, 10 min), followed by centrifugation of the resulting supernatant at ⫻88 K for 45 min.
Samples for PAGE were boiled in SDS using standard protocols. Proteins separated by SDS-PAGE (15%) were blotted
to nitrocellulose and probed with a rabbit polyclonal antibody
(19) directed against rat liver NDPK or a monoclonal antibody directed against Nm23-H1.
Endothelial NDPK-phosphotransferase activity. Endothelial cell membranes were incubated with 100 ␮mol/l ATP
([␥-32P]ATP, 100 ␮Ci) ⫾ the NDPK substrate ADP (30
␮mol/l) added as a phosphate acceptor. Reactions carried out
in endothelial cell membranes at 21°C for 30 min in the
absence of a phosphoryl donor were separated on 15% SDS
PAGE gels exposed to Kodak X-OMAT AR film in cassettes
with intensifying screens held at 4° for 48–72 h. Film was
developed (Konica QX-70 film processor) and quantified by
desitometry.
NDPK-A surface labeling by flow cytometry. Endothelial
cells were incubated with mouse monoclonal antibody
(IgG2a) directed against human Nm23-H1 antigen (Santa
Cruz Biotechnology; Santa Cruz, CA). A secondary rabbit
antibody-FITC conjugate directed against mouse IgG2a was
employed to detect binding of the primary antibody. Controls
were employed for nonimmune mouse IgG2a/secondary antibody binding. Cells (10,000) were analyzed by flow cytometry
using a Beckman-Coulter EPICS Elite ESP instrument, and
flow experiments were repeated five times with endothelial
cells from different cell isolations.
RNA isolation and RT-PCR. Total RNA was isolated from
50 mg of freshly dissected guinea pig ventricle or 1 ⫻ 106
plated cardiac endothelial cells using the TRIzol method
(GIBCO-BRL, Life Technologies; Grand Island, NY). Isolated
RNA was DNAse I-treated before cDNA synthesis and reverse transcribed using Superscript II. Quality of cDNA was
tested for genomic contamination by performing ␤-actin control RT-PCRs and checking for the presence of the genomic
(700 bp) or cDNA (500 bp) product. RT-PCR was performed
for 40 cycles at 94°C 25 s, 58°C 25 s, and 72°C 60 s in an
Eppendorf Mastercylcer Gradient (Eppendorf Scientific;
Westbury, NY) with primers of our own design obtained from
Integrated DNA Technologies (Coralville, IA). Oligonucleotide primers for NDPK were designed for PCR based on
conserved sequences of the human (GenBank X73066),
mouse (M65037), and rat (D13374) NDPK genes as follows:
forward GAGCGTACCTTCATTGC(G/C)ATC, reverse GCACTCTCCAC(A/T)GAATCACTGC. Products were analyzed on
1.0% agarose gels, stained with 2 ug/ml ethidium bromide
and imaged. RACE-ready cDNA was synthesized according
to the SMART-RACE protocol (Clontech; Palo Alto, CA) using
3 ␮g of ␤-actin verified total RNA. The 3⬘ reaction was
performed using the RACE primer and the forward primer
given above. The 5⬘ reaction was performed using the RACE
primer and the reverse primer GATGTTCCTGCCGACTTG.
RACE PCRs were performed using the following variation of
touchdown PCR: 5 cycles 94°C 30 s/72°C 3 min, 5 cycles 94°C
30 s/70°C 30 s/72°C 3 min, and 28 cycles 94°C 30 s/68°C 30
s/72°C 3 min. Potential bands were isolated from a 1.0%
agarose gel (QIAgen Gel extraction method, Valencia, CA)
and sequenced using an ABI/prism sequencer.
Materials. All drugs and chemicals were obtained from
Sigma (St. Louis, MO) unless otherwise noted. Collagenase
NUCLEOTIDE AXIS IN CARDIAC BLOOD VESSELS
H1659
type-II was obtained from Worthington Biochemical (Lakewood, NJ). Radioactive nucleotides were obtained from NEN
Life Science Products, now Perkin-Elmer Life Sciences (Boston, MA). Polyclonal antibody to rat liver NDPK was the
generous gift of N. Kimura, Tokyo Metropolitan Institute of
Gerontology (Tokyo, Japan). Monoclonal antibody to
Nm23-H1 employed in immunoblots was obtained from
Seikagaku America (Rockville, MD). DNAse I was obtained
from Promega, Madison, WI and Superscript II from Gibco
(Rockville, MD).
RESULTS
AJP-Heart Circ Physiol • VOL
Fig. 1. Agonist-mediated ATP release from guinea pig coronary
arteries in situ. Female guinea pig hearts were cannulated for
collection of the perfusate. ATP, expressed as picomoles of ATP per
milliliter of perfusate, was measured using the luciferin-luciferase
method. A: agonists were added continuously at the concentrations
shown, and the perfusate was collected at the indicated times (rate ⫽
4 ml/min). A lag seen is due to the start time being marked just
before switching flow to a buffer containing drug. B: hearts were
prepared as in A but perfusate from right and left vessels were
segregated. Agonists were added at the indicated times and flow
collected over 2 min. Removal of endothelium in the right coronary
only, by perfusing with distilled water for 3 min at min 90–93,
prevented the response to bradykinin (BK), which persisted in the
left coronary artery and again could be prevented by the addition of
antagonist. 2-Me-S-ATP, 2-methylthio-ATP. Bsl, basal; H, HOE-140.
