Characterization of grapevine (Vitis vinifera L.) berry
cuticle for its role in water stress response
Chandra Shekhar Misra
Thesis to obtain the Master of Science Degree in
Biotechnology
Supervisors
Doctor Olfa Zarrouk
Professor Doctor Isabel Maria de Sá Correia Leite de Almeida
Examination Committee
Chairperson:
Doctor Leonilde Fatima Moreira Morais
Supervisor:
Doctor Olfa Zarrouk
Members of the Committee: Doctor Carla Pinheiro
Professor Maria Manuela Coelho Cabral Ferreira Chaves
November 2015
Abstract
This study aims at characterization of the grape berry cuticle (Vitis vinifera L.) subjected to two
irrigation regimes: sustained deficit irrigation (SDI) and regulated deficit irrigation (RDI), belonging from
two different sides of vine canopy (east and west). The analysis of the cuticular water permeance
showed no impact of different treatments in the transpiration of intact berries. However, in de-waxed
berries, permeance increased by 4-fold and RDIW showed significantly higher permeance suggesting
the role of cuticular waxes in the control of berry water loss. TEM analysis indicates the effect of water
deficit intensity and temperature on cuticle architecture by the increase of wax and pectin deposition.
ATR-FTIR of berry cuticle, skin and cutin revealed the presence of methylene, ester, aromatic and
polysaccharides groups. The mRNA expression pattern of seven cuticle related genes was analysed.
Deficit irrigation impacts the expression of only four genes. The up-regulation of VviLTP3 in RDIW
suggests the synergic effect of water and heat stresses in the stimulation of wax deposition at the
berry surface to deal with the high transpiration demand of stressed berries. The up-regulation of
VviCYP716A15 and VviCYP716A17, involved in triterpenoid biosynthesis, in the most stressed berries
pinpoint the possible role of triterpenoids in abiotic stress responses. Results herein presented are a
starting point for the understanding of the biology of grape berry fruit cuticle and could be vital for
future viticultural managements.
Keywords: Attenuated Total Reflectance - Fourier Transform Infrared Spectroscopy (ATR-FTIR); heat
stress; regulated deficit irrigation (RDI); sustained deficit irrigation (SDI); Transmission electron
microscopy (TEM).
i
Resumo
O presente estudo visa a caracterização da cutícula da uva (Vitis vinifera L.) provenientes de
diferentes lados da planta (este/oeste) e submetida a dois diferentes sistemas de rega: rega
deficitária sustentável (SDI) e rega deficitária regulada (RDI). A análise da permeabilidade da cutícula
mostrou o impacto dos diferentes tratamentos na transpiração dos bagos intactos. Quando as ceras
foram removidas, a permeabilidade aumentou 4 vezes sugerindo o papel das ceras cuticulares como
uma barreira eficaz para o controlo da perda da água por transpiração. As análises da TEM indicaram
o efeito da intensidade do déficit hídrico e da temperatura na arquitectura da cutícula, com o aumento
da deposição das ceras e pectinas. O estudo ATR-FTIR da cutícula isolada, da pele e da cutina
mostrou a presença de grupos metileno, éster, aromáticos e polissacáridos. Os resultados mostraram
o efeito da rega deficitária só no perfil de expressão de quatro genes. A sobreexpressão do VviLTP3
no RDIW sugere o efeito do stress hídrico e da temperatura na estimulação da deposição das ceras
como medida de controlo da alta demanda tranpiracional das uvas sugeitas a stress.A
sobreexpressão dos genes VviCYP716A15 e VviCYP716A17 envolvidos na biossíntese dos
triterpenos, nos bagos sujeitos a stress, aponta o possível papel dos triterpenos na resposta ao stress
abiótico. O presente trabalho servirá de ponto de partida para a compreensão da biologia da cutícula
no bago da uva. Além disso, a presente investigação acrescenta mais informação nos efeitos das
técnicas vitícolas, na qualidade da uva e do vinho.
Palavras-chave: Attenuated Total Reflectance - Fourier Transform Infrared Spectroscopy (ATRFTIR); stress do calor; rega deficitária regulada (RDI); rega deficitária sustentável (SDI); microscopia
electrónica de transmissão (TEM).
ii
Acknowledgements
This project would not have been executed or written without the assistance and support of many
groups and individuals. I place on record my profound sense of gratitude and indebtedness to my
supervisor, Dr. Olfa Zarrouk for the incredible inspiration, valuable and pain taking guidance,
encouragement, untiring and constant help and above all her positive attitude towards my abilities
which made the achievement of this goal- a challenging, enjoyable, rewarding and stimulating
experience. My deep regard and reverence for her would remain preserved in my heart and would
always be grateful to her for kindly accepting me in her project. No vocabulary can suffice to document
my dues to her. I thank Prof. Dr. Maria Manuela Chaves, Group Leader, Molecular Ecophysiology Lab,
Instituto de Tecnologia Química e Biológica (ITQB) for giving me the opportunity to be associated with
her research group at ITQB.
I wish to thank my co-supervisor Prof. Dr. Isabel Sa-Correia for her immense support, assistance,
efforts and valuable directions and for facilitating all the administrative formalities.
I would like to record my thanks to all the faculty members and staff of IBB - Institute for Biotechnology
and Bioengineering at Instituto Superior Técnico (IST) for their moral and physical support and
inspiration throughout the course of master program.
I thank Dr. Dylan Kosma, University of Nevada, USA and Dr. Victoria Fernández, Technical University
of Madrid, Spain for their valuable guidance in identifying some of the important cuticle related
properties which helped to reach a comprehensive conclusion about my work. I would also like to
thank Electron Microscopy Facility at the Instituto Gulbenkian de Ciência, Oeiras, Portugal for timely
help in sample analysis for transmission electron microscopy. I also would like to thank Dr. Victoria
Fernández for helping us in the GC-MS analysis of our wax samples without which this project would
not be complete.
I would be failing badly if I do not accord my most sincere gratitude to Tania Genebra, my friend and
lab colleague who deserves a very special reference for all she meant to me and her kind help to me
throughout the laboratory experiments. Her valuable suggestions and advice at times were really
important for my experiment. My thanks are due to my friends and other colleagues for their help and
moral support extended during the course of my research work.
I cannot forget the help and assistance extended by Ana Pipio, Coordinator International Affairs Office
and Ana Barbosa, Núcleo de Mobilidade e Cooperação Internacional at Instituto Superior Técnico and
would like to thank them for making my stay in Portugal as convenient as possible.
I would also like to acknowledge the INNOVINE FP7-KBBE-2012-6 311775 project (2013-2017) for
their financial support and also the Erasmus Mundus HERITAGE program for sponsoring my Master
studies at IST.
iii
I am greatly indebted to my Beloved Parents and Grandmother who showered their love and affection
on me and without whose blessings and sacrifice I would never have had an opportunity to be
studying miles away from them still so close to them.
Place: Lisbon
Date: 24.11.2015
Chandra Shekhar Misra
iv
Table of Contents
Abstract .............................................................................................................................................. i
Resumo ............................................................................................................................................. ii
Acknowledgements ......................................................................................................................... iii
List of Figures .................................................................................................................................. ix
List of Tables.................................................................................................................................... xi
List of Abbreviations ...................................................................................................................... xii
1. Background and Introduction ......................................................................................................1
2. Review of Literature ......................................................................................................................3
2.1. Grapevine (Vitis vinifera L.).......................................................................................................3
2.1.1. Phenology of grapevine .....................................................................................................3
2.1.2. Role of plant phytohormone during grape berry ripening ....................................................4
2.2. Water deficit and grapevine ......................................................................................................5
2.2.1. Sustained deficit irrigation in grapevine ..............................................................................6
2.2.2. Regulated deficit irrigation in grapevine..............................................................................6
2.2.3. Effect of water deficit on berry ripening/quality ...................................................................7
2.3. Introduction to plant cuticle and its significance .........................................................................7
2.3.1. Role of cuticle as a barrier to water loss .............................................................................8
2.3.2. Cuticular Permeance .........................................................................................................8
2.4. Cuticle Structure, Biosynthesis and Assembly...........................................................................9
2.4.1. Composition and structure of cuticle ..................................................................................9
2.4.2. Biosynthesis and composition of cuticle components: waxes and cutin............................. 10
2.4.3. Biosynthesis and composition of cuticle components in grapevine.................................... 11
2.5. Architecture of plant cuticle ..................................................................................................... 13
2.5.1. Ultrastructure of grape berry cuticle ................................................................................. 13
2.6. Spectroscopic characterization of grapevine cuticle and its components ................................. 14
2.7. Genes implicated in fruit cuticle biosynthesis .......................................................................... 15
3. Research Objectives and Hypotheses ....................................................................................... 21
3.1. Research objectives: .............................................................................................................. 21
3.2. Research hypotheses ............................................................................................................. 21
4. Materials and Methods................................................................................................................ 22
v
4.1. Field conditions and plant material .......................................................................................... 22
4.2.Characterization of berry ......................................................................................................... 23
4.2.1. Determination of Total Soluble Solids (TSS) and Titrable Acidity (TA) .............................. 23
4.3. Characterization of cuticle ...................................................................................................... 23
4.3.1. Isolation of Cuticle ........................................................................................................... 23
4.3.2. Isolation of cuticle components ........................................................................................ 23
4.4. Determination of wax content ................................................................................................. 23
4.5. Determination of cuticular permeance..................................................................................... 24
4.6.Ultra-structure of cuticle using transmission electron microscopy ............................................. 24
4.7.Attenuated Total Reflectance - Fourier Transform Infrared Spectroscopy (ATR-FTIR).............. 25
4.8.Gene expression analysis........................................................................................................ 25
4.8.1. Extraction of RNA from grape berry cuticle....................................................................... 25
4.8.2. Purification of RNA .......................................................................................................... 26
4.8.3. Optimization of RNA extraction protocol ........................................................................... 26
4.8.4. DNA synthesis (RT-PCR) ................................................................................................ 27
4.8.5. Primer design .................................................................................................................. 27
4.8.6. Quantitative RT-PCR ....................................................................................................... 28
4.9.Statistical analysis ................................................................................................................... 29
5. Results......................................................................................................................................... 30
5.1.Grape berry characterization ................................................................................................... 30
5.2. Grape berry cuticle characterization........................................................................................ 31
5.2.1. Quantitative changes in the wax content .......................................................................... 31
5.2.2. Cuticular water permeability during grape berry fruit development .................................... 31
5.2.3. Ultra-structure of grape berry cuticle using transmission electron microscopy (TEM) ........ 32
5.2.3.1. Cuticle ...................................................................................................................... 37
5.2.3.2. Epicuticular waxes .................................................................................................... 37
5.2.3.3. Inner cuticle .............................................................................................................. 38
5.2.3.4. Cell wall .................................................................................................................... 38
5.2.3.5. Dark pectin like layer ................................................................................................. 38
5.2.4. Spectral characterization of cuticle, skin and cutin ............................................................ 39
vi
5.2.4.1. Spectroscopic characterization of cuticle ................................................................... 39
5.2.4.2. Spectroscopic characterization of skin....................................................................... 42
5.2.4.3. Spectroscopic characterization of cutin ..................................................................... 43
5.2.5. Expression profiling of cuticle related genes ..................................................................... 46
5.2.5.1. Expression level of VviKCS1 gene in the cuticle of grape berry during different
phenological stages ............................................................................................................... 46
5.2.5.2. Expression level of VviKCS6 gene in the cuticle of grape berry during different
phenological stages ............................................................................................................... 46
5.2.5.3. Expression level of VviGDSL gene in the cuticle of grape berry during different
phenological stages ............................................................................................................... 47
5.2.5.4. Expression level of VviCER9 gene in the cuticle of grape berry during different
phenological stages ............................................................................................................... 47
5.2.5.5. Expression level of VviLTP3 gene in the cuticle of grape berry during different
phenological stages ............................................................................................................... 48
5.2.5.6. Expression level of VviCYP716A15 gene in the cuticle of grape berry during different
phenological stages ............................................................................................................... 48
5.2.5.7. Expression level of VviCYP716A17 gene in the cuticle of grape berry during different
phenological stages ............................................................................................................... 49
6. Discussion................................................................................................................................... 50
6.1.Water deficit affects berry qualities .......................................................................................... 50
6.2. Water stress affects cuticular wax accumulation and cuticular permeability ............................. 50
6.3. Water deficit affects the architecture of berry cuticle ............................................................... 52
6.4. Water stress enhanced the deposition of epicuticular waxes and other protecting materials
(likely pectinaceous) ...................................................................................................................... 53
6.5. FTIR study of berry cuticle, skin and cutin............................................................................... 53
6.6. Water stress affects cuticle related gene expression ............................................................... 57
7. Conclusion .................................................................................................................................. 60
8. Future Prospects......................................................................................................................... 62
References ...................................................................................................................................... 63
Appendix I ....................................................................................................................................... 80
Appendix II ...................................................................................................................................... 81
vii
Appendix III ..................................................................................................................................... 82
Appendix IV ..................................................................................................................................... 83
Appendix V ...................................................................................................................................... 87
Appendix VI ..................................................................................................................................... 88
viii
List of Figures
Figure 1: Developmental Stages of grape berry development showing color changes in the berry,
o
compounds accumulation, Brix Level and rate of xylem phloem sap inflow (Coombe, 1973 illustration
by Jordan Koutroumanidis)..................................................................................................................4
Figure 2: Curves showing vegetative and reproductive growth of grapevine (Vitis vinifera)(Coombe
and McCarthy, 2000)...........................................................................................................................6
Figure 3: Schematic of a plant surface showing the major structural features of the cuticle and
underlying epidermal cell layer and representative model of cuticular wax secretion. ABC transporter,
ATP binding cassette transporter; CER5, ECERIFERUM 5; FAE, fatty acid elongase; LTP, lipid
transfer protein; WBC, WHITE-BROWN COMPLEX (Samuels et al., 2008). ...................................... 10
Figure 4: Overview of the cuticular wax and cutin biosynthesis. CER, ECERIFERUM; WSD, wax
synthase/diacylglycerol acyltransferase; MAH, mid-chain alkane hydroxylase (Yeats and Rose, 2013).
......................................................................................................................................................... 18
Figure 5: Grape berries sampled from four different phenological stages: pea size(a), véraison(b),
mid-ripening(c) and full maturation(d). ............................................................................................... 22
Figure 6: Wax content (µg.mm -2) for different phenological stages. SDI: Sustained Deficit Irrigation;
RDI: Regulated Deficit Irrigation. E- East; W- West. PS- pea size; V- Véraison; MR- Mid Ripening; FMFull Maturation. The values are represented as mean± SE. ............................................................... 31
Figure 7: Transmission electron micrographs of transverse sections of grape berry cuticle at pea size
(PS)- East (a), West (b). EW- Epicuticular Waxes; CW- Cell wall; IC-inner cuticle; C- Cuticle; P-Pectin
like material. Arrows indicate EW. Bar: 0.5 µm. ................................................................................. 33
Figure 8: Transmission electron micrographs of transverse sections of grape berry cuticle at véraison
(V)- SDIE (a), SDIW (b), RDIE (c), RDIW (d). EW- Epicuticular Waxes; CW- Cell wall; IC-inner cuticle;
C- Cuticle; P- Pectin like material. Arrows indicate EW. Bar: 0.5 µm .................................................. 34
Figure 9: Transmission electron micrographs of transverse sections of grape berry cuticle at midripening (MR)- SDIE (a), SDIW (b),RDIE (c), RDIW (d). EW- Epicuticular Waxes; CW- Cell wall; ICinner cuticle; C- Cuticle; P- Pectin like material. Arrows indicate EW. Bar: 0.5 µm.............................. 35
Figure 10: Transmission electron micrographs of transverse sections of grape berry cuticle at Full
maturation (FM)- SDIE (a), SDIW (b),RDIE (c), RDIW (d). EW- Epicuticular Waxes; CW- Cell wall; ICinner cuticle; C- Cuticle; P- Pectin like material. Arrows indicate EW. Bar: 0.5µm............................... 36
Figure 11: Epicuticular wax of the grape berries using transmission electron microscopy .................. 38
Figure 12: Attenuated Total Reflectance-Fourier Transform Infrared (ATR-FTIR) of inner and outer
side of cuticle. Pea size (a); Véraison(b); Mid ripening(c); Full maturation(d). SDI: Sustained Deficit
Irrigation; RDI: Regulated Deficit Irrigation. E- East; W- West. Red- SDIE; Blue- SDIW; Green- RDIE;
Black-RDI W. Continuous line shows inner side of the cuticle, shaded line is outer side of the cuticle.
Arrows indicate important peaks: (a) 2925 cm -1; (b) 1722 cm-1; (c) 1602 cm-1 (d) 1027 cm-1. A1-A4 in
legend of the FTIR spectra represents four phenological stages from Pea Size to Full Maturation
respectively....................................................................................................................................... 41
Figure 13: Attenuated Total Reflectance-Fourier Transform Infrared (ATR-FTIR) of skin of grape
berries (Vitis vinifera ,cv.Aragonez). Pea size (a); Véraison(b); Mid ripening(c); Full maturation(d). SDI:
ix
Sustained Deficit Irrigation; RDI: Regulated Deficit Irrigation. E- East; W- West. Red- SDIE; BlueSDIW; Green- RDIE; Black-RDI W. Spectra on the top is the enlarge view of the right panel in range of
900-1800 cm-1 characteristic of polysaccharides. A1-A4 in legend of the FTIR spectra represents four
phenological stages from Pea Size to Full Maturation respectively. ................................................... 43
Figure 14: Attenuated Total Reflectance-Fourier Transform Infrared(ATR-FTIR) of
depolymerised
cutin of grape berries(Vitis vinifera,cv.Aragonez ). Pea size (a); Véraison(b); Mid ripening(c); Full
maturation(d). SDI: Sustained Deficit Irrigation; RDI: Regulated D Deficit Irrigation. E- East; W- West.
Red- SDIE; Blue- SDIW; Green- RDIE; Black-RDI W. A1-A4 in legend of the FTIR spectra represents
four phenological stages from Pea Size to Full Maturation respectively.............................................. 45
Figure 15: Spectral Comparison between berry cuticle, de-waxed cuticle, skin and depolymerised
cutin. Red- Cuticle; Blue- De-waxed cuticle; Green-Skin; Black- Depolymerised Cutin. ...................... 45
Figure 16: Expression of the gene VviKCS1 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after
anthesis); V- Véraison(9 weeks after anthesis); MR- Mid Ripening(11 week after anthesis); FM- Full
Maturation(13 weeks after anthesis). ................................................................................................. 46
Figure 17: Expression of the gene VviKCS6 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after
anthesis); V- Véraison(9 weeks after anthesis);MR- Mid Ripening(11 weeks after anthesis); FM- Full
Maturation(13 weeks after anthesis). ................................................................................................. 47
Figure 18: Expression of the gene VviGDSL in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after
anthesis); V- Véraison(9 weeks after anthesis);MR- Mid Ripening(11 weeks after anthesis); FM- Full
Maturation(13 weeks after anthesis). ................................................................................................. 47
Figure 19: Expression of the gene VviCER9 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after
anthesis); V- Véraison(9 weeks after anthesis);MR- Mid Ripening(11 weeks after anthesis); FM- Full
Maturation(13 weeks after anthesis). ................................................................................................. 48
Figure 20: Expression of the gene VviLTP3 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size(7 weeks after
anthesis); V- Véraison(9 weeks after anthesis);MR- Mid Ripening(11 weeks after anthesis); FM- Full
Maturation(13 weeks after anthesis). ................................................................................................. 48
Figure 21: Expression of the gene VviCYP716A15 in grape berry cuticle of SDI and RDI on two sides
of the canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after
anthesis); V- Véraison (9 weeks after anthesis);MR- Mid Ripening (11 weeks after anthesis); FM- Full
Maturation (13 weeks after anthesis). ................................................................................................ 49
Figure 22: Expression of the gene VviCYP716A17 in grape berry cuticle of SDI and RDI on two sides
of the canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after
anthesis); V- Véraison (9 weeks after anthesis);MR- Mid Ripening (11 weeks after anthesis); FM- Full
Maturation(13 weeks after anthesis). ................................................................................................. 49
x
List of Tables
Table 1: Cuticular wax compositions and predominant cutin monomers in different fruit species ....... 12
Table 2: Gene associated with cuticle biosynthesis ........................................................................... 17
Table 3: Primers used for Quantitative PCR amplification ................................................................. 28
Table 4: Effect of different irrigation regime on the Fresh (FW), Dry weight (DW), oBrix, Titrable acidity
(TA) and pH for different phenological stages. ................................................................................... 30
Table 5: Permeance for water (×10−5 ms−1) of untreated and chloroform treated de-waxed grape berry
var. Aragonez for different phenological stages. ................................................................................ 32
Table 6: TEM analysis of the grape berry skin................................................................................... 39
xi
List of Abbreviations
ABA
Abscisic acid
ABC
ATP binding cassette
ATR
Attenuated total reflectance
cDNA
Complementary DNA
CER9
ECERIFERUM 9
CT
Threshold cycle
CYP716A15
Cytochrome P450 monooxygenases/hydroxylases, Homolog A15
CYP716A17
Cytochrome P450 monooxygenases/hydroxylases, Homolog A17
DEPC
Diethyl pyrocarbonate
DW
Dry weight
ETc
Crop evapo-transpiration
FAE
Fatty acid elongase
FTIR
Fourier transform infrared spectroscopy
FM
Full maturation
FW
Fresh weight
GDSL
Glycine–aspartic acid–serine–leucine (GDSL) motif lipase/hydrolase
IR
Infrared
KCS1
β-ketoacyl- CoA synthase, isoform 1
KCS6
β-ketoacyl- CoA synthase, isoform 6
LTP3
Lipid transfer proteins 3
MR
Mid-ripening
mRNA
Messenger RNA
NAD(P)H
Nicotinamide adenine dinucleotide phosphate
PM
Plasma membrane
PVPP
Polyvinyl polypyrrolidone
PS
Pea Size
qRT-PCR
Quantitative Real-time Polymerase Chain Reaction
RDI
Regulated deficit irrigation
xii
RNA
Ribonucleic acid
RT-PCR
Reverse transcriptase Polymerase Chain Reaction
SDI
Sustained deficit irrigation
SEM
Scanning electron microscopy
Ssp
Subspecies
TA
Titrable Acidity
TEM
Transmission electron microscopy
TSS
Total soluble solids
V
Véraison
VLCFA
Very long chain fatty acid
xiii
1. Background and Introduction
The plants colonized the land around 450 million years ago, and have had to face the daunting task of
acclimatizing to the new environmental conditions such as desiccation, extreme temperature
conditions and exposure to UV radiations (Leliaert et al., 2011; Waters, 2003). This evolution of plants
from mainly aquatic to terrestrial life style have necessitated the development of some physiological
mechanism in plants such as development of complex cell walls for biomechanical support which are
typical of modern land plants (Sørensen et al., 2011). However, among the several modification that
happened in plants to adapt to the new terrestrial environment, the most critical adaptive trait would
have been to develop the ability to retain water in otherwise highly desiccating external environment,
considering the need and importance of water in the physiology of plant growth and development.
Therefore, the capacity to synthesize, transport, deposit and maintain a hydrophobic layer or cuticle
over the surface of their aerial organs was inarguably one of the most significant innovation occurred
in the history of plant evolution. This idea is well supported by the both fossil evidence and ubiquity of
cuticles is almost all plant from embryophytes to angiosperms (Budke et al., 2012).
