Physiol Genomics 44: 152–161, 2012.
First published November 22, 2011; doi:10.1152/physiolgenomics.00089.2011.
C6orf176: a novel possible regulator of cAMP-mediated gene expression
Armin Reitmair,1 George Sachs,2,3,4 Wha Bin Im,1 and Larry Wheeler1
1
Department of Biological Sciences, Allergan Incorporated, Irvine; Departments of 2Physiology and 3Medicine, David Geffen
School of Medicine, University of California Los Angeles; and 4Membrane Biology Laboratory, West Los Angeles Veterans
Affairs Medical Center, Los Angeles, California
Submitted 6 June 2011; accepted in final form 22 November 2011
cAMP signaling; gene expression; intraocular pressure, prostaglandins PGE2
cAMP pathway represents an important signaling pathway
involved in many aspects of cell regulation. An increasing
number of examples now in the literature link its deregulation
to disease and suggest that agents that can restore normal
signaling by targeting components of the cAMP signaling
pathway have therapeutic potential. Examples include Alzheimer’s disease (24); cardiovascular diseases such as atherosclerosis, restenosis, and reperfusion injury (9); diabetes (6, 10, 11,
27); depression (23); and cancer (3, 4).
THE
Address for reprint requests and other correspondence: A. Reitmair, Dept. of
Biological Sciences, Allergan, Inc., RD3, 2525 Dupont Dr., Irvine, CA 92612
(e-mail: [email protected]).
152
Chromosome 6 open reading frame 176 (C6orf176), a new,
primate-specific gene of unknown function, was identified in
previous genome-wide expression studies by strong upregulation of its expression subsequent to activation of the cAMP
signaling pathway following treatment of human ciliary
smooth muscle (hCSM) cells with prostaglandin E2 receptor
subtype EP2- and EP4-specific agonists (19). These agonists,
AGN007 and AGN008, respectively, with improved receptor
affinity and specificity characteristics are being developed as
next generation ocular hypotensive antiglaucoma agents enhancing uveo-scleral outflow via activation of the cAMP pathway. They bind to the EP2 and EP4 prostanoid receptors,
which are two of the four known subtypes (EP1– 4). Both of
these receptors couple to Gs and mediate increases in cAMP
concentration, in contrast to the Gi coupling of EP3 and the Gq
coupling of EP1 receptors (18, 22). The cAMP-response element binding protein (CREB) family of activators stimulate
cellular gene expression after cAMP-dependent protein kinasemediated phosphorylation (15). In our experimental conditions, the most pronounced transcriptional upregulation by far
was observed for C6orf176, which may serve as a biomarker
and/or pharmaceutical drug target in context of diseases with
deregulated cAMP signaling.
The National Center for Biotechnology Information (NCBI)
has recently reclassified the C6orf176 gene as a noncoding
RNA (ncRNA) and lists two transcript variants that share the
first exon: transcript variant 1 (tv1; accession number:
NR_026860) and transcript variant 2 (tv2; accession number:
NR_026861). ncRNA is emerging as an important regulator of
gene expression in many organisms. Some ncRNAs that trigger
different types of gene silencing are collectively referred to as
RNA silencing or RNA interference (RNAi). Here, we present
evidence, based on qRT-PCR, Northern blot analysis, as well
as cDNA library screening, for existence of additional
C6orf176 transcript variants [whose observed open reading
frames (ORFs) could be translated], and discuss possible
RNAi-mediated regulatory functions upon expression of other
genes that are part of cell type-specific networks mediating
physiological effects in response to cAMP signaling.
EXPERIMENTAL PROCEDURES
Materials. Agents used to activate various cell surface receptors as
well as adenylate cyclase were prepared in 10 mM dimethyl sulfoxide
(DMSO) stock solutions. The EP2 agonist AGN007 and the EP4
agonist AGN008 were synthesized at Allergan (Irvine, CA). The
prostaglandin E2 receptor pan-agonist PGE2, the DP1 receptor agonist
BW 245C, the FP receptor agonist PGF2␣, the IP receptor agonist
carbacyclin, the ␣2-adrenergic receptor agonist brimonidine tartrate,
the dopamine DRD2 receptor agonist (⫾)-quinpirole dihydrochloride
(QDC), the thromboxane A2 receptor agonist U46619, and the adenylate cyclase activator forskolin were purchased from Sigma-Aldrich
and EMD Chemicals. Growth media, fetal bovine serum (FBS),
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
Reitmair A, Sachs G, Im WB, Wheeler L. C6orf176: a novel
possible regulator of cAMP-mediated gene expression. Physiol
Genomics 44: 152–161, 2012. First published November 22, 2011;
doi:10.1152/physiolgenomics.00089.2011.— cAMP mediates diverse
cellular signals including prostaglandin (PG) E2-mediated intraocular
pressure (IOP)-lowering activity in human ocular ciliary smooth
muscle cells (hCSM). We have identified gene regulatory networks
and key genes upon activation of the cAMP pathway in hCSM, using
novel agonists highly selective for PGE2 receptor subtypes EP2 or
EP4, which are G protein-coupled receptors well known to activate
cAMP signaling. Here we describe a novel, EP2/EP4-induced, primate-specific gene of hitherto unknown function, also known as
C6orf176 (chromosome 6 open reading frame 176) and recently
reclassified as noncoding RNA in NCBI’s database. Its expression, as
determined by quantitative real-time RT-PCR (qRT-PCR), is dramatically upregulated (⬎2,000-fold) subsequent to transduction of EP2/
EP4/Gs/cAMP signaling not only in hCSM, but also in HEK cells
overexpressing the recombinant receptors. Moreover, activation of
other IOP lowering, Gs-coupled prostanoid receptors, such as DP1
and IP, as well as a direct activator of adenylyl cyclase, forskolin, also
substantially upregulated C6orf176 in hCSM, while FP and TP, which
are Gq-coupled prostanoid receptor subtypes, did not. Novel transcript
variants carrying open reading frames, derived from an at least 67 kb
genomic locus on chromosome 6q27 with putative alternative transcription start sites, were identified. Transcriptional upregulation of
transcript variants as well as of two genes expressed in antisense
orientation that partially overlap the transcribed C6orf176 region was
observed, to varying degrees, subsequent to induction of cAMP
signaling using various agonists. Small interfering RNA-mediated
C6orf176 gene silencing experiments showed modulation of several
cAMP-responsive genes. These transcriptional activities identify
C6orf176 as a potential biomarker and/or therapeutic target in context
with diseases linked to deregulated cAMP signaling. Also, the cAMPinducible C6orf176 gene locus could be useful as a model system for
studying transcriptional regulation by chromatin and RNA polymerase II.
153
C6orf176, A NOVEL GENE INVOLVED IN cAMP SIGNALING
at 60°C hybridization/extension. Amplification plots were analyzed
using the Sequence Detection System version 1.9.1 software (Applied
Biosystems) to determine threshold cycles (Ct) of amplification detection. Triplicate qRT-PCR analysis was performed for each gene of
interest based on RNA materials derived from at least three biologically independent experiments. Relative gene expression ratios in
treated vs. untreated samples (fold changes of transcript levels) were
calculated based on the comparative Ct method (⌬⌬Ct method) (13)
using GAPDH and beta-actin controls included in each real-time
RT-PCR run. P values are based on two-sided two-sample Student’s
t-tests for the null hypothesis of no difference compared with controls.
Data are expressed as means ⫾ SE.
Preparation of Northern blot probes. Complementary DNA probes
for C6orf176 exon 1 and human GAPDH were labeled with [␣32
P]dCTP (6,000 Ci/mmol, PerkinElmer) using the Prime-It II Random Primer Labeling Kit (Stratagene/Agilent Technologies) according to the manufacturer’s recommendation with the following modification. To selectively obtain gene-specific radioactively labeled
antisense probes, the random oligonucleotide primers provided with
the kit were replaced by custom-synthesized (Integrated DNA Technologies) gene-specific antisense primers (C6orf176_L12: 5=-actgcgcaaagc, and GAPDH_L12: 5=-atccgttgactc, respectively).
DNA template to be labeled consisted of custom-synthesized oligo
sequences (C6orf176_ex1_200nt, 5=-gctttccccg agacccccag atggaaagga
gggaaggagg aaccccacac actcgccttt tgcgagaaga tcggcgcgca ccccagagtg
ccccaagcct ttggaatctg cctgctgagc ggagcgcgcg agcgtggtgg acaggtcccg
aacttggcca gcgggctttc ttggcaactt gctttgcgca gttctccatg; and GAPDH_80nt,
5=-tcttcttttg cgtcgccagc cgagccacat cgctcagaca ccatggggaa ggtgaaggtc
ggagtcaacg gatttggtcg, respectively), which were selected subsequent to BLAST searches for minimization of sequence homologies to other RNA sequences in the human transcriptome. We
annealed 50 pmol of probe to 0.4 pmol of template, followed by 10
min of Exo(-) Klenow enzyme-mediated DNA synthesis at 40°C
and purification by NucTrap Probe Purification Columns (Stratagene/Agilent Technologies).
