Chem 109 C Fall 2014 Armen Zakarian Office: Chemistry Bldn 2217 OVERVIEW DNA, RNA, etc. Structure and Classification • DNA: Deoxyribonucleic acid encodes hereditary information controls cell division and growth • RNA: Ribonucleic acid transcription and translation stores genetic information in viruses DNA, RNA, etc. Structure and Classification O P O- O P Obase O O O 5' 5' 2' 2' O base O O OH O P O- O P Obase O base O O O O O O P O- O P O- base O OH base O O O O DNA O OH RNA DNA, RNA, etc. Structure and Classification DNA and RNA RNA only DNA only DNA, RNA, etc. Structure and Classification DNA and RNA RNA only DNA only DNA, RNA, etc. Structure and Classification DNA and RNA RNA only DNA only DNA, RNA, etc. Structure and Classification DNA and RNA RNA only DNA only DNA, RNA, etc. Structure and Classification DNA and RNA RNA only DNA only DNA, RNA, etc. Structure and Classification DNA and RNA RNA only DNA only DNA, RNA, etc. Structure and Classification nucleosides = base + sugar NH2 NH2 N N N N N O HO N N N O HO HO 2'-deoxyadenosine HO OH adenosine PRACTICE PROBLEM Draw the structures and provide names for all other nucleosides DNA, RNA, etc. Structure and Classification nucleotides = base + sugar + phosphate N HN H2N -O O P O- O O O N N N HN H2N N N -O HO O HO 2'-deoxyguanosine 5'-monophsphate a deoxynucleotise H2N O O O OH N HN O P O- N N O O O O P O- O P O- O- O- guanosine 3'-monophosphate a ribonucleotide OH DNA, RNA, etc. Structure and Classification nucleotides = nucleoside phosphates NH2 NH2 dAMP 2’-deoxy Adenosine Mono Phosphate N N O O O P N O O- -O O HO O P O- O O P O- O O O P N O O- O HO OH OH cytidine 5'-triphosphate cytidine 5'-monophosphate CMP CTP NH2 NH2 N PRACTICE PROBLEM 2 Draw the structures for: dCMP, UDP, dTTP O O P O- O N N O -O O HO O P O- O O P O- O N O O HO 2'-deoxycytidine 5'-monophosphate 2'-deoxycytidine 5'-diphosphate dCMP dCDP DNA, RNA, etc. Structure and Classification dinucleotides 2 nucleotides oligonucleotides 3-10 nucleotides polynucleotides many (human DNA - 3,100,000,000 bp) NH2 N -O O P O- O O P O- O O P O- O NH2 N O O + HO dCTP -O N N O P O- O O P O- O O P O- N O HO dATP N O DNA, RNA, etc. NH2 N -O O P O- O O P O- O O P O- O N O O + O O P O- N O N O NH2 -O O P O- O O P O- O- N N HO CAGTAACCTGAGAACCAATCGGAA… Synthesis: nucleotide triphosphates, 5’ 3’ DNA, RNA, etc. Facts about DNA ! double helix ! two anti-parallel strands A pairs with T, G pairs with C pairing through hydrogen bonds stacking interactions DNA, RNA, etc. Facts about DNA double helix two anti-parallel strands ! A pairs with T, G pairs with C pairing through hydrogen bonds stacking interactions DNA, RNA, etc. Facts about DNA double helix two anti-parallel strands A pairs with T, G pairs with C ! pairing through hydrogen bonds stacking interactions DNA, RNA, etc. Facts about DNA double helix two anti-parallel strands A pairs with T, G pairs with C pairing through hydrogen bonds ! stacking interactions DNA, RNA, etc. PRACTICE PROBLEM 4 and 5 Indicate which functional group of the five heterocyclic bases can function as a hydrogen bond donor (D), a hydrogen bond acceptor (A), or both (D/A) How would the base pairing be affected if the bases existed in the “enol” form? DNA, RNA, etc. PRACTICE PROBLEM 7 If one of the strands of DNA has the following sequence of bases running in the 5’ → 3’ direction, GGACAATCTGC a. what is the sequence of bases in the complementary strand? b. what base is closest to the 5’-end in the complementary strand? DNA, RNA, etc. DNA is stable, RNA is not O P O- O P Obase O base O O OH O -O O P O- O O P OO O B O OH RNA O- 2',3'-phosphodiester H + O O P base O base O O :B 2' O base O O 5' O P O- O OH base OH O O OH DNA, RNA, etc. DNA is stable, RNA is not O P O- O P Obase O base O O OH O -O O P O- O O P OO O B O OH RNA O- 2',3'-phosphodiester H + O O P base O base O O :B 2' O base O O 5' O P O- O OH base OH O O OH DNA, RNA, etc. DNA (bio)synthesis ! is called replication strand separation, replication fork ! done by DNA polymerase again, always in 5’ → 3’ direction using nucleotide triphosphates DNA, RNA, etc. DNA (bio)synthesis is called replication ! strand separation, replication fork done by DNA polymerase ! again, always in 5’ → 3’ direction using nucleotide triphosphates
© Copyright 2026 Paperzz