Testosterone and Blood Pressure
Prenatal Testosterone Exposure Induces Hypertension in
Adult Females via Androgen Receptor–Dependent Protein
Kinase Cδ–Mediated Mechanism
Chellakkan S. Blesson,* Vijayakumar Chinnathambi,* Gary D. Hankins,
Chandra Yallampalli, Kunju Sathishkumar
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
Abstract—Prenatal exposure to excess testosterone induces hyperandrogenism in adult females and predisposes them
to hypertension. We tested whether androgens induce hypertension through transcriptional regulation and signaling
of protein kinase C (PKC) in the mesenteric arteries. Pregnant Sprague–Dawley rats were injected with vehicle or
testosterone propionate (0.5 mg/kg per day from gestation days 15 to 19, SC) and their 6-month-old adult female offspring
were examined. Plasma testosterone levels (0.84±0.04 versus 0.42±0.09 ng/mL) and blood pressures (111.6±1.3 versus
104.5±2.4 mm Hg) were significantly higher in prenatal testosterone–exposed rats compared with controls. This was
accompanied with enhanced expression of PKCδ mRNA (1.5-fold) and protein (1.7-fold) in the mesenteric arteries of
prenatal testosterone–exposed rats. In addition, mesenteric artery contractile responses to PKC activator, phorbol-12,13dibutyrate, was significantly greater in prenatal testosterone–exposed rats. Treatment with androgen receptor antagonist
flutamide (10 mg/kg, SC, BID for 10 days) significantly attenuated hypertension, PKCδ expression, and the exaggerated
vasoconstriction in prenatal testosterone–exposed rats. In vitro exposure of testosterone to cultured mesenteric artery
smooth muscle cells dose dependently upregulated PKCδ expression. Analysis of PKCδ gene revealed a putative androgen
responsive element in the promoter upstream to the transcription start site and an enhancer element in intron-1. Chromatin
immunoprecipitation assays showed that androgen receptors bind to these elements in response to testosterone stimulation.
Furthermore, luciferase reporter assays showed that the enhancer element is highly responsive to androgens and treatment
with flutamide reverses reporter activity. Our studies identified a novel androgen-mediated mechanism for the control
of PKCδ expression via transcriptional regulation that controls vasoconstriction and blood pressure. (Hypertension.
2015;65:683-690. DOI:10.1161/HYPERTENSIONAHA.114.04521.) Online Data Supplement
•
Key Words: blood pressure ◼ protein kinase C ◼ polycystic ovary syndrome ◼ testosterone ◼ vasoconstriction
a
recapitulates many of these features, including hyperandrogenism with associated hypertension, in adult female rats,
it is not clear whether testosterone plays a causative role in the
development of hypertension. The contribution of androgens
in the development of hypertension in males is straight forward because orchiectomy prevents blood pressure (BP) elevation and testosterone replacement restores hypertension in
animal models.4,13,14 However, the contribution of androgens
to vascular dysfunction and hypertension in females remains
controversial.15,16 Several observations suggest that testosterone may amplify hypertension development in females.
In genetic hypertensive rat models, such as spontaneously
hypertensive rats (SHR)17 and TGR(mRen2)27,18 blockade of
the androgen receptor (AR) reduces BP in females, and direct
testosterone administration to ovariectomized SHR females
increases BP.19 In addition, it has been demonstrated that
suboptimal intrauterine environment results in impaired
fetal growth and leads to increased incidence of cardiovascular, metabolic, and reproductive disorders in adult life.1 An
abnormal intrauterine hormonal milieu can influence clearly
fetal growth and development and has been identified as a factor known to cause intrauterine programming.2 For instance,
excessive prenatal exposure to androgens causes intrauterine
growth restriction, hypertension, insulin resistance, reproductive disruptions, and other metabolic abnormalities, simulating the polycystic ovary syndrome (PCOS) phenotype in adult
females.3–10
PCOS, which affects ≈10% of women of reproductive
age,11 is a multifaceted condition comprising infertility, dysfunctional uterine bleeding, and components of metabolic
syndrome, including obesity, diabetes mellitus, dyslipidemia,
and hypertension.12 Although prenatal testosterone exposure
Received August 28, 2014; first decision September 8, 2014; revision accepted November 6, 2014.
From the Department of Obstetrics and Gynecology, Baylor College of Medicine, Houston, TX (C.S.B., C.Y.); and Division of Reproductive
Endocrinology, Department of Obstetrics and Gynecology, University of Texas Medical Branch, Galveston (V.C., G.D.H., K.S.).
*These authors contributed equally to this work.
The online-only Data Supplement is available with this article at http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSION
AHA.114.04521/-/DC1.
Correspondence to Kunju Sathishkumar, Department of Obstetrics and Gynecology, University of Texas Medical Branch, 301 University Blvd,
Galveston, TX 77555-1062. E-mail [email protected]
© 2014 American Heart Association, Inc.
Hypertension is available at http://hyper.ahajournals.org
DOI: 10.1161/HYPERTENSIONAHA.114.04521
683
684 Hypertension March 2015
120
Before
Flutam ide
After
115
110
105
T
Control
100
95
1
3
5
7
9 11 13 15 17 19 21 23 25 27
the mechanisms that control the expression of PKC isozymes,
especially knowledge on the functional elements in the PKC
gene promoter or the nature of the factors that control PKCδ
gene transcription is not well characterized.
Because testosterone is known to interact with PKC, upregulating the classical constrictor pathway via upregulation of
PKC isoenzymes,39,40 we investigated the molecular mechanism by which testosterone transcriptionally modulates PKC
expression and determined whether regulation of PKC signaling by testosterone plays an important role in mediating vascular contraction and hypertension.
Methods
All experimental procedures were performed in accordance with the
National Institutes of Health guidelines (NIH Publication No. 85–23,
revised 1996) with approval by the Animal Care and Use Committee
at the University of Texas Medical Branch. Timed-pregnant Sprague–
Dawely rats (Harlan, Houston, TX) were divided into 2 groups on gestational day 14, and 1 group received daily injections of testosterone
propionate (Sigma, St. Louis, MO) subcutaneously from gestational
days 15 to 19 at 0.5 mg/kg body weight/d (n=8). The other group
received vehicle (sesame oil, n=8). This dose and duration of exposure are commonly used to mimic plasma testosterone levels (2-fold
increase) observed in preeclamptic women.3,4,41,42 Dams in both groups
were allowed to deliver at term and the birth weights of pups were
recorded. The number of pups in the control and testosterone litters
were adjusted to 10 pups per dam to ensure equal nutrient access for
all offspring (pups with weights at each extreme were euthanized).
The ratio of male to female pups remained equivalent after culling,
when possible. Pups were weaned at 3 weeks of age, and only females
were used for this study. At 6 months of age, arterial pressure was
monitored using the telemetry system. After BP measurements, the
animals were euthanized, the plasma separated and mesenteric arteries (MAs) were isolated. A portion of the MAs was used for vascular
reactivity studies, and the remaining were quickly frozen for RNA/
B
Before Flutamide After
Mean arterial pressure
(mm Hg)
Mean arterial pressure
(mm Hg)
A
115
110
*
*
Control
T
105
100
Days
C
Mean arterial pressure
(mm Hg)
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
adult prenatal testosterone–exposed females have higher testosterone levels, and ovariectomy not only reduces testosterone levels but also reverses BP,4 suggesting that the presence
of increased testosterone levels is essential for increasing
BP. These data provide evidences that androgens may contribute to the hypertensive process in females. Available data
in humans also indicate that androgens can contribute to
BP control in women just as in men because young women
with conditions such as PCOS, postmenopausal women,20
and black women21,22 have higher serum testosterone levels,
and the frequency of hypertension is greater in these populations.23–25 Thus, direct and indirect evidence implicates androgens in hypertension in females. However, the molecular
mechanisms underlying androgen-mediated increases in BP
remain largely unclear.