Grapevine is one of the most important fruit species worldwide and ranks second in fruit production
(FAO, 2007). More than 50 species of grapes are recognized but most commonly used for wine
production and table grapes is Vitis vinifera L. Unlike most of the modern food, the wine‘s attractions
relies not on strong consistent flavors but upon a subtle array of shifting sensations which makes it
charm difficult to define and where the role of grape berry skin comes into play since it contributes
almost 90% to the wine quality (Bisson et al., 2002). Grape berry with its complex developmental
process involving several metabolic changes and the highly active berry skin metabolism determines
the final characteristics of the berry/wine. The skin or exocarp is formed of single layer of epidermal
cells which are lined by cuticle. Cuticle serves as first barrier against the abiotic and biotic stresses
(Domínguez et al., 2011a) and its main function in fruits are to minimize the water loss and limit the
loss of substances from the internal tissues. In fact, several reports indicate the putative role of cuticle
disruption in the berry weight loss (Rogiers et al., 2004) known as berry shrivel, observed at the last
stages of berry maturation in some varieties. Apart from its protective role, cuticle wax composition
deeply influences the efficacy of the fermentative process during wine production processes (Casado
and Heredia, 2001; Orbán et al., 2009). In addition, changes in the cuticle composition and structure
are being considered to be an integral part of the fruit ripening process (Saladié et al., 2007). Although
grapevine is well adapted to the Mediterranean climate, the present prevailing environmental
conditions and the predicted forecast due to the shift in the global environmental patterns, the effect
on berry development and its quality had come into light. The response of berries under environmental
stresses is a complex process and is well documented (Chaves et al., 2010; Schultz, 2003; Zarrouk et
al., 2012). Such global environmental shift brought several regions around the world to the threshold
of temperature and rainfall for optimum grapevine growth forcing the viticulturist to have increased
dependence on the irrigation for grapevine cultivation, namely at the Mediterranean region (Chaves et
al., 2010). However, the right balance between vegetative and reproductive growth is of paramount
significance to the berry quality, and one way to address this key issue is the use of deficit irrigation
1
practices (Chaves et al., 2010). Use of regulated deficit irrigation is one of the key strategies.
However, sustained deficit irrigation is also used in vineyards in order to enhance the wine and berry
qualities (McCarthy et al., 2002).
In spite of the importance of the cuticle under this scenario of global environmental shift, little is known
about its function in grapevine. The majority of studies carried out on role of cuticle in plant has been
limited to vegetative tissues, though in recent years there has been growing interest in biological role
of cuticle in the fruits such as cherry and most intensely tomato fruits (Alkio et al., 2012; Isaacson et
al., 2009; Leide et al., 2007; Shi et al., 2011; Yeats and Rose, 2013). However the tomato is a
climacteric fruit where ethylene phytohormone plays a pivotal role in the ripening and fruit
development in contrast to non-climacteric fruit such as grape berries where abscisic acid (ABA)
phytohormone is reported to be significantly controlling the fruit ripening (Wheeler et al., 2009). Recent
findings suggest the possible role of ABA in the biosynthesis of epicuticular waxes and cuticular water
permeability, as well as in the development and composition of fruits waxy layer thereby enhancing
the resistance to pathogens and pests (Curver et al., 2010; Romero et al., 2012). Several
transcriptomic and proteomic studies have been reported on the effect of water deficit conditions on
berry ripening and quality (Castellarin et al., 2007a; Deluc et al., 2009; Grimplet et al., 2009). Despite
significant work being done by the grapevine research community in the last few years (Castellarin et
al., 2007a,b; Deluc et al., 2009), there are still some knowledge gaps that exist pertaining to the role,
cuticle plays in grape berry and the effect of water deficit on grape berry metabolism and berry cuticle
in particular. Some insight into molecular genetics of cuticle biosynthesis had been reported from
Arabidopsis (Kunst and Samuel, 2003; Samuel et al., 2008) and more recently from tomato fruit cuticle
(Matas et al., 2011). To address some of these questions, the present ―master thesis‖ was carried out
for the morphological, metabolomic and molecular characterization of the cuticle under water deficit.
2
2. Review of Literature
2.1. Grapevine (Vitis vinifera L.)
Grapevine (Vitis spp) is one of the most cultivated fruit crops worldwide covering around 7.8 million
hectares of land in 2011 and producing 67.5 million tons of berries (http://www.oiv.int/). More than
68% of the grape berries harvested are primarily used for wine production and the rest is used to
provide the fresh table grapes (30%), raisins (2%) and minor products, such as jelly, grape juice,
vinegar, ethanol, grape seed oil, tartaric acid, and fertilizers (Fasoli et al., 2012). Grape berries are
known for their high content of antioxidants in form of polyphenols which have important health
benefits and are valued in food, pharmaceutical and cosmetic industries. Each variety of grapevine is
distinct in its own way and characterization of one variety will not be enough to give complete
information about the entire species. Therefore it becomes essential to characterize each variety of
grapevine separately in order to determine the overall characteristics of each of them. In addition, the
same variety growing in different geographical locations can show different properties depending on
the environmental conditions to which it is exposed to. Within the geographical region, the berry
characteristics can show variability between different years as well (Genebra et al., 2014; Zarrouk et
al., 2012, 2015).
2.1.1. Phenology of grapevine
Grapevines are woody perennial deciduous plants and their annual growth stages are quite similar to
other such plants. Grape berries are non-climacteric fruit and a sink of water, minerals, micronutrients
and primary metabolites such as sugar and amino acids. In addition, it is also the site for synthesis of
the major determinants of the aroma, colour and flavour presents in the wine (Grimplet et al., 2007).
The grape berry growth is characterized by a double sigmoid curve resulting from two consecutive
stages of growth, separated by a slow phase or no growth as shown in Figure 1.
Stage I: This stage is characterized by berry formation which starts at bloom with rapid cell division.
The berry expands in volume by accumulating lot of organic content which reach maximum during this
stage, however different part of berries accumulate different acids and metabolites. For instance, skin
and seeds begin to accumulate tannins, especially important for red wine imparting color and stability.
Stage II or lag phase: Seed embryos develop rapidly and berries attain almost half their size. 5 to 10
days after this stage, the cells continue to expand and accumulate acids and tannin reaching their
maximum levels at véraison.
Stage III: This stage starts with berry softening and coloring with accumulation of soluble solids and is
termed as véraison. The acid content begins to reduce and the berry size almost doubles. Seed
tannins and some aroma also begin to decline. Post véraison, the significant increase in glucose and
fructose occurs. Secondary metabolites, major determinant of wine such as anthocyanins for red wine
continue to accumulate.
3
Figure 1: Developmental Stages of grape berry development showing color changes in the berry,
compounds accumulation, oBrix Level and rate of xylem phloem sap inflow (Coombe, 1973 illustration by
Jordan Koutroumanidis).
2.1.2. Role of plant phytohormone during grape berry ripening
Plant physiologist commonly use two terms: climacteric and non-climacteric in order to divide the
fleshy fruits. Climacteric fruits are those that show increased ethylene evolution and respiration at the
onset of ripening (Adams-Phillips et al., 2004). On the other hand, the control of ripening in nonclimacteric fruits such as grapes where respiration rates do not exhibit large peaks at véraison is
poorly understood. Even though the ethylene is not as important in ripening in non-climacteric fruit as
it is in climacteric fruit, it has become evidently known that division between climacteric and nonclimacteric fruit is less precise than once thought (Wheeler et al., 2009).
The control of grape berry ripening is a complex interplay between the various hormones. Lot of
literature accounts for the role of ethylene or ethylene-releasing compounds that have been applied
and produced increase in anthocyanin and/or sugar level (El-Kereamy et al., 2003; Tira-Umphon et al.,
2007; Wheeler et al., 2009), making it apparent that ethylene does play role in the control of some
genes expressed during non-climacteric fruit ripening as well (El-Kereamy et al., 2003; Tira-Umphon et
al., 2007). Auxin (Jeong et al., 2004; Wheeler et al., 2009) and brassinosteroids (BR) (Symons et al.,
2006) have also been reported to play a role in control of berry ripening. However, it is clear that ABA
have a pivotal role in the control of grape berry ripening. Several studies showed that free ABA levels
increase around véraison period (Gagne et al., 2006; Okamoto et al., 2004; Zarrouk et al., 2012) and
that ABA application can enhance both sugar and anthocyanin accumulation. Recent findings by Sun
et al. (2010) implicated both ethylene and ABA to be likely responsible for the start of berry ripening
through functional interaction and synergistic effect of ABA and ethylene combined. Some studies
have been conducted which reveal that water stress cause production of signalling molecules namely
ABA which helps plants to tolerate abiotic stresses (Seki et al., 2007). These ABA molecules could be
involved in modulating the epicuticular wax biosynthesis in plants and also affecting the cuticle
4
permeability, development and composition in fruit waxy layer (Curvers et al., 2010; Romero et al.,
2010).
The berry ripening also depends on several environmental factors such as drought and temperature
which thereby regulate the internal biosynthetic pathways under the control of these hormones.
Recent findings by Zarrouk and co-authors (2012) have also suggested that water deficit induced
changes in ABA level affect the ripening process and also the berry quality. However no reliable
pattern of the effect of deficit irrigation on berry ripening process could be ascertained leaving this
area of hormonal control and ABA in particular in berry ripening for further research (Zarrouk et al.,
2015).
2.2. Water deficit and grapevine
Among the various problems associated to the viticulture, water scarcity is one of the most significant
limitations to agriculture practices worldwide and to grape production in particular (Chaves et al.,
2007). It is reported that more than 60 percent of major grape production areas worldwide receive
precipitation below 700Lm -2 (Flexas et al., 2010). Moreover, large fraction of vineyards located in these
areas are subjected to intense seasonal drought that coincides with the grapevine growing seasons
especially in the Mediterranean climate areas.
The areas of Mediterranean climates are particularly characterized by progressive soil water deficits
and relatively higher leaf-to-air vapor pressure gradient along with high irradiance and temperatures
which altogether result in the reduced yield and quality of grape fruit (Flexas et al., 2010). As reported
by Chaves et al. (2007), the numbers of dry days have increased in Southern Europe and to go by
recent climate prediction, viticulture areas subjected to water deficit limitation will further increase in
near future forcing viticulturist to rely on the irrigation more. The impact of irrigation management will
be most on the wine industry because several reports have established the controversial effect of
excess irrigation on grape quality which eventually results in reduced quality through decrease in color
and sugar content, and imbalanced acidity (Matthews et al., 1990, Medrano et al., 2003, Salón et al.,
2005).
Although wine grape irrigation had been prohibited in many countries owing to the traditional believe
that it reduces wine quality, the introduction of drip irrigation practices over the last few decades and
the expansion of grape berry cultivation in many of the arid regions of the world (such as South Africa,
Australia and some US states – California, Arizona etc), it has become obvious that the quality of wine
can be maintained high even under different irrigation practice (Bravdo, 2001). The European
authorities have also recently approved the irrigation of vineyards on slopes with steepness more than
30%. Vineyards in Portugal have also sought special permit from the national wine Institute (Bravdo,
2001). This has also been made possible due to the changing precipitation patterns in some of the
semi arid Mediterranean region of the Southern Europe (Schultz, 2000) which has led the viticulturist
of these regions to be more dependent on the irrigation in order to stabilize the yield and maintain or
improve the berry and hence the wine quality.
5
Studies conducted by Bravdo (2001) suggested that wine quality can be maintained even under deficit
irrigation regime, at the same time also enables to keep the soil water availability at optimum level
thereby maintaining the sufficient vine water potential needed for different vegetative and reproductive
stages. However, achieving high quality wine grape in irrigated vineyards is possible only with an
appropriate balance between vegetative and reproductive development.
2.2.1. Sustained deficit irrigation in grapevine
The research on plant water stress had shown that response of plants to water deficits is very much
dependent on the pattern of stress imposed (Dorenboos and Kassam, 1979). One such pattern of
stress that has been frequently used is sustained deficit irrigation (SDI). In this, water deficit increases
progressively as the season advances because of the combination of the uniform application of the
reduced amount of water and corresponding depletion of the soil water reserve. This pattern therefore
allows stress to develop slowly and helps plants to adapt to the water deficits gradually in soils with
significant water storage capacity. Zarrouk and co-authors (2012) have reported the tissue specific
influence of water deficit (RDI and SDI) in grape berry where they reported the differential
accumulation of anthocyanin and sugar in seeds and skin, however this effect varied between the two
years (2007 and 2008) under study (Zarrouk et al., 2015).
2.2.2. Regulated deficit irrigation in grapevine
For efficient irrigation management practices, the use of regulated deficit irrigation (RDI) serves as a
promising practical solution for grapevine development that allows accurate control of water
application rate and suitable timing. It was first used for grapevine by McCarthy et al. (2002). RDI
consists in reducing the applied water at selected phenological stages which are less sensitive to
water deficit thus subjecting the plant to the water stress in the controlled manner and would therefore
be feasible water saving practice for arid areas with minimum impact on yield and fruit quality (Fereres
and Soriano, 2007; Girona et al., 2006; McCarthy et al., 2002). In order to study the effect of water
stress on berry development stages, Coombe and McCarthy (2000), based on their findings integrated
their results in the form of graph as shown in Figure 2.
Figure 2: Curves showing vegetative and reproductive growth of grapevine (Vitis vinifera)(Coombe and
McCarthy, 2000).
6
RDI helps to maintain the vine water status within the prescribed limits of deficit in relation to the
maximum water potential required for different part of the developmental stages during the grapevine
growth and helps to keep the balance between vegetative growth and reproductive growth as
illustrated by Coombe and McCarthy, (2000) in the Figure 2. However timings and intensities of water
deficit can be manipulated in order to achieve the desired objectives (Prichard et al., 2004).
2.2.3. Effect of water deficit on berry ripening/quality
Water deficit influences berry development and composition. Nevertheless its intensity and timing are
two major factors that regulate the berry characteristics (Deluc et al., 2009). Additionally, each variety
of grapevine shows different effect under water deficit which also depends on the specific tissues of
the grape berries: skin, pulp, seeds (Deluc et al., 2009; Zarrouk et al., 2015).The fruit composition is
largely dependent on the vine water status through an indirect effect on berry size which also affects
the skin to pulp ratio (Kennedy et al., 2002). Various timings and intensities of the deficit can be used
to achieve specific objectives (Prichard et al., 2004). In grapevines, controlled pre and post-véraison
deficit irrigation have been reported to affect berry size, flavonoid and phenolic content, sugar and
total acidity (Kennedy et al., 2002; Matthews et al., 1987; Prichard et al., 2004). Conflicting report
about the effect of water stress conditions on anthocyanin accumulation in grape berries are available
which many be reasoned due to the anthocyanin accumulation being dependent on several variable
which overall determine the anthocyanin content in grape berries (Castellarin et al., 2007b; Downey et
al., 2006; Dry et al., 1998; Kennedy et al., 2002; Zarrouk et al., 2012). However some studies have
shown that water stress has relatively little to no effect on other phenols in berries (Downey et al.,
2006; Genebra et al., 2014; Kennedy et al., 2002; Zarrouk et al., 2012).
Most of the findings corroborating the effect of water deficit on grape berry quality are descriptive with
no proper reasoning behind this adaptive response occurring in the grapevine. This might led to
conclude that the plant stress response is highly regulated complex phenomenon involving large
number of molecular interactions with indefinite variables and factors that come into play which makes
its almost unfeasible to study on an experimental scale.
2.3. Introduction to plant cuticle and its significance
Plant cuticle is an extra cellular hydrophobic layer that covers the aerial epidermis of all land plants.
The cuticle is a physical structure that incorporates numerous functions of importance for plant life
(Kerstiens, 1996). It is a non-living though highly multifunctional structure into which numerous
functions have been integrated. This integration is sometimes not ideal as some physiological
demands are in conflict with each other (Riederer and Muller, 2008).
Cuticle is synthesized by the epidermis which covers it and serves as first barrier against the abiotic
and biotic stress which the plant has to undergo (Domínguez et al., 2011a). The main function
attributed to the fruit cuticle are to minimize the water loss, limit the loss of substances from the
internal tissues, serves as a protective barrier against the physical, chemical and biological attack and
providing the mechanical framework to support the integrity of plant organ. However the fruit cuticle
7
has been largely disregarded in terms of its putative effect in modulating the development of fruit,
specially the ripening and postharvest performance. In order to retain these functions, the structural
integrity of cuticle through fruit development and expansion has to remain firm (Edelmann et al.,
2005). These biophysical properties are however dependent to some extent upon the external
conditions like temperature and relative humidity (Edelmann et al., 2005; Matas et al., 2005). Strength
and rigidity of cuticle inversely varies with the increase of temperature and this influence of
temperature is related to the relative humidity as water play an important role in plasticizing the plant
cuticle and facilitating to withstand the external environment (Domínguez et al., 2011b). In this sense
temperature and humidity are two important factors used in devising the storage strategies after the
fruit is harvested (reviewed in Lara et al., 2014).
2.3.1. Role of cuticle as a barrier to water loss
After the vascular plants inhabited the dry land, they developed the special mechanism to protect
against the desiccation with the help of cuticle. The main physiological attribute associated with its
permeability to water basically lies in reducing the uncontrolled water loss adequately enough to allow
higher plants to survive on land and it is quite evident that role of cuticle in helping the terrestrial plants
to live is fulfilled (Burghardt and Riederer, 2006; Riederer and Schreiber, 2001). Schreiber and
Reiderer (1996) have reported the cuticular permeability of plant species from different habitat and
showed that fruit cuticles had the highest rate of cuticular transpiration probably because they have no
stomata or their frequency is much lower compared to leaves hinting at the possible role, cuticle have
as a transport barrier and how cuticular transpiration regulates fruit growth. They were also able to
demonstrate that the cuticle thickness bears no direct relationship with the permeances but it is the
wax that forms the effective transport barrier which was later supported by several studies (Riederer
and Schreiber, 2001; Schreiber and Riederer, 1996). The question arises-than what is the
physiological significance of cuticle when its serves as somewhat less than a perfect barrier to water
and how much amount of water is lost through cuticle when stomata (if present) are still closed. The
answer to these kinds of questions has been the inspiration for the lot of current paradigm of research
which are done to investigate the physiology of cuticle and its role in stress mechanism especially in
fruits such as grapevine subjected to water deficit conditions in arid and semi arid regions.
2.3.2. Cuticular Permeance
So far the research on cuticle permeance has been mostly restricted to fully developed leaves and
fruits of dicotyledonous plant (Kerstiens 1996, 2006; Riederer and Schreiber, 2001). The possible
relationship between cuticular waxes and permeance and the possible role of cutin in making cuticle
the transport barrier have been assessed either by the comparison of plant surfaces intact with the
ones that have had the waxes removed mechanically or altered (Jetter et al., 2000) or through
analysis of waxes that are solvent extracted and reconstituted (Kirsch et al., 1997; Šantrůček et al.,
2004; Schreiber and Schonherr, 1993).
8
The cuticle permeance study conducted by Leide et al. (2007) on the role of cuticular waxes in the
transpirational water loss in the tomato fruit (Lycopersicon esculentum) ‗MicroTom‘ and
its lecer6 (mutant defective in a β-ketoacyl-coenzyme A synthase involved in very long chain fatty acid
elongation) over the different developmental stages, showed that even though both wild type and
mutant showed similar patterns of wax accumulation, they exhibited different water permeances. The
lecer6 mutant was shown to exhibit about 3 to 8 fold increase in water loss per unit time and fruit
surface compared to the wild type. However both the wild type and mutant immature green fruits
showed similar water loss which showed that although deficiency in the LeCER6 β-ketoacyl-CoA
synthase caused increased permeance in the mutant compared to wild type, but the major effect
caused by this deficiency are apparently not displayed until the fruit entered the transition from fruit
ripening category of immature green to mature green.
Several previous studies have been attempted to find out a correlation between the wax
characteristics and transpirational barrier properties of the cuticle. However absence of any reliable
astomatous plant model system so far had made the functional analysis of cuticle from plant with
defined genetic modifications difficult and therefore all attempts to correlate water permeance with the
qualitative or quantitative composition of cuticular waxes have proved futile (Riederer and Schreiber,
1995, 2001). Vogg et al. (2004) also followed the developmental stage of dwarf tomato ‗MicroTom‘
and its lecer6 mutant in order to elucidate the quantitative and qualitative modification of cuticular wax
composition during the fruit maturation and established that water permeability of cuticle in tomato
fruits was largely dependent on the aliphatic component of intracuticular wax layer which was modified
by the variable amount of triterpenoids during the various maturation stages.
Leide et al. (2007) were able to establish the negative correlation between the water permeance and
wax coverage in tomato fruits. Just like the previous study (Riederer and Schreiber, 2001), findings of
Leide et al. (2007) also indicated that cuticular wax quality rather than its quantity predominately
affects the water barrier properties. However to the best of our knowledge no study on cuticular
permeance of grape berry had been reported so far.
2.4. Cuticle Structure, Biosynthesis and Assembly
2.4.1. Composition and structure of cuticle
Plant cuticles are composite structures and are generally composed of a covalently linked
macromolecular scaffold cutin and a variety of organic solvent-soluble lipids that together constitute
waxes (Yeats and Rose, 2013). Plant cuticle is usually considered to be independent from the
polysaccharide cell wall of epidermis lying underneath (Yeats and Rose, 2013) but the two structures
are physically associated and have some overlapping function. It would not be therefore wrong to
consider cuticle as a specialised lipid-modification of cell wall just as lignification is a common
modification of secondary cell wall in plants (Yeats and Rose, 2013). The waxes are either deposited
within the cutin matrix which are called intracuticular wax or accumulate on its surface as epicuticular
wax crystals, or films. The epicuticular waxes confer distinct macroscopic surface properties to the
9
plant surface and are responsible for glossy appearance common to many leaves and fruits, while
epicuticular wax crystals account for the dull, glaucous appearance of broccoli (Brassica oleracea)
leaves and Arabidopsis (Arabidopsis thaliana) stems (Yeats and Rose, 2013) and serve as the
interface of the plant and the outer external environment. These epicuticular waxes are highly
hydrophobic in nature and are efficient barrier to transpirational loss (Bernard and Joubès, 2013). The
structure and composition of cuticle is highly complex and can vary widely among plant species and
within plant species in different organ and developmental stages. This is well illustrated in typical
-2
range of thickness (1-10 µm) and quantity (100-1000 µg cm ) of deposited cuticle (Riederer and
Muller, 2006). This protective barrier of cutin and cuticular waxes are assembled ultrastructurally in
several layers as shown in Figure 3.
2.4.2. Biosynthesis and composition of cuticle components: waxes and cutin
Cuticle comprises mainly of waxes and cutin. Composition of waxes may differ substantially with
species, ontogeny and environmental conditions (Jenks and Ashworth, 1999). In most of the cases,
the majority of compounds constituting the cuticular wax are derived from very-long chain fatty acids
(VLCFAs; C20-C34), including alkanes, aldehydes, primary and secondary alcohols, ketones and
esters. Several lipophilic secondary metabolites such as pentacyclic triterpenoids, flavonoids, and
tocopherols have also found to be substantial components (Jetter et al., 2006). Molecular biology
underlying VLCFA-derived wax biosynthesis has made tremendous progress and to this end
Arabidopsis has provided an excellent experimental model (reviewed in Bernard and Joubès, 2013).
Figure 3: Schematic of a plant surface showing the major structural features of the cuticle and underlying
epidermal cell layer and representative model of cuticular wax secretion. ABC transporter, ATP binding
cassette transporter; CER5, ECERIFERUM 5; FAE, fatty acid elongase; LTP, lipid transfer protein; WBC,
WHITE-BROWN COMPLEX (Samuels et al., 2008).
10
Cutin is composed of interesterified hydroxyl fatty acids with lesser amounts of glycerol,
phenylpropanoids, and dicarboxylic acids (Kolattukudy, 2001). Chemical breakdown of ester bonds
using processes such as saponification readily releases these monomeric constituents, although in
some species an additional lipidic polymer referred to as cutan remains recalcitrant to such
treatments. Cutan is rich in ether and C-C bond but its structure remain unknown and restricted to
relatively few species (Gupta et al., 2006). The hydroxy fatty acids of cutin typically comprised of ωhydroxy fatty acids, usually with one or two additional mid chain hydroxyl groups or an epoxy group.
Extensive studies have been done to identify the chemical composition of plant cutin as early as in
1970‘s and 1980‘s (Kolattukudy, 2001) before the composition of Arabidopsis cutin was determined
(Bonaventure et al., 2004; Franke et al., 2005) and more recently in other fruits such as tomato fruits.
This important model species contain atypical composition of cutin in stems and leaves, the
dicarboxylic acid, implying that the predominant structural motif must be a copolymer with an unknown
polyhydroxy compound, presumably glycerol (Pollard et al., 2008). Despite its atypical nature of cutin,
Arabidopsis has proven to be an important model for deciphering the pathway of cutin biosynthesis.