RNA isolation and northern blot analysis. Naïve HEK-293 cells as
well as HEK-293 cells stably overexpressing the hEP2 receptor
(HEK-293/hEP2) were grown to confluence in 15 cm dishes, followed
by starvation in absence of FBS and presence of 100 nM of the
cyclooxygenase inhibitor indomethacin, 20 ␮g/ml fatty acid-free
BSA, and 4 ␮g/ml transferrin for 22 h. Cells were then exposed for 2
h to 200 nM of the EP2 agonist AGN007 (HEK-293/hEP2 cells) or the
corresponding amount of DMSO (HEK-293naïve cells) in the absence
of FCS and presence of transferrin. The FastTrack MAG mRNA
Isolation Kit (Invitrogen) was used to isolate high-quality mRNA
according to the manufacturer’s recommendation with the exception
of an extended separation period (overnight at 4°C) of mRNA-bound
magnetic beads in the magnetic separator. mRNA was quantitated
using a spectrophotometer ND-1000 (Nanodrop Technologies). Its
quality was assessed regarding purity and stability using a Bioanalyzer 2100 (Agilent Technologies).
Table 1. Custom-designed primer and probe sets for expression analysis at and near the C6orf176 genomic locus
Set
Set
Set
Set
a
b
c
d
Forward Primer
Reverse Primer
Probe (minor groove binder)
5=-AAATGAAGCGGAAAGCAGATATGC
5=-TTGCTGCTTCTTCCAAAGTAGGT
5=-ACGCCCCCGCAGTC
5=-GCCAGTGCAGGAGTTCCT
5=-CAACGAGCACCAGAGAATACTAGTG
5=-TGTGGTCCCTGTCCTGACT
5=-GCGAGCCCGACACGT
5=-TGGTCCTCTCTCCCACCTTT
FAM-CCAGCATCCCGCCAAAG-NFQ
FAM-CAGATGCGATGGCTTC-NFQ
FAM-CCCGCCCCTTGTCACT-NFQ
FAM-CCGGTGACCTGGACTC-NFQ
TaqMan-based primer and probe sets were designed to monitor transcription of chromosome 6 open reading frame 176 (C6orf176) transcript variant 2 (tv2)
(set a), a putative alternatively spliced exon (set b) based on expressed sequence tag (EST) sequence information, and an Image cDNA clone (accession number:
CB985684), the hypothetical gene LOC441177 based on an Image cDNA clone (accession number: BC110806) in antisense direction that partially overlap the
transcribed C6orf176 exon 1 region (set c), and another putative gene in antisense orientation (hmm409034) located ⬃3.5 kb further upstream (set d). The minor
groove binding probe oligonucleotides have a 6-carboxy fluorescein (FAM) fluorescent dye attached to their 5=-ends and a nonfluorescent quencher (NFQ) at
their 3=-ends.
Physiol Genomics • doi:10.1152/physiolgenomics.00089.2011 • www.physiolgenomics.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
L-glutamine, geneticin (G418), and antibiotic/antimycotic (10,000
units/ml penicillin G, 10,000 units/ml streptomycin sulphate, 25
␮g/ml amphotericin B in 0.85% saline), were purchased from Gibco.
DMSO, indomethacin, fatty acid-free bovine serum albumin (BSA),
and transferrin were acquired from Sigma. Various commercially
available kits were obtained as specified below.
Cell cultures. hCSM and human embryonic kidney-293 cells heterologously expressing a human recombinant EP2 receptor (HEK293/hEP2) were established and cultured as described in Reitmair et
al. (19). TM86 were primary trabecular meshwork cells isolated as
described previously (21) from a 3 mo old baby and obtained from Dr.
D. Stamer’s lab (Department of Ophthalmology and Vision Science,
University of Arizona, Tucson, AZ). They were grown in DMEMLow Glucose (Gibco 11885) with 10% FBS and 1% antibiotic/
antimycotic. Retinal pigment epithelia (ARPE-19/CRL-2302) were
obtained from the American Type Culture Collection (Manassas, VA)
and cultured in DMEM-F12 (Gibco 10565), containing 10% FBS and
1% antibiotic/antimycotic.
Time course and drug profiling experiments. When hCSM cells,
passaged into 10 cm dishes, reached 80% confluence, each dish
received starvation medium for 24 h that contained MEM (D-Valine),
1% L-glutamine, 1% antibiotic/antimycotic, transferrin (4 ␮g/ml),
fatty acid-free BSA (20 ␮g/ml), and indomethacin (0.1 ␮M). Indomethacin was added separately on the day of starvation treatment.
Subsequently, the medium was exchanged with an incubation medium, which consisted of MEM (D-Valine), 1% L-glutamine, 1%
antibiotic/antimycotic, and transferrin (4 ␮g/ml). We began drug
treatment for the specified time periods began by adding the respective amounts of each drug into dishes. Untreated controls received
equal amounts of DMSO. The experiments with TM86, ARPE-19,
and HEK-293 cells were performed using the cell lines’ respective
growth media.
Quantitative real-time reverse transcriptase-polymerase chain
reaction. For quantitative real-time reverse transcriptase-polymerase
chain reaction (qRT-PCR), total RNA from cells was isolated as
described previously (19). qRT-PCR assays were performed using an
ABI Prism 7700 thermocycler (Applied Biosystems, Foster City, CA)
with 100 ng of total RNA as template input in 25 ␮l total volume per
reaction in 96-well plate format along with template-free negative
controls. Primers and probes for each gene (TaqMan Gene Expression
Assays) and TaqMan One-Step PCR Master Mix Reagents kits,
containing a TaqMan Universal PCR master mix, a Multiscribe
reverse transcriptase, and an RNase inhibitor mix, were obtained from
Applied Biosystems. Final primer and probe concentrations were 200
and 900 nM, respectively. In addition to the commercially available
primer and probe set for C6orf176 (Hs00293257_m1) which monitors
tv1, custom-designed primer and probe sets, based on publicly available genomic sequence information from the human genome reference assembly NCBI Build 36.3, were obtained through Applied
Biosystems’s Assays-by-Design service and are listed in Table 1. A
reverse transcription step of 31 min at 48°C was followed by 10 min
at 95°C, as well as 40 cycles of 15 s at 95°C denaturation and 1 min
154
C6orf176, A NOVEL GENE INVOLVED IN cAMP SIGNALING
according to the manufacturer’s protocol, which included treatment
with DNaseI. We used 4 ␮g mRNA as starting material for subsequent
cDNA library construction using Invitrogen’s CloneMiner II cDNA
Library Construction Kit according to the manufacturer’s instructions.
Single-stranded mRNA was converted into double-stranded cDNA
containing attB sequences on each end. Through site-specific recombination, attB-flanked cDNA was cloned directly into an attP-containing donor vector. Competent ElectroMAX DH10B T1 Phage resistant
cells were transformed, and a plating assay was performed. Library
titer and yield for the EP2 agonist-induced cDNA library were 3 ⫻
107 cfu/ml and 3.6 ⫻ 108 cfu, respectively. Individual colonies were
grown overnight in LB medium containing 50 ␮g/ml kanamycin,
followed by plasmid isolation using Invitrogen’s PureLink Quick
Plasmid MiniPrep Kit according to the manufacturer’s protocol.
Plasmid DNAs were subjected to a BsrG I restriction enzyme digest
followed by 1% agarose gel electrophoresis to evaluate cDNA inserts.