Protein kinase C (PKC) is a key regulatory enzyme
involved in the signal transduction in vascular health and disease, including cell growth and contractility.26–28 Several lines
of evidence have implicated the activation of PKC-mediated
signaling in pathogenesis of hypertension.29–32 For example,
PKC-mediated contractile responses are enhanced in aortas
of SHR but not Wistar–Kyoto rats33,34; hypertensive models,
including the SHR35,36 and DOCA-salt hypertensive rats have
increased vascular expression/activity of PKC37; perfusion of
hindlimb of SHR and Wistar–Kyoto rats with the PKC activator, phorbol 12,13-dibutyrate (PDBu) caused prolonged
vasoconstriction and increased perfusion pressure38; and PKC
gene silencing normalized arterial BP in SHR.29 These studies
suggest that increased PKC expression and function may be
a key molecule contributing to the development of hypertension. However, the molecular basis of activation of PKCs and
*
120
110
a
100
Control
T
Control
T
Rottlerin
Figure 1. Changes in blood pressure in control and prenatal testosterone (T)-exposed rats. A, Progressive changes in mean arterial pressure
(measured by telemetry) in 6-month-old females before, during, and after flutamide (10 mg/kg, SC, BID for 10 days) treatment. B, Summarized
mean arterial pressure levels. n=6 to 8 in each group. C, Changes in mean arterial pressure (measured through carotid arterial catheter) before
and after treatment with rottlerin (0.3 mg/kg through jugular vein; n=8 in each group).*P<0.05 vs respective controls. aP<0.05 vs vehicle-treated
prenatal T-exposed rats.
2.0
(2 -∆∆ct)
PKC isoforms
mRNA expression levels
Blesson et al Androgens Enhance PKCδ-Mediated Vasoconstriction 685
*
1.5
Control
T
1.0
0.5
α
β
δ
ε
γ
PKCδ Expression Is Increased in the MAs of
Hyperandrogenic Prenatal Testosterone–Exposed
Females
ι
PKC isoforms
Figure 2. Changes in mRNA levels of protein kinase C (PKC)
isoforms in mesenteric artery from control and prenatal
testosterone (T)-exposed rats. Real-time polymerase chain
reaction was used to assess vascular PKC α, β, ε, γ, δ, and ζ
mRNA expression. Measurement of vascular mRNA expression
was normalized relative to β-actin. n=5 in each group. *P<0.05 vs
controls.
Results
Prenatal Testosterone Exposure Leads to
Hyperandrogenism and Hypertension in Adult
Females
Plasma testosterone levels in 6-month-old females were significantly higher by 2-fold in prenatal testosterone–exposed rats
(0.84±0.04 ng/mL; n=8) compared with controls (0.42±0.09
ng/mL; n=8; P<0.05).
As shown in Figure 1A and 1B, prenatal testosterone exposure significantly increased BP in adult females, as compared
with control animals (P<0.05; n=6–8).
Antiandrogen Treatment and PKCδ Blockade
Reverses Increased BP in Hyperandrogenic
Prenatal Testosterone–Exposed Rats
Flutamide administration significantly attenuated the
increased BP observed in prenatal testosterone–exposed
females (Figure 1A; P<0.05; n=6–8). Flutamide had no
T
2.0
PKC δ / β actin
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
protein analysis. One offspring was studied from each litter, and n
refers the number of litters studied. An expanded Methods section is
available in the online-only Data Supplement, which includes animals,
BP measurements, arterial segment preparation, vascular contractile
and relaxation responses, RNA isolation and quantitative real-time
polymerase chain reaction, Western blotting, and statistical analysis.
Control
a
1.0
0.5
0.0
Control
T
We next determined the expression profile of PKC isozymes
in the MAs. As shown in Figure 2, quantitative real-time polymerase chain reaction shows the expression of at least 6 PKC
isozymes, α, β, δ, ε, γ, and ζ in rat MAs. When compared
with control rats, vessels in prenatal testosterone–exposed
rats showed significantly increased expression levels of only
PKCδ (1.5-fold; Figure 2; P<0.05; n=5 in each). Western
blotting also showed that PKCδ protein levels were significantly increased (1.7-fold) in the MA from prenatal testosterone–exposed rats (n=6) than in those from the control (n=6;
Figure 3; P<0.05). Flutamide administration to prenatal testosterone–exposed rats significantly attenuated the increase in
PKCδ protein levels (Figure 3; P<0.05; n=6). PKCδ expression was not significantly different between flutamide-treated
prenatal testosterone–exposed rats and flutamide-treated control rats (Figure 3; n=6 in each).
PKCδ-Mediated Vasoconstrictor Responses Were
Enhanced in MAs of Hyperandrogenic Prenatal
Testosterone–Exposed Females
We next determined the functional implications of increased
PKCδ expression in MAs of prenatal testosterone–exposed
rats. As shown in Figure 4, stimulation of PKC with PDBu
significantly increased contractile responses with an
increase in maximal responses in MAs of prenatal testosterone–exposed rats (27.2±3.5%; n=6) compared with controls
(18.7±1.9%; n=8; P<0.05). To further confirm the primary
role of PKCδ toward exaggerated vasoconstriction in prenatal testosterone rats, PDBu-induced contractile responses
were elicited in the presence of the PKCδ inhibitor, rottlerin. Incubation with rottlerin significantly decreased
PDBu-induced contractions in MAs of both control and
T + Flu
Control + Flu
*
1.5
significant effect on BP in controls. Stopping flutamide treatment returned arterial pressure to pretreatment levels in prenatal testosterone–exposed adults (Figure 1A and 1B; P<0.05).
Inhibition of PKCδ with rottlerin abrogated increase in BP
in prenatal testosterone–exposed females (Figure 1C; P<0.05;
n=8). Rottlerin had no significant effect on BP in controls
(Figure 1C).
Control+Flu T+Flu
Figure 3. Changes in protein kinase C (PKC) δ
protein levels in mesenteric artery from control
and prenatal testosterone (T)-exposed rats without
and with flutamide (Flu) treatment. Representative
Western blots for PKCδ are shown at top; blot
density obtained from densitometric scanning of
PKCδ normalized to β-actin is shown at bottom.
n=6 in each group. *P≤0.05 vs controls. aP < 0.05
vs vehicle-treated prenatal T-exposed rats.
Contraction
(% of tension to 80mM KCL)
686 Hypertension March 2015
Testosterone Increases PKCδ Gene Expression
Levels in Cultured MA Smooth Muscle Cells
30
T
20
Control
T+Flu
Control+Flu
Control+Rot
T+Rot
10
0
Based on the effects of hyperandrogenism on PKCδ expression and contractions in MAs, we next assessed the mechanism of testosterone stimulation of PKCδ expression. We
determined the effects of testosterone on PKCδ mRNA and
protein levels in an in vitro cell culture model. Both mRNA and
protein levels in cultured MA smooth muscle cells were dose
dependently increased by testosterone treatment (Figure 5A
and 5B; P<0.005; n=4), indicating that testosterone induces
PKCδ expression.
Treatment with testosterone for 5 days also increased the
protein levels of AR in a dose-dependent manner with significant increases at 50 and 100 nmol/L in MA smooth muscle
cells (Figure 6; P<0.05; n=4).
-8
-7
-6
PDBu [log M]
-5
AR Binding Sites in PKCδ Gene Promoter and
Intron 1 Regions
Analysis of PKCδ promoter and intron 1 regions showed 6 and
5 androgen response element (ARE)-like sequences, respectively. Putative AREs identified in the promoter region were
named p-ARE1 to p-ARE6, and the putative AREs present
in intron 1 were named int1-ARE1 to int1-ARE5 (Figure 7;
Table S2 in the online-only Data Supplement). We then used
the chromatin immunoprecipitation assay to identify if any
of these putative AREs interact with AR in the presence of
AR-specific ligands. Our results show that putative p-AREs
5,6 and int1-ARE2 interacted with AR in a ligand-dependent
fashion. p-AREs 5,6 showed a 2-fold enrichment when
treated with testosterone compared with control and flutamide
treatment (Figure 8; P<0.05; n=4). Interestingly, int1-ARE2
(Figure 8; P<0.05; n=4) showed ≈12-fold enrichment in the
presence of testosterone compared with vehicle, flutamide,
or testosterone+flutamide. However, other predicted putative
AREs did not show any ligand-dependent enrichment (data
not shown). Thus, our data suggest the presence of functional
prenatal testosterone–exposed rats; however, the magnitude
of decrease was greater in the arteries of prenatal testosterone–exposed rats than in controls (Figure 4; P<0.05; n=6 in
each group). These data indicate that PKCδ contributes to
exaggerated PDBu-induced contractions in MAs of prenatal
testosterone–exposed rats.