Several studies have reported the composition and biosynthesis of cutin and cuticular waxes in detail
which are summarized in recent reviews (e.g. Lara et al., 2015; Lee and Suh, 2015). However,
majority of the work investigating cuticle biosynthesis and composition has been conducted on
vegetative plant tissues and little information is available in relation to the fruits- both fleshy and nonfleshy fruits. The significant differences observed over the last 40 years in the study of cuticle and its
components of different organs of the same plant, both cutin (Espelie et al., 1979; Järvinen et al.,
2010; Marga et al., 2001) and waxes (Baker et al., 1975; Radler, 1965,1970) provided enough
evidence that the assumption that fruit cuticle composition can be inferred from that of leaves and
stems cannot be sustained. Therefore tomato fruit has been the excellent model for fleshy fruits and
studied extensively recently. Tomato fruit cuticle provided valuable cuticle-related information as they
are astomatous and comparatively thick which means it is possible to isolate considerable amount of
―unperforated‖ material for biochemical, physical, or structural characterization (Martin and Rose,
2014). Albeit less intensively, other fruit cuticles corresponding to the crops of economic relevance
have also been investigated and revealed significant differences across genotypes in their properties
as the understanding of the functions and impact of this outer layer on quality, storage potential and
shelf life of produce will require its characterization as a first step (Lara et al., 2015). The composition
of cuticle component of some of the most common fruits has been summarized in Table 1. Detailed
composition of cuticle and its components in grapevine is described below (section 2.4.3.).
2.4.3. Biosynthesis and composition of cuticle components in grapevine
Waxes from the grape berry cuticle mostly comprises of aldehydes, where both straight chain, even
chain length type predominates. As early as 1965, it was reported in two separate studies that the
surface waxes of ripe sultana grape variety consists largely of the triterpernoid oleanolic acid, with
relatively lesser amounts of n-alcohols (C24, C26, and C28), n-aldehydes (largely C28 and C30),
esters,
free
acids
(mostly
C24,
C26,
11
and
C28)
(Radler,
1965)
Table 1: Cuticular wax compositions and predominant cutin monomers in different fruit species
Fruit
Ripening Type
Predominant wax components
Predominant cutin monomers
References
Tomato (Solanum
lycopersicum)
Climacteric
n-hentriacontane (C31) triterpenoid
alcohols (α-, β-, and δ-amyrin)
C16 monomers (10,16-dihydroxy C16:0)
Isaacson et al. (2009); Leide et
al. (2007); Petit et al. (2014);
Shi et al. (2013); Yeats et al.
(2012a)
Plum (Prunus
domestica)
Climacteric
n-nonacosane (C29) triterpenoid acids
(oleanolic acid)
not reported
Ismail et al. (1977).
Peach (Prunus persica)
Climacteric
n-tricosane (C23), n-pentacosane (C25)
n-heptacosane (C27) triterpenoid acids
(ursolic acid, oleanolic acid)
C18 monomers (ω-hydroxy C18:1)
Belge et al. (2014a) ;
Fernández et al. (2011)
Sweet cherry (Prunus
avium)
Nonclimacteric
n-nonacosane (C29) triterpenoid acids
(ursolic acid)
cultivar-dependent (dihydroxy C16:0 or
dihydroxy C18:x reported mainly)
Belge et al. (2014b); Peschel
et al. (2007)
Strawberry (Fragaria ×
ananassa)
Nonclimacteric
not reported
C16 monomers (9(10),16- dihydroxy
C16:0
Järvinen et al. (2010).
Olive (Olea europaea)
Nonclimacteric
n-heptacosane (C27), triterpenoid
acids (oleanolic acid)
not reported
Bianchi et al. (1992).
Grape (Vitis vinifera)
Nonclimacteric
n-pentacosane (C25) triterpenoid acids
(oleanolic acid), n-heptacosane (C27)
n-nonacosane (C29)
not reported
Casado and Heredia (1999);
Comménil et al. (1997);Pensec
et al. (2014); Radler
(1965,1970); Radler and Horn
(1965)
12
and n-hydrocarbons (predominantly C25, C27, C29, and C31)(Radler, 1965, Radler, and Horn, 1965).
Around 30% of oleanolic acid was also found in the cuticle waxes of ‗Palomino fino‘ grapes (Casado
and Heredia, 1999). However it was surprising that authors did not find any aldehydes and n- alkanes
represented less than 5% of the total mass (Casado and Heredia, 1999). Oleanolic acid was also
found to be dominant component in the cuticular waxes of ‗Pinot noir‘ grapes along all phenological
stages of berry development (Comménil et al., 1997). Oleanolic acid was also reported to be present
in all eight different cultivars investigated in the recent study by Pensec et al. (2014) in which authors
reported triterpenoid content to be as high as around 42% to 80% of the total cuticular waxes
depending on the genotype. Major triterpenes such as oleanolic acid and β-sitosterol have significant
importance for the success of wine fermentative processes and their health promoting properties have
made them an ideal candidate for the study in the grape waxes and also to characterize the varieties
based on their economical and pharmaceutical significance (Orbán et al., 2009; Szakiel et al., 2012).
Only minor quantitative differences were found in the cuticular wax fraction of the fruits of the
European wild vine (Vitis vinifera ssp. sylvestris) and the cultivated vine (V. vinifera ssp. vinifera)
suggesting their conservation during the evolution (Radler, 1970). Although significant literature and
studies on the wax composition of the grape berry cuticle is available, data describing the composition
of another important part of cuticle, the cutin, is still not available. However the evolution of total cutin
amount during fruit maturation has been reported
(Comménil et al., 1997). Considering the
commercial importance of cutin with regard to its consumption both in the form of fresh table grapes
and also wine making makes further studies addressing this issue more desirable.
2.5. Architecture of plant cuticle
Cuticle architectural organization can be discerned using a number of microscopic techniques such as
scanning electron microscopy (SEM) which can reveal the elaborate and diverse morphologies of
epicuticular wax crystals (Jeffree, 2006) or transmission electron microscopy (TEM) which helps to
understand distinct patterning of interior layers of the cuticle, although this approach does not allow
the visualization of wax structures. Cuticles vary considerably in their architectural design and,
depending on the species and varieties, differ dramatically in their thickness from nanometer to the
micrometer scale (Jeffree, 2006). Light microscopy can also be used on micrometer scale to elucidate
the fine structure of cuticle and epidermal cell wall as reported by Yeats and Rose (2013).
Histochemical staining coupled with confocal microscopy can further help to resolve the threedimensional architecture of cuticle (Buda et al., 2009).
2.5.1. Ultrastructure of grape berry cuticle
Microscopic techniques have been widely used to study the structure of cuticle and more recently
electron microscopic technique has also been employed. Casado and Heredia (2001) studied the
ultrastructure of cuticle in grape berry during development using electron microscopy (SEM and TEM)
in which they found that during the period of rapid expansion, the cuticle spread out over the grape
berry and outer wax layer of 0.5 µm was identified. However, the final stage of berry growth was
13
characterized by the homogenous cuticle with a thickness of 3µm (Casado and Heredia, 2001). The
studies on fruit cuticle has revealed that it is highly diverse but to date not much information could be
obtained regarding the patterns of cuticular deposition and what are factors that regulate such unique
architectural integrity. Nevertheless, cuticle structure at various scales certainly influences the
properties such as water permeability or pathogen adhesion (Yeats et al., 2012a). Therefore
investigation of such structure-function relationship would be an area worth exploring in the near
future.
2.6. Spectroscopic characterization of grapevine cuticle and its components
Plant cuticle has biological and agricultural significance but its applied use as a source of organic
compounds and its importance as plant biomass have recently begun to be investigated. In this
regard, cuticle components such as waxes and cutin are potential alternative feedstock for aliphatic
compounds found in plants (Tsubaki and Azuma, 2013). The lipid composition of cuticle is commonly
determined by gas chromatography coupled with mass spectroscopy. However these techniques
present limitations and the identification of the components is not always complete. It‘s also not
possible to distinguish some functional groups after depolymerization such as ester/carboxylic
acid/carboxylate functional groups and non-degradable fractions cannot be analyzed (Pollard et
al., 2008). Amorphous nature of plant cuticle also presents some limitations to the use of more
traditional techniques like X-ray diffraction (Luque et al., 1995). Other spectroscopic measurement
using
13
C nuclear magnetic resonance provide limited information concerning molecular structure due
to overlapping of broad spectral lines and, for quantitative measurements, long acquisition times are
required (Serra et al., 2012). In order to overcome these bottlenecks, more recently infrared (IR) and
Raman spectroscopic techniques have been used which are non-destructive and accessible
techniques which have shown certain advantages in terms of chemical and structural analysis of plant
cuticles: like identification of functional groups and conformations, determination of intra and
intermolecular interactions of cuticle components with exogenous molecules and qualitative estimation
of the cutin polymerization. While Raman spectroscopy presents some drawbacks such as
fluorescence interference and overlapping signals, IR measurements are fast, easy and no
interferences are produced by other mechanisms. However, sample preparation for IR spectroscopy
presents some hindrance on sample thickness, uniformity and dilution to avoid saturation. Wide set of
different modes of acquisition of IR techniques provide more important and complementary chemical
information. One mode of acquisition is ATR-FTIR. ATR is a useful technique to obtain the IR
spectrum of the surface of samples such as cuticle (Günzler and Gremlich, 2002; Heredia-Guerrero et
al., 2014).
Several studies on characterization of plant cuticles by IR spectroscopy have provided significant
amount of information on the nature of functional groups present in cuticle matrix and on the structural
arrangement of the cuticular components (España et al., 2014; López-Casado et al., 2007; Ramírez et
al., 1992). However it is remarkably important to note that despite the advances of IR and other
spectroscopic techniques, the information acquired from them is very limited. It is also important to
remark that most of the spectroscopic studies are focused on fruit cuticle of tomato. This bias can be
14
justified by the enhanced agronomic interest of these fruits and their high proportion of cuticle material
and easy isolation of their cuticles (Heredia-Guerrero et al., 2014).
Although tomato fruit cuticle is considered as model system of fleshy climacteric fruit with well known
composition, structure and properties, direct extrapolation of results to cuticles of the other species
could be wrong (Heredia-Guerrero et al., 2014). It is therefore important to use the information from
tomato cuticle and apply it to other non-climacteric fruit such as grape berries to get further insight into
the cuticle system of other plant. However, small size and contamination by several interfering
compounds makes the process of isolation of cuticle from grape berry, a very tedious job. However,
the present thesis aims to present some basic insight into grapevine cuticle system using IR
spectroscopy which could be a good starting point in the research of other non-climacteric fruit cuticle
research. However in depth analysis of IR coupled with other techniques like microscopes
(microspectroscopy) could help in better understanding of this heterodox and complex plant system.
2.7. Genes implicated in fruit cuticle biosynthesis
The majority of fundamental research to study the cuticle biosynthesis has been carried out in
Arabidopsis (Pollard et al., 2008; Samuels et al., 2008; Schreiber, 2010) which is a dry fruit bearing
species. However, using the information available from the Arabidopsis, homologous genes with
identical predicted function have been identified in a large number of fleshy fruit species using the
transcriptomics approaches (Albert et al., 2013; Alkio et al., 2012; Mintz-Oron et al., 2008).
Nevertheless, the range of genes identified in the model plant Arabidopsis had been limited by its
relatively small size and thin cuticle. Although the bioinformatics tool available for homology search
are useful and could suggest the possible mechanistic conservation, however it does not lead to any
possible discovery of the molecular pathways and processes that might be fruit specific. The fruit
cuticle of other plant and fleshy fruits in particular are often more substantial compared to the
Arabidopsis and therefore serve as a more excellent model for identifying new genes involved in
formation and restructuring of cuticle. Despite tremendous efforts in the recent times, several key
areas of cuticle biogenesis remain unclear. First, the molecular mechanism underlying the intracellular
and extracellular transport of wax and cutin precursors remains poorly understood, although key ABC
transporters for their export across the plasma membrane have been identified (Bird et al., 2007; Chen
et al., 2011;Fabre et al., 2015; Pighin et al., 2004). The recent strides made in the field of genetics and
advancement of latest molecular techniques had made tomato a most favourite model plant which
made it possible to characterize the cuticle-related genes or its mutant. Several transgenic tomato
lines have been produced to explore and confirm the cuticle-related gene function and are well
documented in the available literature (Girard et al., 2012; Shi et al., 2013; Vogg et al., 2004; Yeats et
al., 2012b).
Cuticle being the major interface between plant surface and the external environment makes it
extremely important to study its properties and its role in grape berries for regulating the loss of water.
Major components of the cuticle are cutin and cuticular waxes. Cutin is structural backbone of the
cuticle, while cuticular wax is embedded in the cutin polymer as intracuticular wax and covers the cutin
15
matrix as distinct layer called epicuticular waxes (Kunst and Samuels, 2009; Samuels et al., 2008).
The present thesis currently focuses on the cuticular wax component of the cuticle for which several
genes have been identified in the literature. The precursors of the cuticular wax biosynthesis are very
long chain of fatty acids (VLCFAs) which are generated by the de novo fatty acid biosynthesis in the
plastid whereas fatty acid elongation occurs in the endoplasmic reticulum of the epidermal cells. The
C16 or C18 acyl-CoAs serve as precursors for the biosynthesis of VLCFAs (C20-C34) by the addition
of C2 units derived from malonyl-CoA. This formation of VLCFAs is usually carried out by the enzymes
of fatty acid elongase (FAE) complex in the endoplasmic reticulum (Kunst and Samuels 2009; LiBeisson et al., 2013). The FAE complex consists of β-ketoacyl- CoA synthase (KCS), β-ketoacyl-CoA
reductase (KCR), 3-hydroxyacyl-CoA dehydratase (HCD), and trans-2,3-enoyl-CoA reductase (ECR),
which catalyze the sequential reactions: condensation, reduction, dehydration, and a second
reduction, respectively (Kunst and Samuels 2009; Li-Beisson et al., 2013). The aliphatic components
of the wax are derived from VLCFAs with the chain length of 24 to 34 carbons (Samuels et al., 2008)
and biosynthesis requires a unique set of condensing enzymes: KCS1, CER6/KCS6/CUT1 and KCS9.
(Kim et al., 2013; Todd et al., 1999). For the present master thesis, we decided to focus on KCS1
encoding for KCS1 enzyme involved in the C26, C28 and C30 elongation and CER6/KCS6/CUT1
(hereafter only referred to as KCS6) encoding for a major condensing enzyme responsible for wax
precursors. Other classes of VLCFAs synthesis genes are also described, namely LACS (Lü et al.,
2009; Weng et al., 2010) which are involved in the synthesis of VLCFAs required for pollen coat
formation (Jessen et al., 2011). There are other cuticle related genes which affect the cuticle
biosynthesis and transport which have been summarized in Table 2.
Wax formation involves various steps from its synthesis in plastids to its elongation in ER from where it
is transported to the plasma membrane(PM). Beyond plasma membrane, the hydrophobic wax
components have to traverse the hydrophilic cell wall, the function which is probably facilitated by the
cell wall associated lipid transfer proteins (Bernard and Joubes, 2013; Kunst and Samuels, 2009). Two
glycosyl-phosphatidylinositol (GPI)-anchored Lipid Transfer Proteins (LTPGs), LTPG1 and LTPG2,
were shown to be required for wax export from the PM to the plant surface (DeBono et al., 2009; Kim
et al., 2012) but the mechanism underlying their roles in wax export is still not clear. Several lipidtransfer proteins have been reported to modulate plant responses to environmental stress, namely
biotic stress. Recently reports showed that wax carrier gene such as LTP3, positively regulated by
MYB96 transcription factor (modulator of wax biosynthesis) is also significantly induced by drought
stress and ABA application (Guo et al., 2013; Seo et al., 2011). Recent investigation by our group has
identified specific lipid transfer protein (LTP3) in the proteome of grape berry cuticle (Zarrouk et al.,
unpublished data) suggesting its role in the VLCFAs transport in grape berries. LTPs are most
important lipid transfer protein for the extrusion of wax beyond PM and study of its relative expression
under water deficit conditions might unfold the adaptive response of grape berries under stress
conditions and how cuticular wax load is modulated under stress conditions. Overview of wax
synthesis is illustrated in Figure 4.
16
Table 2: Gene associated with cuticle biosynthesis
Gene
Protein Family name
Affected Cuticular components
References
KCS1
β-Ketoacyl-coenzyme A synthase
Cuticular wax biosynthesis
Todd et al. (1999)
KCS6/CER6/CUT1
β-Ketoacyl-coenzyme A synthase
Cuticular wax biosynthesis
Hooker et al. (2002); Millar et al. (1999)
FATB
Fatty acyl-ACP thioesterase B
Cuticular wax biosynthesis
Bonaventure et al. (2003)
LACS1/CER8
Long chain acyl-CoA Synthetase
Cuticular wax biosynthesis
Lü et al. (2009), Weng et al. (2010)
LACS2
Long chain acyl-CoA Synthetase
Cuticular wax biosynthesis
L ü et al. (2009), Weng et al. (2010)
LCAS4
Long chain acyl-CoA Synthetase
Cuticular wax biosynthesis
Jessen et al.(2011)
KCS2/DAISY
β-Ketoacyl-coenzyme A synthase
Cuticular wax biosynthesis
Franke et al. (2009); Lee et al. (2009)
KCS9
β-Ketoacyl-coenzyme A synthase
Cuticular wax biosynthesis
Kim et al. (2013)
KCR1
β-Ketoacyl-coenzyme A reductase
Cuticular wax biosynthesis
Beaudoin et al. (2009)
CER2
BAHD acyltransferase
Cuticular wax biosynthesis
Haslam et al. (2012, 2015); Xia et al. (1996)
CER1
Alkane-forming pathway
Cuticular wax biosynthesis
Aarts et al. (1995); Bourdenx et al. (2011)
CER3/WAX2
VLC-Acyl-CoA reductase putative
Cuticular wax biosynthesis
Chen et al. (2003)
ABCG12/CER5
ABC transporter
Cuticular wax transport
Pighin et al. (2004)
LTPG1/LTPG2/LTPG3
GPI-anchored lipid transfer protein (LTPG)
Cuticular wax transport
DeBono et al. (2009); Kim et al. (2012)
LTP3
lipid transfer protein
Cuticular wax transport
Guo et al.(2013); Seo et al. (2011)
CER9
Putative E3 ubiquitin ligase
Post-translational regulation of
Lü et al. (2012), Zhao et al. (2014)
wax biosynthesis
GDSL/CD1
WSD1
Cutin synthase/hydroxyacylglycerol
Cutin and wax biosynthesis and
Beisson and Ohlrogge (2012); Buxdorf et al. (2014);
Transesterase
epidermal patterning
Shi et al. (2013); Yeats et al. (2012b)
Wax synthase
Wax biosynthesis
Li et al. (2008).
17
Figure 4: Overview of the cuticular wax and cutin biosynthesis. CER, ECERIFERUM; WSD, wax
synthase/diacylglycerol acyltransferase; MAH, mid-chain alkane hydroxylase (Yeats and Rose, 2013).
The process of cutin polymerization from 2-monoacylglycerol units had eluded many scientists till date.
A recent study of tomato cutin deficient (CD1) mutant which has limited amount of cutin and
accumulates 2-monoacylglycerol at the fruit surface led to the identification of the member of glycine–
aspartic acid–serine–leucine (GDSL) motif lipase/hydrolase superfamily that acts as the cutin
synthase (Beisson and Ohlrogge 2012; Girard et al., 2012). This CD1 gene is expressed in the
epidermal cells and the encoded GDSL protein is localized extracellularly within the cuticle which
allows cutin polymerization (Yeats et al., 2012b). GDSL is an important gene for cutin synthesis,
therefore we decided to study its relative expression in the grape berries and how its expression
change along the phenological stages and under various treatment.
Plant cuticle biosynthesis, transport and deposition is a complex and highly regulated network of
genetic interplay and is influenced by environmental stress but details of this regulation are not well
understood (Bernard and Joubes, 2013; Nawrath et al., 2013). Apart from the network of transcription
factors that regulate cuticle biosynthesis, namely WIN1/SHN1, MYB106 and MYB16 (Aharoni et al.,
2004; Broun et al., 2004; Oshima et al., 2013), regulatory mechanism that do not involve direct
transcriptional activation or repression by promoter binding have recently been discovered. One such
example is the studies from CER9 which is the first described gene related to cuticle biosynthesis
whose deficiency improves plant response to water deficit (Lü et al., 2012). Although the exact role
18
and mechanism of CER9 which caused these changes in still not clear, but recent finding by Zhao et
al. (2014) reinstated the role of CER9 in cuticle biosynthesis and its role in drought tolerance.
Waxes of several fruits, including grape berries, have showed secondary metabolites presence,
namely oleanolic acid as one of the major component (Casado and Heredia, 1999). Fukushima et al.
(2011) have recently identified two homologs of Medicago truncatula CYP716A12 genes: CYP716A15
and CYP716A17 and showed their ability in terpenoids production in grapes such as oleanolic acid.
CYP716A subfamily members are multifunctional oxidases which are involved in triterpenoid
biosynthesis (Fukushima et al., 2011). They are Cytochrome P450 monooxygenases/hydroxylases
(P450s), which are enzymes found in plants, human and bacteria and catalyze the oxidation of various
substrates by oxygen and NAD(P)H (Nelson et al., 2004; Nelson, 1999). Plant P450s are involved in
secondary metabolism and catalyze the wide variety of monooxygenation/hydroxylation reactions
(Mizutani and Sato, 2011; Shibuya et al., 2006). Several other P450s have been identified in plants
such as Soybean CYP93E1(β-amyrin C-24 hydroxylase) which is involved in soyasaponin
biosynthesis (Achnine et al., 2005). The CYP88D6 (β-amyrin oxidase) was characterized in both
Glycyrrhiza glabra and Glycyrrhiza uralensis. Glycyrrhiza uralensis CYP93E3 was identified as βamyrin 24-hydroxylase and CYP72A154 was found to catalyze C30 oxidation of β-amyrin (Seki et al.,
2011). Fukushima et al. (2011) identified Medicago truncatula CYP716A12 as a multifunctional
enzyme with β-amyrin 28-oxidase, α-amyrin 28-oxidase and lupeol 28-oxidase activities. Authors also
identified homologs of CYP716A12 in grape (CYP716A15 and CYP716A17), indicating that the
function of the CYP716A subfamily among plants is highly conserved. Grape berry skin and
particularly cuticle is rich is in terpenoids (oleanolic acid) requiring putative P450 genes (Seki et al.,
2011; Yonekura-Sakakibara and Saito, 2009) for its productions (Yonekura-Sakakibara and Saito,
2009). These terpenoids have been reported to possess medicinal properties (Jennewein et al., 2001).
The cyclic terpenoid such as oleanolic acid comprises upto 30% of grape berry cuticular waxes and
are important for the wine industry and may determine the efficacy of the alcoholic fermentative
process (Casado and Heredia, 2001; Orbán et al., 2009). Therefore we decided to study the
expression pattern of these two genes (CYP716A15 and CYP716A17) to see the expression pattern
of these genes under water stress.
The list of genes involved in cuticle biosynthesis had been extensive topic of research in both model
and non-model plant and is growing as more and more transcript are being studied. With more and
more genome based techniques and the genetic resources available, it would be feasible to study the
existing list of potential candidate genes that are associated with cuticle biosynthesis, transport and
deposition and would shed more light on the dynamics of cuticle biology in near future (Martin and
Rose, 2014). Understanding of cuticle biosynthetic pathways would bring us closer to an ability to
selectively modify cuticle properties in order to enhance agricultural productivity in fruits such as
grapevine. Nevertheless, in order to make such modification rationally will require an in-depth
understanding of the complexity of cuticle function at molecular level, an area where far less progress
has been made. To this end, further work aimed at understanding the ecophysiological aspects of
cuticle and its adaptive response under environmental stress will provide a framework for
19
understanding the complex interaction of cuticle structure, composition and its functions (Yeats et al.,
2012a; Yeats and Rose, 2013). These findings might reveal the cuticle complexities that underscore
the fact that the cuticle is much more than just a preformed barrier to water loss (Yeats and Rose,
2013).