The recombination rate was determined at ⬎80%.
cDNA library screening by hybridization with a radiolabeled
probe. The EP2 agonist-induced cDNA library propagated as plasmids in bacteria was plated onto 15 cm agar plates containing 50
␮g/ml kanamycin at various densities (200,000 – 400,000 clones per
plate) and grown overnight at 37°C. After 1 h at 4°C, BrightStar-Plus
(Ambion) positively charged nylon membranes were placed in duplicate onto agar plates, marked, lifted, and autoclaved for 1 min at
121°C with a quick-exhaust program to lyse the cells. Positive control
(C6orf176_ex1_200nt) and negative control DNA oligos (GAPDH_
80nt) were spotted onto nylon membranes followed by UV crosslink-
Table 2. TaqMan Gene Expression Assays to evaluate effects of C6orf176 knock-down on selected target genes
Gene Symbol
KYNU
PGM2L1
AVPI1
C13orf33
CRISPLD2
Gene Name
kynureninase (L-kynurenine hydrolase)
phosphoglucomutase 2-like 1
arginine vasopressin-induced 1
chromosome 13 open reading frame 33
cysteine-rich secretory protein LCCL domain
containing 2
PCSK5
proprotein convertase subtilisin/kexin type 5
GPRC5A
G protein-coupled receptor, family C, group
5, member A
LOXL3
lysyl oxidase-like 3
CXCR7
chemokine (C-X-C motif) receptor 7
RGS2
regulator of G protein signaling 2, 24 kDa
TFPI2
tissue factor pathway inhibitor 2
RASD1
RAS, dexamethasone-induced 1
CHRDL2
chordin-like 2
IL11
interleukin 11
BMP6
bone morphogenetic protein 6
STC1
stanniocalcin 1
INHBA
inhibin, beta A
NAMPT (PBEF1) nicotinamide phosphoribosyltransferase
AREG
amphiregulin (schwannoma-derived growth
factor)
IL8
interleukin 8
BMP2
bone morphogenetic protein 2
FGF10
fibroblast growth factor 10
NR4A3
nuclear receptor subfamily 4, group A,
member 3
NR4A1
nuclear receptor subfamily 4, group A,
member 1
AQP3
aquaporin 3 (Gill blood group)
ATP1B3
ATPase, Na⫹/K⫹ transporting, beta 3
polypeptide
CHST6
carbohydrate (N-acetylglucosamine 6-O)
sulfotransferase 6
ACTB
actin, beta
GAPDH
glyceraldehyde-3-phosphate dehydrogenase
Group
Assay ID
Probe Context Sequence
hydrolase
mutase
miscellaneous function
miscellaneous function
cell adhesion molecule
Hs00187560_m1
Hs00328100_m1
Hs00222250_m1
Hs00262558_m1
Hs00230322_m1
ACAGGATCTGCCTCCAGTTGATTTA
ACAGTCAACACAGGGGATGTACAAA
CTGCCCTTCAGTGTGAGCATCCACA
GACACCTCAAAAGAAAGGACGTACG
TCTGAAAGCCTGGGGACTCCTCGGG
serine protease
G protein-coupled receptor
Hs00196400_m1 GGGATGGGTTAAGCCTGCAGGGATC
Hs00173681_m1 GCCTTGGCACTAGGGTCCAGAATGG
other receptor
G protein-coupled receptor
G protein modulator
Dna glycosylase
Dna photolyase
signaling molecule
cytokine
cytokine
protein/peptide hormone
cytokine
cytokine
growth factor
Hs00261671_m1
Hs00604567_m1
Hs00180054_m1
Hs00197918_m1
Hs00607394_g1
Hs00248808_m1
Hs00174148_m1
Hs00233470_m1
Hs00174970_m1
Hs00170103_m1
Hs00237184_m1
Hs00155832_m1
CCCTGGAACAGGCCGCATCTGGCTG
CCCAGCCAGCCCGGAGGTCATTTGA
AACGGACCCTTTTAAAAGATTGGAA
CGCACCAAAGAAAATTCCATCATTT
TCCTCACAGGAGACGTTTTCATCCT
CAGCTGCACAGAGGGCCAGATCTAC
TGCACAGCTGAGGGACAAATTCCCA
ATCAGCACAGAGACTCTGACCTGTT
CAAAACTCAGCTGAAGTGGTTCGTT
ACGTTTGCCGAGTCAGGAACAGCCA
CACCGACTCCTACAAGGTTACTCAC
TTACAGTCCAGCTTAGAAGACAATA
chemokine
cytokine
growth factor
nuclear hormone receptor
Hs00174103_m1
Hs00154192_m1
Hs00610298_m1
Hs00235001_m1
CTCTGTGTGAAGGTGCAGTTTTGCC
CAGCTTCCACCATGAAGAATCTTTG
ACTGCCCGTACAGCATCCTGGAGAT
CTTTCCATCAGGTCAAACACTGCTG
nuclear hormone receptor
Hs00374230_m1 CTTGTCCTCATCACCGACCGGCATG
other transfer/carrier protein
apolipoprotein
Hs00185020_m1 GGCCAGGTCTCTGGGGCCCACCTGA
Hs00740857_mH AGATTCCTAGCCCAGGACTCATGGT
other transferase
Hs00375366_m1 CAAGCTTTGGGGTGCTGAGGAACCT
actin family cytoskeletal protein Hs99999903_m1 TCGCCTTTGCCGATCCGCCGCCCGT
dehydrogenase
Hs99999905_m1 GGGCGCCTGGTCACCAGGGCTGCTT
Assay information was compiled from the corresponding assay information files obtained from Applied Biosystems and includes ␤-actin and GAPDH controls.
As exact sequence information for proprietary primer and probe sets was not disclosed, only probe context sequence is shown.
Physiol Genomics • doi:10.1152/physiolgenomics.00089.2011 • www.physiolgenomics.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
The Ambion NorthernMax Kit was used to perform the Northern
blot following the manufacturer’s protocol with the subsequent conditions. We loaded 19 ␮g of mRNA per lane onto a denaturing 1%
agarose-formaldehyde gel and electrophoresed for 3.5 h at 80 V. Two
RNA molecular weight markers (Sigma and Ambion) containing 125
ng/ml ethidium bromide were also run on the gel to estimate transcript
size. A downward capillary blot was used to transfer mRNA to a
BrightStar-Plus (Ambion) positively-charged nylon membrane and
immobilized using an ultraviolet crosslinker (UV Stratalinker 2400;
Stratagene/Agilent Technologies). The blot was mixed with ULTRAhyb buffer from the NorthernMax kit and allowed to prehybridize for
40 min at 60°C. The C6orf176 exon 1-specific radioactive probe was
heated to 95°C for 10 min and added to the buffer, followed by
hybridization for 20 h at 60°C. After hybridization, the membrane was
washed twice with low-stringency buffer for 5 min at room temperature, then washed twice with high -buffer (45°C for 15 min and 55°C
for 20 min), and subsequently exposed to BioMax XAR film (Kodak)
at ⫺80°C using an intensifying screen (Kodak). After analysis, the
membrane was stripped with boiling RNase-free water containing
0.1% SDS and hybridized to the GAPDH-specific probe for 18 h at
50°C, followed by two washes with low stringency (5 min at room
temperature), three washes with high stringency buffer (45°C for 15
min twice, and 50°C for 20 min), and exposure to film.
cDNA library construction. A cDNA library was constructed based
on mRNA extracted from 1 ⫻ 107 hCSM cells after treatment with the
EP2 agonist AGN007 (0.2 ␮M) for 2 h, followed by mRNA extraction
using Invitrogen’s FastTrack MAG mRNA Isolation Kit (version C)
C6orf176, A NOVEL GENE INVOLVED IN cAMP SIGNALING
RESULTS
Time course analysis of C6orf176 expression in response to
EP2 and EP4 agonist stimulation of hCSM cells. The effect of
treatment with the EP2 agonist AGN007 (0.2 ␮M) or the EP4
agonist AGN008 (0.2 ␮M) was monitored by changes of
C6orf176 tv1 mRNA transcript levels compared with untreated
control (DMSO only) in hCSM cells. As described previously,
this primary cell line expresses high levels of EP2 and EP4
receptors (19). Transcriptional regulation was evaluated using
qRT-PCR in time course experiments over a 24 h period
(Fig. 1). At the 2 h time point of EP2 or EP4 agonist treatment,
a robust peak transcriptional upregulation with a fold change
(⫾ SE) of 2,585 ⫾ 748 or 3,944 ⫾ 750, respectively, was
observed. Average Ct values (⫾ SE) at this time point were
22.0 ⫾ 0.5 (EP2 agonist), 21.6 ⫾ 0.2 (EP4 agonist), and
33.3 ⫾ 0.5 (DMSO). In comparison, the Ct values for betaactin and GAPDH, used as controls for normalization purposes, were 17.2 ⫾ 0.5 and 16.1 ⫾ 0.3 (EP2 agonist), 17.7 ⫾
0.4 and 16.5 ⫾ 0.2 (EP4 agonist), and 17.3 ⫾ 0.3 and 16.4 ⫾
0.2 (DMSO), respectively, demonstrating no significant change
in these housekeeping genes subsequent to EP2 or EP4 agonist
treatment. The peak transcriptional upregulation at the 2 h time
point was followed by a rapid decline but to still substantially
elevated baseline transcript levels, ranging between 144- and
342-fold transcriptional upregulation at the 6, 10, and 24 h time
points.