Enhanced PKC-mediated contractile responses observed in
prenatal testosterone–exposed rats were abrogated after flutamide administration (n=6; 18.6±3.1%; P<0.05; Figure 4).
However, flutamide administration to control females had
no significant effect on PKC-mediated contractile responses
(n=6; Figure 4). These data indicate that androgens have an
underlying role in exaggerated PDBu-induced contraction in
prenatal testosterone–exposed rats.
A
B
2.0
1.5
* * *
**
PKCδ
β-actin
Vehicle 1nM
*
5nM 10nM 50nM 100nM
Testosterone
0.4
1.0
0.5
Vehicle 1
5 10 50 100
Testosterone (nM)
PKCδ / β -actin
(2-∆∆ct)
PKCδ mRNA expression
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
Figure 4. Contractile responses in mesenteric artery (MA) rings
of control and prenatal testosterone (T)-exposed rats without
and with flutamide (Flu) treatment. Endothelium-denuded
MA rings were incubated in Krebs buffer, and then vascular
contractile responses were taken to cumulative additions of
protein kinase C (PKC) activator, phorbol 12,13-dibutyrate
(PDBu) in the absence or presence of a selective PKCδ inhibitor,
rottlerin (Rot). Contractions were presented as percentage of
80 mmol/L KCl contractions. MA rings from 6 to 8 rats of each
group were used.
*
*
0.3
0.2
0.1
0.0
Vehicle
1
5
10
50
100
Testosterone (nM)
Figure 5. Testosterone (T) upregulates protein kinase C (PKC) δ expression in cultured mesenteric artery (MA) smooth muscle cells.
Concentration-dependent T-induced increase in PKCδ (A) mRNA and (B) protein in cultured MA smooth muscle cells. The primary MA
smooth muscle cells were treated with vehicle or T for 5 days with fresh medium along with T replaced every day. Cell extracts were
prepared and subjected to PKCδ expression analysis using quantitative reverse transcription polymerase chain reaction and Western
blot. Measurement of vascular PKCδ mRNA and protein expression was normalized relative to β-actin. Data represent mean of 4
independent experiments. *P<0.05 vs controls, **P<0.001 vs controls.
Blesson et al Androgens Enhance PKCδ-Mediated Vasoconstriction 687
Discussion
AR
The major finding of this study is the identification of a novel
androgen-mediated mechanism that controls the expression of
PKCδ in MA smooth muscle cells by positively regulating PKCδ
transcript and protein levels. We identified the functional androgen response and enhancer element that binds AR in response
to androgen stimulation in the PKCδ gene promoter and intron
1, respectively. Regulation of PKCδ expression by androgens
via the AR has significant functional consequences, as we
determined that androgens exert a significant control of PKCδmediated arterial contraction and hypertension. Therefore, we
suggest that increases in vascular PKCδ-stimulated responses
may mediate the development and maintenance of hypertension
induced by hyperandrogenism in adult females.
There is mounting evidence that elevated testosterone levels
during pregnancy may have adverse effects on fetal growth
and thereby increase the potential for an increased risk of
cardiovascular diseases in adult life.3–5,43 Consistent with evidence showing that boys and girls of PCOS mothers are often
hyperandrogenic,44,45 we and others using this model of prenatal androgen exposure have shown that adult females tend
to produce higher testosterone compared with controls. We
previously reported that hyperandrogenism is associated with
increased arterial pressure in prenatal testosterone–exposed
adult females. In this study, we show that treatment with the
selective AR antagonist flutamide abolished the hypertensive
response in prenatal testosterone–exposed adult females. This
suggests that AR activation contributes, in part, to the increase
in BP in prenatal testosterone–exposed hypertensive adults.
The observation that cessation of flutamide treatment reverses
BP back to hypertensive levels suggests that testosterone
actively regulates BP and that testosterone increase may be
a key factor in promoting elevation of BP in the adult prenatal testosterone–exposed females. This is consistent with the
growing evidence that shows an important role for androgens
in the pathophysiology of hypertension.20–25
The question arises as to how androgens provoke increase
in BP. Recent studies showed that PKC is a key pathological
factor in hypertension.29,46–48 PKC mediates its physiological effects mainly through 13 isoforms, divided into 3 major
β-actin
Vehicle 1nM
5nM 10nM 50nM 100nM
Testosterone
AR / β actin
0.75
*
**
0.50
0.25
0.00
Control
1
5
10
50
100
Testosterone (nM)
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
Figure 6. Testosterone (T)-induced increase in protein levels
of androgen receptor (AR) in cultured mesenteric artery (MA)
smooth muscle cells. The primary MA smooth muscle cells were
treated with vehicle or T for 5 days with fresh medium along with
T replaced every day. Cell extracts were prepared and subjected
to AR expression using Western blot. Measurement of vascular
AR protein expression was normalized relative to β-actin. Data
represent mean of 4 independent experiments. *P<0.05 vs
controls, **P<0.01 vs controls.
ARE-like sites in the promoter and intron 1 regions of the
PKCδ gene.
PKCδ Gene Has a Functional Enhancer Element in
the Intron 1 Region
We further probed int1-ARE2 because it showed higher fold
enrichment. We cloned and sequenced the intron 1 region
(GenBank: KF573407.1) and performed a reporter assay.
Results show that AR was able to induce transcription in a
ligand-dependent manner. Testosterone increased luciferase
activity by ≈7-fold and was significantly higher than vehicle
and testosterone+flutamide (Figure 9; P<0.05; n=4). Thus,
our data suggest that the functional AR binding site in the
intron 1 region of the PKCδ gene has an enhancer elementlike function.
ARE like sites in promoter
5’tgaggctcgatgtgtgccacat3’
-7899 to -7878
1
5’
-5261 to -5240
2
5’
5’
3’
5
4
3
-5683 to -5662
ctgacc 3’
-4192 to -4171
5’
-4568 to -4547
c3’
t3’
6
Exon 1
+1
-4161 to -4140
PKCδ Start Site
5’caaggaacacactcaaaccctc3’
ARE like sites in intron 1
5’gaaagcccacagcctccttgac3’
+1106 to +1137
Exon 1
+1
PKCδ Start Site
1
5’ctcatcccaccatttactggcc3’
+3989 to +4010
2
+3761 to +3782
5’ctgtgcccactctgatctggcc3’
3
5’ctaagacagtcttgttctcgca3’
+4451 to +4472
4
5
Exon 2
+4017 to +4038
5’catagcacatccacttccatgg3’
Figure 7. Identification for putative androgen receptor (AR) binding sites in the protein kinase C (PKC) δ gene. Bioinformatic prediction
using Consite program shows androgen response element (ARE)–like sites in the promoter and intron 1 of rat PKCδ gene.
688 Hypertension March 2015
B
Int1- ARE 2
*
0.1
0.0
Vehicle
T
Flu
T+Flu
Mock
0.75
% Input
0.2
% Input
p- ARE 5,6
A
***
0.50
0.25
0.00
Vehicle
T
Flu
T+Flu
Mock
Figure 8. Protein kinase C (PKC) δ gene has an active androgen receptor (AR) binding site. The chromatin immunoprecipitation assay
shows AR interaction with putative (A) response and (B) enhancer elements from the promoter region (p-androgen response element
[ARE] 5,6) and intron 1 (Int1-ARE 2), respectively, when treated with testosterone (T), flutamide (Flu), and both for 5 days. Data represent
mean of 4 independent experiments. *P<0.05 vs controls, ***P<0.001 vs controls.
notion that modulation of the PKCδ by testosterone contributes
to hypertension in prenatal testosterone–exposed female rats.
The finding that testosterone exposure to cultured MA smooth
muscle cells upregulates PKCδ mRNA suggests that PKCδ is
a physiological target for testosterone and that androgens can
directly regulate the transcription of PKCδ. The question arises
as to how androgens regulate PKCδ expression. Our in silico
analysis of a 10-kb region upstream of the PKCδ transcription
start site revealed 2 tandem ARE-like sequences (p-AREs 5,6)
separated by 9 bp located at ≈−4.2 kb resembling the ARE consensus sequence. It is known that steroid receptor binding sites
can deviate considerably from the consensus high-affinity motif,
and steroid receptor recognition by low-affinity sites can be significantly enhanced by flanking sequences and coregulators.60,61
Furthermore, we also found an ARE-like sequence in the intron
1 region of PKCδ (int1-ARE2) at ≈+2.6 kb from the transcriptional start site, which could potentially act as an enhancer element. The presence of enhancers in various regions including in
introns has been well documented.62 Importantly, our chromatin
immunoprecipitation studies show that both the p-AREs 5,6 present in the promoter region and int1-ARE2 are efficiently binding
to AR in response to testosterone in MA smooth muscle cells,
suggesting that it is functionally relevant in vivo. The luciferase
reporter assay of int1-ARE2 showed a ligand-dependent activation, indicating that this sequence is responsive to androgens.