20
3. Research Objectives and Hypotheses
3.1. Research objectives:
Main objectives of this work are:
1. To characterize grape berry cuticle in terms of its morphology and biochemistry which may
shed light on its stress tolerance and to evaluate the role of cuticle as a barrier to water loss.
2. Qualitative and quantitative estimation of cuticular metabolites during the course of berry
development and along the ripening process.
3. To identify putative genes relating to the cuticle biosynthesis, transport and deposition.
3.2. Research hypotheses
This study is based on following hypotheses:
1. Water deficit affects the cuticle physiological properties in grape berries.
2. Grape berry skin and cuticle architecture are affected by water stress.
3. Spectroscopic techniques provide significant information about the cuticle and its
macromolecular arrangement.
4. Water stress affect cuticle related gene expression in grape berries.
21
4. Materials and Methods
4.1. Field conditions and plant material
Grape berries were harvested from Aragonez (Vitis vinifera) variety grafted on Paulsen 1103 rootstock
along the berry development (June to September of 2014) cultivated at a commercial vineyard
(Herdade do Esporão) located at Reguengos de Monsarraz, Alentejo region.
Grapevines were subjected to two irrigation regimes:
- Sustained Deficit Irrigation (SDI) in which 20% of evapo-transpiration (ETC= 235 mm) were supplied.
- Regulated Deficit Irrigation (RDI): in which 14% of ETc (ETc = 235mm), were supplied.
The general field lay out plan of the vineyard is represented in Figure 1 (Appendix I). To avoid ‗border
effect‘ only berries belonging from the grapevine of middle rows were sampled (columns marked in
colors). Grape berries were randomly sampled from both sides (East and West) of the canopy
subjected to two different irrigation regimes at four developmental stages:
- Pea size (PS): 7 weeks after anthesis (collected at 16.06.2014);
- Véraison (V): 9 weeks after anthesis (collected at 14.07.2014);
- Mid Ripening (MR): 11 weeks after anthesis (collected at 29.07.2014);
- Full maturation (FM): 13 weeks after anthesis (collected at 11.08.2014).
The berries sampled from different phenological stages have been shown in Figure 5. The pre- dawn
water potential (ΨPD) and temperature of both side of the vine was monitored over the period of growth
and maximum air and berry temperature on east and west sides of the vine canopy for SDI and RDI
treatment has been shown in Appendix II and Appendix III respectively.
Figure 5: Grape berries sampled from four different phenological stages: pea size(a), véraison(b), midripening(c) and full maturation(d).
22
For each of the sampling time, approximately 50 bunches representative of the vineyard were
collected. Berries from these bunches was transported at 4ºC to the laboratory. A first sub-sample of
berries was then used to determine the fresh weight and juice was extracted to determine the total
soluble solids (oBrix) and titrable acidity (TA). A second subsample was used for the cuticular
permeance study and a third subsample was frozen in liquid nitrogen and stored at -80ºC for gene
expression analysis.
4.2.Characterization of berry
4.2.1. Determination of Total Soluble Solids (TSS) and Titrable Acidity (TA)
The grape berries were crushed using mortar and pestle and the grape juice of the crushed berries
o
was used subsequently for TSS ( Brix) and titrable acidity determination. The concentration of TSS in
the juice was quantified using a manual refractometer (ITREF 32, Instrutemp). The titrable acidity was
assessed according to Office International de la Vigne et du Vin (OIV, 1990).
4.3. Characterization of cuticle
4.3.1. Isolation of Cuticle
Cuticles were enzymatically isolated from grape berry skins following the protocol described by
Petracek and Bukovac (1995), with slight modifications. An aqueous sodium citrate buffer (50 mM, pH
3.7) with a mixture of fungal cellulase (4% w/v, Sigma, USA) and pectinase (4%, w/v, Sigma, USA)
was used. 1 mM NaN3 was added to prevent microbial growth. In order to facilitate enzyme
penetration, vacuum was applied to the suspension of fruit cuticles and incubated with continuous
agitation at 37ºC for 10-14 days. Cuticular membranes were then manually separated from the
epidermis, rinsed in distilled water and stored under dry conditions.
4.3.2. Isolation of cuticle components
Cuticular components such as waxes were removed by refluxing the isolated cuticle samples in
chloroform:methanol (2:1, v/v) for 3 h at 50ºC. Afterwards, the cuticles were thoroughly washed thrice
in methanol. Cutin isolates were obtained after refluxing the de-waxed cuticles in a KOH (1%, w/v)
methanolic solution at 35-40oC for 48 h in order to hydrolyze cutin matrix (López-Casado et al., 2007).
After this time, residual material appeared as continuous and fragile films.
4.4. Determination of wax content
In order to determine the total wax content, three replicate composed by 10 to 15 berries each, were
used. Berries were immersed in chloroform for 10 seconds and the extracts were left to dry overnight
under hood. The wax content was estimated using the weight by precision (0.1 mg) balance (Radwag,
Poland).
23
4.5. Determination of cuticular permeance
Cuticular water permeance for the grape berries was determined for each developmental stage and
for each treatment (irrigation and sides of canopy) using the methodology of Leide et al. (2007). The
surface of the berries from each treatment was determined using the vernier calipers as the average
of vertical and horizontal diameters by assuming ellipsoid shape of the berries. Three replicates of 10
berries per treatment were used (2 irrigation treatments x 2 sides of the canopy x 3 replicates). The
attachment site of pedicel to the berry was sealed using the paraffin. The permeance of untreated
berries and de-waxed berries was measured. To remove waxes, berries from each treatment were
dipped in aqueous gum arabic solution (45% w/v, Sigma Aldrich) and then allowed to dry on filter
paper at room temperature for approximately 1 hour. Afterwards, the gum arabic film was peeled off
gently from the berries using a small spatula. The berries were then dipped in the chloroform solution
for 10 s, making sure that the chloroform does not dissolve the paraffin from the attachment site of the
pedicel. This technique allows the removal of most of the extra and intra epicuticular waxes
(Buschhaus and Jetter, 2011).
The untreated and de-waxed berries were then placed in the closed bottle containing silica at 25oC
and the amount of water transpired was measured using a balance with a precision of 0.1 mg
(Radwag, Poland) against the time interval of 15 minutes. At least seven data points were recorded: 015min- 30min- 45min- 60min- 75min- 90min.
The calculation of cuticular permeance is based on the equation calculated for tomato by Leide et al.
(2007). The water flow rate of cuticle (F, g/s) for individual set of fruits were determined from the slope
of a linear regression line fitted for the gravimetric data (Appendix IV). Coefficients of determination r2
was also determined and it averaged r2=1. Flux (J in gm -2s-1) was calculated by dividing F by the total
berry surface area as determined previously.
(Eq. 1)
Under conditions of storage in the silica containing bottle, it was assumed that the external water
vapour concentration was nearly zero. Vapour phase-based driving force is calculated using the
difference between the outer water vapour condition and the internal vapour condition and is the
-3
established value considered for the present study which was found to be 23.07 g m . For calculating
the water permeance (P in ms-1), which was based on water vapour concentration, flux was divided by
the vapour phase-based driving force (Δc) for transpiration.
4.6.Ultra-structure of cuticle using transmission electron microscopy
Grape berry skins were analysed using transmission electron microscopy (TEM) at Electron
Microscopy Facility at the Instituto Gulbenkian de Ciência, Oeiras, Portugal. Skins were fixated in
glutaraldehyde solution (2% v/v, with phosphate buffer 0.2 M and pH 7) fixation buffer and stored at
4ºC. Small pieces of fixated skin were sliced into small pieces of about 1-2mm and rinsed thoroughly
24
in fresh buffer. Afterward, skins were post-fixed in osmium tetroxide (2% v/v, in phosphate buffer) for
4h at 4oC and then rinsed again thoroughly in phosphate buffer. Samples were dehydrated using
acetone solution gradients: 40, 50, 60, 70, 95 and 100% with increasing times from 15 min to 1h 30
min for dehydration. Samples were then kept in a mixture of acetone and resin with 1:1 v/v
concentration for 2h in vacuum followed by overnight storage at room temperature. Skins were then
o
embedded in an araldite resin for 1h in vacuum and kept for polymerization during 72h at 60 C. Ultramicrotome (Reichert) with diamond knife was used to obtain transverse sections of approximately 7080 nm. Sections were then observed at 100kV with TEM (Hitachi H-7650). TEM images were analysed
and processed using open source ImageJ software(http://rsb.info.nih.gov/ij). Average of 5-10 images
with 10-15 measurement for each image for each of the parameters studied were considered for
further analysis.
4.7.Attenuated Total Reflectance - Fourier Transform Infrared Spectroscopy (ATR-FTIR)
Infrared spectra of cuticle, skin, de-waxed cuticle and depolymerised cutin were obtained with an ATR
accessory coupled to FTIR spectrometer (Bruker Optics, Ettlingen, Germany). All spectra were
recorded in the 4000 to 600 cm -1 range with 4 cm -1 resolution and accumulating 128 scans. The
cuticle, de-waxed cuticle and depolymerised cutin were used after isolation as described in section
4.3.1 and 4.3.2. For skin, the peels were removed, treated with chloroform for 1h, followed by 1:1 v/v
mixture of chloroform and methanol for 1h followed by methanol for 1h and finally treated with
chloroform for 1h.
The samples were then gently collocated on the spot of the ATR accessory and slowly pressed. The
analysis depth, dp, of ATR-FTIR depends on several factors such as the wave number, λ, the angle of
incidence θ, the refractive index of the ATR crystal (n1), and the sample (n2), as indicated in the
following equation:
(Eq. 2)
In our ATR-FTIR spectrometer, n1 = 2.43 and, considering the refractive index of the cuticle as 1.5
(Holloway, 1982), the penetration depth of ATR into the sample varies between 0.47 μm at 4000 cm-1
-1
and 2.71 μm at 700 cm .
4.8.Gene expression analysis
4.8.1. Extraction of RNA from grape berry cuticle
RNA extraction was performed according to the protocol described by Reid et al. (2006) with
modifications. Berry skins were removed using the sharp scalpel and were grounded to a fine powder
in the liquid nitrogen using the mortar and pestle with PVPP (100mg for 1-2g tissue). Before the
extraction was carried out, the extraction buffer (Appendix V) was pre-warmed at 65oC using the
thermal mixer and 2% β-mercaptoethanol was added to the grounded tissue. The grounded powder
25
was then added to the pre-warmed extraction buffer (1ml/100-500mg tissue) and was shaken
vigorously using the vortex mixer.
o
The mixture of skin material and extraction buffer was then incubated at 65 C for 10 minutes with
continuous mixing. Mixtures were extracted twice with equal volume (1ml) of chloroform:isoamyl
o
alcohol (24:1) and centrifuged at 13200 rpm for 10 minutes at 4 C. The aqueous layer obtained after
centrifugation was transferred to the new tube and centrifuged again at 13200 rpm for 15 minutes at
4oC to remove any remaining insoluble material. To the supernatant, 0.1 vol. (100 µl) of sodium
acetate (3M, pH 5.2) and 0.6 vol (600 µl) of isopropanol were added, mixed thoroughly and then
o
incubated at -80 C for 30 minutes. Nucleic acids were pelleted along with any remaining carbohydrate
o
using the centrifugation at 13200 rpm for 30 minutes at 4 C. The pellet was dissolved in 250 µl of TE
(pH 7.5) and in order to selectively precipitate RNA, 0.3 vol (90 µl) of 8M lithium chloride (LiCl) was
added and the sample was stored at 4 oC for overnight. The following day, the RNA was obtained in
the form of pellet by centrifugation at 13200 rpm for 30 minutes at 4oC and then washed with ice-cold
70% ethanol, air dried and dissolved in 100 µl of DEPC-treated water. Extracted RNA was evaluated
for its concentration, 260/280nm and 260/230nm using Nanodrop ND-2000 spectrophotometer
(Nanodrop Technologies, Wilmington, DE, USA).
4.8.2. Purification of RNA
RNA was purified using the RNeasy Mini Kit protocol (Qiagen). Before following the purification
protocol, DNase digestion was performed for which the DNase I stock solution was prepared by mixing
10 µl RDD buffer with 2.5 µl DNase I. To the 100 µl of extracted RNA sample, 12.5 µl of DNase I stock
solution was added and allowed to stand at room temperature for 10 minutes. Then 350 µl of RTL
buffer was added and mixed well, followed by 250 µl of ethanol (96-100%) and was mixed with
pipetting. The content of the mixture were then transferred to the RNeasy mini spin column and
centrifuged for 15s at 13200 rpm. The flow through was discarded and 500 µl of RPE buffer was
added to the RNeasy mini spin column. After centrifuging it at 13200 rpm for 15s, the flow through was
discarded and 500 µl of RPE buffer was added again to the RNeasy mini spin column. Now, it was
centrifuged for 2 minutes at 13200 rpm and flow through was discarded and centrifugation was again
repeated for another 1 minute at 13200 rpm. RNeasy mini spin column were then placed in the new
1.5 ml collection tube and 30 µl of RNase free water was added. Collection tube was then centrifuged
for 13200 rpm for 1 minute in order to elute the RNA. Purity of the extracted RNA, its concentration,
260/280 nm and 260/230 nm ratio was again determined.
4.8.3. Optimization of RNA extraction protocol
The RNA extraction from grape berries is very difficult because of the presence of lot of phenol
compounds which interfere with the extraction methodology. The content of these agents is highly
dependent on the seasonal variation and prevailing weather conditions and therefore their content can
vary from year to year. The grape berries used for the current year were extremely difficult to process
26
in order to isolate RNA and therefore the available extraction protocols were suitably modified in order
to increase the purity and yield of RNA extracted.
In the first modification of the protocol described above, slight increase in the mixing time (15 minutes)
was done in first step of mixing on thermal mixer. This was expected to facilitate the efficient mixing of
powdered plant material with the extraction buffer and help in the better extraction yield. Subsequent
modifications were made in the centrifugation step by increasing the centrifugation time by up to 5-10
minutes depending upon the steps. In order to have better yield, double precipitation with LiCl was
attempted after precipitating the RNA pellet with LiCl for overnight. However the yield obtained were
not as expected. Finally we precipitated the purified RNA (RNA purified by Qiagen Kit) using 33% LiCl
for 90 minutes on ice and pelleting at 13200 rpm by centrifuging it for 30 minutes. The pellet was then
re-washed with 70% ethanol, re-dried and finally re-dissolved in 30 µl RNAase free water and the
concentration
and
purification
ratios
were
estimated
again
using
Nanodrop
ND-2000
spectrophotometer. The RNA extracted was to be used for the cDNA synthesis using RT-PCR for
which 1000ng of RNA would be required. In recalcitrant samples, RNA was additionally concentrated
using the CentriVap vacuum concentrators (LABCONCO, Kansas City, USA). After concentration
using CentriVap, RNA concentration and 260/280 nm ratio was again determined using a ND-2000
spectrophotometer. RNA integrity was evaluated by 1% (w/v) agarose gel electrophoresis.
4.8.4. DNA synthesis (RT-PCR)
First strand cDNA was synthesized using the Omniscript® Reverse Transcription kit (Qiagen, Hilden,
Germany) according to the manufacturer‘s instructions. The cDNA was prepared from 1000 ng of total
extracted RNA. The reverse-transcription reaction mixture comprised the following components in final
concentrations: buffer RT 1X, 0.5 mM of each dNTP, 1 μM oligo-dT primer, 0.5 units of RNase
inhibitor, 0.2 units of Omniscript Reverse Transcriptase enzyme and template RNA calculated for 1000
ng to make 20 μL of final reaction volume. cDNA was synthesized at 37 ºC for 60 min and the cDNA
was stored at -80 ºC.
4.8.5. Primer design
For PCR amplification, primers for VviKCS6, VviKCS1 and VviGDSL were designed based on the
blast search (http://www.ncbi.nlm.nih.gov/) of these genes against the genome of the tomato
(Lycospersicum esculentum) and for VviCER9, the primer was designed based on the blast search of
this gene against the genome of the Arabidopsis thaliana. For VviLTP3, the primer was designed
based on the cDNA sequence corresponding to the amino acid sequence obtained for the protein
identified in berry cuticle proteome (Zarrouk et al., unpublished data). The primers of VviCYP716A15
and VviCYP716A17 were designed based on the genes identified in the Vitis genome
(http://vitaceae.org). The primers for actin were retrieved from the literature (Reid et al., 2006). The
primer details are represented in Table 3.
27
4.8.6. Quantitative RT-PCR
The cDNAs were diluted 1:50 with RNase free-water. Aliquots of the same cDNA sample were used
with all primer sets for Quantitative Real-time (qRT) PCR. Each reaction was performed in 20 μl
containing 250 nM of each gene-specific primers, 5μl of diluted (1:50) cDNA and 10ul of Power SYBR
Green Master Mix (Bio-Rad).
Table 3: Primers used for Quantitative PCR amplification
Vitis Gene
Primer Sequence
forward/reverse(5’
3’)
Amplicon
Melting
Accession
length(bp)
Temperature
number
o
(Tm, C)
VviKCS1
VviKCS6
VviGDSL
VviCER9
VviLTP3
VviCYP716A15
VviCYP716A17
VviActin
GGAGGATGGTCGGAAGATGT/
20
56.4
XM_002264685.2
TGGAACTGAACCGTCTCCTC
20
56.4
GCCAAGTACCGTCTAGTCCA/
20
56.2
TTCTTCGTAGACGCATCAGT
20
56.1
GGAAACCCTAGCTGCTCTCT/
20
56.4
GGTGCTTGACCTGCCATAAC
20
56.4
TGGAAGCATTCATGCATCAGG/
21
55.7
AGCACAAAGCCGTACTCTGA
20
56.4
GGTCTGGAGAGTGATGATGGA/
21
55.8
Proteomic data in
CTTACTGAGTGGTGCCCAGA
20
56.5
our lab
GATGCCACATGAATGAAATGGAAA/
24
54.4
NM_001281186.1
TGATAAGGAATGTAATGGCAGCA
23
54.5
TGAGAGCAAGGCCTCAAAAAC/
21
55.8
GCATCCATCTTCATCTGTAGCC
22
55.5
CTTGCATCCCTCAGCACCTT/
20
54.0
TCCTGTGGACAATGGATGGA
20
53.9
XM_002283694.3
XM_002277667.2
XM_010649426.1
NM_001281147.1
Reid et al.(2006)
Thermal cycling conditions used for qPCR were: 95oC for 10 min followed by 95oC for 10s, 60oC for
10s and 72oC for 10s for the total of 40 cycles. qRT-PCR was performed in the iQ5 2.0 Standard
Edition (Bio-Rad, Hercules, CA, USA), sequence detection system in a 96-well reaction plate.
o
o
Dissociation curves were obtained by heating the amplicon from 55 C- 95 C and these curves for
each amplicon were then analyzed to verify the specificity of each amplification reaction. No evidence
for any primer-dimer or other non-specific product formation was detected for any of the primer pairs
used. Each PCR cycle was run in triplicate within the same plate and the average of cycle threshold
(Ct) values obtained from the technical replicates was obtained. Gene transcripts were quantified by
comparing the Ct of the target gene with that of the actin as described below. Gene expression was
expressed as mean and standard error calculated over the three biological replicates. The relative
gene expression was determined using efficiency (E) method:
(Eq. 3)
28
(Eq. 4)
-where Egene is the efficiency of our target gene and Eactin is efficiency of actin (control). Slope is
obtained from a semi-log regression line plot of Ct values vs. log of input nucleic acid.
4.9.Statistical analysis
All the experiments were performed in triplicate and the gene expression study was also conducted
based on three biological and three technical replicates. All the results are expressed as mean±
standard error (SE). Data were examined by analysis of variance (ANOVA) with SPSS software
package 16.0 for Windows (SPSS Inc., Chicago, USA). When the t-test was significant, means were
separated by Duncan‘s multiple range tests (p ≤ 0.05).
29
5. Results
5.1.Grape berry characterization
The fresh weight (FW) and dry weight (DW) increased along the phenological stages from pea size
stage to full maturation (Table 4). Significant differences could be observed between the irrigation
treatments and two sides of canopy at véraison and full maturation stage. Total soluble solids (TSS,
o
Brix) increased along phenological stages as seen in Table 4. Significant differences were observed
only at véraison and full maturation stage, in what concern total soluble solids content between
irrigation treatments and cluster position within the canopy (e.g. east and west sides).
o
Table 4: Effect of different irrigation regime on the Fresh (FW), Dry weight (DW), Brix, Titrable acidity (TA)
and pH for different phenological stages.
Berry Properties
FW(gram/berry)
DW(gram/berry)
o
Brix
Titrable Acidity (g L-1)
pH
Irrigation
Treatment
East
West
SDIE
SDIW
RDIE
RDIW
East
West
SDIE
SDIW
RDIE
RDIW
East
West
SDIE
SDIW
RDIE
RDIW
East
West
SDIE
SDIW
RDIE
RDIW
East
West
SDIE
SDIW
RDIE
RDIW
Pea Size
0.76±0.02
0.87±0.05
0.077±0.002
0.089±0.004
5.87±0.74
6.10±0.80
Véraison
Mid
Ripening
b
1.35±0.07
1.03±0.01a
1.09±0.04a
1.26±0.02b
1.81±0.08
1.67±0.10
1.79±0.07
1.64±0.08
2.01±0.02
1.98±0.18
1.78±0.10
2.15±0.06
0.235±0.015c
0.172±0.003a
0.197±0.01ab
0.217±0.004bc
0.368±0.016
0.327±0.02
0.363±0.018
0.321±0.017
0.272±0.002ab
0.271±0.024ab
0.243±0.015a
0.303±0.011b
18.60±0.25
17.53±0.47
18.60±0.35
18.13±0.07
21.03±0.41
20.47±0.29a
22.07±0.18b
22.73±0.18b
b
14.97±0.03
12.73±0.37a
15.60±0.31b
13.27±0.18a
16.45±0.05
16.58±0.04
2.72+0.01
2.69+0.02
Full
Maturation
a
a
8.03±0.04
b
9.25±0.11
7.38±0.44a
8.95±0.22b
5.18±0.13
ab
4.69±0.21
4.73±0.06ab
4.58±0.23a
b
5.43±0.16
c
5±0.03b
4.73±0.17ab
4.55±0.11a
c
3.07+0.01ab
3.03+0.01a
b
3.10+0.02
3.10+0.02b
3.47+0.05
3.48+0.09
3.55+0.08
3.53+0.02
3.41+.04 a
3.46+0.01ab
bc
3.51+0.01
3.54+0.01c
Titrable acidity (TA) expressed as g L-1 of tartaric acid equivalent. SDI: Sustained Deficit Irrigation; RDI: Regulated
Deficit Irrigation. E- East; W- West. The values are represented as mean± SE. Different letters (a, b, c, ab, bc)
indicate significant differences among treatments using Duncan‘s test (p ≤ 0.05).
Titrable acidity (TA) result showed that the acidity remarkably decreased from the pea size stage to
the full maturation stage (Table 4). No significant differences between the east and west side were
observed at the pea size stage, however significant differences in acidity content between the different
irrigation and berry side treatments were observed at véraison, mid-ripening and at full maturation
stages. The pH of grape juice was virtually same and increased after véraison till mid ripening and
30
decreasing slightly upto the full maturation. Final juice pH did not differ by more than 0.06 pH units
among the treatments. There was no apparent trend among treatment (Table 4).
5.2. Grape berry cuticle characterization
5.2.1. Quantitative changes in the wax content
Wax weight per unit surface was estimated in berries over the different developmental stages and is
represented in Figure 6. It was found that maximum wax content was obtained at the pea size stage.
Figure 6: Wax content (µg.mm-2) for different phenological stages. SDI: Sustained Deficit Irrigation; RDI:
Regulated Deficit Irrigation. E- East; W- West. PS- pea size; V- Véraison; MR- Mid Ripening; FM- Full
Maturation. The values are represented as mean± SE.
At the pea size stage, no significant differences between the east and west side were observed.
However it was observed a tendency of waxes to be higher at west side compared to east side.
Véraison stage showed a highly reduced wax content in both treatments as compared to pea size
stage. In addition, RDI presented slightly lower content of waxes as compared with SDI, though the
differences were not significant. SDI west had relatively lesser waxes compared to its east side and no
differences in the wax content between east and west side were observed in RDI.