C6orf176 transcriptional upregulation subsequent to induction of cAMP signaling in various cell types and by various
agents. The 2 h time point was chosen to determine the change
in C6orf176 RNA transcript levels in hCSM cells treated with
various known IOP-lowering agents. The dopamine DRD2
receptor agonist QDC and the thromboxane A2 receptor agonist U46619 were used as controls and are not IOP-lowering
agents. Four of the eight agents tested that are known cAMP
Fig. 1. Time course study of chromosome 6 open reading frame 176
(C6orf176) transcriptional upregulation in human ciliary smooth muscle
(hCSM) cells subsequent to stimulation by EP2 or EP4 agonists. Average
ratios (treated vs. untreated) and SE of C6orf176 mRNA levels [transcript
variant 1 (tv1)] after treatment with 0.2 ␮M of either EP2 agonist AGN007 or
EP4 agonist AGN008 at various time points are displayed. Ratios were
calculated based on the comparative Ct method (⌬⌬ Ct method) using GAPDH
and beta-actin controls included in each real-time RT-PCR run. Data analysis
is based on a minimum of 3 independent biological experiments. P values
are ⱕ 0.001 (statistically extremely significant) for all data points and based on
2-sided 2-sample Student’s t-tests for the null hypothesis of no difference.
Physiol Genomics • doi:10.1152/physiolgenomics.00089.2011 • www.physiolgenomics.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
ing (UV Stratalinker 2400, Stratagene/Agilent Technologies). Prehybridization was performed for 45 min at 42°C in ULTRAhyb buffer
(Ambion). The C6orf176 exon 1-specific radioactive probe, described
above, was heated to 95°C for 10 min and then added to the
prehybridization solution. The hybridization was allowed to continue
for 30 h at 42°C. Subsequently, membranes were washed twice with
low-stringency wash buffer (Ambion) for 5 min at room temperature,
then washed twice with high-stringency wash buffer (Ambion) at
42°C for 20 min, and exposed to BioMax XAR film (Kodak) at
⫺80°C for 2–5 days using an intensifying screen (Kodak).
For isolation of positive clones, round pieces (4 mm diameter) were
cut out from primary screen agar plates, placed into 200 ␮l of S.O.C.
medium (Invitrogen), heated for 5 min at 37°C, vortexed, and replated
at low densities (200 – 800 clones per plate). Secondary screening by
hybridization with the C6orf176 exon 1-specific radiolabeled probe
was carried out as described above. Isolated individual positive
colonies were picked and grown overnight at 37°C in 5 ml TB
medium containing 50 ␮g/ml kanamycin. Plasmids were isolated
using Invitrogen’s PureLink Quick Plasmid MiniPrep Kit according to
the manufacturer’s protocol. Plasmid DNA was quantitated and its
quality assessed using a spectrophotometer ND-1000 (Nanodrop
Technologies). Insert sequencing with at least twofold coverage was
performed using M13forward and M13reverse primers as well as primers
specific for insert sequences.
RNAi-based gene silencing experiments. hCSM cells were set up as
described above and transfected with double-stranded small interfering (si) RNA molecules (Stealth RNAi, Invitrogen) using Lipofectamine 2000 (Invitrogen). The transfection procedure followed the
manufacturer’s recommendations and was optimized using the
BLOCK-iT Alexa Fluor Red Fluorescent Oligo (Invitrogen), an Alexa
Fluor 555-labeled RNA duplex designed for use as a tool for siRNA
uptake assessment. RNAi molecules were designed using Invitrogen’s
online BLOCK-iT RNAi designer tool. A total of 20 siRNA duplexes
were tested and a combination of the four most effective siRNA duplexes
selected. Sequences were: 5=-UUCAUCGUGAUGCAUCUCCCGGCGC, 5=-UUAAACUGGAUCUUUGCAGACAGGG, 5=-GCUACAGACGUCAUCGCCUCCUGUU, and 5=-CAUCAUUUCCCUACCUGCUCCUCCU.
Briefly, when cells that were passaged into 15 cm dishes reached
50 –70% confluence, each dish received 25 ml of starvation media
containing high-glucose DMEM, D-valine, 1% antibiotic/antimycotic,
transferrin (4 ␮g/ml), fatty acid-free BSA (20 ␮g/ml), and indomethacin (0.1 ␮M). Indomethacin was added separately to media on the
day of the starvation treatment. After 2 h at 37°C, cells were transfected with either Stealth RNAi negative control duplexes (Invitrogen) as a control for sequence-independent effects or with a combination of the four selected Stealth RNAi siRNA duplexes targeting
C6orf176. siRNA-containing mixtures were added drop-wise to tubes
containing Lipofectamine 2000 and incubated for 30 min at room
temperature. Subsequently, the solutions were added drop-wise to the
dishes containing hCSM cells in starvation medium followed by
incubation at 37°C for 46 h. Then the medium was exchanged with
incubation medium containing high-glucose DMEM, D-valine, 1%
antibiotic/antimycotic, transferrin (4 ␮g/ml), and the EP2 agonist
AGN007 (0.2 ␮M). Following incubation at 37°C for 2 h, total RNA
from hCSM cells was extracted as described above. C6orf176 knockdown efficiency was monitored by qRT-PCR using the commercially
available C6orf176-specific primer and probe set (TaqMan Gene
Expression Assay Hs00293257_m1; Applied Biosystems). Other predesigned TaqMan Gene Expression Assays that were used to evaluate
effects of C6orf176 knock-down on gene expression of selected downstream cAMP signaling-responsive genes identified previously (19) are
shown in Table 2. Quantitative real-time RT-PCR analysis was performed as described above based on RNA materials derived from three
biologically independent experiments.
155
156
C6orf176, A NOVEL GENE INVOLVED IN cAMP SIGNALING
signaling-inducing agents (PGE2, BW 245C, carbacyclin, forskolin), in addition to our EP2 and EP4 agonists, also substantially upregulated C6orf176 tv1 gene expression (Fig. 2).
Those agents that activate other signaling pathways did not
upregulate C6orf176 tv1 transcript levels (brimonidine tartrate)
or only minimally (PGF2␣, 3.1 ⫾ 0.9; U46619, 17.0 ⫾ 9.2;
and QDC, 1.9 ⫾ 0.5).
Next we evaluated a subset of compounds (AGN007,
AGN008, PGF2␣, carbacyclin, QDC, and forskolin) in respect
to C6orf176 tv1 transcript levels in two other ocular cell lines,
the trabecular meshwork (TM86) and retinal pigment epithelial
(ARPE-19) cell lines. Results for 2 h treatments are shown in
Table 3, compared with data obtained with hCSM cells. Substantial transcriptional upregulation of C6orf176 tv1 was also
observed in TM86 cells in response to cAMP signal-inducing
agents. For the EP2 agonist, average Ct values (⫾ SE) were
22.8 ⫾ 0.3, and 23.2 ⫾ 0.5 for the EP4 agonist. However, in
TM86 cells, upregulation by the EP4 agonist appeared less
pronounced than with the EP2 agonist, possibly due to lower
EP4 receptor cell surface densities in TM86 cells. In ARPE-19
cells, exposure to cAMP signal-inducing agents resulted in
less-pronounced C6orf176 tv1 upregulation. Interestingly in
this cell line, a clear difference in responses was seen between
Table 3. qRT-PCR-based profiling of C6orf176 tv1 transcriptional regulation across ocular cell lines in response to
various drugs
TM861 Fold Change
hCSM2 Fold Change
ARPE-19 Fold Change
Agent
AVG ⫾ SE
P Value
AVG ⫾ SE
P Value
AVG ⫾ SE
P Value
AGN007
AGN008
PGF2␣
Carbacyclin
QDC
Forskolin
2,626.0 ⫾ 428.5
1,980.6 ⫾ 660.6
1.3 ⫾ 0.3
1,267.3 ⫾ 176.9
1.6 ⫾ 0.9
2,978.0 ⫾ 647.6
***
**
114.2 ⫾ 49.2
714.9 ⫾ 25.8
1.0 ⫾ 0.0
6.1 ⫾ 2.4
0.9 ⫾ 0.2
1,113.9 ⫾ 192.1
**
***
2,609.7 ⫾ 298.1
3,876.7 ⫾ 1154.2
3.1 ⫾ 0.9
5005.7 ⫾ 104.3
1.9 ⫾ 0.5
4,499.5 ⫾ 133.8
***
***
**
***
*
***
***
***
**
***
All agents were used at a 1 ␮M concentration, with the exception of AGN007 and AGN008, which were at 0.2 ␮M, as well as forskolin, which was at 5 ␮M.
Average ratios (treated vs. untreated) and SE are displayed. P values are based on 2-sided 2-sample Student’s t-tests for the null hypothesis of no difference:
*for ⱕ0.05 (statistically significant), ** for ⱕ0.01 (statistically highly significant), and *** for ⱕ0.001 (statistically extremely significant).1C6orf176 tv1
expression in untreated TM86 cells was undetectable within 40 qRT-PCR cycles of amplification; for calculation purposes, a conservative Ct of 34 cycles was
used as cut-off. 2Data for human ciliary smooth muscle (hCSM) cells are from a separate experiment.