Androgen-induced upregulation of PKCδ could be mediated
Relative Luminescence
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
groups: (1) classical PKC isoforms (α, βI, βII, and γ) requiring both Ca2+ and diacylglycerol for activation, (2) novel PKC
isoforms (δ, ε, η, and θ) requiring only diacylglycerol for activation, and (3) atypical PKC isoforms (λ, μ, and ζ) that are
activated by binding phosphatidylserine but not diacylglycerol
or Ca2+.49 The α, β, δ, ε, and ζ isoenzymes of PKC have been
detected in vascular smooth muscles.50,51 Although not all of
these seem to be in all vascular smooth muscle cells, our studies show presence of all 6 isoenzymes in the MAs, consistent
with previous reports.27 In the present study, we found that
only expression of PKCδ was significantly higher in the MAs
of hyperandrogenic females. In addition, flutamide treatment
reversed the increased PKCδ expression in hyperandrogenic
females. These findings suggest that androgens play an important role in stimulating PKCδ expression. This is consistent
with the previous findings that coronary PKCδ levels directly
correlate with endogenous testosterone levels,52 and that testosterone increases PKCδ protein levels in coronary smooth
muscle of swine.52,53
Given the importance of PKCδ in mediating vascular smooth
muscle contractile responses,54–56 we investigated the functional
impact of elevated PKCδ expression. In the present study,
PDBu, an activator of PKC, induced contractile responses that
were significantly increased in hyperandrogenic rats. The Emax
were greater in the hyperandrogenic rats and were related to testosterone levels and BP increases. Furthermore, the enhanced
vasoconstriction was reversed when the arterial rings were preincubated with rottlerin, suggesting that PKCδ is the primary
factor in enhancing vascular contractile responses in hyperandrogenic rats. In fact, previous studies demonstrated that PKCδ
located in smooth muscle directly mediates vasocontractile
effects.54,55,57 Although PKC isoforms have been implicated
in contractile responses in dispersed/cultured smooth muscle
cells,58,59 we think this to be the first instance in which individual PKC isoforms have been specifically identified as being
involved in a contractile response in intact vessels, at least
when challenged with PDBu. Indeed, the present finding that
rottlerin a selective PKCδ inhibitor abrogated hypertension
observed in hyperandrogenic rats indicates a causative role of
the heightened PKCδ-mediated signaling in the pathogenesis of
androgen-induced hypertension. Given that flutamide abolished
the exaggerated contractile responsiveness to PDBu in hyperandrogenic rats suggests that the enhanced responsiveness to
PKC in these rats is testosterone dependent. This reinforces the
15
*
10
5
0
Vehicle
T
T+Flu
Figure 9. Presence of a functional enhancer element in intron 1 of
protein kinase C (PKC) δ gene. Reporter assay showing luciferase
activity in mesenteric artery smooth muscle cells transfected with
reporter plasmid containing int1-androgen response element
(ARE) 2 showing an ≈7-fold increase when incubated with
testosterone (T). This increase was suppressed when treated with
T in the presence of flutamide (Flu). Data represent mean of 4
independent experiments. *P<0.05 vs controls.
Blesson et al Androgens Enhance PKCδ-Mediated Vasoconstriction 689
by a combination of both direct and indirect effects. Direct
effects may be mediated by the cis-acting elements present in
the promoter and intron-1 regions, acting as possible response
and enhancer elements, respectively. Furthermore, we also show
that testosterone upregulates its own receptor, AR in MA smooth
muscle cells there by transregulating PKCδ expression via AR
levels. Thus, androgen could potentially regulate the expression
of PKCδ by a combination of cis- and transregulation.
Although we focused on females in this study, it is possible
that androgens exert a similar increases in PKCδ-mediated vasoconstriction in male vasculature as well, which needs further
investigation. Thus, in this study, we show that prenatal testosterone treatment induces hyperandrogenism, which controls PKCδ
expression via transcriptional regulation to cause enhanced
vasoconstriction and hypertension in adult female offspring.
Perspectives
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
Evidence indicates that androgens can contribute to BP control
in women just as in men because young women with conditions
such as PCOS, postmenopausal women, and black women have
higher plasma testosterone levels, and the frequency of hypertension is greater in these populations. In this study, higher testosterone levels during adult life significantly increases BP. We
have shown that PKCδ plays a role in the hypertensive activity of androgen. This study is the first to show the presence
of functional androgen response and enhancer elements in the
rat PKCδ gene promoter and intron-1, respectively. Regulation
of PKCδ expression by androgens via the AR has significant
functional consequences, as we determined that androgens
exert a significant increase in PKCδ-mediated vasoconstriction. Altogether, this study sets forth a novel paradigm suggesting that inhibition of PKCδ can be a potential target for
diseases that are regulated by androgen-induced hypertension.
Sources of Funding
Financial support from the National Institute of Health through grants
HD069750 and HL119869 awarded to K. Sathishkumar and HL102866
and HL 58144 awarded to C. Yallampalli is greatly appreciated.
Disclosures
None.
References
1.Fowden AL, Giussani DA, Forhead AJ. Intrauterine programming of
physiological systems: causes and consequences. Physiology (Bethesda).
2006;21:29–37.
2. Fowden AL, Forhead AJ. Endocrine mechanisms of intrauterine programming. Reproduction. 2004;127:515–526.
3. Sathishkumar K, Elkins R, Yallampalli U, Balakrishnan M, Yallampalli C.
Fetal programming of adult hypertension in female rat offspring exposed
to androgens in utero. Early Hum Dev. 2011;87:407–414.
4.Chinnathambi V, Balakrishnan M, Yallampalli C, Sathishkumar K.
Prenatal testosterone exposure leads to hypertension that is gonadal
hormone-dependent in adult rat male and female offspring. Biol Reprod.
2012;206:507.e1–507.e10.
5. Chinnathambi V, Yallampalli C, Sathishkumar K. Prenatal testosterone
induces sex-specific dysfunction in endothelium-dependent relaxation
pathways in adult male and female rats. Biol Reprod. 2013;89:97.
6. Veiga-Lopez A, Moeller J, Patel D, Ye W, Pease A, Kinns J, Padmanabhan
V. Developmental programming: impact of prenatal testosterone excess
on insulin sensitivity, adiposity, and free fatty acid profile in postpubertal
female sheep. Endocrinology. 2013;154:1731–1742.
7.Xu N, Chua AK, Jiang H, Liu NA, Goodarzi MO. Early embryonic
androgen exposure induces transgenerational epigenetic and metabolic
changes. Mol Endocrinol. 2014;28:1329–1336.
8. Ramezani Tehrani F, Noroozzadeh M, Zahediasl S, Piryaei A, Hashemi S,
Azizi F. The time of prenatal androgen exposure affects development of
polycystic ovary syndrome-like phenotype in adulthood in female rats. Int
J Endocrinol Metab. 2014;12:e16502.
9. Yan X, Dai X, Wang J, Zhao N, Cui Y, Liu J. Prenatal androgen excess
programs metabolic derangements in pubertal female rats. J Endocrinol.
2013;217:119–129.
10. Sun M, Maliqueo M, Benrick A, Johansson J, Shao R, Hou L, Jansson T,
Wu X, Stener-Victorin E. Maternal androgen excess reduces placental and
fetal weights, increases placental steroidogenesis, and leads to long-term
health effects in their female offspring. Am J Physiol Endocrinol Metab.
2012;303:E1373–E1385.
11. Cussons AJ, Stuckey BG, Watts GF. Cardiovascular disease in the polycystic ovary syndrome: new insights and perspectives. Atherosclerosis.
2006;185:227–239.