At mid ripening stage, the wax content increased as compared to véraison stage. No significant
differences due to berry position were observed in SDI treatment. However RDI east had significantly
higher wax content compared to the west side.
At full maturation, wax content of SDI east was higher when compared to the west side. However, the
opposite trend was observed in RDI treatment with west side of the treatment having more wax
content and the difference was quite significant between the east and west side of the RDI treatment.
5.2.2. Cuticular water permeability during grape berry fruit development
Cuticle permeance of the grape berry was determined during the different developmental stages both
in intact and in de-waxed berries (Table 5).
31
Cuticle permeance of intact berries was maximal at pea size stage, and gradually decreased along
berry development (Table 5). At pea size stage, the berries belonging from the west side showed
increased permeance compared with berries belonging from the east side. However, the differences
were not significant. At véraison, permeance decreased by up to 26% compared to the pea size stage.
Significant differences between the irrigation type and canopy sides were observed. SDIE showed the
lowest cuticle permeance. At mid ripening, although a tendency of higher permeance of berries
belonging from the west side of canopy in the two irrigation treatments (SDI and RDI) were observed,
no significant differences were recorded. At full maturation, no significant differences between the
irrigation treatments or two sides of the canopy was recorded. Overall, the permeance decrease at
maturation stage was about 34% compared to the pea size stage.
Table 5: Permeance for water (×10−5 ms−1) of untreated and chloroform treated de-waxed grape berry var.
Aragonez for different phenological stages.
Category
SDIE
SDIW
RDIE
RDIW
V
0.93±0.01a
1.08±0.02b
1.04±0.03b
1.08±0.02b
MR
0.85±0.03a
0.93±0.01a
0.79±0.02a
0.9±0.09a
FM
0.67±0.03a
0.76±0.08a
0.67±0.02a
0.62±0.02a
V
2.4±0.24a
2.45±0.12a
2.23±0.17a
2.07±0.06a
FM
1.83±0.21
PS
Untreated
PS
East
West
1.26±.06
1.36±0.08
1.46±0.08
1.56±0.0
Treated Dewaxed
a
a
2.15±0.26
a
1.7±0.16
b
2.78±0.56
SDI: Sustained Deficit Irrigation; RDI: Regulated Deficit Irrigation. E- East; W- West. PS- Pea size stage; VVéraison; MR- Mid Ripening; FM- Full Maturation. Treated berries are with waxes removed using gum
arabic+chloroform. The values are represented as mean± SE. Different letters (a, b) indicate significant
differences among treatments using Duncan‘s test (p ≤ 0.05).
In contrast with intact berries, the permeance of de-waxed berries increased along berry development
when waxes were removed (Table 5). No differences were observed between east and west sides at
pea size stage. The permeance of de-waxed berries increased by approximately 1.2-fold at this stage
compared to the intact berries (Table 5). At véraison, the cuticle permeance was higher compared to
the pea size. However no significant differences between the treatments were observed. The cuticle
permeance of de-waxed berries increased approximately 2-fold as compared with the intact berries. At
full maturation, no significant differences between the two sides were observed in SDI treatment.
However in RDI, west side presented significantly higher permeance than the east side. At this stage,
the permeance of de-waxed berries increased upto 4-fold than untreated berries.
5.2.3. Ultra-structure of grape berry cuticle using transmission electron microscopy (TEM)
The ultra-structure of grape berry cuticle examined during the different developmental stages and
under the different treatments using TEM are shown in Figures 7-10. Right from the onset of pea size
stage, the formation of cuticle is visible and is often seen with minute cuticular ridges. At pea size
32
stage (berries with diameter of 1.9 cm), the average thickness of the cuticle was about 2.7 µm. Cuticle
thickness increased to around 3 µm at véraison (berries with diameter of 2.1 cm).
Figure 7: Transmission electron micrographs of transverse sections of grape berry cuticle at pea size
(PS)- East (a), West (b). EW- Epicuticular Waxes; CW- Cell wall; IC-inner cuticle; C- Cuticle; P-Pectin like
material. Arrows indicate EW. Bar: 0.5 µm.
33
Figure 8: Transmission electron micrographs of transverse sections of grape berry cuticle at véraison (V)SDIE (a), SDIW (b), RDIE (c), RDIW (d). EW- Epicuticular Waxes; CW- Cell wall; IC-inner cuticle; C- Cuticle;
P- Pectin like material. Arrows indicate EW. Bar: 0.5 µm
34
Figure 9: Transmission electron micrographs of transverse sections of grape berry cuticle at mid-ripening
(MR)- SDIE (a), SDIW (b),RDIE (c), RDIW (d). EW- Epicuticular Waxes; CW- Cell wall; IC-inner cuticle; CCuticle; P- Pectin like material. Arrows indicate EW. Bar: 0.5 µm
35
Figure 10: Transmission electron micrographs of transverse sections of grape berry cuticle at Full
maturation (FM)- SDIE (a), SDIW (b),RDIE (c), RDIW (d). EW- Epicuticular Waxes; CW- Cell wall; IC-inner
cuticle; C- Cuticle; P- Pectin like material. Arrows indicate EW. Bar: 0.5µm.
36
The outer most zone of the berry skin in the pea size stage is constituted by a convoluted and electron
light amorphous layer with rugose appearance of variable thickness (0.3-0.4µm), corresponded to the
epicuticular waxes. Beneath this wax layer in all the stages, cuticle and inner cuticle can be
distinguished, though the differentiation might not be clearly visible. Cuticle is generally seen as an
amorphous layer above the cell wall material. On the other hand inner cuticle includes all cuticle
without the epicuticular wax layer as seen in Figure 7-10. Inner layer formed more than three-fourth of
the cuticle. Inner cuticle layer present on the inner most side of the cuticle surface appears more
electron dense and reticulate probably due to the incrustation formed due to the polysaccharides or
other cell-wall materials including pectinaceous materials as seen in Figure 7-10. The details of the
TEM analysis are presented in the Table 6. Five to ten images with 10-15 measurements for each
TEM images of the berry skin have been analysed and differentiated into 5 different parameters to
draw comparison between different phenological stages and between different treatment types. The
parameters under study were: 1) Cuticle; 2) Epicuticular waxes; 3) Inner cuticle; 4) Cell wall; 5) Dark
pectin like material. All these parameters have been clearly demarcated and showed in the Figure 710.
5.2.3.1. Cuticle
Cuticle increases from pea size to véraison stage and decreases thereafter (Table 6). At pea size
stage, there were no significant differences between the two sides: east and west. The maximum
cuticle thickness was observed at véraison and significant differences between the irrigation regimes
and side of the canopy were observed (Table 6). The cuticle thickness decreased from véraison to the
full maturation. Significant differences between the irrigation type and two sides of canopy were
observed at mid ripening and full maturation with west side having significantly higher thickness
compared to the east side.
5.2.3.2. Epicuticular waxes
Epicuticular waxes increased from pea size stage to full maturation stage (Figure 11). At pea size, no
significant differences were observed between the two canopy sides. Contrasting with results of
extractable soluble waxes referred above (section 5.2.1.), the thickness of epicuticular waxes
increased from pea size to véraison. At véraison, SDIE showed the lowest epicuticular waxes
thickness while RDIW showed the highest. At mid-ripening, epicuticular waxes increased and RDIW
showed significantly higher thickness compared to all the other treatments. Trend continued at full
maturation stage and the thickness increased with significant differences between irrigation type and
two sides could be observed. In general the west side had higher epicuticular wax thickness than the
east side, and RDIW had the highest thickness.
37
Figure 11: Epicuticular wax of the grape berries using transmission electron microscopy
5.2.3.3. Inner cuticle
Inner cuticle showed similar trend of increase as the cuticle and thickness increased from pea size to
véraison. However no significant differences were observed between the irrigation treatments and
sides of the canopy, both at pea size and véraison. From véraison, the thickness of inner cuticle
decreased to full maturation and significant differences were observed between the two irrigation
treatments (SDI and RDI) and canopy sides. At full maturation, RDI in general showed the higher inner
cuticle being RDIW the highest one (Table 6). Overall from the irrigation treatment, the thickness of
inner cuticle on the west side was significantly higher than the east side.
5.2.3.4. Cell wall
Cell wall increased from pea size to véraison and decreased thereafter (Table 6). Differences between
the irrigations (SDI and RDI) and canopy sides (East and West) were significant at all stages except at
pea size. Since véraison onward, the berries belonging from the west side showed significantly higher
cell wall thickness compared to the east side. Thickness of cell wall was significantly lesser in RDI
compared to the SDI at mid ripening and full maturation.
5.2.3.5. Dark pectin like layer
A dark and amorphous layer was observed at cell wall and inner cuticle interface which was likely to
be pectinaceous material. This pectin like dense layer increased in thickness from pea size to full
maturation stage. At pea size, thickness of this dense layer showed no significant differences between
the two sides. At véraison the pectinaceous material increased and was higher in SDIW in respect to
SDIE and RDIW in respect to RDIE. Pectinaceous layer further increased at mid ripening but no
significant differences were observed between all treatments. At full maturation, pectinaceous layer
reached its maximum thickness, and SDIE showed the lowest thickness (Table 6).
38
Table 6: TEM analysis of the grape berry skin
Parameter
Cuticle
East
West
Pea Size
Véraison
2.67±0.05
2.78±0.04
SDIE
SDIW
RDIE
RDIW
2.87±0.06a
b
3.00±0.03
3.23±0.02b
3.32±0.01c
2.72±0.04bc
c
2.92±0.10
2.71±0.04a
2.96±0.08ab
Inner cuticle
East
West
2.24±0.02
2.43±0.03
SDIE
SDIW
RDIE
RDIW
2.42±0.09
a
2.54±0.02
2.67±0.08a
2.72±0.02a
a
2.08±0.03
b
2.27±0.09
2.17±0.05ab
2.48±0.02c
1.86±0.02
b
2.21±0.06
2.16±0.02b
2.32±0.03c
Cell Wall
East
West
0.99+0.01
1.04±0.02
SDIE
SDIW
RDIE
RDIW
1.01±0.02a
a
1.14±0.04
b
1.15±0.02
1.33±0.02b
0.92±0.05a
ab
0.99±0.06
a
0.72±0.03
0.85±0.01b
0.90±0.02a
c
0.98±0.05
b
0.69±0.01
0.83±0.02bc
Pectin like layer
East
West
0.55±0.02
0.56±0.02
SDIE
SDIW
RDIE
RDIW
0.61±0.02
0.69±0.02b
0.65±0.03ab
0.74±0.01c
a
Mid Ripening
a
a
0.69±0.04
0.70±0.04a
0.67±0.02a
0.78±0.02a
Full Maturation
2.41±0.04b
c
2.83±0.04
2.70±0.04a
2.73±0.02b
a
a
0.75±0.02
0.86±0.02b
0.85±0.03b
0.87±0.03b
SDI: Sustained Deficit Irrigation; RDI: Regulated Deficit Irrigation. E- East; W- West. PS- pea size; V- Véraison;
MR- Mid Ripening; FM- Full Maturation. The values (thickness in µm) are represented as mean± SE. Different
letters (a, b, c, ab, bc) indicate significant differences among treatments using Duncan‘s test (p ≤ 0.05).
5.2.4. Spectral characterization of cuticle, skin and cutin
The FTIR spectral analysis of isolated grape berry cuticle allowed the identification of several band
characteristic of plant cuticle. Figure 12-14 shows the FT-IR spectrum between 4000 and 600 cm -1 for
an isolated grape berry cuticle, skin, and cutin respectively. The complex FTIR spectrum shows
several absorption bands. The assignments for these bands were facilitated by previous data based
on chemical composition of the cuticle and the study made on different isolated cuticular membranes
(Espana et al., 2014; Luque et al., 1993; Ramírez et al., 1992).
5.2.4.1. Spectroscopic characterization of cuticle
The cuticle (both inside and outside) of grape berry showed broad medium intensity peak at 3300 cm -1
and a weak band at approximately 2921 cm -1 (Figure 12). The broad band is indicative of the hydroxyl
group stretching vibrations where hydroxyl group is hydrogen bonded. Absorption bands at 2921 cm -1
corresponded to asymmetrical vibrations of methylene (CH2) groups, νa(CH2).
Weak IR absorption bands were also observed at around 3050 cm
-1
which corresponds to carbon-
hydrogen stretching vibrations in aromatic constituents, namely the benzene derivative molecules.
These bands were accompanied by the corresponding δ(CH2) bending vibrations at around 1380 and
761 cm
−1
that are potentially associated with hemicelluloses. These bands in general were ascribed to
the aliphatic material present in the plant cuticle which are cutin, waxes and cutan.
Weak band around 1496 cm -1 was assigned to aromatic stretching vibrations, ν(CC). A weak band at
around 1728 cm-1 corresponding to the carbon-oxygen stretching vibrations, ν(C=O) of ester groups
39
accompanied by a single band at around 1166 cm -1 attributed to the asymmetrical (or symmetrical) CO-C stretching ester vibrations. These bands were associated to the cutin matrix made by esterified
bonds: i.e. the bond that links the different hydroxyl and epoxy fatty acids to form the cutin crosslinking (Holloway, 1982). These bands showed variable intensity depending on the treatment type and
varied along the phenological stages with no significant variations as seen in Figure 12.
In addition to these important bands, other minor absorptions were also observed. Bands in the region
of 1650-1500 cm-1 spectral region with variable intensity were related to the aromatic domain of the
cuticle, mainly formed by phenolic compounds and C=C functional groups which confirms the
-1
presence of benzene derivative molecules. The strong band around 1600 cm assigned to aromatic
stretching vibration was generally found along all treatments and in all phenological stages (Figure
12). The presence of medium intensity band appears around 1436 cm-1 corresponding to an aromatic
C-C stretching vibration is characteristic of the aromatic ring conjugated with unsaturated groups.
Some bands between 1300-1200 cm-1 assigned to the oxygen-hydrogen bending vibrations, δ(OH)
and these bands overlap to some degree with the neighbouring band at around 1218 cm-1 which is
assigned to ν(CC) vibration while band at around 1270 cm-1 is assigned to δ(OH).
The ν(C-O) of alcoholic group appear around 1090 cm-1. This band appeared as weak, narrow band.
Band at around 830 cm-1 corresponded to the carbon-hydrogen and carbon-carbon out of plane
bending vibrations. Some variations between the treatments were also observed. The general
tendency of RDI having higher intensity of bands compared to the SDI with west side having stronger
band absorption compared to the east side was observed. However, some minor deviation from the
general trend was seen in pea size stage where two sides of canopy showed opposite trend. Also the
two sides of cuticle showed differences in intensities of the absorption bands with outer side of cuticle
had stronger band absorption compared to the inner side.
FT-IR spectra of de-waxed cuticle was also studied in order to see the differences between the intact
cuticle and cuticles with the waxes removed. After wax removal, the intensity of bands associated with
the C-H groups reduced (Figure 15).
40
Figure 12: Attenuated Total Reflectance-Fourier Transform Infrared (ATR-FTIR) of inner and outer side of
cuticle. Pea size (a); Véraison(b); Mid ripening(c); Full maturation(d). SDI: Sustained Deficit Irrigation; RDI:
Regulated Deficit Irrigation. E- East; W- West. Red- SDIE; Blue- SDIW; Green- RDIE; Black-RDI W.
Continuous line shows inner side of the cuticle, shaded line is outer side of the cuticle. Arrows indicate
important peaks: (a) 2925 cm -1; (b) 1722 cm -1; (c) 1602 cm -1 (d) 1027 cm -1. A1-A4 in legend of the FTIR
spectra represents four phenological stages from Pea Size to Full Maturation respectively.
41
5.2.4.2. Spectroscopic characterization of skin
The cuticle of grape berry was also compared with the berry skin. The ATR-FTIR of berry skin showed
that most of spectral properties of berry skin were similar to the cuticle with more intensity. The bands
in the region of 1800 to 900 cm −1 are corresponding to the polysaccharide nature of the skin (Figure
13). The peak vibrations at around 1099cm-1 and 1168 cm-1 were assigned to the ν(C-O-C) stretching
vibration corresponding to ester linkages while band at around 896 cm -1 was assigned to (C-H)
bending(out of plane) corresponding to aromatic compounds. These bands may constitute pectin like
substances observed as an extension of cell wall in TEM images. Bands had higher intensity on the
west side compared to the east at pea size and véraison, whereas east side of both irrigation
treatments (SDI and RDI) tend to have higher intensity of these bands compared to the west side at
mid-ripening and full maturation stages. Also no consistent pattern in the intensity could be observed
in the difference between the irrigation treatments as well. Bands in the ―fingerprint‖ region (600-1500
-1
cm ) showed some spectral differences but these differences did not show any significant pattern of
differences along the berry ripening. .
42
Figure 13: Attenuated Total Reflectance-Fourier Transform Infrared (ATR-FTIR) of skin of grape berries
(Vitis vinifera ,cv.Aragonez). Pea size (a); Véraison(b); Mid ripening(c); Full maturation(d). SDI: Sustained
Deficit Irrigation; RDI: Regulated Deficit Irrigation. E- East; W- West. Red- SDIE; Blue- SDIW; Green- RDIE;
Black-RDI W. Spectra on the top is the enlarge view of the right panel in range of 900-1800 cm -1
characteristic of polysaccharides. A1-A4 in legend of the FTIR spectra represents four phenological
stages from Pea Size to Full Maturation respectively.
The additional peak at around 1525 cm -1 was found in the skin samples which were not present in the
cuticles. This peak was assigned to the stretching vibration, ν(C-C) of aromatic compounds which
constitute phenolic compounds. The intensity of this band increased along the berry ripening. It was
also seen that intensity of this band was higher on east side of the two irrigation treatments compared
to the west side. Also RDI had higher intensity of band at 1525 cm -1 compared to SDI (Figure 13).
5.2.4.3. Spectroscopic characterization of cutin
The IR spectrum of cutin is characterized by broad medium to strong intensity band at around 3250
cm-1 (Figure 14). This broad band is indicative of hydroxyl group stretching vibrations where hydroxyl
group is hydrogen bonded. The depolymerised cutin showed a very weak band at around 2918 and
-1
2848 cm . Alkaline hydrolysis leads to depolymerised cutin which showed shifted peak at around 1580
-1
-1
cm which were generally found around 1600 cm in the cuticle. Several weak peaks corresponding
to δ(CH2) bending vibrations at around 1380 cm−1 in cuticle were missing (Figure 14).
43
44
Figure 14: Attenuated Total Reflectance-Fourier Transform Infrared(ATR-FTIR) of depolymerised cutin of
grape berries(Vitis vinifera,cv.Aragonez ). Pea size (a); Véraison(b); Mid ripening(c); Full maturation(d).
SDI: Sustained Deficit Irrigation; RDI: Regulated D Deficit Irrigation. E- East; W- West. Red- SDIE; BlueSDIW; Green- RDIE; Black-RDI W. A1-A4 in legend of the FTIR spectra represents four phenological
stages from Pea Size to Full Maturation respectively.
Instead the methylene groups had three bending vibrations: wagging, twisting and rocking vibrations.
In IR spectra, these modes were assigned to single strong peak at around 1380 cm -1 which was found
in all phenological stages. The shape and relative intensities of the different peaks located at 1143,
-1
1091 and 1006 cm can be clearly assigned to the carboxylic acid derivatives with ν(O-C) stretching
vibrations and O-H deformations in secondary alcohols and define the infrared cellulose fingerprint.
The characteristic shifted peak at 1580 cm -1 and the corresponding band present near 829 cm-1 and
702 cm-1 may be related to phenolic compounds and aromatic compounds present in the cutin(Figure
14).
The spectral comparison of cuticle, de-waxed cuticle, skin and depolymerised cutin is represented in
Figure 15. De-waxed cuticle showed peak around 3300 cm-1 assigned to hydroxyl (OH) group which
was of lesser intensity compared to the intact cuticle. However skin showed band vibration stronger
than cuticle and de-waxed cuticle. Depolymerised cutin showed strong band intensity at around 2900
-1
cm assigned to methylene group which are exposed after depolymerisation of cutin.
Figure 15: Spectral Comparison between berry cuticle, de-waxed cuticle, skin and depolymerised cutin.
Red- Cuticle; Blue- De-waxed cuticle; Green-Skin; Black- Depolymerised Cutin.
45
5.2.5. Expression profiling of cuticle related genes
The mRNA expression levels of fatty acid elongase 3-ketoacyl-CoA synthase (VviKCS1), very-longchain fatty acid β-ketoacyl-CoA synthase (VviKCS6), VviGDSL, Ubiquitin ligase (VviCER9), lipid
transfer protein 3 (VviLTP3), multifunctional oxidases (VviCYP716A15, and VviCYP716A17) were
determined by real time quantitative PCR during different phenological stages subjected to different
treatment: two irrigation regimes and two sides of canopy. Transcripts for each of the studied genes
showed different expression pattern under different treatment along the berry ripening.
5.2.5.1. Expression level of VviKCS1 gene in the cuticle of grape berry during different
phenological stages
The expression of VviKCS1 was detected in the berry in all treatments since pea size except at the full
maturation stage (Figure 16). The expression for VviKCS1 increased at véraison and decreased
thereafter. No significant differences in the expression level were observed between the treatments
(irrigation and cluster position) along the berry development.
Figure 16: Expression of the gene VviKCS1 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after anthesis); VVéraison(9 weeks after anthesis); MR- Mid Ripening(11 week after anthesis); FM- Full Maturation(13
weeks after anthesis).
5.2.5.2. Expression level of VviKCS6 gene in the cuticle of grape berry during different
phenological stages
The transcripts of VviKCS6 were detected in grape berry since pea size in all treatments and
afterwards its expression level was maintained till mid-ripening and decreased at full maturation
(Figure 17). No significant differences between irrigation regimes and canopy sides were observed.
46
Figure 17: Expression of the gene VviKCS6 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after anthesis); VVéraison(9 weeks after anthesis);MR- Mid Ripening(11 weeks after anthesis); FM- Full Maturation(13
weeks after anthesis).
5.2.5.3. Expression level of VviGDSL gene in the cuticle of grape berry during different
phenological stages
The transcripts of VviGDSL were detected since pea size and the expression peaked at véraison and
decreased thereafter till the full maturation as seen in Figure 18. Water deficit and side of canopy had
no significant differences in the expression level of VviGDSL.
Figure 18: Expression of the gene VviGDSL in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after anthesis); VVéraison(9 weeks after anthesis);MR- Mid Ripening(11 weeks after anthesis); FM- Full Maturation(13
weeks after anthesis).
5.2.5.4. Expression level of VviCER9 gene in the cuticle of grape berry during different
phenological stages
VviCER9 was expressed in all phenological stages except at full maturation (Figure 19). The VviCER9
attained its maximum expression at véraison. Significant differences were observed at pea size, being
the west side up-regulated in relation to the east side. At mid ripening the VviCER9 was only
expressed in RDI berries (east and west).
47
Figure 19: Expression of the gene VviCER9 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after anthesis); VVéraison(9 weeks after anthesis);MR- Mid Ripening(11 weeks after anthesis); FM- Full Maturation(13
weeks after anthesis).
5.2.5.5. Expression level of VviLTP3 gene in the cuticle of grape berry during different
phenological stages
Transcripts of VviLTP3 were detected in the grape berry cuticle since pea size. VviLTP3 showed peak
of expression at véraison with up-regulation in RDIW berries. VviLTP3 expression was downregulated
thereafter till full maturation in all treatments (Figure 20). At full maturation, significant differences in
the expression were observed where VviLTP3 showed higher expression under RDIW when
compared to all the other treatments.
Figure 20: Expression of the gene VviLTP3 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size(7 weeks after anthesis); VVéraison(9 weeks after anthesis);MR- Mid Ripening(11 weeks after anthesis); FM- Full Maturation(13
weeks after anthesis).
5.2.5.6. Expression level of VviCYP716A15 gene in the cuticle of grape berry during different
phenological stages
The transcripts of VviCYP716A15 were detected in the berry cuticle in all phenological stages (Figure
21). The expression of VviCYP716A15 peaked at véraison and decreased thereafter. Significant
differences between the two irrigation treatments and two sides of canopy were observed at véraison
and mid ripening.