Means ⫾ SE, n ⫽ 8 experiments (A), n ⫽ 4 experiments (B).
thelium is not prevented, it is clear that within this
1-min exposure to endothelium, the disappearance of
[3H]ADP can be approximately accounted for by the
[3H] products of metabolism seen on the chromatogram. Control perfusions through endothelium-de-
281 • OCTOBER 2001 •
www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
In perfused coronary artery of the guinea pig, introduction of BK results in the immediate release of ATP
that can be measured in the perfusate (Fig. 1A). The
time course of release to BK (1 nM) in the continued
presence of the agonist (flow, 4 ml/min) peaks within
the first minute; desensitizes, thereafter, consistent
with action of BK at the BK2 receptor on endothelium;
and is blocked by the addition of the BK receptor
antagonist HOE-140. Release of ATP by coronary artery was endothelium-dependent, because removal of
endothelium in the right, but not the left, coronary
artery by prior perfusion with distilled water eliminated the response to BK (Fig. 1B). Addition of 2-methylthio-ATP or ADP, both agonists at the endothelial
P2Y1 receptor (1), led to the immediate appearance of
ATP in the perfusate (Fig. 1A). However, unlike the
action of BK, stimulation of the endothelial P2Y1 receptor led to the sustained appearance of ATP in the
perfusate despite the fact that ATP receptor responses
are known to desensitize rapidly (36). Because ATP is
known to stimulate its own release from endothelial
cells in culture (37), we reasoned that such a phenomenon could explain the continued presence of ATP in
the coronary perfusate. However, studies in cultured
cells suggested an additional possibility.
When ADP was added in increasing concentrations
to cultured guinea pig endothelial cells, ATP elaboration measured at concentrations above 10 ␮mol/l was
significantly greater than that seen with BK at any
dose (Fig. 2A, inset) and represented as much as 10%
(at 100 ␮M ADP) of total cellular ATP (Fig. 2B). Such
a large amount of ATP from cells could not be explained by release alone. Indeed, all of the ATP in the
cell, defined by treatment with perchloric acid, totaled
18.8 ⫾ 2.45 nmol/million cells, whereas total “releasable” ATP defined by treatment with ionomycin (1 ␮M)
for 2 min (Fig. 2B), measured 12.34 ⫾ 2.23 nmol/
million cells. To test our hypothesis that ATP could be
generated extracellularly by endothelium, we introduced [3H]ADP (1 ␮Ci, 100 ␮M) into the coronary
artery perfusate in the presence of a phosphoryl donor
(GTP, 1 mM). The perfusate was collected and subjected to HPLC anion-exchange separation with radioactive flow detection. In the presence of GTP, there was
a rapid formation of [3H]ATP at the expense of
[3H]ADP along with the expected formation of
[3H]AMP and [3H]adenosine (Fig. 3A). Although it is
not strictly possible to account for all adenyl purine in
these experiments where adenosine uptake into endo-
H1660
NUCLEOTIDE AXIS IN CARDIAC BLOOD VESSELS
nuded vessels demonstrated that this [3H]ATP formation is a consequence of an intact endothelium (Fig.
3B). In particular, the fact that one observes ATP
formation comparable to that of AMP formation in
intact vessels, suggests the presence of an ecto-ADP
kinase present on endothelium. The ability of endothelium to convert ADP to ATP in the presence of GTP was
not exclusive. When [3H]UDP was employed as substrate and ITP employed as a phosphoryl donor,
[3H]UTP was formed (data not shown).
The existence of an endothelial ectoenzyme was also
suggested in experiments employing primary cultures
of cardiac endothelial cells. The candidate enzyme for
ATP production from ADP in the presence of a phosphoryl donor is a NDPK that catalyzes the reaction [N1
DP ⫹ N2TP 7 N1TP ⫹ N2DP] (23). Intact cell culture
monolayers exposed to ADP in the presence of GTP
AJP-Heart Circ Physiol • VOL
281 • OCTOBER 2001 •
www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
Fig. 2. Measurement of ADP-stimulated ATP elaboration by primary cultures of cardiac endothelial cells suggests a process other
than release. A: guinea pig cardiac endothelial cells, isolated and
cultured as previously described (37), were exposed to increasing
concentrations of ADP or BK (Inset) in Krebs buffer for 2 min, and
ATP was measured using the chemiluminescent luciferin-luciferase
assay. B: confluent monolayers of endothelial cells were washed, and
total cellular ATP was measured after perchloric acid extraction
(PCA, 2%) using chemiluminescence. Treatment of cultures with
ionomycin (IONO, 1 ␮M, 2 min) defined all ATP that could possibly
be made available for release under any physiological circumstance.
Data are means ⫾ SE, n ⫽ 5 experiments.