12.Azziz R, Carmina E, Dewailly D, Diamanti-Kandarakis E, EscobarMorreale HF, Futterweit W, Janssen OE, Legro RS, Norman RJ, Taylor
AE, Witchel SF; Androgen Excess Society. Positions statement: criteria for defining polycystic ovary syndrome as a predominantly hyperandrogenic syndrome: an Androgen Excess Society guideline. J Clin
Endocrinol Metab. 2006;91:4237–4245.
13. Ojeda NB, Grigore D, Yanes LL, Iliescu R, Robertson EB, Zhang H,
Alexander BT. Testosterone contributes to marked elevations in mean
arterial pressure in adult male intrauterine growth restricted offspring. Am
J Physiol Regul Integr Comp Physiol. 2007;292:R758–R763.
14. Reckelhoff JF. Gender differences in the regulation of blood pressure.
Hypertension. 2001;37:1199–1208.
15.Reckelhoff JF, Roman RJ. Androgens and hypertension: role in both
males and females? Hypertension. 2011;57:681–682.
16.Huang G, Tang E, Aakil A, Anderson S, Jara H, Davda M, Stroh H,
Travison TG, Bhasin S, Basaria S. Testosterone dose-response relationships with cardiovascular risk markers in androgen-deficient women:
a randomized, placebo-controlled trial. J Clin Endocrinol Metab.
2014;99:E1287–E1293.
17.Ganten U, Schröder G, Witt M, Zimmermann F, Ganten D, Stock G.
Sexual dimorphism of blood pressure in spontaneously hypertensive rats:
effects of antiandrogen treatment. J Hypertens. 1989;7:721–726.
18. Baltatu O, Cayla C, Iliescu R, Andreev D, Bader M. Abolition of endorgan damage by antiandrogen treatment in female hypertensive transgenic rats. Hypertension. 2003;41(3 Pt 2):830–833.
19. Reckelhoff JF, Zhang H, Granger JP. Testosterone exacerbates hypertension and reduces pressure-natriuresis in male spontaneously hypertensive
rats. Hypertension. 1998;31(1 Pt 2):435–439.
20.Laughlin GA, Barrett-Connor E, Kritz-Silverstein D, von Mühlen D.
Hysterectomy, oophorectomy, and endogenous sex hormone levels in
older women: the Rancho Bernardo Study. J Clin Endocrinol Metab.
2000;85:645–651.
21. Falkner B, Sherif K, Sumner A, Kushner H. Hyperinsulinism and sex hormones in young adult African Americans. Metabolism. 1999;48:107–112.
22. Huisman HW, Schutte AE, Van Rooyen JM, Malan NT, Malan L, Schutte
R, Kruger A. The influence of testosterone on blood pressure and risk factors for cardiovascular disease in a black South African population. Ethn
Dis. 2006;16:693–698.
23.Hall WD, Ferrario CM, Moore MA, Hall JE, Flack JM, Cooper W,
Simmons JD, Egan BM, Lackland DT, Perry M Jr, Roccella EJ.
Hypertension-related morbidity and mortality in the southeastern United
States. Am J Med. Sci. 1997;313:195–209.
24. Dumesic DA, Schramm RD, Abbott DH. Early origins of polycystic ovary
syndrome. Reprod Fertil Dev. 2005;17:349–360.
25.Franks S. Adult polycystic ovary syndrome begins in childhood. Best
Pract Res Clin Endocrinol Metab. 2002;16:263–272.
26.Nakayama K, Obara K, Tanabe Y, Saito M, Ishikawa T, Nishizawa
S. Interactive role of tyrosine kinase, protein kinase C, and Rho/Rho
kinase systems in the mechanotransduction of vascular smooth muscles.
Biorheology. 2003;40:307–314.
27.Ohanian V, Ohanian J, Shaw L, Scarth S, Parker PJ, Heagerty AM.
Identification of protein kinase C isoforms in rat mesenteric small arteries and
their possible role in agonist-induced contraction. Circ Res. 1996;78:806–812.
28. Salamanca DA, Khalil RA. Protein kinase C isoforms as specific targets
for modulation of vascular smooth muscle function in hypertension.
Biochem Pharmacol. 2005;70:1537–1547.
29. Novokhatska T, Tishkin S, Dosenko V, Boldyriev A, Ivanova I, Strielkov
I, Soloviev A. Correction of vascular hypercontractility in spontaneously
hypertensive rats using shRNAs-induced delta protein kinase C gene
silencing. Eur J Pharmacol. 2013;718:401–407.
690 Hypertension March 2015
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
30. Webster BR, Osmond JM, Paredes DA, DeLeon XA, Jackson-Weaver
O, Walker BR, Kanagy NL. Phosphoinositide-dependent kinase-1
and protein kinase Cδ contribute to endothelin-1 constriction and elevated blood pressure in intermittent hypoxia. J Pharmacol Exp Ther.
2013;344:68–76.
31.Chou WH, Messing RO. Hypertensive encephalopathy and the
blood-brain barrier: is deltaPKC a gatekeeper? J Clin Invest.
2008;118:17–20.
32.Palanisamy N, Viswanathan P, Ravichandran MK, Anuradha CV.
Renoprotective and blood pressure-lowering effect of dietary soy protein
via protein kinase C beta II inhibition in a rat model of metabolic syndrome. Can J Physiol Pharmacol. 2010;88:28–37.
33. Sasajima H, Shima H, Toyoda Y, Kimura K, Yoshikawa A, Hano T, Nishio
I. Increased Ca2+ sensitivity of contractile elements via protein kinase C
in alpha-toxin permeabilized SMA from young spontaneously hypertensive rats. Cardiovasc Res. 1997;36:86–91.
34. Shibata R, Morita S, Nagai K, Miyata S, Iwasaki T. Effects of H-7 (protein
kinase inhibitor) and phorbol ester on aortic strips from spontaneously
hypertensive rats. Eur J Pharmacol. 1990;175:261–271.
35. Bazan E, Campbell AK, Rapoport RM. Protein kinase C activity in blood
vessels from normotensive and spontaneously hypertensive rats. Eur J
Pharmacol. 1992;227:343–348.
36. Turla MB, Webb RC. Enhanced vascular reactivity to protein kinase C
activators in genetically hypertensive rats. Hypertension. 1987;9(6 Pt
2):III150–III154.
37. Turla MB, Webb RC. Vascular responsiveness to protein kinase C activators in mineralocorticoid-hypertensive rats. J Hypertens. 1991;9:209–215.
38. Bilder GE, Kasiewski CJ, Perrone MH. Phorbol-12,13-dibutyrate-induced
vasoconstriction in vivo: characterization of response in genetic hypertension. J Pharmacol Exp Ther. 1990;252:526–530.
39. Salamanca DA, Khalil RA. Protein kinase C isoforms as specific targets
for modulation of vascular smooth muscle function in hypertension.
Biochem Pharmacol. 2005;70:1537–1547.
40. Orshal JM, Khalil RA. Gender, sex hormones, and vascular tone. Am J
Physiol Regul Integr Comp Physiol. 2004;286:R233–R249.
41.Chinnathambi V, Balakrishnan M, Ramadoss J, Yallampalli C,
Sathishkumar K. Testosterone alters maternal vascular adaptations: role
of the endothelial NO system. Hypertension. 2013;61:647–654.
42.Sathishkumar K, Elkins R, Chinnathambi V, Gao H, Hankins GD,
Yallampalli C. Prenatal testosterone-induced fetal growth restriction is
associated with down-regulation of rat placental amino acid transport.
Reprod Biol Endocrinol. 2011;9:110.
43. King AJ, Olivier NB, Mohankumar PS, Lee JS, Padmanabhan V, Fink
GD. Hypertension caused by prenatal testosterone excess in female sheep.
Am J Physiol Endocrinol Metab. 2007;292:E1837–E1841.
44. Sir-Petermann T, Maliqueo M, Codner E, Echiburú B, Crisosto N, Pérez
V, Pérez-Bravo F, Cassorla F. Early metabolic derangements in daughters
of women with polycystic ovary syndrome. J Clin Endocrinol Metab.
2007;92:4637–4642.
45.Kent SC, Gnatuk CL, Kunselman AR, Demers LM, Lee PA, Legro RS.
Hyperandrogenism and hyperinsulinism in children of women with polycystic ovary syndrome: a controlled study. J Clin Endocrinol Metab.