Physiol Genomics • doi:10.1152/physiolgenomics.00089.2011 • www.physiolgenomics.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
Fig. 2. Profiling of C6orf176 tv1 transcriptional regulation in hCSM cells
subsequent to stimulation by various agents for 2 h. All agents were used at a
1 ␮M concentration, with the exception of forskolin, which was at 5 ␮M.
Average ratios (treated vs. untreated) and SE as determined by real-time
RT-PCR analysis are shown (triplicate analysis). P values are based on 2-sided
2-sample Student’s t-tests for the null hypothesis of no difference: * for ⱕ 0.05
(statistically significant), ** for ⱕ 0.01 (statistically highly significant), and
*** for ⱕ 0.001 (statistically extremely significant).
the EP2 and EP4 agonists, as well as a rather modest response
to carbacyclin stimulation.
Using real-time RT-PCR we found that receptor transcript
levels overall correlated with the magnitude of C6orf176 tv1
transcriptional upregulation. The following rank order of receptor
expression within the cell types tested was established: TM ⬎
CSM ⬎⬎ ARPE-19 ⬎ HEK-293 for the EP2 receptor, and
CSM ⬃ TM ⬎ ARPE-19 ⬎⬎ HEK-293 for the EP4 receptor.
Inducibility of C6orf176 transcript variants and two genes in
antisense orientation subsequent to cAMP signaling. To evaluate expression of different known and putative C6orf176
transcript variants, as well as two nearby genes in antisense
orientation that partially overlap the transcribed C6orf176 exon
1 region, additional qRT-PCR primer and probe sets were
custom-designed (Table 1). These include primer and probe
sets to monitor transcription of C6orf176 tv2 (set a), a putative alternatively spliced exon (set b) based on expressed
sequence tag sequence information, and an Image cDNA
clone (accession number: CB985684), the hypothetical gene
LOC441177 based on an Image cDNA clone (accession number: BC110806) in antisense orientation that partially overlaps
the transcribed C6orf176 exon 1 region (set c), and another
putative gene in antisense orientation (hmm409034) located
⬃3.5 kb further upstream (set d).
Table 4 shows results from real-time RT-PCR experiments
performed on total RNA obtained from the “drug profiling” studies described above at the 2 h time point using primary cultures of
hCSM cells. Agents that are able to activate the cAMP signaling
pathway (EP2 and EP4 agonists, carbacyclin, forskolin) induced
transcription in a qualitatively similar fashion, albeit to a lesser
degree, than observed with the commercially available primer and
probe set for C6orf176, which monitors tv1. This includes the two
genes expressed in antisense orientation (sets c and d). Thus,
concomitant upregulation of LOC441177, whose transcription
start site lies within the transcribed C6orf176 exon 1 region in
antisense orientation, allows dsRNA formation within the overlap.
Inducible presence of the putative alternatively spliced exon
(monitored with set b) confirms the existence of an additional
transcript variant. The substantial transcriptional upregulation at
or near the C6orf176 gene locus is likely due to presence of a large
number of CREB binding sites (CRE). The multiple CRE full-site
and half-site sequences (29) identified within the promoter region
as well as the transcribed C6orf176 gene locus, including intragenic regions, are summarized in Table 5.
157
C6orf176, A NOVEL GENE INVOLVED IN cAMP SIGNALING
Table 4. qRT-PCR-based profiling of transcriptional activity in response to various drugs at and near the C6orf176 gene
locus in hCSM cells
Set a Fold Change
Set b Fold Change
Set c Fold Change
Set d Fold Change
Agent
AVG ⫾ SE
P Value
AVG ⫾ SE
P Value
AVG ⫾ SE
P Value
AVG ⫾ SE
P Value
AGN007
AGN008
PGF2a
Carbacyclin
QDC
Forskolin
1,213.0 ⫾ 204.3
1,937.9 ⫾ 886.4
2.8 ⫾ 0.8
2,047.5 ⫾ 802.4
1.4 ⫾ 0.3
2,115.8 ⫾ 998.7
***
*
**
**
605.5 ⫾ 117.3
768.8 ⫾ 133.8
1.9 ⫾ 0.3
1,872.4 ⫾ 394.9
1.1 ⫾ 0.3
1,750.7 ⫾ 507.8
**
**
**
***
500.3 ⫾ 111.5
951.3 ⫾ 281.2
1.2 ⫾ 0.4
877.1 ⫾ 106.5
n/c
1,038.8 ⫾ 149.3
***
**
141.1 ⫾ 57.4
95.2 ⫾ 19.0
1.0 ⫾ 0.3
100.8 ⫾ 47.3
n/c
147.2 ⫾ 54.5
*
***
*
***
***
***
*
**
All agents were used as described in Table 1. Average ratios (treated vs. untreated), SE, and P values are displayed. Primer and probe sets monitor transcription
of C6orf176 tv2 (set a), a putative alternatively spliced exon (set b), LOC441177 (set c), and hmm409034 (set d). n/c, Nonconclusive.
Identification of novel C6orf176 transcript variants by sequencing of cDNA clones obtained from a cDNA library
screen. To elucidate the identity of inducible C6orf176 transcripts, a cDNA library was constructed based on mRNA
extracted from hCSM cells after 2 h treatment with the EP2
Table 5. cAMP-response element binding protein binding
sites within the C6orf176 genomic locus
CRE Full Sites
(conserved)
(1 mismatch)
CRE Half Sites
(conserved)
Promotor region
3048
26499
⫺1745
⫺160
⫺88
C6orf176 transcribed region
1095
9560
14315
14831
19720
20753
25352
34659
37912
39139
43254
43535
44529
46572
53806
55334
55470
62282
⫺2070
⫺163
⫺88
493
2462
3048
9372
18008
19474
22024
22989
24087
26499
29023
33727
35888
36540
40922
43538
48325
57039
58567
cAMP-response element binding protein binding (CRE) full-site (TGACGTCA)
and half-site (TGACG/CGTCA) sequences identified are listed in relative position to
the start of C6orf176 tv1 and tv2. We analyzed 9 kb of promoter context sequence as
well as 65 kb of the transcribed C6orf176 gene locus. For CRE full sites, 1 mismatch
was allowed.
Fig. 3. Northern blot analysis of C6orf176 mRNA expression in response to
EP2 agonist treatment for 2 h. Lane 1 (⫺), HEK-293Naïve cells treated with
DMSO; lane 2 (⫹), HEK-293/hEP2 cells treated with 0.2 ␮M AGN007. The
results of C6orf176 and GAPDH Northern blot hybridizations are shown. The
GAPDH RNA serving as loading and constitutively expressed control is shown
at the bottom. Sizes of 2 RNA molecular weight markers used in the experiment are shown on the left; estimated sizes of detectable C6orf176 transcript
variants are shown on the right.
Physiol Genomics • doi:10.1152/physiolgenomics.00089.2011 • www.physiolgenomics.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
Identification of multiple inducible C6orf176 transcript variants by Northern blot analysis. To examine the effect of
human EP2 receptor stimulation on the induction of
C6orf176 expression, HEK-293/hEP2 were treated with the
EP2 agonist AGN007 for 2 h. Northern blot analysis using
a C6orf176 exon 1-specific radioactive antisense probe
revealed induction of several C6orf176 transcript variants of
various length and abundance (Fig. 3). Three major variants
of ⬃3.5, 3, and 1.1 kb were observed, the 3.5 kb long
transcript variant being the predominant one. Additional
bands corresponding to transcript variants of ⬃10, 7, 5.5, 5,
and 4.5 kb were also seen. In HEK-293Naïve control cells
treated with DMSO, no C6orf176 transcripts were detected
in this Northern blot analysis.
158
C6orf176, A NOVEL GENE INVOLVED IN cAMP SIGNALING
agonist AGN007. Colony hybridization of the cDNA library
using a C6orf176 exon 1-specific 32P-labeled probe identified
positive cDNA clones (Fig. 4), including one C6orf176 tv1,
two clones of tv1 with a 61 nt extended 5= sequence, as well as
a new, 1,675 nt long transcript variant (termed tv3) that uses an
alternate exon in its 3=-end. Tv3 maps ⬃2 kb downstream of
the alternate exon used by tv2, extending the transcribed
C6orf176 genomic locus to ⬃67 kb.