(1 mM) yielded the rapid appearance ATP in the buffer
bathing the cells in a fashion (15) suggesting the presence of an ectoenzyme (Fig. 4A). The substrate concentration at which the maximal rate of reaction (Vmax) is
half-maximal (Km) obtained in these experiments
(Km ⫽ 38.5 ␮mol/l) was consistent with the action of an
NDPK as was blockade by addition of UDP at high (5
mM) concentration, the absence of an effect of the
adenylate kinase inhibitor diadenosine pentaphosphate (Fig. 3D), and the ability to see the same activity
(albeit with a much decreased Vmax) at 4°C (data not
shown). Consistent with an NDPK is its promiscuity
with respect to nucleotide substrate and phosphoryl
donor (23). Endothelial cells were able to convert
[3H]GDP to [3H]GTP in the presence of ATP (Fig. 3C)
and could also utilize IDP or CDP as substrate (data
not shown). The ability of the nonneutralizing antiNDPK antibody we employed to activate the enzyme
(Fig. 3D) was also seen when the antibody was employed with the purified rat liver NDPK (Sigma) used
as a control.
We employed mild trypsin treatment of the cultures
(Fig. 4B) and obtained results demonstrating an 85%
reduction in ATP generated within 1 min. The effect of
trypsin was reversible after a 45-min recovery period in
growth medium. The presence of an ecto-NDPK was
confirmed in Western blots, employing polyclonal antibodies directed against rat liver NDPK (19), which
showed the presence of a 20.5-kDa membrane-associated
NDPK (Fig. 5A). This same nonneutralizing antibody,
when added to activity assays, stimulated the enzyme
twofold (Fig. 3D). A monoclonal antibody directed against
the human Nm23-H1 gene product, an NDPK isoform
expressed by numerous transformed cells (14, 31, 32) and
proposed as a metastasis associated gene (27), further
identified the endothelial NDPK as the guinea pig homologue of human Nm23-H1 (Fig. 5B).
Partially purified endothelial cell membranes were incubated in the presence of [␥-32P]ATP, washed, incubated
with the NDPK acceptor (ADP), and separated by SDS
PAGE followed by autoradiography. Autoradiograms
demonstrated decreasing concentrations of [␥-32P]phosphate associated with NDPK over time (Fig. 6) dependent
on the presence of the acceptor, ADP.
While the expression of NDPK as an ectoenzyme is
strongly suggested by the ability to measure enzyme
activity in a coronary vessel or in a cell monolayers,
additional evidence for the surface expression was obtained using flow cytometry of intact cells. Incubation
of cells with a fluorescent antibody directed at human
NDPK (Nm23-H1 specific) and analysis of fluorescence
by flow cytometry revealed that the entire population
of cells acquired a fluorescence signal consistent with
expression of an ecto-NDPK (Fig. 7).
RT-PCR was employed to sequence a guinea pig
NDPK based on the notion that the activity we measure is homologous to Nm23-H1. The following open
reading frame was obtained from the sequences of the
NDPK RACE products (Genbank accession number
AY017306): ATGGCCAGCAGTGAGCGGACCTTCATTGCCATCAAGCCGGATGGTGTCCAGCGGGGAC-
NUCLEOTIDE AXIS IN CARDIAC BLOOD VESSELS
H1661
TTGTGGGAGACATCATCAAACGCTTTGAGCAGAAGGGATTCCGCCTTGTGGCCCTGAAACTTATACAGGCCTCGGAGGACCTGCTCAAGGAGCACTACGTCGACCTGAAGGACCGCCCGTTCTTCCCTGGCCTGGTGCAGTACATGCACTCGGGACCTGTGGTTGCCATGGTCTGGGAGGGGCTGAACGTGGTGAAGACGGGCCGTGTGATGCTGGGAGAGACCAACCCTGCAGACTCCAAGCCGGGCACCATCCGAGGGGACTTCTGCATCCAAGTCGGCAGGAACATCATCCACGGCAGCGGCGACTCGGTGGAGAGCGCCGAGAAGGAGATCGCGCTGTGGTTCCAGCCGGAGGAGCTGGTGGACTACAGGAGCTGTGCTCAGGACTGGATCTATGAGTGA.
This sequence is up to 86% identical to the published
mouse, human, and rat sequences and translates into a
154 amino acid protein that is up to 91% identical and
over 94% homologous to these other NDPK sequences
(Fig. 8). This sequence contains one more codon than
the comparable sequences corresponding to a glycine at
position 121. This sequence contains key conserved
residues believed to be associated with phosphorylation
(serines-44, -120, -123, -126), protein:protein interaction
AJP-Heart Circ Physiol • VOL
(phenylalanine-59), and catalysis of the phosphate transfer (histidine-118) (20). Serines-123 and -126 correspond
to -122 and -125 in all other published NDPKs that lack
glycine-121. The guinea pig NDPK contains one of the
three amino acids associated with DNA binding (arginine-34); however, it lacks the other two (asparagine-69
and lysine-135) of the human Nm23-H2 (25).