2008;93:1662–1669.
46. Buchholz RA, Dundore RL, Cumiskey WR, Harris AL, Silver PJ. Protein
kinase inhibitors and blood pressure control in spontaneously hypertensive rats. Hypertension. 1991;17:91–100.
47. Bynagari-Settipalli YS, Chari R, Kilpatrick L, Kunapuli SP. Protein kinase
C - possible therapeutic target to treat cardiovascular diseases. Cardiovasc
Hematol Disord Drug Targets. 2010;10:292–308.
48. Snow JB, Gonzalez Bosc LV, Kanagy NL, Walker BR, Resta TC. Role for
PKCβ in enhanced endothelin-1-induced pulmonary vasoconstrictor reactivity following intermittent hypoxia. Am J Physiol Lung Cell Mol Physiol.
2011;301:L745–L754.
49.Steinberg SF. Structural basis of protein kinase C isoform function.
Physiol Rev. 2008;88:1341–1378.
50. Zhang H, Xiao D, Longo LD, Zhang L. Regulation of alpha1-adrenoceptor-mediated contractions of uterine arteries by PKC: effect of pregnancy.
Am J Physiol Heart Circ Physiol. 2006;291:H2282–H2289.
51.Walsh MP, Horowitz A, Clément-Chomienne O, Andrea JE, Allen
BG, Morgan KG. Protein kinase C mediation of Ca(2+)-independent
contractions of vascular smooth muscle. Biochem Cell Biol.
1996;74:485–502.
52. Maddali KK, Korzick DH, Tharp DL, Bowles DK. PKCdelta mediates
testosterone-induced increases in coronary smooth muscle Cav1.2. J Biol
Chem. 2005;280:43024–43029.
53. Korzick DH, Rishel ME, Bowles DK. Exercise and hypercholesterolemia
produce disparate shifts in coronary PKC expression. Med Sci Sports
Exerc. 2005;37:381–388.
54. Liu L, Liu J, Gao Y, Yu X, Dou D, Huang Y. Protein kinase Cδ contributes
to phenylephrine-mediated contraction in the aortae of high fat diet-induced
obese mice. Biochem Biophys Res Commun. 2014;446:1179–1183.
55.Ishida K, Matsumoto T, Taguchi K, Kamata K, Kobayashi T. Protein
kinase C delta contributes to increase in EP3 agonist-induced contraction
in mesenteric arteries from type 2 diabetic Goto-Kakizaki rats. Pflugers
Arch. 2012;463:593–602.
56.Allahdadi KJ, Duling LC, Walker BR, Kanagy NL. Eucapnic intermittent
hypoxia augments endothelin-1 vasoconstriction in rats: role of PKCdelta.
Am J Physiol Heart Circ Physiol. 2008;294:H920–H927.
57. Obara K, Ukai K, Ishikawa T. Mechanism of potentiation by tea epigallocatechin of contraction in porcine coronary artery: the role of protein kinase Cδmediated CPI-17 phosphorylation. Eur J Pharmacol. 2011;668:414–418.
58. Khalil RA, Lajoie C, Morgan KG. In situ determination of [Ca2+]i threshold for translocation of the alpha-protein kinase C isoform. Am J Physiol.
1994;266(6 Pt 1):C1544–C1551.
59. Khalil RA, Lajoie C, Resnick MS, Morgan KG. Ca(2+)-independent isoforms of protein kinase C differentially translocate in smooth muscle. Am
J Physiol. 1992;263(3 Pt 1):C714–C719.
60.Adler AJ, Scheller A, Robins DM. The stringency and magnitude of androgen-specific gene activation are combinatorial functions of receptor and
nonreceptor binding site sequences. Mol Cell Biol. 1993;13:6326–6335.
61. Heinlein CA, Chang C. Androgen receptor (AR) coregulators: an overview. Endocr Rev. 2002;23:175–200.
62. Fan LQ, Hardy DO, Catterall JF, Zhao J, Li SX. Identification and characterization of an androgen-responsive Kap promoter enhancer located in
the intron II region of human angiotensinogen gene. J Steroid Biochem
Mol Biol. 2010;119:135–140.
Novelty and Significance
What Is New?
What Is Relevant?
• Postnatal androgens dynamically regulate blood pressure in hyperandro-
• Sex steroid hormones, including testosterone, have an important influ-
• Androgen-mediated mechanism controls the expression of protein ki-
• Hypertension is one of the most common complications during adult life.
• Heightened PKC signaling has been implicated in the development of
genic females.
nase C (PKC) δ in mesenteric artery smooth muscle cells by positively
regulating PKCδ transcript and protein levels
• Functional androgen response and enhancer element binds androgen
receptor in response to androgen stimulation in the PKCδ gene promoter
and intron 1, respectively.
• Regulation of PKCδ expression by androgens via the androgen receptor
has significant functional consequences, as androgens exert a significant control of PKCδ-mediated arterial contraction and blood pressure.
ence on blood pressure.
hypertension.
Summary
The present study provides new evidence in an animal model linking hormonal regulation of PKCδ expression and increased risk
of hypertension and reveals a mechanistic understanding of the
heightened PKCδ-mediated signaling in the pathogenesis of androgen-induced hypertension.
Prenatal Testosterone Exposure Induces Hypertension in Adult Females via Androgen
Receptor−Dependent Protein Kinase Cδ−Mediated Mechanism
Chellakkan S. Blesson, Vijayakumar Chinnathambi, Gary D. Hankins, Chandra Yallampalli and
Kunju Sathishkumar
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
Hypertension. 2015;65:683-690; originally published online December 8, 2014;
doi: 10.1161/HYPERTENSIONAHA.114.04521
Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2014 American Heart Association, Inc. All rights reserved.
Print ISSN: 0194-911X. Online ISSN: 1524-4563
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://hyper.ahajournals.org/content/65/3/683
Data Supplement (unedited) at:
http://hyper.ahajournals.org/content/suppl/2014/12/08/HYPERTENSIONAHA.114.04521.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Hypertension is online at:
http://hyper.ahajournals.org//subscriptions/
Online Supplement
PRENATAL TESTOSTERONE EXPOSURE INDUCES HYPERTENSION IN ADULT
FEMALES VIA ANDROGEN RECEPTOR-DEPENDENT PKCδ-MEDIATED
MECHANISM
Chellakkan S. Blesson,1,a Vijayakumar Chinnathambi,2,a Gary D. Hankins,2 Chandra
Yallampalli1 and Kunju Sathishkumar2,*
1
Department of Obstetrics and Gynecology, Baylor College of Medicine, Houston, TX 77030;
2
Division of Reproductive Endocrinology Department of Obstetrics and Gynecology, University
of Texas Medical Branch, Galveston, TX 77555
a
Contributed Equally
Short Title: Androgens enhance PKCδ mediated vasoconstriction
Supplemental Table: 2
*Corresponding author and reprint requests:
K. Sathishkumar, DVM, PhD
Assistant Professor, Dept. of Obstetrics & Gynecology
University of Texas Medical Branch
301 University Blvd.
Galveston, TX 77555-1062
Phone: (409) 772-7592
Fax: (409) 772-2261
Email: [email protected]
1 Methods:
Animals
Timed pregnant Sprague-Dawley rats (gestational day, GD 12) were purchased from Harlan
Laboratories, Inc. (Houston, TX). Rats were housed in a temperature-controlled room (23°C)
with a 12:12-hour light/dark cycle with food and water available ad libitum. Plasma levels of
testosterone (T) were measured by ELISA (Enzo life sciences, Farmingdale, NY) as previously
described.1
Experimental procedures
Measurement of BP and flutamide and rottlerin treatment
Mean arterial pressure in conscious free-moving rats was determined using the telemetry
system as previously described.1 Briefly, rats were anesthetized with 2.5% isoflurane, and a
flexible catheter attached to a radio transmitter (TA11PA-C10, Data Sciences, Minneapolis,
MN) was inserted into the left femoral artery. After surgery, rats were housed in individual
cages and allowed to recover for a week. BP measurements obtained with a 10-s sampling
period were averaged and recorded every 10 minutes, 24 hours a day, using the software
(Dataquest 4.0, Data Sciences, Minneapolis, MN) provided by the manufacturer. A subset of
female offspring at 6 months of age was administered with anti-androgen (flutamide, Sigma,
10 mg/kg, s/c) twice daily for 10 days. Before, during, and after flutamide treatment, changes
in arterial pressure were recorded as described above.