Identification of modulation of expression of cAMP signaling-responsive genes due to siRNA-mediated knock-down of
C6orf176. RNAi was used to evaluate effects of C6orf176 gene
silencing in presence of the EP2 agonist AGN007 (0.2 ␮M, 2
h) in hCSM cells. A combination of gene-specific siRNA
duplexes was selected and compared with unrelated negative
control duplexes. C6orf176 silencing efficiency was 77%
(0.23-fold change) in EP2 agonist-treated cells as determined
by quantitative real-time RT-PCR analysis. Transcript levels of
beta-actin and GAPDH control housekeeping genes were es-
sentially unaffected. Average Ct and calculated fold change
values are given in Table 6.
To evaluate a possible regulatory role of C6orf176 in cAMPmediated gene expression, the effect of C6orf176 gene silencing upon transcript levels of several other genes, selected from
a small group of downstream cAMP signaling-responsive
genes identified previously (19), was then investigated using
qRT-PCR. Six genes were identified, out of 27 analyzed, that
revealed a statistically significant modulation of their expression levels due to the knock-down of C6orf176 (Table 7).
These included the transcription factors NR4A3 and NR4A1,
(nuclear receptor subfamily 4, group A, member 1 and 3,
respectively), the osmolarity regulator AVPI1 (arginine vasopressin-induced 1), the extracellular matrix (ECM)-associated
cell adhesion gene CRISPLD2 (cysteine-rich secretory protein
LCCL domain containing 2), the ECM remodeling factor
CHST6 [carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6], as well as a novel gene of unknown function,
Table 6. Downregulation of C6orf176 gene expression due to RNAi-mediated gene silencing
Fold Change due to
Knock-down
Gene
Description
Negative Control siRNA Duplexes,
AVG Ct ⫾ SE
C6orf176-specific siRNA Duplexes,
AVG Ct ⫾ SE
AVG ⫾ SE
P Value
C6orf176
ACTB
GAPDH
chromosome 6 open reading frame 176
actin, beta
glyceraldehyde-3-phosphate dehydrogenase
22.9 ⫾ 1.1
17.6 ⫾ 0.9
15.8 ⫾ 0.4
25.2 ⫾ 1.2
17.7 ⫾ 0.9
15.7 ⫾ 0.4
0.23 ⫾ 0.03
0.95 ⫾ 0.09
1.05 ⫾ 0.09
***
Average threshold cycle (AVG Ct) values were determined by quantitative real-time RT-PCR for C6orf176 tv1 as well as beta-actin and GAPDH housekeeping
genes in hCSM cells. Cells were exposed to the EP2 agonist AGN007 (0.2 ␮M; 2 h) after transfection with either negative control siRNA duplexes or
C6orf176-specific siRNA duplexes. Fold change calculations of gene expression ratios due to knock-down (C6orf176-specific siRNA duplexes vs. unrelated
negative control duplexes) are based on 3 independent experiments. Average ratios (AVG) of treated vs. control samples as well as SE are displayed. P values
are based on 2-sided 2-sample Student’s t-tests for the null hypothesis of no difference: ***for ⱕ0.001 (statistically extremely significant).
Physiol Genomics • doi:10.1152/physiolgenomics.00089.2011 • www.physiolgenomics.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
Fig. 4. Novel C6orf176 transcript variant sequences identified from a cDNA library
screen. Novel C6orf176 exon sequences are
in boldface, the common exon 1 sequence is
in italics, and observed single nucleotide
polymorphisms are depicted in underlined
lowercase. A: 61 nt 5=-sequence extension of
tv1 observed in 2 clones. B: C6orf176 tv3 that
uses an alternate 1,145 nt exon in its 3=-end,
carrying a single nucleotide polymorphism,
A¡G, at position 935. (A 1-nucleotide 5=extension and 1 single nucleotide polymorphism, A¡T, at position 17, were uniformly
seen in all sequences obtained.)
159
C6orf176, A NOVEL GENE INVOLVED IN cAMP SIGNALING
Table 7. Transcriptional upregulation of cAMP signaling-responsive genes due to C6orf176 knock-down
Fold Change due to
Knock-down
Gene
Description
Category/Function
AVG ⫾ SE
P Value
NR4A3
NR4A1
AVPI1
CRISPLD2
CHST6
C13orf33
nuclear receptor subfamily 4, group A, member 3
nuclear receptor subfamily 4, group A, member 1
arginine vasopressin-induced 1
cysteine-rich secretory protein LCCL domain containing 2
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6
chromosome 13 open reading frame 33
transcription factor
transcription factor
osmolarity regulator
ECM adhesion molecule
ECM remodeling factor
unknown
2.0 ⫾ 0.4
1.7 ⫾ 0.2
2.0 ⫾ 0.6
1.8 ⫾ 0.3
2.4 ⫾ 0.6
2.4 ⫾ 0.8
**
**
*
**
**
**
C13orf33 (chromosome 13 open reading frame 33). The previously observed transcriptional upregulation subsequent to
EP2 agonist exposure was confirmed in cells transfected with
the negative control siRNA duplexes (data not shown). For the
genes identified, knock-down of C6orf176 resulted in a modest
additional transcriptional upregulation (between 1.4- and 3.4fold), consistent with a possible negative regulatory function of
C6orf176 upon expression of those genes (direct or indirect).
DISCUSSION
Previous microarray- and qRT-PCR-based gene regulation
profiling experiments identified C6orf176 as the most highly
upregulated gene in hCSM cells following treatment with
either EP2 (AGN007) and EP4 (AGN008) agonists and established that the cAMP pathway is the most important one in
hCSM cells subsequent to EP2 and EP4 receptor stimulation
(19). Systematic time course experiments over a 24 h period
identified the highest upregulation of C6orf176 at the 2 h time
point (⬃2,600- and ⬃3,900-fold, respectively), monitoring
expression levels of tv1 by qRT-PCR. The rapid and pronounced transcriptional upregulation followed by a brisk decline to elevated baseline transcript levels resembles kinetics of
early response genes that are often transcription (co-)factors
that have regulatory function upon expression of downstream
genes. C6orf176 transcript levels remained significantly upregulated at the 6, 10, and 24 h time points, reflecting the
continuous exposure to the EP2 or EP4 agonists.
C6orf176 tv1 transcriptional upregulation was more pronounced in response to the EP4 agonist than to the EP2 agonist
in hCSM and ARPE-19 cells, which correlates with relative
receptor transcript levels. In TM86 cells, the EP4 agonist
upregulated C6orf176 less than the EP2 agonist, also reflecting
receptor transcript levels. Other agents known to activate the
cAMP signaling pathway also sharply induced C6orf176 transcription.
Furthermore, we have identified multiple C6orf176 transcript variants in HEK-293/hEP2 cells following stimulation of
the EP2 receptor. After treatment with the EP2 agonist
AGN007, at least 10 discernible bands were observed, in
addition to signals suggestive of transcripts of variable length
possibly due to the existence of putative alternative transcription start sites (or regions). The official tv1 has a length of
1,832 bp and is recognizable as part of the signal area corresponding to RNA sizes between 1.5 and 2.5 kb in length; tv2
has a length of 1,123 bp and is detectable as a major band on
the film.
Existence of additional inducible transcript variants subsequent to EP2 agonist treatment and cAMP signaling may
challenge NCBI’s reclassification of the C6orf176 gene as a
purely ncRNA. Sequence analysis of new transcript variants
identified existence of additional ORFs and corresponding
protein candidates that might be able to serve as future drug
targets to manipulate the cAMP signaling pathway. Existence
of any of those protein candidates, however, requires experimental verification, particularly as translation start sites are not
embedded within canonical Kozak consensus sequence environments.
Using qRT-PCR we evaluated consequences of RNAi-based
C6orf176 gene silencing. We selected several genes, putative
key players mediating physiological IOP-lowering effects,
from a larger group of downstream cAMP signaling-responsive
genes identified previously (19) for analysis. However, presumably due to prevalence of very high transcript levels
subsequent to EP2 agonist treatment, C6orf176 silencing efficiency was significant but incomplete (77%). Nevertheless, for
six genes (including the osmolarity regulator AVPI1, the ECM
adhesion molecule CRISPLD2, and the ECM remodeling factor CHST6), knock-down of C6orf176 resulted in a modest
additional transcriptional upregulation between 1.4- and 3.4fold. This observation establishes proof-of-principle for a possible regulatory function of C6orf176 upon expression of genes
that are part of cell type-specific networks mediating physiological effects in response to cAMP signaling.