DISCUSSION
Our results demonstrate that critical elements of our
proposed nucleotide axis hypothesis can be established
in coronary arteries in situ and support the notion that
the elaboration of ATP through release and extracellular formation by endothelium could serve to regulate
the production of endothelium-dependent vasodilators
and prevent thrombosis. Indeed, when agonist is delivered to the perfused coronary, the effluent is seen to
contain significant amounts of ATP as soon as a measurement can be taken. This result is consistent with
the notion that the regulated release of ATP could be
281 • OCTOBER 2001 •
www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
Fig. 3. Guinea pig coronary endothelium expresses nucleoside diphosphate kinase (NDPK) activity. A: representative HPLC tracings of [3H]ADP metabolism by coronary artery. Radioactive ADP ([3H]ADP, 1 ␮Ci) in the
presence of nonradioactive ADP (30 ␮mol/l) was introduced into the perfusion (4 ml/min) as a 400-␮l bolus and the
perfusate collected at 20 (A), 40 (B), and 60 s (C). Retention time for ATP was determined using bona fide standard.
B: results from several experiments demonstrate that guinea pig coronary arteries generate significant amounts
of ATP from ADP in an endothelium-dependent fashion (nd ⫽ none detected). Endothelium was removed as
detailed in Fig. 1. Total recovery of radioactivity was 3 ⫾ 0.5% less in the endothelium intact vessels. Data are
mean ⫾ SE, n ⫽ 5 experiments. C: endothelial cell monolayers, convert [3H]GDP to [3H]GTP in the presence of ATP
added as a phosphoryl donor. Representative HPLC tracings performed as in A are (trace A) HPLC separation of
the radioactive label before addition to cells (trace B), HPLC tracing of sample incubated with cells for 2 min.
Retention time for GTP was determined using bona fide standard. D: determination of activity converting [3H]GDP
to [3H]GTP in the absence and presence of the adenylate kinase inhibitor Ap5A (100 ␮mol/l), the putative NDPK
inhibitor UDP (5 mmol/l) and a nonneutralizing polyclonal antibody to NDPK. cpm, Counts per minute. Data are
means ⫾ SE, n ⫽ 4–6 experiments.
H1662
NUCLEOTIDE AXIS IN CARDIAC BLOOD VESSELS
Fig. 4. Endothelial cells express an ecto-NDPK. A: intact endothelial
cell monolayers were exposed to increasing concentrations of ADP in
the presence of GTP (1 mmol/l) and ATP in the Krebs incubation
buffer was determined at 2 min using the luciferin-luciferase assay.
Data were normalized to cell number and computer fit to obtain KM
and Vmax using the equation: v/Vmax ⫽ [S]/Ks ⫹ [S] where v, rate
observed; Vmax, maximal rate of reaction; [S], substrate concentration; Ks, affinity of enzyme for substrate; Km, substrate concentration
at which rate is one-half maximal. Data are the means ⫾ SE, n ⫽ 10.
B: NDPK activity was assessed in similar cultures in the absence of
ADP and GTP (basal) or in the presence of both substrate and donor
(ADP 10 ␮mol/l ⫹ GTP 1 mmol/l) for 1 min. Treatment of the same
cultures with trypsin (0.3% wt/vol in Ca2⫹-free Krebs buffer) for 90 s
followed by washing (posttrypsin) reduced the ability of the cells to
convert ADP to ATP (623 ⫾ 35 7 132 ⫾ 16 pmol/106 cells). Cells
reacquired the ability to generate ATP from added ADP after cells
were returned to growth conditions for 45 min, washed, and the
experiment repeated (recovery). Data are means ⫾ SE, n ⫽ 6.
involved in acute alterations in blood flow and prevention of platelet aggregation and in agreement with the
measurement of significant amounts of ATP seen in
arterial blood (5). The fact that such release can be
blocked and is not seen, if endothelium is intentionally
damaged, supports the notion that ATP release is a
receptor-mediated endothelial cell phenomenon in a
real blood vessel.
Studying ATP release from endothelium with agonists such as BK does not suffer ambiguity as was the
case with the P2y1 receptor agonist ADP. Our efforts to
AJP-Heart Circ Physiol • VOL
Fig. 6. Autoradiographic analysis of ADP-ATP phosphotransferase
activity in cardiac endothelial cell membranes. A: endothelial cell
membranes were incubated with [␥-32P]ATP (100 ␮Ci; 100 ␮M) in
the presence (lanes 3, 5, and 7) and absence (lanes 2, 4, and 6) of the
NDPK substrate ADP (30 ␮M) as a phosphate acceptor. Enzymatic
reactions carried out at 21°C for 10 min (lanes 2, 3), 20 min (lanes 4,
5), or 30 min (lanes 6, 7) were separated on 15% SDS gels and
developed using a radiographic imager. Lanes 1 and 8 are purified
bovine NDPK under identical conditions in the absence of acceptor
for 1 min (lane 1) to 34 min (lane 8) as an assay control. Radiogram
is representative of six experiments yielding similar results. B:
densitometric analysis. Means ⫾ SE, n ⫽ 4 experiments.
281 • OCTOBER 2001 •
www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
Fig. 5. Western blot demonstration of NDPK protein in cardiac
endothelial cell membranes. Samples for PAGE were boiled in SDS
using standard protocols. A: proteins separated by SDS PAGE (15%)
were blotted to nitrocellulose and probed with a polyclonal antibody
directed to rat liver to NDPK [gift of N. Kimura (19)]. The blot was
developed using a goat anti-rabbit antibody conjugated to alkaline
phosphatase and revealed a 20.5-kDa membrane associated NDPK.