To another cohort of rats, jugular and carotid arterial catheters were fixed under 2.5% isoflurane
anesthesia. After 24 h of recovery, mean arterial pressure was measured through their carotid
catheters.2;3 After ensuring that the arterial pressure was maintained at a stable level, rats were
injected with rottlerin (0.3 mg/kg through jugular catheter)4;5 and blood pressure changes were
assessed.2
Quantitative Real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
Total RNA was isolated from mesenteric arteries by using TRIzol reagent (Invitrogen, Grand
Island, NY). All RNA isolates were made DNA free by treatment with DNase and further
purification with RNeasy clean-up kit (QIAGEN Inc., Valencia, CA). Total RNA concentration
and purity were determined using an ND-1000 model Nanodrop spectrophotometer (Thermo
Fisher Scientific, Newark, DE). Two micrograms of total RNA were reverse transcribed using a
modified Maloney murine leukemia virus-derived reverse transcriptase (New England Biolabs
Inc., Ipswich, MA) and a blend of oligo(dT) and random hexamer primers (Invitrogen). The
reaction was carried out at 28°C for 15 min and then at 42°C for 50 min, and the reaction was
stopped by heating at 94°C for 5 min, followed by 4°C, before storage at −20°C until further
analysis. One microliter of the resulting cDNA was amplified by real-time RT-PCR using SYBR
Green (Bio-Rad, Hercules, CA) as fluorophore in an CFX96 model real-time thermal cycler
(Bio-Rad). Specific pairs of primers from published literature were used for each gene
amplification (Table S1). PCR conditions used were 10 min at 95°C for 1 cycle, 15 sec at 95°C,
30 sec at 60°C, and 15 sec at 72°C for 40 cycles, with a final dissociation step (0.05 sec at 65°C
and 0.5 sec at 95°C). Results were calculated using the 2–ΔΔCT method and expressed as foldlevel increases or decreases the expression of genes of interest in prenatal exposed T offspring vs
2 those in control rats. All reactions were performed in duplicate, and β actin was used as an
internal control.
Western Blotting
Protein extract (20 µg) from each sample was resolved on 4%–12% precast gradient
polyacrylamide gels (NuPAGE® Bis-Tris Gels, Invitrogen). Proteins from the gel were
transferred to a PVDF membrane (Millipore, Billerica, MA) by electroblotting. After blocking
the membranes in 5% BSA in TBS containing 0.1% Tween for 1 hour at RT, they were
incubated overnight at 4°C with primary antibodies (PKCδ: cat# 2058 and β-actin: cat# 3700
from Cell signaling, Danvers, MA and Androgen receptor: cat # ab74272 from Abacam,
Cambridge, MA) diluted 1:1000 in 5% BSA. Membranes were washed and incubated for 60 min
at RT with HRP-conjugated secondary antibodies (1:1000, anti-rabbit). Membranes were washed
and incubated in Pierce Western Blotting detection reagents (Thermo Scientific, Rockford, IL)
for 1 min. and exposed to film and developed. Densitometric analyses of the films were
performed using AlphaView software (Alpha Innotech, Santa Clara, CA).
Ex Vivo Vascular Reactivity Studies
Freshly excised third-order mesenteric arteries from 6-month-old female offspring were placed
in an ice-cold modified Krebs bicarbonate solution (KBS) of the following composition (in mM):
118 NaCl, 4.7 KCl, 25 NaHCO3, 2.5 CaCl2, 1.2 MgSO4, 1.2 KH2PO4, and 11 dextrose. The
mesenteric arteries were cleaned of adherent connective tissue and precisely cut into rings of
same length (2 mm). Two to 4 rings from 1 rat were used for 1 experiment. The n presented with
each figure represents the number of animals studied. Endothelium was denuded by gently
rubbing it with tungsten wires. Two 25-μm tungsten wires were threaded through the lumen, and
the rings were mounted in an isometric wire myograph system (model 610M wire myography,
Danish Myotechniques, Aarhaus, Denmark). The rings were bathed in 6 mL KBS, gassed with
95% oxygen and 5% carbon dioxide, maintained at a temperature of 37°C, and allowed to
equilibrate for 30 minutes before normalization to an internal diameter of 0.9 of L13.3kPa by
using a normalization software package (Myodata, Danish Myotechnologies). This corresponds
to a transmural pressure of approximately 90 mmHg. Following normalization, rings were
repeatedly exposed to KCl (80mM) to test their viability and to determine a standard contractile
response for each of them. The rings were contracted with phenylephrine (3µM, Sigma), and
when responses were stable, endothelium-denudation was confirmed by an absence of relaxation
to acetylcholine (10µM, Sigma). The rings were then allowed to recover for 60 minutes, after
which cumulative concentration-response curves were generated with the PKC activator, PDBu
(10−8 to 3x10−5 M, Sigma). Concentration-response curves of PDBu were obtained by the
cumulative addition of the agonist in approximate one-half log increments. Additionally,
contractile responses to PDBu were assessed in the presence of rottlerin (3 µM, selective PKCδ
inhibitor, Sigma). Arterial rings were incubated with rottlerin for 30 min prior to and during
PDBu dose-response. Contractile responses to PDBu were expressed as percent of 80 mM KCl
constriction.
Vascular Smooth Muscle Cell isolation and Culture
Mesenteric artery smooth muscle cells were isolated from adult female rats as described earlier. 3
Isolated cells were assessed for their purity by α-actin staining and were found to be >95% pure.
3 Cells were routinely cultured in DMEM containing 4.5g/L glucose supplemented with 25mM
HEPES, 2mM L-glutamine, 10% FBS, and antibiotics without sodium pyruvate. Cells were
changed to serum and phenol red-free media 48 hours prior to treatments. Cells were treated with
T (1–100nM) for 5 days with fresh media changes every day. After treatments, cells were
washed with PBS and lysed for RNA or protein preparation.
Bioinformatic analysis
A bioinformatic analysis was performed on the rat PKCδ gene (Gene ID: 170538) at the
promoter and intron 1 region using ConSite data base6 for the presence of androgen response
element- (ARE) like sequences with 75% transcriptional factor cut off score. The analysis was
performed up to 10 kb upstream to the transcriptional start site to cover the promoter region and
the entire intron 1 region, which is in the 5’ un-translated region directly upstream to the
initiation codon. The predicted ARE-like sequences present on the positive DNA strands were
considered for further analysis by chromatin immunoprecipitation ChIP assay.
ChIP assay and qPCR
Chip assay was performed to screen for AR binding sites in the promoter and intron 1 region of
the PKCδ gene. The assay was performed using a SimpleChIP® Chromatin Immunoprecipitation
kit (Cell Signaling Technologies), following the manufacturer’s instruction. Briefly, MASM
cells (approximately 3X107 cells per group) were cultured in the presence of T (50nM),
flutamide (1µM), T+flutamide, and vehicle for 5 days. Cells were washed and cross linked by
incubating them with 1% formaldehyde for 10 min at room temperature. Crosslinking was
stopped by the addition of 1X glycine for 5 min. After they were washed with ice-cold PBS, the
cells were scrapped and lysed to prepare chromatin. The chromatin was then fragmented by
enzymatic digestion using micrococcal nuclease for 20 min at 37°C with frequent mixing. The
digestion was stopped by adding 0.5 M EDTA on ice. Next, the nuclei were pelleted and
sonicated for 20s twice with 40% power to break the nuclear membrane. The lysates were then
clarified by spinning at 10,000 rpm for 10 min at 4°C. The supernatant contained the required
cross-linked chromatin. The chromatin was then treated with RNase A and then incubated with
Proteinase K for 2 hours at 65°C. DNA from the digested chromatin was isolated using spin
columns, quantified, and run on a 1% agarose gel to verify the enzymatic digestion of chromatin.