Reclassified by NCBI as an ncRNA, C6orf176 belongs to a
new class of functional transcripts emerging as important
negative or positive regulators of gene expression in many
organisms. Recent transcriptomic and bioinformatic studies
have identified a surprisingly large number of ncRNAs in
eukaryotic cells and suggest existence of thousands of ncRNAs
within the human genome (1, 2, 5, 14, 25). The observed
transcript sizes categorize C6orf176 transcripts as long
ncRNAs, which, for example, have been shown to be involved
in epigenetic regulation, such as the 2.2 kb long noncoding
(lnc) RNA termed HOTAIR (20). C6orf176 appears to exert a
negative regulatory effect upon expression of the target genes
identified subsequent to RNAi-based C6orf176 gene silencing.
Although unexpected given the early induction of C6orf176
expression due to cAMP signaling pathway activation, it may
Physiol Genomics • doi:10.1152/physiolgenomics.00089.2011 • www.physiolgenomics.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
Quantitative real time RT-PCR analysis was performed for each gene of interest in hCSM cells based on RNA materials derived from 3 biologically
independent experiments. Fold changes of gene expression were calculated subsequent to knock-down of C6orf176 (C6orf176-specific siRNA duplexes vs.
unrelated negative control duplexes) in presence of the EP2 agonist AGN007 (0.2 ␮M; 2 h). Average ratios (AVG) of knock-down vs. control samples, SE, as
well as P values are displayed.
160
C6orf176, A NOVEL GENE INVOLVED IN cAMP SIGNALING
ACKNOWLEDGMENTS
We thank Richard Siles, Mahmud Penjwini, and Hong Tang for help with
cell culture and real-time RT-PCR experiments, as well as Dr. Alissar Nehme
(Allergan) for sharing the TM86 cells, which were originally obtained from Dr.
W. Daniel Stamer’s lab (Department of Ophthalmology and Vision Science,
University of Arizona).
2.
DISCLOSURES
Armin Reitmair, Wha Bin Im, and Larry Wheeler are employed by
Allergan,Inc.
3.
4.
AUTHOR CONTRIBUTIONS
Author contributions: A.R., G.S., W.B.I., and L.A.W. conception and
design of research; A.R. performed experiments; A.R. analyzed data; A.R. and
G.S. interpreted results of experiments; A.R. prepared figures; A.R. drafted
manuscript; A.R., G.S., and W.B.I. edited and revised manuscript; G.S.
approved final version of manuscript.
5.
6.
REFERENCES
1. Birney E, Stamatoyannopoulos JA, Dutta A, Guigo R, Gingeras TR,
Margulies EH, Weng Z, Snyder M, Dermitzakis ET, Thurman RE,
Kuehn MS, Taylor CM, Neph S, Koch CM, Asthana S, Malhotra A,
Adzhubei I, Greenbaum JA, Andrews RM, Flicek P, Boyle PJ, Cao H,
Carter NP, Clelland GK, Davis S, Day N, Dhami P, Dillon SC,
Dorschner MO, Fiegler H, Giresi PG, Goldy J, Hawrylycz M, Haydock A, Humbert R, James KD, Johnson BE, Johnson EM, Frum TT,
Rosenzweig ER, Karnani N, Lee K, Lefebvre GC, Navas PA, Neri F,
Parker SC, Sabo PJ, Sandstrom R, Shafer A, Vetrie D, Weaver M,
Wilcox S, Yu M, Collins FS, Dekker J, Lieb JD, Tullius TD, Crawford
GE, Sunyaev S, Noble WS, Dunham I, Denoeud F, Reymond A,
Kapranov P, Rozowsky J, Zheng D, Castelo R, Frankish A, Harrow J,
Ghosh S, Sandelin A, Hofacker IL, Baertsch R, Keefe D, Dike S,
Cheng J, Hirsch HA, Sekinger EA, Lagarde J, Abril JF, Shahab A,
Flamm C, Fried C, Hackermuller J, Hertel J, Lindemeyer M, Missal
K, Tanzer A, Washietl S, Korbel J, Emanuelsson O, Pedersen JS,
Holroyd N, Taylor R, Swarbreck D, Matthews N, Dickson MC,
Thomas DJ, Weirauch MT, Gilbert J, Drenkow J, Bell I, Zhao X,
Srinivasan KG, Sung WK, Ooi HS, Chiu KP, Foissac S, Alioto T,
Brent M, Pachter L, Tress ML, Valencia A, Choo SW, Choo CY, Ucla
7.
8.
9.
10.
11.
12.
C, Manzano C, Wyss C, Cheung E, Clark TG, Brown JB, Ganesh M,
Patel S, Tammana H, Chrast J, Henrichsen CN, Kai C, Kawai J,
Nagalakshmi U, Wu J, Lian Z, Lian J, Newburger P, Zhang X, Bickel
P, Mattick JS, Carninci P, Hayashizaki Y, Weissman S, Hubbard T,
Myers RM, Rogers J, Stadler PF, Lowe TM, Wei CL, Ruan Y, Struhl
K, Gerstein M, Antonarakis SE, Fu Y, Green ED, Karaoz U, Siepel A,
Taylor J, Liefer LA, Wetterstrand KA, Good PJ, Feingold EA, Guyer
MS, Cooper GM, Asimenos G, Dewey CN, Hou M, Nikolaev S,
Montoya-Burgos JI, Loytynoja A, Whelan S, Pardi F, Massingham T,
Huang H, Zhang NR, Holmes I, Mullikin JC, Ureta-Vidal A, Paten B,
Seringhaus M, Church D, Rosenbloom K, Kent WJ, Stone EA,
Batzoglou S, Goldman N, Hardison RC, Haussler D, Miller W, Sidow
A, Trinklein ND, Zhang ZD, Barrera L, Stuart R, King DC, Ameur A,
Enroth S, Bieda MC, Kim J, Bhinge AA, Jiang N, Liu J, Yao F, Vega
VB, Lee CW, Ng P, Yang A, Moqtaderi Z, Zhu Z, Xu X, Squazzo S,
Oberley MJ, Inman D, Singer MA, Richmond TA, Munn KJ, RadaIglesias A, Wallerman O, Komorowski J, Fowler JC, Couttet P, Bruce
AW, Dovey OM, Ellis PD, Langford CF, Nix DA, Euskirchen G,
Hartman S, Urban AE, Kraus P, Van Calcar S, Heintzman N, Kim
TH, Wang K, Qu C, Hon G, Luna R, Glass CK, Rosenfeld MG,
Aldred SF, Cooper SJ, Halees A, Lin JM, Shulha HP, Xu M, Haidar
JN, Yu Y, Iyer VR, Green RD, Wadelius C, Farnham PJ, Ren B,
Harte RA, Hinrichs AS, Trumbower H, Clawson H, Hillman-Jackson
J, Zweig AS, Smith K, Thakkapallayil A, Barber G, Kuhn RM,
Karolchik D, Armengol L, Bird CP, de Bakker PI, Kern AD, LopezBigas N, Martin JD, Stranger BE, Woodroffe A, Davydov E, Dimas A,
Eyras E, Hallgrimsdottir IB, Huppert J, Zody MC, Abecasis GR,
Estivill X, Bouffard GG, Guan X, Hansen NF, Idol JR, Maduro VV,
Maskeri B, McDowell JC, Park M, Thomas PJ, Young AC, Blakesley
RW, Muzny DM, Sodergren E, Wheeler DA, Worley KC, Jiang H,
Weinstock GM, Gibbs RA, Graves T, Fulton R, Mardis ER, Wilson
RK, Clamp M, Cuff J, Gnerre S, Jaffe DB, Chang JL, Lindblad-Toh
K, Lander ES, Koriabine M, Nefedov M, Osoegawa K, Yoshinaga Y,
Zhu B, de Jong PJ. Identification and analysis of functional elements in
1% of the human genome by the ENCODE pilot project. Nature 447:
799 –816, 2007.
Cheng J, Kapranov P, Drenkow J, Dike S, Brubaker S, Patel S, Long
J, Stern D, Tammana H, Helt G, Sementchenko V, Piccolboni A,
Bekiranov S, Bailey DK, Ganesh M, Ghosh S, Bell I, Gerhard DS,
Gingeras TR. Transcriptional maps of 10 human chromosomes at 5-nucleotide resolution. Science 308: 1149 –1154, 2005.
Cho-Chung YS. cAMP signaling in cancer genesis and treatment. Cancer
Treat Res 115: 123–143, 2003.
Cho-Chung YS, Nesterova M, Becker KG, Srivastava R, Park YG,
Lee YN, Cho YS, Kim MK, Neary C, Cheadle C. Dissecting the
circuitry of protein kinase A and cAMP signaling in cancer genesis:
antisense, microarray, gene overexpression, and transcription factor decoy.
Ann NY Acad Sci 968: 22–36, 2002.
Costa FF. Non-coding RNAs: new players in eukaryotic biology. Gene
357: 83–94, 2005.