Lane 1, molecular weight marker (lysozyme); lane 2, bovine NDPK
(Sigma N-2635, 2 ␮g); lane 3, 4 ␮g of endothelial cell homogenate;
lane 4, 2 ␮g of endothelial cell cytoplasm; lane 5, 3 ␮g of endothelial
cell membrane fraction; lane 6, 4 ␮g of K562 leukemia cell homogenate (positive control). B: a monoclonal antibody (Seikagaku America) directed against human Nm23-H1 protein was employed to
detect cardiac endothelial cell NDPK after incubation with rabbit
anti-mouse antibody conjugated to horseradish peroxidase and detected using chemiluminescence. Lane 1, 1 ␮g of bovine NDPK; lane
2, 4 ␮g of endothelial cell homogenate; lane 3, 4 ␮g of endothelial cell
homogenate from cells pretreated with trypsin (0.5% w/v ⫻ 5 min);
lane 4, 4 ␮g of endothelial cell cytoplasm; lane 5, 4 ␮g of endothelial
cell membrane; lane 6, 4 ␮g of K562 leukemia cell homogenate
control. Blots in (A) and (B) were scanned to text and are representative of 7–10 experiments.
H1663
NUCLEOTIDE AXIS IN CARDIAC BLOOD VESSELS
measure the effect of ADP stimulation led to the unmistakable conclusion that ADP was not only acting at
a purinergic receptor to stimulate ATP release from
cells but was, in addition, supporting ADP phosphorylation extracellularly. The amounts of ATP that could
Fig. 8. Sequence alignment of endothelial NDPK-A. Alignment of guinea
pig NDPK-A (AY017306) with human
Nm23-H1 (X73066) and Nm23-H2
(X58965), mouse Nm23 (M65037), and
rat NDPK (D13374). A consensus sequence is presented below the alignment. A phylogenetic tree is also given
that demonstrates the guinea pig
NDPK is most closely related to the
human NM23-H1 protein. Alignment
and tree were prepared in Vector NTI
Suite 6.0 (Informax; Bethesda, MD).
AJP-Heart Circ Physiol • VOL
281 • OCTOBER 2001 •
www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
Fig. 7. Flow cytometric analysis of Nm23-H1 binding to intact
guinea pig cardiac endothelial cells. CD31-sorted endothelial cells
were grown to confluence in tissue culture flasks, removed without
the aid of trypsin, and immunostained as described in METHODS. Cells
were analyzed using a Beckman Coulter EPICS Elite ESP FACS and
side scatter from blue laser (488 nm) excitation of the cells quantified
from PMT2 as fluorescence isothiocyanate fluorescence for each cell
event under isotype control and Nm23-H1-positive conditions. Control cells received only the secondary antibody (IgG1) conjugated to
FITC as an isotype control. Data are from a single experiment
repeated 5 times with qualitatively similar results.
be generated by addition of ADP to endothelial cell
monolayers was enormous in contrast to the amounts
of ATP that could be measured by maximal stimulation
with nonnucleotide agonists and was more than could
be reasonably explained by release alone (2,800 pmoles
vs. 100 pmol/106 cells; data of Fig. 2). If ATP elaborated
after the addition of 100 ␮M ADP (Fig. 2A) were the
result of P2y1 receptor stimulation alone, it would
constitute ⬃20% of the ATP available after membrane
compartments were accessed by ionomycin treatment
(⬃10% total cellular ATP). Such a possibility was not
intellectually pleasing and, furthermore, does not fit
with the fact that coronary endothelium remains intact
after ADP perfusions as evidenced by the tissue’s ability to release ATP to subsequent introduction of BK
(data not shown). The alternate possibility that ADP
added in this fashion enters the cell, is phosphorylated,
and returns to the extracellular space without obvious
damage to the cell is also remote in the extreme. In
addition, the ability to measure NDPK activity in cell
cultures at 4°C suggests that under these conditions,
well below the phase transition temperature of a mammalian cell membrane, nucleotides could not possibly
enter and exit cells freely. We hypothesized, therefore,
that ATP formation after ADP perfusion of the coronary vessel was due not to regulated release alone, but
included in large measure, extracellular enzymatic formation of ATP.
Although substituted nucleotides such as 8-chlorocAMP have been employed as NDPK inhibitors (2),
there is no known potent and selective nonnucleotide
inhibitor of NDPK described to date that offers utility
H1664
NUCLEOTIDE AXIS IN CARDIAC BLOOD VESSELS
AJP-Heart Circ Physiol • VOL
serve to decrease the chances of platelet activation (5).
Such possibilities need not be rejected on the basis of
perceived dilution of the nucleotide. ATP, released
from or generated by endothelium, might reasonably
be expected to act as ATP (or a metabolite) immediately adjacent to the site of release in vivo (34). On the
basis of our data where ATP is measured in the bulk
perfusate, ATP reaches concentrations as high as 0.1
␮M in the coronary vessel. Whereas the subsequent
actions of released ATP may be diffusion limited, this
limitation is a special case for endothelium where the
laminar flow fluid layer above endothelial cells is in
motion continuously and not in immediate equilibrium
with the majority of liquid flowing in the vessel (11).