Chromatin (5µg of DNA in 500µl volume for each immunoprecipitation) was then subjected to
immunoprecipitation with an AR antibody (25µl per reaction, Abcam ab74272) along with
positive (10µl anti-histone antibody; Cell Signaling Technologies #4620) and negative (1µl of
rabbit IgG, Cell Signaling Technologies # 2727) controls. Immunoprecipitation was performed
overnight at 4°C with constant rotation. ChIP-grade Protein G magnetic beads were then added
to each reaction and incubated for 2 h at 4°C with rotation. Next, the pellets were precipitated
using a magnetic rack. Cross links were then reversed by adding 5mM NaCl and proteinase K
and incubating at 65°C for 2 h. DNA was purified using spin columns, quantified, and stored for
further analysis. Purified DNA from ChIP assays along with their respective 2% inputs were
subjected to qPCR to identify the ligand-dependent AR binding to putative AR binding sites in
PKCδ gene. Primer sets were synthesized to flank the predicted putative ARE sites (Table S2).
PCR conditions used were 10 min at 95°C for 1 cycle, 15 sec at 95°C, 30 sec at 60°C, and 15 sec
at 72°C for 40 cycles, with a final dissociation step (0.05 sec at 65°C and 0.5 sec at 95°C).
Percentage Input was calculated by calculating 2% x 2(C[T] 2%Adjusted Input Sample – C[T] IP Sample) (C[T] =
Threshold cycle of PCR reaction).
4 Reporter Assay
The intron 1 region (approximately 7 kb) of the rat PKCδ gene was cloned and sequenced
(GenBank: KF573407.1), and a reporter construct was made by inserting it in to pGL3 basic
vector (Promega, Madison, WI). Mesenteric artery smooth muscle cells were transiently
transfected using Amaxa reagent for human aortic smooth muscle cells (VPC-1001, Lonza)
using program number U-025. Five transfections were performed with each transfection
containing 5µg of pGL3-int1 ARE vector and 0.5 pRL µg DNA with ~ 5x105 mesenteric artery
smooth muscle cells. After transfections, cells were pooled from all cuvettes and were seeded on
to a 12 well plate. Control transfections were also performed with pGL3 and pmaxGFP® vectors
to check for background and transfection efficiency, respectively. After 24 hours, cells were
washed and were cultured in the presence of T (50nM), flutamide (1µM), T+flutamide, and
vehicle (ethanol) for 5 days in DMEM containing 4.5g/L glucose, supplemented with 25mM
HEPES, 2mM L-glutamine, and antibiotics without sodium pyruvate and FBS at 37oC with 5%
CO2 . Fresh media containing T, F, and vehicle were replaced every day. The cells were then
washed with ice-cold PBS thrice and were lysed by adding 250 µl of passive lysis buffer per well
(Promega). A luciferase assay was performed using the Dual-Luciferase® reporter assay system
(Promega), following the manufacturer’s instruction. Cell lysates (25µl) were transferred on to a
96 well plate and 100µl of Luciferase Assay reagent II was dispensed, and firefly luciferase
activity (activity of inserted ARE like sequences) was measured. Stop & Glo® reagent was then
added to measure the renilla luciferase activity. Luminescence was measured using Fluorstar
Omega (BMG Labtech, Cary, NC) with 1s readout per well. The firefly luciferase activity was
normalized with the renilla luciferase activity, and the results were expressed as relative
luminescence.
Statistics
All values are given as mean ± SEM. Sigmoidal functions were modeled to individual dose–
response curves (Prism, GraphPad Software, San Diego CA), and statistical comparisons of
Emax and BP values were made by ANOVA with Bonferroni correction for multiple
comparisons. For statistical comparison of single parameters, an independent t test was used.
Statistical significance was assumed if P < 0.05.
Reference List
1. Chinnathambi V, Balakrishnan M, Ramadoss J, Yallampalli C, Sathishkumar K. Testosterone
Alters Maternal Vascular Adaptations: Role of the Endothelial NO System. Hypertension.
2013;61:647-654.
2. Sathishkumar K, Elkins R, Yallampalli U, Yallampalli C. Protein Restriction during Pregnancy
Induces Hypertension and Impairs Endothelium-Dependent Vascular Function in Adult Female
Offspring. J Vasc Res. 2008;46:229-239.
5 3. Sathishkumar K, Yallampalli U, Elkins R, Yallampalli C. Raf-1 Kinase Regulates Smooth Muscle
Contraction in the Rat Mesenteric Arteries. J Vasc Res. 2010;47:384-398.
4. Hlavackova M, Kozichova K, Neckar J, Kolar F, Musters RJ, Novak F, Novakova O. Up-regulation
and redistribution of protein kinase C-delta in chronically hypoxic heart. Mol Cell Biochem.
2010;345:271-282.
5. Yun N, Lee SM. Activation of protein kinase C delta reduces hepatocellular damage in ischemic
preconditioned rat liver. J Surg Res. 2013;185:869-876.
6. Sandelin A, Wasserman WW, Lenhard B. ConSite: web-based prediction of regulatory elements
using cross-species comparison. Nucleic Acids Res. 2004;32:W249-W252.
Table S1: Primers used to amplify PKC isoforms
Prkc
Farward 5’- 3’
Reverse 5’- 3’
Alpha
GTGCAAGGAACACATGATGG
GTAATCCGGAGTCCCACAGA
Beta
CTCAGAGCGGAAGGGTACAG
GTGCACTCCACATCGTCATC
Delta
TACCGGGCTACGTTTTAT
ACATCCCGAAGTCAGCAATC
Epislon
ACGGTGGAGACCTCATGTTC
TCACTCCATGTTGGTGGAGA
Gamma TTGATGGGGAAGATGAGGAG
CGGGAAAGTGACTTGGGATA
Iota
CGGCATGTGTAAGGAAGGAT
CAGTCAACGCTGAAGCCATA
Theta
TAGAAAGGGAGGCCAAGGAT GCGGATGTCTCCTCTCACTC
Zeta
CCAGGACCTCTGTGAGGAAG
CCTTCACTGTCCACCCACTT
6 Table S2: Primers used to amplify putative AREs from promoter and intron 1 regions of
PKCδ gene after ChIP assay
Primers used in Promoter Region
Prkcd-P-ARE 1 Forward: 5’TCATAGTGGGACTTCCCCAG-3’
Reverse: 5’TGTAGAGGGGAAGCCAGTGA-3’
Prkcd-P-ARE 2 Forward: 5’CCACCATACCCATGGTCTTC-3’
Reverse: 5’CCAAATTCTCTTGGGAACCA-3’
Prkcd-P-ARE 3 Forward: 5’CTTCGAGACTCGTTGGCTTC-3’
Reverse: 5’CAGTCTTCTGAGCTCCAGGG-3’
Prkcd-P-ARE 4 Forward: 5’GTGTGTGTGCTGGAATCAGG-3’
Reverse: 5’CTGAGGAAACTTCAAACGCC-3’
Forward: 5’Prkcd-P-ARE
ACACAGGGAGACAAAGCCAA-3’
5-6*
Reverse: 5’GGACATTCGCAGAAAGAAGC-3’
Putative AR binding sites
5’TGAGGCTCGATGTGTGCCACAT3’
Primers used in Intron 1 Region
Forward: 5’TGGACCTATCTCCTGGGTTG-3’
Reverse: 5’CTGTGACTGACTGGTTGGGA-3’
Forward: 5’Prkcd-Int1GCTGAGGAAGCTGCTCACTAC-3’
ARE2
Reverse: 5’GGCCTTTGTCCAGATACCAA-3’
Forward: 5’Prkcd-Int1TGAAACTCCTGCAGTGACCA -3’
ARE3&4*
Reverse: 5’ACCAGCACAAGGACTCACCT-3’
Forward: 5’Prkcd-Int1GTGTTGCTTTGGTCATGGTG-3’
ARE5
Reverse: 5’TGGAGTCTGTGTGGTTGGTG-3’
Putative AR binding sites
5’GAAAGCCCACAGCCTCCTTGAC3’
Prkcd-Int1ARE1
5’GCAAGGACACAGCGTTCTGACC3’
5’CCCAGTACATTCTGGCCGTAAA3’
5’CAGGAAACTCCCTGTTCGGCCC3’
5’ATGAGCACACAGTTGTCCACAT3’
5’CAAGGAACACACTCAAACCCTC3’
5’CTGTGCCCACTCTGATCTGGCC3’
5’CTCATCCCACCATTTACTGGCC3’
5’CATAGCACATCCACTTCCATGG3’
5’CTAAGACAGTCTTGTTCTCGCA3’
* Putative AREs were very close and hence two were covered by the same set of primers
7