Costes S, Broca C, Bertrand G, Lajoix AD, Bataille D, Bockaert J,
Dalle S. ERK1/2 control phosphorylation and protein level of cAMPresponsive element-binding protein: a key role in glucose-mediated pancreatic beta-cell survival. Diabetes 55: 2220 –2230, 2006.
Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, Huarte
M, Zuk O, Carey BW, Cassady JP, Cabili MN, Jaenisch R, Mikkelsen
TS, Jacks T, Hacohen N, Bernstein BE, Kellis M, Regev A, Rinn JL,
Lander ES. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature 458: 223–227, 2009.
He Y, Vogelstein B, Velculescu VE, Papadopoulos N, Kinzler KW. The
antisense transcriptomes of human cells. Science 322: 1855–1857, 2008.
Ichiki T. Role of cAMP response element binding protein in cardiovascular remodeling: good, bad, or both? Arterioscler Thromb Vasc Biol 26:
449 –455, 2006.
Jansson D, Ng AC, Fu A, Depatie C, Al Azzabi M, Screaton RA.
Glucose controls CREB activity in islet cells via regulated phosphorylation of TORC2. Proc Natl Acad Sci USA 105: 10161–10166, 2008.
Jhala US, Canettieri G, Screaton RA, Kulkarni RN, Krajewski S,
Reed J, Walker J, Lin X, White M, Montminy M. cAMP promotes
pancreatic beta-cell survival via CREB-mediated induction of IRS2.
Genes Dev 17: 1575–1580, 2003.
Kiyosawa H, Yamanaka I, Osato N, Kondo S, Hayashizaki Y. Antisense transcripts with FANTOM2 clone set and their implications for gene
regulation. Genome Res 13: 1324 –1334, 2003.
Physiol Genomics • doi:10.1152/physiolgenomics.00089.2011 • www.physiolgenomics.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
be indicative of a negative feedback loop that fine-tunes the
expression response of downstream target genes. However, as
the subset of cAMP-responsive genes analyzed was small, a
possible role as transcription enhancer, which has been described for some lncRNAs (7, 16), cannot be ruled out.
Increasing numbers of natural sense-antisense transcript
pairs are being identified in a variety of prokaryotic and
eukaryotic organisms (12, 17, 26, 28). The distribution of
antisense transcripts is distinct from that of sense transcripts
and is nonrandom across the human genome and different
among cell types, which suggests that they are a fundamental
component of gene regulation (8). It is possible that different
transcript variants could mediate regulation of different gene
subsets that may be involved in mediating the IOP-lowering
effects via the uveo-scleral outflow path subsequent to EP2 and
EP4 receptor stimulation and activation of the cAMP signaling
pathway.
Whether C6orf176 transcript variants are in fact noncoding,
protein-coding, or a combination thereof awaits further experimental evidence, along with sequence identification of larger
transcripts variants as observed by Northern blot analysis.
C6orf176 should be useful as a biomarker, e.g., by measuring
expression levels in context with disease-dependent deregulation of the cAMP signaling pathway, as a novel drug target,
and/or as a model system for studying transcriptional regulation by chromatin and RNA polymerase II.
C6orf176, A NOVEL GENE INVOLVED IN cAMP SIGNALING
25.
26.
27.
28.
29.
way and long-term potentiation: reversibility by drugs that enhance cAMP
signaling. Proc Natl Acad Sci USA 99: 13217–13221, 2002.
Washietl S, Pedersen JS, Korbel JO, Stocsits C, Gruber AR, Hackermuller J, Hertel J, Lindemeyer M, Reiche K, Tanzer A, Ucla C,
Wyss C, Antonarakis SE, Denoeud F, Lagarde J, Drenkow J, Kapranov P, Gingeras TR, Guigo R, Snyder M, Gerstein MB, Reymond A,
Hofacker IL, Stadler PF. Structured RNAs in the ENCODE selected
regions of the human genome. Genome Res 17: 852–864, 2007.
Yamada K, Lim J, Dale JM, Chen H, Shinn P, Palm CJ, Southwick
AM, Wu HC, Kim C, Nguyen M, Pham P, Cheuk R, Karlin-Newmann
G, Liu SX, Lam B, Sakano H, Wu T, Yu G, Miranda M, Quach HL,
Tripp M, Chang CH, Lee JM, Toriumi M, Chan MM, Tang CC,
Onodera CS, Deng JM, Akiyama K, Ansari Y, Arakawa T, Banh J,
Banno F, Bowser L, Brooks S, Carninci P, Chao Q, Choy N, Enju A,
Goldsmith AD, Gurjal M, Hansen NF, Hayashizaki Y, JohnsonHopson C, Hsuan VW, Iida K, Karnes M, Khan S, Koesema E, Ishida
J, Jiang PX, Jones T, Kawai J, Kamiya A, Meyers C, Nakajima M,
Narusaka M, Seki M, Sakurai T, Satou M, Tamse R, Vaysberg M,
Wallender EK, Wong C, Yamamura Y, Yuan S, Shinozaki K, Davis
RW, Theologis A, Ecker JR. Empirical analysis of transcriptional activity in the Arabidopsis genome. Science 302: 842–846, 2003.
Yang S, Fransson U, Fagerhus L, Holst LS, Hohmeier HE, Renstrom
E, Mulder H. Enhanced cAMP protein kinase A signaling determines
improved insulin secretion in a clonal insulin-producing beta-cell line
(INS-1 832/13). Mol Endocrinol 18: 2312–2320, 2004.
Yelin R, Dahary D, Sorek R, Levanon EY, Goldstein O, Shoshan A,
Diber A, Biton S, Tamir Y, Khosravi R, Nemzer S, Pinner E, Walach
S, Bernstein J, Savitsky K, Rotman G. Widespread occurrence of
antisense transcription in the human genome. Nat Biotechnol 21: 379 –
386, 2003.
Zhang X, Odom DT, Koo SH, Conkright MD, Canettieri G, Best J,
Chen H, Jenner R, Herbolsheimer E, Jacobsen E, Kadam S, Ecker JR,
Emerson B, Hogenesch JB, Unterman T, Young RA, Montminy M.
Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc
Natl Acad Sci USA 102: 4459 –4464, 2005.
Physiol Genomics • doi:10.1152/physiolgenomics.00089.2011 • www.physiolgenomics.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.3 on June 17, 2017
13. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2[-delta delta C(T)] method.
Methods 25: 402–408, 2001.
14. Mattick JS, Makunin IV. Non-coding RNA. Hum Mol Genet 15, Spec
No. 1: R17–R29, 2006.
15. Mayr B, Montminy M. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat Rev Mol Cell Biol 2: 599 –609, 2001.
16. Orom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, Bussotti
G, Lai F, Zytnicki M, Notredame C, Huang Q, Guigo R, Shiekhattar
R. Long noncoding RNAs with enhancer-like function in human cells.
Cell 143: 46 –58, 2010.
17. Osato N, Yamada H, Satoh K, Ooka H, Yamamoto M, Suzuki K,
Kawai J, Carninci P, Ohtomo Y, Murakami K, Matsubara K, Kikuchi
S, Hayashizaki Y. Antisense transcripts with rice full-length cDNAs.
Genome Biol 5: R5, 2003.
18. Regan JW. EP2 and EP4 prostanoid receptor signaling. Life Sci 74:
143–153, 2003.
19. Reitmair A, Lambrecht N, Yakubov I, Nieves A, Old D, Donde Y,
Dinh D, Burk R, Sachs G, Im WB, Wheeler L. Prostaglandin E2
receptor subtype EP2- and EP4-regulated gene expression profiling in
human ciliary smooth muscle cells. Physiol Genomics 42: 348 –360, 2010.
20. Rinn JL, Kertesz M, Wang JK, Squazzo SL, Xu X, Brugmann SA,
Goodnough LH, Helms JA, Farnham PJ, Segal E, Chang HY. Functional demarcation of active and silent chromatin domains in human HOX
loci by noncoding RNAs. Cell 129: 1311–1323, 2007.
21. Stamer WD, Seftor RE, Williams SK, Samaha HA, Snyder RW.
Isolation and culture of human trabecular meshwork cells by extracellular
matrix digestion. Curr Eye Res 14: 611–617, 1995.
22. Sugimoto Y, Narumiya S. Prostaglandin E receptors. J Biol Chem 282:
11613–11617, 2007.
23. Tardito D, Perez J, Tiraboschi E, Musazzi L, Racagni G, Popoli M.
Signaling pathways regulating gene expression, neuroplasticity, and neurotrophic mechanisms in the action of antidepressants: a critical overview.
Pharmacol Rev 58: 115–134, 2006.
24. Vitolo OV, Sant’Angelo A, Costanzo V, Battaglia F, Arancio O,
Shelanski M. Amyloid beta-peptide inhibition of the PKA/CREB path-
161