Although there is no objective method to determine the
concentration of released ATP at the microenvironment next to the endothelial surface, if restricted there
for a time, the resulting nucleotide concentration (10 to
100 times or more that determined for the bulk phase)
would be vasoactive in guinea pigs (7) and may lead to
formation of ADP that would achieve a local concentration sufficient to support the activity of NDPK.
Nucleotide axis hypothesis may offer a context in
which to consider the elegant work of those who have
established our understanding of the critical importance of NO in the regulation of vascular tone. It
appears that the list of those agonists and perturbations that stimulate endothelial cells to liberate NO (6,
12, 13, 28, 33, 37) also stimulates ATP release. Our
hypothesis suggests that ATP plays a central role in
the signaling and responsiveness of endothelium in
vivo and serves to amplify and carry forward in time
and space the effects of other vasoactive agonists or
shear stress beyond their initial sites of action in the
blood vessel. ATP release by endothelium stimulates
its own release, thus amplifying local vasodilation.
Once metabolized to ADP, the nucleotide can act again
at an endothelial cell P2y1 receptor to again amplify
the response (downstream) and, to the extent that ADP
is rephosphorylated to ATP, can act yet again as ATP
and then ADP, etc., furthering the axis cascade. The
movement of the nucleotide in the bloodstream, together with the estimated fraction of ADP that can be
rephosphorylated to ATP in the vessel (12%; data of
Fig. 4B), mitigates this seemingly positive feedback
system. Moreover, the presence of ATP elaboration by
endothelium will serve to limit platelet activation both
because ATP receptor activation leads to NO release
and because ATP [and its ultimate vascular end product adenosine (22)], like NO, is directly antithrombogenic. Once metabolized to adenosine, the purine acts
again to dilate terminal arterioles. This concept offers
the pleasing feature of biological economy by employing a single purine molecule acting multiple times at
disparate purinergic receptor sites in different locations within the vessel to achieve the local regulation of
blood flow. Finally, the avid uptake of adenosine by
capillary endothelium, where it can be reutilized, offers
the ultimate in biological economy.
In studies presented herein, we have employed an
extracellular phosphoryl donor in the form of either
281 • OCTOBER 2001 •
www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
in our studies. The enzyme’s ability to phosphorylate
either adenyl or guanyl purine dinucleotides as well as
pyrimidine dinucleotide, together with its inhibition by
high levels (in mM) of pyrimidine dinucleotide substrate or EGTA, are well known (14, 30). Whereas its
presence as an endothelial ectoenzyme was not known,
such a possibility was apparent in perfused hearts (21),
not without precedence in transformed cells (18, 19),
and could be directly tested in cultured cardiac endothelial cells.
The effect of limited proteolysis to remove the ability
of cells to support ADP to ATP conversion, together
with the return of the activity in the same cells after
trypsin removal and a period of control incubation,
supports the notion that the NDPK activity we measure is assembled as an ectoenzyme and that the cells
are capable of rapid recovery of activity under these
conditions.
The identity of the NDPK activity of endothelium as
Nm23-G1, the guinea pig homologue of Nm23-H1, is
evident from immunoblots and is consistent with the
ability of purified endothelial cell membranes to display a phosphoprotein that operates as a phosphoryl
donor capable of transferring phosphate to ADP. The
fact that this ping-pong transphosphorylase is an ectoenzyme is supported by our finding that intact cells
can be immunostained with Nm23-H1-specific antibody, analyzed by flow cytometry, and found to express
the antigen on the surface of the cell.
The proposed sequence of guinea pig ecto-NDPK contains three consensus protein kinase C sites at serine-4,
threonine-86, and threonine-103. These sites are conserved in all of the NDPKs aligned (Fig. 8). Sequence
analysis reveals that there are no transmembrane regions in NDPK, yet we find NDPK to be associated with
the membrane. There are no typical glycosylation sites,
but there are two conserved N-myristoylation sites
shared by all of the NDPKs at glycines-15 and -102, as
well as an additional myristoylation site in Nm23-G1
created at glycine-119 due to the unique presence of
glycine-121. This is absent in the human, mouse, and rat
proteins. This site is near the catalytic histidine-118 and
interrupts the potentially phosphorylated serines at -120,
-123, and -126. The role of this extra glycine is unclear,
and particularly interesting due to its location in such an
active region of the enzyme. The GDP binding pocket and
active site are conserved with histidine-118, leucine-48,
and serine-123 (24, 25).
Current dogma does not predict ADP-kinase activity
of endothelium but rather predicts the rapid metabolism of adenyl purine nucleotides to adenosine (15).
The notion that endothelium could generate ATP extracellularly was intriguing because it would be consistent with maintaining the actions of ATP in time
and space within the blood vessel and would allow the
purine nucleotide signal, originally generated by acute
changes in shear or the actions of rapidly degraded
peptide agonists such as BK to be carried forward well
beyond the site of initial endothelial response. Furthermore, the removal of the aggregatory agonist ADP by
rephosphorylation to platelet antagonist (ATP) would
NUCLEOTIDE AXIS IN CARDIAC BLOOD VESSELS
We are grateful to David Schooley for critical review of the manuscript and to Qaio Zhong for flow cytometry assistance.