48
Figure 21: Expression of the gene VviCYP716A15 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after anthesis); VVéraison (9 weeks after anthesis);MR- Mid Ripening (11 weeks after anthesis); FM- Full Maturation (13
weeks after anthesis).
5.2.5.7. Expression level of VviCYP716A17 gene in the cuticle of grape berry during different
phenological stages
VviCYP716A17 was expressed in all phenological stages with maximum expression at véraison
(Figure 22). No expression was seen in SDIE at full maturation stage. Both at véraison and full
maturation stages VviCYP716A17 was up-regulated in RDI berries.
Figure 22: Expression of the gene VviCYP716A17 in grape berry cuticle of SDI and RDI on two sides of the
canopy: East and West. Values presented are means ± SE (n ≥ 3). PS- Pea size (7 weeks after anthesis); VVéraison (9 weeks after anthesis);MR- Mid Ripening (11 weeks after anthesis); FM- Full Maturation(13
weeks after anthesis).
49
6. Discussion
The present investigation was carried out in order to characterize the grapevine berry cuticle (Vitis
vinifera cv. Aragonez) under water deficit conditions and analyse the component of berry cuticle such
as waxes and the role they play in regulating the loss of water from the surface of the berries. Several
previous studies have been conducted describing the effect of water deficit on berry quality and
development (Reviewed by Chaves et al., 2010) but no studies have been reported regarding the role
of cuticle in grape berries and the relation between the cuticle component and water stress remain
elusive to-date. Cuticle studies have so far been limited to Arabidopsis and more recently to tomato
fruits but this characterization of cuticle in grape berries would be the first such study in a nonclimacteric fruit.
6.1.Water deficit affects berry qualities
The results show the increase in berry fresh and dry weight along the ripening. Water deficit conditions
are already reported to interfere in the cell division process resulting in lesser fresh weight of berries
(Thomas et al., 2006) which is in accordance with our data. The total soluble solids (TSS) are one of
the most important grape wine qualities that are affected under water deficit conditions. Our results are
in accordance with Deluc et al. (2009) and Okamoto et al. (2004) who also reported the increase in
total soluble sugar in grape berries under deficit conditions. TSS and acidity showed more marked
increase/decrease in the RDI at véraison stage which suggests that the onset of ripening in RDI
berries is delayed in comparison to the SDI berries as reported by Zarrouk et al. (2012). The titrable
acidity (TA) results obtained in the present study are also in accordance with the previous studies
wherein several authors have reported that the TA decreases with the different phenological stages
with maximum decrease reported at the onset of ripening (De la Hera-Orts et al., 2005; Sun et al.,
2010). Several studies previously conducted have shown that reduced acidity content may be due to
the additive result of a reduced synthesis of malic and tartaric acid during the berry development
(Blouin and Guimberteau, 2000; Esteban et al., 1999; Souza et al., 2005). The higher temperature
responsible for higher malic acid respiration rate due to more exposure to the sunlight may account for
this effect. In our present study, berries belonging from the west side experienced higher temperature
compared to the east side due to more hours of exposure to the sunlight (Appendix III), which affects
the acidity content, being comparatively lower on the west side than the east one in both irrigation
regimes at mid ripening and full maturation. RDI treatment shows always the lower acidity compared
to the SDI. This is in accordance to several literature that have shown that increased water deficit had
resulted in lower TA value as in the case of RDI where the water stress was more pronounced
compared to the SDI (Deluc et al., 2009; Zarrouk et al., 2012).
6.2. Water stress affects cuticular wax accumulation and cuticular permeability
The analysis of wax content per unit surface area suggests that maximum wax accumulation occurred
at the early stages of growth and decreases at véraison. Nonetheless it is important to keep in mind
that véraison stage is characterized by rapid enlargement of berries which is probably not
accompanied by similar rate of wax deposition. At mid-ripening stage, the wax content increases as
50
compared with véraison in all treatments but decreases at full maturation. These results imply the
possibility of a new wax biosynthesis after véraison. However, the reason for a less wax content at full
maturation remains unclear. The inconsistency in the wax deposition along development had also
been reported previously by Yamamura and Naito (1983) who reported an increase of wax content in
Delaware berry variety during early pre-véraison stages that remained constant thereafter. In contrast,
-2
Radler (1965) reported no change in the total waxes (1 μg mm ) during berry growth. In Pinot Noir
berries, wax content increased across berry development (Comménil et al., 1997). Our results for
Aragonez suggest that maximum wax synthesis occurs during early berry development stages and
rate of synthesis/deposition reduces in the late stages. The contrasting reports on the amount of wax
per unit surface area could be the consequence of variability in wax extraction methods which
interferes with the solubility of the waxes in the solvent used. Corroborating theses hypothesis, the
ultrastructure analysis using TEM revealed that thickness of wax layer increased along berry
development and significant effect of irrigation and side of canopy treatments was observed (Figure
11). It is suggested that nature of waxes is changing along berry development which is reflected by the
variation in their solubility in chloroform.
The relation between the wax accumulation and transpirational barrier properties of the grape berry
cuticle had been studied for the first time to the best of our knowledge. Several previous studies on the
grape berries have reported the relationship between the berry quality and metabolite accumulation
under water deficit and high temperature (Deluc et al., 2009; Intrigliolo and Castel, 2010; Zarrouk et
al., 2012). However no study so far had reported the relationship between the wax characteristics and
the transpirational barrier properties of the cuticle in grape berry, although some information about this
topic had been coming from other climacteric species such as tomato fruit (Leide et al., 2007). In the
present findings, the increase of permeance rate along developmental stages of de-waxed berries
contrast with the decrease of permeance rate along ripening of untreated berries. The cuticular
permeance of untreated berries ranged between 1.26±0.06 x 10-5 ms-1 at pea size stage to 0.62±0.02
x 10-5 ms-1 at full maturation stage. For de-waxed berries, permeance was higher and it ranged from
1.46±0.08 x 10-5 ms-1 at pea size stage to 2.78±0.56 x 10-5 ms-1 at full maturation stage. For untreated
berries, the west side of both SDI and RDI treatments showed highest water loss by transpiration. This
suggests that berries from west side of both irrigation treatments experiencing higher temperature,
tend to transpire more as compared with east side. Moreover, the absence of differences in the
transpirational rate between sides in intact berries compared with de-waxed ones suggests the
importance of waxes as effective barrier to water loss (Leide et al., 2007; Schreiber and Riederer,
1996) and also to overcome with the heat stress condition. Water stress conditions causes closure of
leaf stomata which may lead to increase in internal temperature of plant and in consequence of berry
inducing heat stress (Zarrouk et al., 2012). Results of TEM images, supports this hypothesis. In fact
epicuticular wax thickness was higher on the west side berries than the east side. In addition, at full
maturation stage, berries belonging from RDIW had lower permeance compared to the RDIE. This
result suggests the additive effect of deficit irrigation to heat stress in what concern the wax synthesis
and/or composition to improve the berry water loss protection as reported in Arabidopsis leaves by
Kosma et al. (2009). Taking into account only data of soluble waxes, our results suggest a negative
51
relation between the wax content (Figure 6) and permeance level (Table 5) as described for the
tomato fruits by Leide et al. (2007). Our study may also suggest that both wax compositions as well as
wax quantity are important for the transpirational barrier properties of cuticle in grape berries.
6.3. Water deficit affects the architecture of berry cuticle
The result of TEM analysis showed that grape berries undergoes several modifications during
ripening. Additionally, several differences due to the irrigation treatment and the sides of the canopy
were observed. These changes in the berry skin and cuticle in particular, might be an adaptive
response of the fruit surface under environmental stress that includes both water and heat stresses.
The cuticle is present in all phenological stages, in accordance with previous studies (Casado and
Heredia, 2001; Considine and Knox, 1979). The authors reported a continuous synthesis and
degradation of this lipophilic material and its physiological role as a mechanical support. However, in
contrast with the results herein presented, an increase in cuticle thickness was reported along berry
development (Casado and Heredia, 2001). Nonetheless, Comménil et al. (1997) studied the
ultrastructure of berry cuticle and found that the cuticle thickness decreases between véraison and full
maturation, which corroborate our TEM analysis. Our results show a slight increase in thickness from
pea size to véraison stage and a decrease thereafter. This inversion in the cuticle thickness trend
could be associated with the berry growth curve (Figure 1). Development of the berry occurs in two
distinct phases of growth (Considine and Knox, 1979); first between anthesis upto véraison and
second between véraison till it attains maturity. The second phase is marked by an extensive growth
of fruits associated with the increase in plasticity of fruit. Increase in cuticle thickness at véraison had
also been reported by Rajaei (1987) but these authors did not observe any variations of whole cuticle
until fruit maturation. As mentioned earlier, previous studies (Considine and Knox, 1979) have
reported identical cuticle thickness throughout the life of berry growth which is not the case in our
present study. Cuticle is largely heterogeneous and dynamic structure with several distinct layers.
Therefore it is not appropriate to study the entire cuticle membrane as a single entity without
differentiating it into its different layers. Most importantly, each grape variety present distinct genetic
makeup which could also present different physiology and adaptive response under stress and this
could not be ruled out as a possible reason for the differences observed between the different studies
done on grape berries (Comménil et al., 1997). Thickness of cell wall increased from pea size to
véraison but decreased slightly between véraison and full maturation. This can largely be attributed to
the rapid synthesis of cell wall material and polysaccharides during the early stages of berry
development necessary for berry growth in size, volume and firmness. However along the berry
growth and after the véraison, most of cell wall material is synthesized and cellular machinery utilizes
its energy to synthesize material necessary to withstand environmental conditions like abiotic stress. It
is therefore possible that most of the resources used for cell wall deposition might be diverted to the
synthesis of epicuticular waxes which are first line of defence against water loss and possible
pathogen attack. Interestingly, recent studies also reveal that pectins are important for maintaining
water status by preventing transpirational loss under drought stress (Leucci et al., 2008; review by Le
Gall et al., 2015 and Tenhaken 2014). Therefore much of the cell wall material might be utilized
52
towards fat material and pectin like material deposited on the surface of middle lamella of cell wall
(Guzmán et al., 2014) as observed in our TEM images. Moreover, the overlapping layers between
pectinaceous material and cell wall were not accounted for calculating the thickness of the cell wall.
6.4. Water stress enhanced the deposition of epicuticular waxes and other protecting materials
(likely pectinaceous)
In the present study, epicuticular waxes have been reported to increase along the phenological
stages. Waxes were much abundant at the west side compared to the east side which suggest that
plant adapt to the high heat stress resulting due to the higher temperature on the west side(Appendix
III) by synthesizing more waxes which also helps prevent excessive water loss. This increase in waxes
is similar to what had been reported previously by Casado and Heredia (2001). Our results from the
TEM analysis are contradictory to the wax obtained from chloroform extraction. This might be due to
the fact that chloroform extraction of wax only yields surface waxes while TEM is the entire wax load
on the cuticle surface which also include intracuticular waxes. Additionally it may suggest that
chloroform solubilisation technique only yields a group of lipids and that the nature of waxes changed
along the berry ripening.
Our TEM images revealed presence of dark and apparently amorphous layer stemming from the
middle lamella of the cell wall (i.e., likely pectinaceous) into the cuticle as reported by Guzmán et al.
(2014). Our personal communication with Dr. Dylan Kosma (University of Nevada) and Dr. Victoria
Fernández (Technical University of Madrid), experts in cuticle and plant lipid polymers helped us to
ascertain that this dark layer (Figure 7-10) is probably related to pectins which may have role in
regulating water loss. TEM reveals that pectinaceous material deposition probably begins at the early
stages of berry development and that their maximum thickness is attained at full maturation. The
pectins are polysaccharide incrustations in the cell wall. Their high deposition along the phenological
stages and more towards the west side support the enhanced adaptive mechanism of grape berries to
withstand the water stress conditions by regulating the water stress as supported by some of the
recent studies speculating the role of pectins in regulating the loss of water under stress conditions
(Leucci et al., 2008; Review by Le Gall et al., 2015 and Tenhaken, 2014). However, further studies
would be required to confirm the deposition of pectins on the cell wall in grape berry cuticle and how
they regulate the water loss at molecular level.
6.5. FTIR study of berry cuticle, skin and cutin
The IR study showed that bulk of the cuticular membrane isolated is primarily aliphatic in nature.
Nevertheless, the cuticular membrane contains detectable amount of aromatic compounds which
corroborate previous data reporting the composition of grape berry cuticle with 30% of oleanolic acid
(Casado and Heredia, 1999).
The intensity of methylene group (CH2) is variable in the cuticle and it tends to increase slightly from
pea size stage to véraison and upto the full maturation. This might be suggested due to the
polymerization of cuticle components and more synthesis of waxes and cutin rich in this ubiquitous
53
structural component. However these weak bands at around 2900 cm-1 also suggest that cuticle in
grape berry is highly complex structure with cross linked aliphatic structure not easily detected through
FTIR.
Weak bands at around 1728 cm
-1
corresponding to the esters are generally seen at same intensity
across all phenological stages showing that esterification of cutin occurs as early as the pea size
stage, followed by a marginal increase at the véraison. These results are well in consistent with the
expression of VviGDSL gene required for the cutin synthesis which showed constitutive expression of
VviGDSL along all stages with no significant differences between the irrigation regime and two canopy
sides.
It is important to note here that grape berry cuticle is mostly comprised of waxes (upto 40%)(Casado
and Heredia, 1999) and not much of the cutin. This is contrary to the tomato fruit whose cuticle
comprises more than 80% of cutin and upto 5% of cuticular waxes (Ramírez et al., 1992).
Spectral differences between the two irrigation treatment (RDI and SDI) could be attributed to higher
accumulation of waxes in the RDI compared to SDI. Two sides of cuticle also showed variation with
outer side of the cuticle having stronger bands mainly due to the wax components more on the outer
side than on the inner side. The spectral differences between the irrigation treatment and between
inside and outside of the cuticle can further be attributed to the adaptive response of the berries under
water stress conditions and as berries mature, they respond in better way with more synthesis of the
wax and triterpenoid compounds on water stressed side. Absence of this trend at pea size stage could
be due to a marginal wax layer formation at early stage of the berries growth. The results of FTIR
might further substantiate the TEM analysis which showed wax deposition increased along the
phenological stages with RDI having significantly higher thickness compared to the SDI. Similarly west
side showed higher accumulation of wax compared to the east side.
The IR spectra showed characteristic absorbance of the hydroxyl group(-OH) around 3300 cm-1 and
absorption around 1026 cm-1 corresponding to C-O-C vibrations which are characteristics of oleanane
triterpenoid saponin (i.e. oleanolic acid) abundant in grape berry. These oleanane-type triterpenoid
saponins are characterized by the C=O infrared absorbance due to oleanolic acid/ester but the ester
linkages were not sufficiently detected by FTIR in our studies which might suggest that oleanane-type
triterpenoids could be monodesmosidic saponins as detected in Entada leptostachya and Rapanea
rhododendroides but these observations need further clarifications(Kareru et al., 2008). The peak
intensity corresponding to these triterpenoids increased along the phenological stages which might
suggest that amount of oleanolic increased from pea size stage to full maturation stage. The peak
intensity corresponding to these triterpenoids increased along the phenological stages which might
suggest that amount of oleanolic increased from pea size stage to full maturation stage which is in
accordance with transcriptional data of both isoforms VviCYP716A15 and VviCYP716A17 responsible
for oleanolic acid synthesis. Spectral differences in two sides of the cuticle related to these
compounds could be attributed to the adaptive response of the berries under water stress conditions
along ripening process. The increase of signal of triterpenoid in west side (more stressed side)
54
suggests the role of these compounds in the heat stress response. This trend disappeared at full
maturation, and is in accordance with transcriptional data, where VviCYP716A15 and VviCYP716A17
were down-regulated at this stage. da Luz (2006) who studied leaf of Olea europea found oleanolic
acid with the characteristic vibration at 1688, 1029 and 996 cm-1.
TEM analysis showed dark layer (likely pectinaceous) deposited on the cell wall along the
phenological stages and increased from pea size stage to full maturation stage. The cellulose and
pectin bands exist in the region of 1800 to 900 cm−1 (Chen et al., 1997; Wellner et al., 1998). The peak
-1
-1
-1
vibrations at around 896 cm , 1099 cm , 1168 cm
could therefore be assigned to the pectin
substances in skin. 896, 953, 1017, 1047, 1100, 1144 cm
-1
have been assigned to pectin
polysaccharides in plant cell wall (Kacuráková et al., 2000). da Luz, (2006) and Wilson et al. (2000)
assigned band at 1008 cm -1 to the polygalacturonic acid, which is a variety of pectin. FTIR study of the
berry skin showed that the intensity of the bands corresponding to the pectin substances showed
variable intensity along the phenological stages. The presence of polysaccharides such as cellulose
may be due to the partial molecular shield of the cellulose, presented in the high degree of crystallinity
giving rise to the rest of the cuticular material (Villena et al., 2000).
Additional band around 1525 cm -1 showed the presence of phenolic compounds in berry skin that
intensity is differentially modulated by the side of canopy than by irrigation. This result suggests that
irrigation did not have significant influence on phenolic compounds. However, higher temperature on
west side tends to decrease the phenolic compounds as seen by the reduced intensity of bands on the
west side. High temperature tends to impair the phenolic biosynthesis and accumulation (Zarrouk et
al., 2012; Zarrouk et al., unpublished data) and slight variation in the intensity of peaks on two sides
could be surmised due to the temperature variation on two sides.
Also the intensity of the bands increased along the phenological stages, consistent with the fact that
mature berries accumulate higher phenolic compounds compared to the young berries.
The isolated berry cuticle was depolymerized in a KOH/Methanol(1%, w/v) solution, which yielded
cuticular pieces with infrared absorptions as shown in Figure 14. The weak ester bonds have been
broken and the corresponding hydroxyl fatty acids and some phenolics linked by ester bonds have
been removed as seen by the absence of peak at around 1730 cm -1. As seen in the spectra (Figure
14), the rest of the cuticular matrix is characterized by only three main chemical characteristics: a
highly aliphatic composition, the aromatic domain and the presence of polysaccharides. The bands
-1
around 1500-1700 cm have significant contribution to this spectrum and appeared as a consequence
of a putative hydrolysis of ester groups of the cutin (Heredia-Guerrero et al., 2014). The
depolymerised grape berry cuticle spectra is similar to spectra of tomato cuticle after depolymerization
-1
with characteristic ―fingerprint‖ infrared region (1000 cm ) as reported by Lòpez-Casado et al. (2007)
and Villena et al. (2000).
It is also note worthy that the rate of depolymerization showed the tendency of decreasing from pea
size to full maturation stage as observed by the intensities of the compounds identified in the spectral
55
peaks. However, the decline was not consistent and did not show any significant pattern explaining
the irrigation type or the two sides of the canopy. However, this result supports the fragility of berry
cuticle at early stages of growth that could easily degrade compared to the firm cuticle at full
maturation. This also may explain the high rate of water loss by transpiration at the early stages of
berry growth.
This behavior of depolymerized cuticular material is a clear demonstration of the complex nature of the
plant cuticle showing that complete depolymerization cannot be achieved because of the special
molecular arrangement of the different components of the cuticle (Villena et al., 2000). However, it is
important to note that method employed for cuticular depolymerization also affect the cuticular
component as analysed by Villena et al. (2000).
ATR-FTIR spectra of cuticle, skin and cutin made it possible to virtually approximate the contribution of
various components present in each one of them and suggest the potential for using spectral
information to analyze the cuticle, skin and cutin. However this technique of IR spectra has several
limitations that need to be addressed for the full potential of its application to be realized. Firstly, when
analyzing the complex biological sample like plant tissue, it is required to have a more complete ATR
spectral database of pure compounds which will help to ensure the alignment of plant tissue spectra to
the pure compounds for better identification. Another potential problem is the limited ATR penetration
depth (c. 0.30–0.55 μm) in the upper part of spectrum (c. 2000–4000 cm−1) which can limit the
detection of certain compounds having spectral properties in this range. For instance, aliphatic fatty
acids common in plant waxes (Bianchi, 1995) are rarely detected in the ATR spectra which display
characteristic broad OH bands in the 2500-3500 cm-1. Wax thickness and distribution pattern is
another important factor contributing to the ATR spectral differences between the irrigation treatments
and two sides of the canopy. When surface waxes are relatively thin as in early stages of berry
growth, the spectra are more strongly influenced by materials from the inner tissue layers such as
polysaccharides and cutin to some extent. Conversely, when the surface waxes are thick (eg, in mid
ripening and full maturation stage), spectra display weaker cutin and polysaccharides feature
reflecting the interplay between the ATR-penetration depth and near-surface composition of plant
tissue. This might further explain the anomaly of skin samples of grape berry at mid ripening and full
maturation with no consistent pattern of band intensity between the irrigation treatment and two sides
-1
of the canopy. Also changes in the intensity of the band region in 900-1800cm could be related to
variety of factors, none of which is currently well-understood. The possible factors may include the
formation of new compounds, changes in crystallinity (van Soest et al., 1995), differences in the
hydrogen bonding, anomeric or positional linkage differences (Kacuráková and Wilson, 2001) and
differences in microfibril orientation caused by cell elongation (Wilson et al., 2000) or some changes in
molecular environment. Thus using the in situ FT-IR spectroscopy could be useful means of describing
the relationships between the different components of the plant cuticle and particularly grape berry
considering the significance of this fruit in wine industry and its adaptive response under
environmental conditions. This IR spectroscopic data could provide the future starting point in order to
study the cuticle from different varieties of grape berries and further detailed study regarding how their
56
cuticle components could be vital for its environmental acclimatization would be worth exploring in
future.
6.6. Water stress affects cuticle related gene expression
Seven genes were analysed. However, three genes were not considered to be differentially expressed
under abiotic stress. All genes had similar expression profile with expression level maximum at
véraison followed by decrease in abundance of transcript.
No significant effects of water and heat stress were recorded for VviKCS1, VviKCS6 and VviGDSL,
though these genes were slightly over expressed at véraison. In contrast, VviCER9, VviLTP3, showed
differential expression at mid ripening and full maturation respectively whereas VviCYP716A15
showed differential expression at véraison and mid ripening and VviCYP716A17 showed differential
expression at véraison, and full maturation.
VviKCS1 and VviKCS6 catalyses the elongation for the very long chain fatty acids (VLCFA) and are
considered pivotal for the epicuticular wax synthesis. The trend of expression of both VviKCS1 and
VviKCS6, shows an up-regulation from pea size stage to véraison followed by a down regulation. This
high expression level of both these genes at the early stages supports the wax deposition at the berry
surface as fruit grows in size. Interestingly the west side tends to show a higher expression level which
corroborates TEM results as well as cuticular permeance data. The higher temperature on west side of
canopy coupled with the more stressed irrigation (e.g. RDI) probably induces an up-regulation of wax
biosynthesis in order to prevent damages of berry water loss. In addition, the up-regulation of these
VLCFA elongation transcripts may account for an urgent demand for covering large area by waxes in
berry since véraison stage is characterized by a rapid berry enlargement. As the berry ripening
process progresses, the expression level of VviKCS1 and VviKCS6 decreases gradually till full
maturation, where VviKCS1 was not expressed. VviKCS1 gene had been reported to exhibit
redundancy and overlap in the function of its elongase activities which might suggest that its function
in the final stage of berry development could be shared by some other wax biosynthetic enzymes
(Todd et al., 1999). Our finding are similar to those reported by Hooker et al. (2002) showing the
positive impact of environmental factors such as water deficit on KCS6 transcript expression level,
since the expression of VviKCS6 was stimulated by RDI as compared to SDI at véraison and mid
ripening.
VviGDSL gene which encodes for esterases/acylhydrolases commonly called GDSL-lipases has a
crucial role in cutin deposition- an important component of cuticle (Girard et al., 2012). The cuticle is
composed by cutin and waxes which together constitute the important function of cuticle to prevent
water loss. However exact contribution of each of these two components to cuticle is still unknown.
The highest expression of VviGDSL gene was observed at pea size stage and gradually declines
suggesting the role of VviGDSL in the rapid cutin deposition at the initial stages of berry development.