This work was supported by grants from the American Heart
Association (National Center), National Heart, Lung, and Blood
Institute Grant HL-56422 and a grant from the Foundation for
Research (to I. L. O. Buxton), a postdoctoral fellowship from the
American Heart Association (Nevada Affiliate) (to D. J. Cheek), a
National Institutes of Health predoctoral fellowship award (NR07379) (to B. C. Oxhorn), and a predoctoral fellowship from the
American Heart Association (Western States Affiliate) (to R. A.
Kaiser).
Current address of D. J. Cheek: University of North Carolina at
Chapel Hill, Carrington Hall, CB 7460, Chapel Hill, NC 27599-7460
(E-mail: [email protected]).
REFERENCES
1. Alexander S and Peters JA. 1999 receptor and ion channel
nomenclature supplement. Trends Pharmacol Sci 10: 1–106.
1999.
AJP-Heart Circ Physiol • VOL
2. Anciaux K, Van Dommelen K, Willems R, Roymans D, and
Slegers H. Inhibition of nucleoside diphosphate kinase (NDPK/
Nm23) by cAMP analogues. FEBS Lett 400: 75–79, 1997.
3. Berne RM. Criteria for the involvement of adenosine in the
regulation of blood flow. In: Methods in Pharmacology, edited by
Paton DM. New York: Plenum, 1985, vol. 2, p. 331–336.
4. Bodin P and Burnstock G. ATP-stimulated release of ATP by
human endothelial cells. J Cardiovasc Pharmacol 27: 872–875,
1996.
5. Born GVR and Kratzer MAA. Source and concentration of
extracellular adenosine triphosphate during haemostasis in rats,
rabbits and man. J Physiol (Lond) 354: 419–429, 1984.
6. Bredt DS and Snyder SH. Nitric oxide: A physiologic messenger molecule. Annu Rev Biochem 63: 175–195, 1994.
7. Bunger R, Haddy FJ, and Gerlach E. Coronary responses to
dilating substances and competitive inhibition by theophylline in
the isolated perfused guinea pig heart. Pflügers Arch 358: 213–
224, 1975.
8. Buxton ILO and Cheek DJ. On the origin of extracellular ATP
in cardiac blood vessels: A dual role for endothelium. In: Adenosine and Adenine Nucleotides: From Molecular Biology to Integrative Physiology, edited by Belardinelli L and Pelleg A. New
York: Kluwer, 1995, p. 193–197.
9. Criscione L, Muller K, and Forney PM. Endothelial cell loss
enhances the pressor response in resistance vessels. J Hypertens,
Suppl II: S441–S444, 1984.
10. Cui YC, Tai PC, Gatter KC, Mason DY, and Spry CJ. A
vascular endothelial cell antigen with restricted distribution in
human foetal, adult and malignant tissues. Immunology 49:
183–189. 1983.
11. Davies PF. Endothelial cells, hemodynamic forces, and the
localization of atherosclerosis. In: Endothelial Cells, edited by
Ryan US. Boca Raton, FL: CRC, 1988, vol. 2, p. 123–138.
12. Dinerman JL, Lowenstein CJ, and Snyder SH. Molecular
mechanisms of nitric oxide regulation-potential relevance to
cardiovascular disease. Circ Res 73: 217–222, 1993.
13. Filtz TM, Li Q, Boyer JL, Nicholas RA, and Harden TK.
Expression of a cloned P2Y purinergic receptor that couples to
phospholipase C. Mol Pharmacol 46: 8–14, 1994.
14. Fukuchi T, Shimada N, Hanai N, Ishikawa N, Watanabe K,
and Kimura N. Recombinant rat nucleoside diphosphate kinase
isoforms (alpha and beta): purification, properties and application to immunological detection of native isoforms in rat tissues.
Biochim Biophys Acta 1205: 113–122, 1994.
15. Gordon EL, Pearson JD, and Slakey LL. The hydrolysis of
extracellular adenine nucleotides by cultured endothelial cells
from pig aorta. Feed-forward inhibition of adenosine production
at the cell surface. J Biol Chem 261: 15496–15507, 1986.
16. Hoyle CHV and Burnstock G. ATP receptors and their physiological roles. In: Adenosine in the Nervous System, edited by
Stone T. London: Academic, 1991, p. 43–76.
17. Keef KD and Bowen SM. Effect of ACh on electrical and
mechanical activity in guinea pig coronary arteries. Am J
Physiol Heart Circ Physiol 257: H1096–H1103, 1989.
18. Kimura N and Johnson GS. Increased membrane-associated
nucleoside diphosphate kinase activity as a possible basis for
enhanced guanine nucleotide-dependent adenylate cyclase activity induced by picolinic acid treatment of simian virus 40-transformed normal rat kidney cells. J Biol Chem 258: 12609–12617,
1983.
19. Kimura N and Shimada N. Membrane-associated nucleoside
diphosphate kinase from rat liver purification, characterization,
and comparison with cytosolic enzyme. J Biol Chem 263: 4647–
4653, 1988.
20. La Rosa AD, Williams RL, and Steeg PS. Nm23/nucleoside
diphosphate kinase: toward a structural and biochemical understanding of its biological functions. Bioessays 17: 53–62, 1995.
21. Moir TW and Downs TD. Myocardial reactive hyperemia:
comparative effects of adenosine, ATP, ADP, and AMP. Am J
Physiol 222: 1386–1390, 1972.
22. Packham MA, Ardlie NG, and Mustard JF. Effect of adenine
compounds on platelet aggregation. Am J Physiol 217: 1009–
1017, 1969.
281 • OCTOBER 2001 •
www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
GTP or ATP to favor the formation of the corresponding purine triphosphate by the action of guinea pig
ecto-Nm23 on a nucleoside diphosphate. Performing
the NDPK assay in this manner permits an unmistakable result. However, this approach also raises questions as to the origin in vivo of the phosphoryl donor
that fuels the ecto-Nm23 reaction. Does the enzyme
require that the phosphoryl donor be present extracellularly as is the case with the substrate, or is the
ectoenzyme phosphorylated in the membrane of the
cell at the expense of intracellular nucleoside triphosphate? One is tempted to suggest that the binding of
substrate and donor occur extracellularly because this
is the way we assay the activity present in intact cells
and on intact endothelium. Such a possibility would fit
with the fact that nucleotides such as GTP and UTP as
well as ATP and ADP are made abundant to the lumen
in vivo from activated platelets. However, because we
can label the guinea pig Nm23 enzyme in intact cells
incubated with [32P]orthophosphoric acid we favor the
notion that, in the normal coronary artery, the enzyme
is phosphorylated at the expense of an intracellular
phosphoryl donor. This notion also fits with data presented herein, showing that the enzyme is stably phosphorylated. Thus the enzyme is not only promiscuous
with respect to substrate and donor but also with
respect to the intracellular versus extracellular source
of the donor, which would mean that the endothelium
could support moment-to-moment formation of ATP in
both normal and pathological states as our hypothesis
proposes.
The framework we offer for considering the nucleotide axis of blood vessels may be a useful extension of
our understanding of the role of purines in protecting
myocardium during ischemia. Whereas these effects of
purine are abluminal, they serve to increase regional
blood flow in the heart. The intravascular actions of
purines also regulate blood flow. To the extent that
endothelial cells release ATP and that ATP is eventually hydrolyzed to adenosine, the nucleotide axis hypothesis can be viewed in context with the adenosine
hypothesis as aspects of the broad role for extracellular
purines in cardiovascular function.
H1665
H1666
NUCLEOTIDE AXIS IN CARDIAC BLOOD VESSELS
AJP-Heart Circ Physiol • VOL
31. Urano T, Furukawa K, and Shiku H. Expression of Nm23/
NDP kinase proteins on the cell surface. Oncogene 8: 1371–1376,
1993.
32. Urano T, Takamiya K, Furukawa K, and Shiku H. Molecular cloning and functional expression of the second mouse Nm23/
NDP kinase gene, Nm23-M2. FEBS Lett 309: 358–362, 1992.
33. Warren JB, Pons F, and Brady AJ. Nitric oxide biology:
implications for cardiovascular therapeutics. Cardiovasc Res 28:
25–30, 1994.
34. Welford LA, Cusack NJ, and Hourani SMO. The structureactivity relationships of ectonucleotidases and of excitatory P2purinoceptors: evidence that dephosphorylation of ATP analogues reduces pharmacological potency. Eur J Pharmacol 141:
123–130, 1987.
35. Westfall DP, Sedaa KO, Shinozuka K, Bjur RA, and Buxton ILO. ATP as a cotransmitter. Ann NY Acad Sci 603: 300–
310, 1990.
36. Yang S, Buxton ILO, Probert CB, Talbot JN, and Bradley
ME. Evidence for a discrete UTP receptor in cardiac endothelial
cells. Br J Pharmacol 117: 1572–1578, 1996.
37. Yang S, Cheek DJ, Westfall DP, and Buxton IL. Purinergic
axis in cardiac blood vessels. Agonist-mediated release of ATP
from cardiac endothelial cells. Circ Res 74: 401–407, 1994.
281 • OCTOBER 2001 •
www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.3 on June 17, 2017
23. Parks RE and Agarwal RP. Nucleoside diphosphokinases. In:
The Enzymes, edited by Boyer PD. New York: Academic, 1973, p.
307–333.
24. Postel EH. NM23-NDP kinase. Int J Biochem Cell Biol 30:
1291–1295, 1998.
25. Postel EH, Weiss VH, Beneken J, and Kirtane A. Mutational
analysis of NM23–H2/NDP kinase identifies the structural domains critical to recognition of a c-myc regulatory element. Proc
Natl Acad Sci USA 93: 6892–6897, 1996.
26. Ralevic V and Burnstock G. Receptors for purines and pyrimidines. Pharmacol Rev 50: 413–492, 1998.
27. Royds JA, Rees RC, and Stephenson TJ. Nm23–a metastasis suppressor gene? J Pathol 173: 211–212, 1994.
28. Smith TP and Canty JM. Modulation of coronary autoregulatory responses by nitric oxide–evidence for flow dependent resistance adjustments in conscious dogs. Circ Res 73: 232–240,
1993.
29. Soderbom F. Cell-cell signaling during dictyostelium development. Trends Microbiol 6: 402–406, 1998.
30. Sonnemann J and Mutzel R. Cytosolic nucleoside diphosphate kinase associated with the translocation apparatus may
provide GTP for protein synthesis. Biochem Biophys Res Commun 209: 490–496, 1995.