The decline of VviGDSL expression level after véraison is also reflected in the TEM results which
showed that thickness of inner cuticle or cutin decreased after véraison due to reduced cutin
57
deposition. The waxes which are probably more effective barrier to water loss in grape berry may not
catch up the pace of the berry development in the early stages, the function of which is initially taken
over by cutin. However as the berry development progresses, the role of cutin is shared by waxes and
therefore the expression level of VviGDSL decreases from véraison to mid ripening upto the full
maturation. Importantly, the function of cutin in water loss may not necessarily be dependent on cutin
content as is reported by Isaacson et al. (2009). This might suggest the fact the VviGDSL expression
was more on east side than on the west side. It is possible that both waxes and cutin having a
synchronized function in controlling water loss. GDSL like proteins have become attractive research
subjects because of their multifunctional properties but our understanding of plant GDSL enzymes is
still very limited (Chepyshko et al., 2012). It is reported that GDSL family from Vitis vinifera alone
consist of 96 members (Volokita et al., 2011) some of which might be functioning in grape berry cuticle
regulating the cutin deposition. However further investigations are needed for better understanding of
the cutin synthesis and deposition in grape berry.
VviCER9 is the first described gene related to cuticle biosynthesis whose deficiency improves plant
response to water deficit and water use efficiency (Lü et al., 2012). Our results of VviCER9 expression
showed a peak of expression at véraison that decreased thereafter. It is interesting to note that
VviCER9 expression was only detected in RDI berries at midripening, while it was not able to detect
any expression in SDI berries. The role attributed in Arabidopsis of CER9 as a negative regulator of
ABA biosynthesis (Zhao et al., 2014) seems not to be verified in grape berries. Findings from our lab
(Zarrouk et al., unpublished data) showed that ABA peaked at véraison (Appendix VI) contradicting
with the role of VviCER9 (Zhao et al., 2014). These results may suggest the presence of other
VviCER9 isoforms (Vitis genome) that could possibly be expressed differentially in the grape berry
leading to the control of water stress in berries. The expression of VviCER9 only in water stressed
berries at mid-ripening may also support the role of VviCER9 in water stress sensing (Zhao et al.,
2014). However this is preliminary study of VviCER9 in grape berries and further understanding of its
mechanism is still open to further research.
Preliminary results of berry cuticle proteome allow the identification of LTP3 protein in berry cuticle
(Zarrouk et al., unpublished data). The expression of VviLTP3 peaked at véraison and decreased
thereafter. LTP3 has been implicated in increasing tolerance to drought stress in several reports (Guo
et al., 2013; Seo et al., 2011) which suggests the implication of VviLTP3 in water stress resistance in
grape berries. Lipid transfer protein are able to bind lipids and act as lipid carrier between intracellular
organelles and deliver the wax components during the assembly of cuticle (De Bono et al., 2009; Sterk
et al., 1991; Yeats and Rose, 2008) from cytosol to the cell membrane or cell wall to form cuticular
wax and thus protecting the plants against adverse environmental conditions such as water and heat
stresses (Guo et al., 2013). High expression of VviLTP3 at véraison might suggest the increase of the
rate of deposition of waxes as berry size increased. The up-regulation of VviLTP3 in RDIW berries
corroborate results of TEM analysis and support the role of VviLTP3 in wax deposition.
58
The role of VviCYP716A15 and VviCYP716A17 in oleanolic acid biosynthesis has been reported in
the grape berries (Fukushima et al., 2011). Triterpenic compounds such as oleanolic acid are mainly
distributed in cuticular wax of fruit (or leaves) and the content varies among different cultivars of fruit
(Casado and Heredia, 1999; Szakiel et al., 2012). The putative substrate by which VviCYP716A15
and VviCYP716A17 synthesize oleanolic acid is β-amyrin (Pollier and Goossens, 2012), synthesis of
which is up-regulated under water stress conditions in olives (Martinelli et al., 2012). This corroborates
our results showing an up-regulation of VviCYP716A15 and VviCYP716A17 in RDI berries compared
to the SDI ones. However the effect of water stress on the expression of these two genes is more in
earlier stages of berry development as reported in olive development by Martinelli et al. (2012). The
distribution and seasonal changes in the content of triterpenoid such as oleanolic acid showed
dynamic variation during growing season, being high in early growth and decreasing with fruit maturity
as reported by Szakiel et al. (2011) consistent with the expression profile of these two genes with
more expression at early stages and decreasing thereafter till full maturation in our present study.
Expression of these two genes was found to be significantly higher on the west side compared to the
east side. This might be attributed to its role in heat stress response and regulating the wax
biosynthesis. More wax synthesis on west side need more synthesis of its components and one of
them is oleanolic acid (Casado and Heredia, 1999). Therefore high wax deposition on west side might
corroborate with high expression of these two genes on west side in order to synthesize more
triterpenoid content of waxes.
Although some genes showed no significant effect, similar effect of water stress on cuticle related
gene expression in pine has been reported by Le Provost et al. (2013). It is also important to note that
all genes peaked at véraison and decrease thereafter, suggesting the importance of early stages of
berry growth in the cuticle biosynthesis and deposition. This hypothesis is supported by study
conducted in barley where Richardson et al. (2005) showed that wax deposition occur independent of
developmental stages.
59
7. Conclusion
The present work is carried out to characterize the grape berry cuticle for its role in water stress
response. The initial findings from this investigation showed that berry qualities are affected by water
deficit conditions as reported previously (Zarrouk et al., 2012). Preventing the water loss is essentially
the main role of cuticle for which cuticular waxes play a pivotal role in limiting transpirational water loss
from berry surface. For this purpose, the epicuticular wax load of the berry was studied. The soluble
cuticular waxes decreased from pea size to full maturation. On the contrary, the TEM analysis
revealed that the thickness of epicuticular waxes increased along the phenological stages with
significant differences between the irrigation treatments (SDI and RDI) and two sides of the canopy
(east and west). This variation in quantitative estimation of wax content and TEM analysis could be
clearly attributed to the variation in the solubility of waxes in chloroform solution. It is also necessary to
point out that TEM analysis was considered to be more accurate determination of epicuticular wax
compared to the quantitative estimation of wax which was laced with significant variation due to the
solubility and berry position within cluster or sub-cluster. Further in order to assess the role of these
surface waxes, cuticle permeability to water loss was studied. The cuticle permeance of the berries
with the wax removed showed significantly higher permeance and the findings were in accordance
with permeance data available from some of the similar studies carried out in tomato fruit (Leide et al.,
2007). De-waxed berries at RDIW of full maturation stage showed significantly much higher water loss
compared to the intact berries further established the role of waxes as an effective barrier to water
loss under water and heat stress. Our quantitative estimation and TEM analysis of waxes may help to
conclude that quality as well quantity are together responsible for regulating the water loss in grape
berries. It is expected that the quality and quality may trade-off as an effective means to regulate water
loss under water stress and heat stress. However several previous studies (Leide et al., 2007;
Riederer and Schreiber, 2001) have proved that quality of waxes are more important for regulating the
water loss rather than quantity, which may not completely hold true for the grape varieties growing
under current environment of high temperature and water stressed conditions. This balance between
quality and quantity of waxes in grape berries needs further study to better understand effective role of
waxes as a barrier to water loss.
TEM was found to be excellent technique to study the architecture of cuticle and it showed that cuticle
properties changes under water stress conditions. TEM study also revealed the deposition of some
dark amorphous material on the surface of cell wall (likely to be pectinaceous) as reported by Guzmán
et al. (2014) which increased along the phenological stages together with epicuticular waxes and
significantly highest at west side of RDI treatments, suggesting that the waxes together with these
pectin like protecting material might be an adaptive strategy of berries under water stress conditions
as pectins are recently pointed out for drought tolerance potential (Leucci et al., 2008; Review by Le
Gall et al., 2015 and Tenhaken, 2014). FTIR analysis of the berry skin though revealed characteristic
band in ―fingerprint‖ region corresponding to the polysaccharide nature of the skin but further study
would be required such as quantitative estimation of these protecting material and how they change
along the phenological stages and how water stress affects their deposition. Further in order to study
60
the cuticle and its components, spectroscopic characterization of isolated grape berry cuticle, skin and
cutin was carried out using ATR-FTIR which provided useful insight about the functional groups
present in the cuticular matrix and their structural role and their molecular arrangement. The weak
peak at around 2925 cm-1 assigned to methylene group showed that they are the significant structural
units in the cutin. However we found weak band corresponding to ester bond near 1735 cm
-1
which
showed that grape berries contain lesser amount of cutin compared to the model tomato fruit which
consist of almost 80% cutin. Spectral shift in the peaks further authenticated the cutin
depolymerization as seen in Figure 14. Cuticle biosynthesis, deposition and transport is an area that is
still under intensive research and several model and non-model plants have been studied in order to
understand the biochemical pathway for cuticle biosynthesis and how they are transcriptionally
regulated. We identified seven cuticle related gene: VviKCS1, VviKCS6, VviGDSL, VviCER9,
VviLTP3, VviCYP716A15 and VviCYP716A17, out of which four genes (VviCER9, VviLTP3,
VviCYP716A15 and VviCYP716A17) were found to be differentially expressed under water deficit and
heat stress conditions. The expression pattern of these genes studied could be promising expression
candidate genes for further forward genetics studies. They will provide stepping stone to further work
on the stress adaptation of grape berries for which relatively little is known yet.
It is to the best of our knowledge that the in-depth characterization of grape berry cuticle had been
carried out. Cuticle permeance and spectral characterization for grape berry have been reported for
the first time with some similarity observed with the tomato fruit. This study could provide base for
future cuticle related research in other non-model plants having economical and agronomic
significance. As far as grape berries are concerned, these are still preliminary findings which provide
sufficient evidence that water deficit could be an effective viticulture practice that can be used for
vineyard without compromising on the berry quality and yield.
61
8. Future Prospects
The present study dealt with cuticle characterization of grape berries and could be useful platform for
further investigating the cuticular properties in other non-model plants. Most of the recent finding about
the cuticular research had been limited to tomato fruit, so this study would provide novel insights into
the cuticular role in non-climacteric fruits such as grape berries. However present work still leaves
many questions unanswered which need to be addressed so as to have better understanding of the
physiology of cuticle and how it modulates the stress response:
1. Even though the present study deals with spectroscopic (FTIR) characterization of cuticle, it is
possible to further use this technique in order to study the interaction between the cuticle and
external environment and application of models to study the diffusion of molecules through
cuticle surface would be an interesting topic. Other advanced techniques such as X-Ray
diffraction and Nuclear Magnetic Resonance would provide the structural information of this
intact natural biopolymer.
2. The following study also opens up the possibility of studying the biomechanical properties of
berry cuticle which will help to evaluate how cuticle responds to changes in the external
temperature or humidity. Technique such as Atomic Force Microscopy would provide
molecular basis to understand the physical properties of this unique polymer.
3.
Although gene expression pattern revealed the putative role of some of the important genes
involved in cuticle synthesis, transport and deposition, it would be desirable to explore entire
transcriptome of the grape berry cuticle and study the differential expression of genes involved
under stress conditions.
4. Furthermore, preliminary studies described herein shed light on the cuticular proteins by
identifying one of the important proteins (LTP3), but identification and characterization of
cuticular proteome during berry ripening would be an area worth exploring in future.
5. Since all grape varieties present different physiological and metabolic behaviour depending on
the environmental conditions they grow under, it could form an interesting piece of work to
characterize other varieties in order to decipher cuticular differences at the genotype level that
would facilitate better selection of variety with better adaptive trait.
6. Our TEM analysis revealed the deposition of pectinaceous material on cell wall increasing
along berry development and positively related to stress degree. This suggests its protectant
role against excessive water loss. It is important to ascertain that dense material stemming
from cell wall is actually pectin in nature and FTIR supported the presence of pectinaceous
material. However, this study falls short of qualitative and quantitative estimation of pectin
material and their changes along the phenological stages under water stress conditions which
requires further study.
62
References
Aarts, M.G., Keijzer, C.J., Stiekema, W. J. and Pereira, A. (1995). Molecular characterization of the CER1
gene of Arabidopsis involved in epicuticular wax biosynthesis and pollen fertility. Plant Cell 7:
2115-2127.
Achnine, L., Huhman, D.V., Farag, M.A., Sumner, L.W., Blount, J.W. and Dixon R.A. (2005). Genomicsbased selection and functional characterization of triterpene glycosyltransferases from the model
legume Medicago truncatula. Plant J. 41:875–887.
Adams-Phillips, L., Barry, C. and Giovannoni, J. (2004). Signal transduction systems regulating fruit
ripening. Trends Plant Sci. 9: 331–338.
Aharoni, A., Dixit, S., Jetter, R., Thoenes, E., van Arkel, G., and Pereira, A. (2004). The SHINE clade of
AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers
drought tolerance when overexpressed in Arabidopsis. Plant Cell 16: 2463-2480.
Albert, Z., Ivanics, B., Molnár, A., Miskó, A., Tóth, M. and Papp, I. (2013). Candidate genes of cuticle
formation show characteristic expression in the fruit skin of apple. Plant Growth Regul. 70: 71–78.
Alkio, M., Jonas, U., Sprink, T., Van Nocker, S. and Knoche, M. (2012). Identification of putative candidate
genes involved in cuticle formation in Prunus avium (sweet cherry) fruit. Ann. Bot. 110: 101–112.
Baker, E. A., Procopiou, J. and Hunt, G. M. (1975). The cuticles of Citrus species. Composition of leaf and
fruit waxes. J. Sci. Food Agric. 26: 1093– 1101.
Beaudoin, F., Wu, X., Li, F., Haslam, R.P., Markham, J.E., Zheng, H., et al. (2009). Functional
characterization of the Arabidopsis β-ketoacyl-coenzyme A reductase candidates of the fatty acid
elongase. Plant Physiol. 150: 1174-1191.
Beisson, F. and Ohlrogge, J. (2012). Plants: Knitting a polyester skin. Nat. Chem. Biol. 8: 603-604.
Belge, B., Llovera, M., Comabella, E., Gatius, F., Guillén, P., Graell, J., et al. (2014b). Characterization of
Cuticle Composition after Cold Storage of ―Celeste‖ and ―Somerset‖ Sweet Cherry Fruit. J. Agric.
Food Chem. 62: 8722– 8729.
Belge, B., Llovera, M., Comabella, E., Graell, J. and Lara, I. (2014a).Fruit cuticle composition of a melting
and a nonmelting peach cultivar. J. Agric. Food Chem. 62: 3488– 3495.
Bernard, A. and Joubès, J. (2013). Arabidopsis cuticular waxes: advances in synthesis, export and
regulation. Prog. Lipid Res. 52: 110-129.
Bianchi, G. (1995). Plant waxes. In: Hamilton RJ, ed. Waxes: chemistry, molecular biology and function.
Dundee, UK: The Oil Press, 175–222.
63
Bianchi, G., Murelli, C. and Vlahov, C. (1992). Surface waxes from olive fruits Phytochemistry 31: 35033506.
Bird, D., Beisson, F., Brigham, A., Shin, J., Greer, S., Jetter, R., et al. (2007).Characterization of
Arabidopsis ABCG11/WBC11, an ATP binding cassette (ABC) transporter that is required for
cuticular lipid secretion. Plant J. 52: 485–498.
Bisson, L.F., Waterhouse, A.L., Ebeler, S.E., Walker, M.A. and Lapsley, J.T. (2002). The present and
future of the international wine industry. Nature 418: 696-699.
Blouin, J. and Guimberteau, G. (2000).Maturation et Maturité des Raisins. Éditions Féret. Bordeaux,
France.
Bonaventure, G., Beisson, F., Ohlrogge, J. and Pollard, M. (2004). Analysis of the aliphatic monomer
composition of polyesters associated with Arabidopsis epidermis: occurrence of octadeca-cis-6,
cis-9-diene-1,18-dioate as the major component. Plant J. 40: 920-930.
Bonaventure, G., Salas, J.J., Pollard, M.R. and Ohlrogge, J.B. (2003). Disruption of the FATB gene in
Arabidopsis demonstrates an essential role of saturated fatty acids in plant growth. Plant Cell 15:
1020-1033.
Bourdenx, B., Bernard, A., Domergue, F., Pascal, S., Léger, A., Roby, D., et al. (2011). Overexpression of
Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences
plant response to biotic and abiotic stresses. Plant Physiol. 156: 29-45.
Bravdo, B.A. (2001). Effect of cultural practices and environmental factors on fruit and wine quality. Agric.
Conspec. Sci. 66: 13-20.
Broun, P., Poindexter, P., Osborne, E., Jiang, C.Z. and Riechmann, J.L. (2004). WIN1, a transcriptional
activator of epidermal wax accumulation in Arabidopsis. Proc. Natl. Acad. Sci. U S A. 101: 47064711.
Buda, G., Isaacson, T., Matas, A.J., Paolillo, D.J. and Rose, J.K.C. (2009).Three dimensional imaging of
plant cuticle architecture using confocal scanning laser microscopy. Plant J. 60: 378–385.
Budke, J.M., Goffinet, B. and Jones, C.S. (2012). The cuticle on the gametophyte calyptra matures before
the sporophyte cuticle in the moss Funaria hygrometrica (Funariaceae). Am. J. Bot. 99: 14–22.
Burghardt, M. and Riederer, M. (2006). Cuticular transpiration in Biology of the Plant Cuticle, eds Riederer
M., Müller C., editors. (Oxford: Blackwell Publishing). pp. 292–311.
Buschhaus, C. and Jetter, R. (2011). Composition differences between epicuticular and intracuticular wax
substructures: how do plants seal their epidermal surfaces? J. Exp. Bot. 62: 841-853.
64
Buxdorf, K., Rubinsky, G., Barda, O., Burdman, S., Aharoni, A. and Levy, M. (2014). The transcription
factor SlSHINE3 modulates defense responses in tomato plants. Plant Mol. Biol. 84: 37-47.
Casado, C.G. and Heredia, A. (1999).Structure and dynamics of reconstituted cuticular waxes of grape
berry cuticle (Vitis vinifera L.). J. Exp. Bot. 50: 175−182.
Casado, C.G. and Heredia, A. (2001). Ultrastructure of the cuticle during growth of the grape berry (Vitis
vinifera L.). Physiol. Plant. 111: 220-224.
Castellarin, S., Matthews, M.A., Gaspero, G.D. and Gambetta, G.A. (2007a).Water deficits accelerate
ripening and induce changes in gene expression regulating flavonoid biosynthesis in grape
berries. Planta 227: 101–112.
Castellarin, S.D., Pfeiffer, A., Sivilotti, P., Degan, M., Peterlunger, E. and DiGaspero, G.
(2007b).Transcriptional regulation of anthocyanin biosynthesis in ripening fruit of grapevine under
seasonal water deficit. Plant Cell Environ. 30: 1381–1399.
Chaves, M.M., Santos, T.P., Souza, C.R., Ortuño, M.F., Rodrigues, M.L., Lopes, C.M., et al. (2007).Deficit
irrigation in grapevine improves water use-efficiency without controlling vigour and production
quality. Ann. Appl. Biol. 150: 237-252.
Chaves, M.M., Zarrouk, O., Francisco, R., Costa, J.M., Santos, T., Regalado, A.P., et al. (2010).
Grapevine under deficit irrigation: hints from physiological and molecular data. Ann. Bot. 105: 661676.
Chen, G., Komatsuda, T., Ma, J.F., Nawrath, C., Pourkheirandish, M., Tagiri, A., et al. (2011). An ATPbinding cassette subfamily G full transporter is essential for the retention of leaf water in both wild
barley and rice. Proc. Natl. Acad. Sci. USA. 108:12354–12359.
Chen, L., Wilson, R.H. and McCann, M.C. (1997). Infra-red microspectroscopy of hydrated biological
systems: design and construction of a new cell with atmospheric control for study of plant cell
walls. J. Microsc.188: 62–71.
Chen, X., Goodwin, S.M., Boroff, V.L., Liu, X. and Jenks, M.A. (2003). Cloning and characterization of the
WAX2 gene of Arabidopsis involved in cuticle membrane and wax production. Plant Cell 15: 11701185.
Chepyshko, H., Lai, C.P., Huang, L.M., Liu, J.H. and Shaw, J.F. (2012). Multifunctionality and diversity of
GDSL esterase/lipase gene family in rice (Oryza sativa L. japonica) genome: new insights from
bioinformatics analysis. BMC Genomics 13: 309.
Commenil, P., Brunet, L. and Audran, J.C. (1997). The development of the grape berry cuticle in relation to
susceptibility to bunch rot disease. J. Exp. Bot. 48: 1599-1607.
65
Considine, J.A. and Knox, R.B. (1979). Development and histochemistry of the cells, cell walls, and cuticle
of the dermal system of fruit of the grape, Vitis vinifera L. Protoplasma 99: 347-365.
Coombe, B.G. (1973). The regulation of set and development of the grape berry. Acta Hort. 34: 261-273.
Coombe, B.G. and McCarthy, M.G. (2000). Dynamics of grape berry growth and physiology of ripening.
Aust. J. Grape Wine Res. 6: 131-135.
Curver, K., Seifi, H., Mouille, G., de Rycke, R., Asselbergh, B., Van Hecke, A., et al. (2010).Abscissic acid
deficiency causes changes in cuticle permeability and pectin composition that influence tomato
resistance to Botrytis cinerea. Plant Physiol. 154: 847-860.
da Luz, B.R. (2006). Attenuated total reflectance spectroscopy of plant leaves: a tool for ecological and
botanical studies. New Phytol. 172: 305–318.
De la Hera-Orts, M.L., Martínez-Cutillas, A., López-Roca, J.M. and Gómez-Plaza, E. (2005). Effect of
moderate irrigation on grape composition during ripening. Span. J. Agric. Res. 3: 352-361.
De Bono, A., Yeats, T.H., Rose, J.K., Bird, D., Jetter, R., Kunst, L., et al. (2009). Arabidopsis LTPG is a
glycosyl phosphatidyl inositol anchored lipid transfer protein required for export of lipids to the
plant surface. Plant Cell 21: 1230–1238.
Deluc, L.G., Quilici, D.R., Decendit, A., Grimplet, J., Wheatley, M.D., Schlauch, K.A., et al. (2009). Water
deficit alters differentially metabolic pathways affecting important flavor and quality traits in grape
berries of Cabernet Sauvignon and Chardonnay. BMC Genomics 10: 212.
Domínguez, E., Cuartero, J. and Heredia, A. (2011a). An overview of plant cuticle biomechanics. Plant
Sci. 181: 77–84.
Domínguez, E., Heredia-Guerrero, J.A. and Heredia, A., (2011b).The biophysical design of plant cuticles:
an overview. New Phytol. 189: 938–949.
Dorenboos, J. and Kassam, A.H. (1979). Yield response to water. FAO Irrigation and Drainage Paper No.
33. Rome, Italy: FAO.
Downey, M.O., Dokoozlian, N. K. and Krstic, M. P. (2006).Cultural practice and environmental impacts on
the flavonoid composition of grapes and wine: A review of recent research. Am. J. Enol. Vitic. 57:
257-268.
Dry, P.R., Loveys, B.R., Botting, D.G., McCarthy, M.G. and M. Stoll. (1998). Vine manipulation to meet
fruit specifications. In Proceedings of the 10th Australian Wine Industry Technical Conference.
R.J. Blair et al. (Eds.), AWITC, Adelaide, pp. 208-214.
66
Edelmann, H.G., Neinhuis, C. and Bargel, H. (2005). Influence of hydration and temperature on the
rheological properties of plant cuticles and their impact on plant organ integrity. J. Plant Growth
Regul. 24: 116–126.
El-Kereamy, A., Chervin, C., Roustan, J.P., Cheynier, V., Souquet, J.M., Moutounet, M., et al. (2003).
Exogenous ethylene stimulates the long-term expression of genes related to anthocyanin
biosynthesis in grape berries. Physiol. Plant. 119: 175–182.
España, L., Heredia-Guerrero, J.A., Segado, P., Benítez, J.J., Heredia, A. and Domínguez E. (2014).
Biomechanical properties of the tomato (Solanum lycopersicum) fruit cuticle during development
are modulated by changes in the relative amounts of its components. New Phytol. 202: 790–802.
Espelie, K.E., Dean, B.B. and Kolattukudy, P.E. (1979). Composition of lipid-derived polymers from
different anatomical regions of several plant species. Plant Physiol. 64: 1089– 1093.
Esteban, M.A., Villanueva, M.J. and Lissarrague, J.R. (1999).Effect of irrigation on changes in berry
composition of Tempranillo during maturation: sugars, organic acids and mineral elements. Am. J.
Enol. Vitic. 50: 418–433.
Fabre, G., Garroum, I., Mazurek, S., Daraspe, J., Mucciolo, A., Sankar, M., et al. (2015). The ABCG
transporter PEC1/ABCG32 is required for the formation of the developing leaf cuticle in
Arabidopsis. New Phytol.
FAO (2007).<http://faostat.fao.org>.
Fasoli, M., Dal Santo, S., Zenoni, S., Tornielli, G.B., Farina, L., Zamboni, A., et al. (2012). The grapevine
expression atlas reveals a deep transcriptome shift driving the entire plant into a maturation
program. Plant Cell 24: 3489-3505.
Fereres, E. and Soriano, M. A. (2007). Deficit irrigation for reducing agricultural water use. J. Exp. Bot. 58:
147-159.
Fernández, V., Khayet, M., Montero-Prado, P., Heredia-Guerrero, J.A., Liakopoulos, G., Karabourniotis,
G., et al. (2011). New insights into the properties of pubescent surfaces: peach fruit as a
model. Plant Physiol. 156: 2098-2108.
Flexas, J., Galmés, J., Gallé, A., Gulías, J., Pou, A., Ribas-Carbo, M., et al. (2010). Improving water use
efficiency in grapevines: potential physiological targets for biotechnological improvement. Aust. J.
Grape Wine Res. 16: 106–121.
Franke, R., Briesen, I., Wojciechowski, T., Faust, A., Yephremov, A., Nawrath, C., et al. (2005). Apoplastic
polyesters in Arabidopsis surface tissues--a typical suberin and a particular cutin. Phytochemistry
66: 2643-2658.
67
Franke, R., Höfer, R., Briesen, I., Emsermann, M., Efremova, N., Yephremov, A., et al. (2009). The DAISY
gene from Arabidopsis encodes a fatty acid elongase condensing enzyme involved in the
biosynthesis of aliphatic suberin in roots and the chalaza‐micropyle region of seeds. Plant J. 57:
80-95.
Fukushima, E.O., Seki, H., Ohyama, K., Ono, E., Umemoto, N., Mizutani, M., et al. (2011). CYP716A
subfamily members are multifunctional oxidases in triterpenoid biosynthesis. Plant Cell Physiol.
52: 2050–2061.
Gagne, S., Esteve, K., Deytieux, C., Sauvier, C. and Geny, L. (2006). Influence of abscisic acid in
triggering véraison in grape berry skins of Vitis vinifera L. cv. Cabernet Sauvignon. Vitis 40: 7-14.
Genebra, T., Santos, R.R., Francisco, R., Pinto-Marijuan, M., Brossa, R., Serra, A.T., et al. (2014).
Proanthocyanidin accumulation and biosynthesis are modulated by the irrigation regime in
tempranillo seeds. Int. J. Mol. Sci. 15: 11862-11877.
Girard, A.L., Mounet, F., Lemaire-Chamley, M., Gaillard, C., Elmorjani, K., Vivancos, J., et al.
(2012).Tomato GDSL1 is required for cutin deposition in the fruit cuticle. Plant Cell 24: 3119-3134.
Girona, J., Mata, M., Del Campo, J., Arbonés, A., Bartra, E. and Marsal, J. (2006). The use of midday leaf
water potential for scheduling deficit irrigation in vineyards. Irrig. Sci. 24: 115-127.
Grimplet, J., Deluc, L.G., Tillett, R.L., Wheatley, M.D., Schlauch, K.A., Cramer, G.R., et al. (2007). Tissuespecific mRNA expression profiling in grape berry tissues. BMC Genomics 8:1-23.
Grimplet, J., Wheatley, M.D., Jouira, H.B., Deluc, L.G., Cramer, G.R. and Cushman, J.C. (2009).Proteomic
and selected metabolite analysis of grape berry tissues under well‐watered and water‐deficit
stress conditions. Proteomics 9: 2503-2528.
Günzler, H. and Gremlich, H. (2002). IR Spectroscopy: an Introduction. Weinheim: Wiley-VCH Verlag
GmbH.
Guo, L., Yang, H., Zhang, X. and Yang, S. (2013). Lipid transfer protein 3 as a target of MYB96 mediates
freezing and drought stress in Arabidopsis. J. Exp. Bot., 64: 1755-1767.
Gupta, N.S., Collinson, M.E., Briggs, D.E.G., Evershed, R.P. and Pancost, R.D. (2006). Reinvestigation of
the occurrence of cutan in plants: implications for the leaf fossil record. Paleobiology 32: 432–449
Guzmán, P., Fernández, V., Khayet, M., García, M.L., Fernández, A. and Gil, L. (2014). Ultrastructure of
plant leaf cuticles in relation to sample preparation as observed by transmission electron
microscopy. The Scientific World Journal.
68
Haslam, T.M., Haslam, R., Thoraval, D., Pascal, S., Delude, C., Domergue, F., et al. (2015).
ECERIFERUM2-LIKE proteins have unique biochemical and physiological functions in very-longchain fatty acid elongation. Plant Physiol. 167: 682-692.
Haslam, T.M., Mañas-Fernández, A., Zhao, L. and Kunst, L. (2012). Arabidopsis ECERIFERUM2 is a
component of the fatty acid elongation machinery required for fatty acid extension to exceptional
lengths. Plant Physiol. 160: 1164-1174.
Heredia-Guerrero, J.A., Benítez, J.J., Domínguez, E., Bayer, I.S., Cingolani, R., Athanassiou, A., et al.
(2014). Infrared and Raman spectroscopic features of plant cuticles: a review. Front. Plant
Sci. 5:305.
Holloway, P.J. (1982). The chemical constitution of plant cutins. In: Cutler DF, Alvin KL, Price CE,
eds. The plant cuticle. London, UK: Academic Press, pp. 45–85.
Hooker, T.S., Millar, A.A. and Kunst, L. (2002). Significance of the expression of the CER6 condensing
enzyme for cuticular wax production in Arabidopsis. Plant Physiol., 129: 1568-1580.
Intrigliolo, D.S. and Castel, J.R. (2010).Response of grapevine cv. ―Tempranillo‖ to timing and amount of
irrigation: water relations, vine growth, yield and berry and wine composition. Irrig. Sci. 28: 113125.
Isaacson, T., Kosma, D.K., Matas, A.J., Buda, G.J., He, Y., Yu, B., et al. (2009). Cutin deficiency in the
tomato fruit cuticle consistently affects resistance to microbial infection and biomechanical
properties, but not transpirational water loss. Plant J. 60: 363–377.
Ismail, H.M., Brown, G.A., Tucknott, O.G., Holloway, P.J., and Williams, A.A. (1977). Nonanal in
epicuticular wax of golden egg plums (Prunus domestica).Phytochemistry, 16: 769-770.
Järvinen, R., Kaimainen, M. and Kallio, H. (2010). Cutin composition of selected northern berries and
seeds. Food Chem. 122: 137– 144.
Jeffree, C.E. (2006).The fine structure of the plant cuticle. In M Riederer, C Müller, eds, Biology of the
Plant Cuticle, Annual Plant Reviews Series, Vol 23. Blackwell Publishing Ltd., Oxford, pp 11–125.
Jenks, M.A. and Ashworth, E.N. (1999). Plant epicuticular waxes: function, production and
genetics. Hortic. Rev. 23: 1–68
Jennewein, S., Rithner, C.D., Williams, R.M. and Croteau, R.B. (2001). Taxol biosynthesis: taxane 13αhydroxylase is a cytochrome P450-dependent monooxygenase. Proc. Natl. Acad. Sci. USA. 98:
13595-13600.
69
Jeong, S., Goto-Yamamoto, N., Kobayashi, S. and Esaka, M. (2004). Effects of plant hormones and
shading on the accumulation of anthocyanins and the expression of anthocyanin biosynthetic
genes in grape berry skins. Plant Sci. 167: 247–252.
Jessen, D., Olbrich, A., Knüfer, J., Krüger, A., Hoppert, M., Polle, A., et al. (2011). Combined activity of
LACS1 and LACS4 is required for proper pollen coat formation in Arabidopsis. Plant J. 68: 715726.
Jetter, R., Kunst, L. and Samuels, A.L. (2006). Composition of plant cuticular waxes. In M Riederer, C
Müller, eds, Biology of the Plant Cuticle. Blackwell, Oxford, pp. 145–181.
Jetter, R., Schäffer, S. and Riederer, M. (2000). Leaf cuticular waxes are arranged in chemically and
mechanically distinct layers: evidence from Prunus laurocerasus L. Plant Cell Environ. 23: 619–
628.
Kacuráková, M. and Wilson, R.H. (2001). Developments in mid-infrared FT-IR spectroscopy of selected
carbohydrates. Carbohydr Polym. 44: 291-303.
Kacuráková, M., Capek, P., Sasinkova, V., Wellner, N. and Ebringerova, A. (2000). FT-IR study of plant
cell wall model compounds: pectic polysaccharides and hemicelluloses. Carbohydr. Polym., 43:
195-203.
Kareru, P.G., Keriko, J.M., Gachanja, A.N. and Kenji, G.M. (2008). Direct detection of triterpenoid
saponins in medicinal plants. Afr. J. Tradit. Complement. Altern. Med. 5: 56-60.
Kennedy, J.A., Matthews, M.A. and Waterhouse, A.L. (2002).The effect of maturity and vine water status
on grape skin flavonoids. Am. J. Enol. Vitic. 53: 268-274.
Kerstiens, G. (2006).Water transport in plant cuticles: an update. J. Exp. Bot. 57: 2493–2499.
Kerstiens, G. (1996).Cuticular water permeability and its physiological significance. J. Exp. Bot. 47: 1813–
1832.
Kim, H., Lee, S.B., Kim, H.J., Min, M.K., Hwang, I. and Suh, M.C. (2012). Characterization of
glycosylphosphatidylinositol-anchored lipid transfer protein 2 (LTPG2) and overlapping function
between LTPG/LTPG1 and LTPG2 in cuticular wax export or accumulation in Arabidopsis
thaliana. Plant Cell Physiol. 53: 1391-1403.
Kim, J., Jung, J.H., Lee, S.B., Go, Y.S., Kim, H.J., Cahoon, R., et al. (2013). Arabidopsis 3ketoacylcoenzyme A synthase9 is involved in the synthesis of tetracosanoic acids as precursors of
cuticular waxes, suberins, sphingolipids and phospholipids. Plant Physiol. 162: 567–580.
Kirsch, T., Kaffarnik, F., Riederer, M. and Schreiber, L. (1997).Cuticular permeability of the three tree
species Prunus laurocerasus L., Ginko biloba L. and Juglans regia L.: comparative investigation of
70
the transport properties of intact leaves, isolated cuticles and reconstituted cuticular waxes. J.
Exp. Bot. 48: 1035–1045.
Kolattukudy, P.E. (2001). Polyesters in higher plants. In Biopolyesters (pp. 1-49). Springer Berlin
Heidelberg.
Kosma, D.K., Bourdenx, B., Bernard, A., Parsons, E.P., Lü, S., Joubès, J., et al. (2009). The impact of
water deficiency on leaf cuticle lipids of Arabidopsis. Plant Physiol. 151: 1918-1929.
Kunst, L. and Samuels, A.L. (2003). Biosynthesis and secretion of plant cuticular wax. Prog. Lipid Res. 42:
51–80.
Kunst, L. and Samuels, L. (2009).Plant cuticles shine: advances in wax biosynthesis and export. Curr.
Opin. Plant Biol. 12:721–727.
Lara, I., Belge, B. and Goulao, L. F. (2014). The fruit cuticle as a modulator of postharvest quality.
Postharvest Biol. Tec. 87:103-112.
Lara, I., Belge, B. and Goulao, L. F. (2015). A Focus on the biosynthesis and composition of cuticle in
fruits. J. Agric. Food Chem. 63: 4005-4019.
Le Gall, H., Philippe, F., Domon, J.M., Gillet, F., Pelloux, J. and Rayon, C. (2015). Cell wall metabolism in
response to abiotic stress. Plants 4: 112-166.
Le Provost, G., Domergue, F., Lalanne, C., Campos, P.R., Grosbois, A., Bert, D., et al. (2013). Soil water
stress affects both cuticular wax content and cuticle-related gene expression in young saplings of
maritime pine (Pinus pinaster Ait). BMC Plant Biol. 13: 95.
Lee, S.B. and Suh, M.C. (2015). Advances in the understanding of cuticular waxes in Arabidopsis thaliana
and crop species. Plant Cell Rep. 34: 557-572.
Lee, S.B., Jung, S.J., Go, Y.S., Kim, H.U., Kim, J.K., Cho, H.J., et al. (2009). Two Arabidopsis 3‐ketoacyl
CoA synthase genes, KCS20 and KCS2/DAISY, are functionally redundant in cuticular wax and
root suberin biosynthesis, but differentially controlled by osmotic stress. Plant J. 60: 462-475.
Leide, J., Hildebrandt, U., Reussing, K., Riederer, M. and Vogg, G. (2007). The developmental pattern of
tomato fruit wax accumulation and its impact on cuticular transpiration barrier properties: effects of
a deficiency in a β-ketoacyl-coenzyme A synthase (LeCER6). Plant Physiol. 144: 1667-1679.
Leliaert, F., Verbruggen, H. and Zechman, F.W. (2011). Into the deep: new discoveries at the base of the
green plant phylogeny. Bioessays 33: 683-692.
71
Leucci, M.R., Lenucci, M.S., Piro, G. and Dalessandro, G. (2008). Water stress and cell wall
polysaccharides in the apical root zone of wheat cultivars varying in drought tolerance. J. Plant
Physiol. 165: 1168-1180.
Li, F., Wu, X., Lam, P., Bird, D., Zheng, H., Samuels, L., et al. (2008). Identification of the wax ester
synthase/acyl-coenzyme A: diacylglycerol acyltransferase WSD1 required for stem wax ester
biosynthesis in Arabidopsis. Plant Physiol. 148: 97-107.
Li-Beisson, Y., Shorrosh, B., Beisson, F., Andersson, M.X., Arondel, V., Bates, P.D, et al. (2013). AcylLipid metabolism. Arabidopsis Book 11:e0161.
López-Carbonell, M., Gabasa, M. and Jáuregui, O. (2009). Enhanced determination of abscisic acid (ABA)
and abscisic acid glucose ester (ABA-GE) in Cistus albidus plants by liquid chromatography–mass
spectrometry in tandem mode. Plant Physiol. Biochem. 47: 256-261.
López-Casado, G., Matas, A.J., Domínguez, E., Cuartero, J. and Heredia A. (2007). Biomechanics of
isolated tomato (Solanum lycopersicum L.) fruit cuticles: the role of the cutin matrix and
polysaccharides. J. Exp. Bot. 58: 3875–3883
Lü, S., Song, T., Kosma, D.K., Parsons, E.P., Rowland, O. and Jenks, M.A. (2009). Arabidopsis CER8
encodes long-chain acyl CoA synthetase 1 (LACS1) that has overlapping functions with LACS2 in
plant wax and cutin synthesis. Plant J. 59: 553-564.
Lü, S., Zhao, H., Des Marais, D.L., Parsons, E.P., Wen, X., Xu, X., et al. (2012). Arabidopsis
ECERIFERUM9 involvement in cuticle formation and maintenance of plant water status. Plant
Physiol. 159: 930-944.
Luque, P., Bruque, S. and Heredia, A. (1995). Water permeability of isolated cuticular membranes – a
structural analysis. Arch. Biochem. Biophys. 317: 417–422.
Luque, P., Heredia, A., Ramírez, F.J. and Bukovac, M.J. (1993). Characterization of NO2 bound to the
plant cuticle by FT-IR spectroscopy. Z. Naturforsch. 48: 666–669.
Marga, F., Pesacreta, T.C. and Hasenstein, K.H. (2001). Biochemical analysis of elastic and rigid cuticles
of Cirsium horridulum. Planta 213: 841– 848.
Martin, L.B.B. and Rose, J.K.C. (2014).There‘s more than one way to skin a fruit: formation and functions
of fruit cuticles. J. Exp. Bot. 65: 4639–4651.
Martinelli, F., Basile, B., Morelli, G., d‘Andria, R. and Tonutti, P. (2012). Effects of irrigation on fruit ripening
behavior and metabolic changes in olive. Sci. Hort. 144: 201-207.
Matas, A.J., López-Casado, G., Cuartero, J. and Heredia, A. (2005). Relative humidity and temperature
modify the mechanical properties of isolated tomato fruit cuticles. Am. J. Bot. 92: 462-468.
72
Matas, A.J., Yeats, T.H., Buda, G.J., Zheng, Y., Chatterjee, S., Tohge, T., et al. (2011). Tissue- and celltype specific transcriptome profiling of expanding tomato fruit provides insights into metabolic and
regulatory specialization and cuticle formation. Plant Cell 23: 3893–3910.
Matthews, M.A., Anderson, M.M. and Schultz, H.R. (1987). Phenologic and growth responses to early and
late season water deficits in Cabernet franc. Vitis 26: 147-160.
Matthews, M.A., Ishii, R., Anderson, M.M. and O'Mahony, M. (1990). Dependence of wine sensory
attributes on vine water status. J. Sci. Food Agric. 51: 321–335.
McCarthy, M.G., Loveys, B.R., Dry, P.R. and Stoll, M. (2002). Regulated deficit irrigation and partial
rootzone drying as irrigation deficit irrigation for reducing agricultural water use 157 management
techniques for grapevines. In: Deficit irrigation practices, FAO Water Reports No. 22. FAO, Rome,
Italy. pp. 79-87.
Medrano, H., Escalona, J.M., Cifre, J., Bota, J. and Flexas, J. (2003). A ten-year study on the physiology
of two Spanish grapevine cultivars under field conditions: effects of water availability from leaf
photosynthesis to grape yield and quality. Funct. Plant Biol. 30: 607–619.
Millar, A.A., Clemens, S., Zachgo, S., Giblin, E.M., Taylor, D.C. and Kunst, L. (1999). CUT1, an
Arabidopsis gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-longchain fatty acid condensing enzyme. Plant Cell 11: 825-838.
Mintz-Oron, S., Mandel, T., Rogachev, I., Feldberg, L., Lotan, O., Yativ, M., et al. (2008).Gene expression
and metabolism in tomato fruit surface tissues. Plant Physiol. 147: 823–851.
Mizutani M. and Sato F. (2011). Unusual P450 reactions in plant secondary metabolism. Arch. Biochem.
Biophys. 507:194–203.
Nawrath, C., Schreiber, L., Franke, R. B. and Geldner, N. (2013). Apoplastic diffusion barriers in
Arabidopsis. The Arabidopsis book/American Society of Plant Biologists, 11: e0167
Nelson, D.R. (1999).Cytochrome P450 and the individuality of species. Arch. Biochem. Biophys. 369: 1–
10.
Nelson, D.R., Schuler, M.A., Paquette, S.M., Werck-Reichhart, D, Bak, S. (2004).Comparative genomics
of rice and Arabidopsis. Analysis of 727 cytochrome P450 genes and pseudogenes from a
monocot and a dicot. Plant Physiol. 135: 756–772.
Office International de la Vigne et du Vin (OIV) (1990). Recueil des methodes internationals d‟analyse des
vins et des mouts (volume 1). pp. 155–158.
Okamoto, G., Kuwamura, T. and Hirano, K. (2004). Effects of water deficit stress on leaf and berry
ripening in Chardonnay grapevines (Vitis vinifera). Vitis 43:15-17.
73
Orbán, N., Kozák, I.O., Drávucz, M., Kiss, A. (2009). LC-MS method development to evaluate major
triterpenes in skins and cuticular waxes of grape berries. Int. J. Food Sci. Technol. 44: 869−873.
Oshima, Y., Shikata, M., Koyama, T., Ohtsubo, N., Mitsuda, N. and Ohme-Takagi, M. (2013). MIXTA-like
transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in
Arabidopsis and Torenia fournieri. Plant Cell. 25:1609-1624.
Pensec, F., Pączkowski, C., Grabarczyk, M., Woźniak, A., Bénard-Gellon, M., Bertsch, C., et al. (2014).
Changes in the triterpenoid content of cuticular waxes during fruit ripening of eight grape (Vitis
vinifera) cultivars grown in the upper Rhine valley. J. Agric. Food Chem. 62: 7998−8007.
Peschel, S., Franke, R., Schreiber, L. and Knoche, M. (2007). Composition of the cuticle of developing
sweet cherry fruit. Phytochemistry 68: 1017– 1025.
Petit, J., Bres, C., Just, D., Garcia, V., Mauxion, J.P., Marion, D., et al. (2014). Analyses of tomato fruit
brightness mutants uncover both cutin-deficient and cutin-abundant mutants and a new
hypomorphic allele of GDSL lipase. Plant Physiol. 164: 888-906.
Petracek, P.D. and Bukovac, M.J. (1995). Rheological properties of enzymatically isolated tomato fruit
cuticle. Plant Physiol. 109: 675-679.
Pighin, J.A., Zheng, H., Balakshin, L.J., Goodman, I.P., Western, T.L., Jetter, R., et al. (2004). Plant
cuticular lipid export requires an ABC transporter. Science 306: 702-704.
Pollard, M., Beisson, F., Li, Y.H. and Ohlrogge, J.B. (2008). Building lipid barriers: biosynthesis of cutin
and suberin. Trends Plant Sci. 13: 236–246.
Pollier, J. and Goossens, A. (2012). Oleanolic acid. Phytochemistry, 77: 10-15.
Prichard, T., Hanson, B., Schwankl, L., Verdegaal, P. and Smith, R. (2004). Deficit irrigation of quality
winegrapes using micro-irrigation techniques. University of California Davis. 89 p.
Radler, F. and Horn, D.H.S. (1965). The composition of grape cuticle wax. Aust. J. Chem. 18: 1059−1069.
Radler, F. (1965).The surface waxes of the sultana vine (Vitis vinifera cv. Thompson Seedless). Aust. J.
Biol. Sci. 18: 1045– 1056.
Radler, F.
(1970).
Investigations
on
the
cuticular
wax
of Vitis
vinifera ssp. sylvestris and Vitis
vinifera ssp. Vinifera. Angew. Bot. 44: 187– 195
Rajaei, H. (1987). Changements cytochimiques et ultrastructuraux des parois cellulaires de la pellicule du
raisin, Vitis vinifera, durant la croissance et la maturation de la baie. Can. J. Bot. 65: 1343-1355.
Ramírez, F.J., Luque, P., Heredia, A. and Bukovac, M.J. (1992). Fourier transform IR of enzymatically
isolated tomato fruit cuticular membrane. Biopolymers 32:1425–1429
74
Reid, K.E., Olsson, N., Schlosser, J., Peng, F. and Lund, S.T. (2006). An optimized grapevine RNA
isolation procedure and statistical determination of reference genes for real-time RT-PCR during
berry development. BMC Plant Biol. 6: 27.
Richardson, A., Franke, R., Kerstiens, G., Jarvis, M., Schreiber, L. and Fricke, W. (2005). Cuticular wax
deposition in growing barley (Hordeum vulgare) leaves commences in relation to the point of
emergence of epidermal cells from the sheaths of older leaves. Planta 222: 472-483.
Riederer, M. and Müller, C. (2006). Biology of the plant cuticle. Oxford: Blackwell Publishing.
Riederer, M. and Schreiber, L. (1995).Waxes—the transport barriers of plant cuticles. In RJ Hamilton, ed,
Waxes: Chemistry, Molecular Biology and Functions. The Oily Press, Dundee, Scotland, pp. 130–
156.
Riederer, M. and Schreiber, L. (2001). Protecting against water loss: analysis of the barrier properties of
plant cuticles. J. Exp. Bot. 52: 2023–2032.
Riederer, M. and Muller, C. (Eds.). (2008). Annual Plant Reviews, Biology of the Plant Cuticle (Vol. 23).
John Wiley and Sons.
Rogiers, S.Y., Hatfield, J.M., Jaudzems, V.G., White, R.G., and Keller, M. (2004). Grape berry cv. Shiraz
epicuticular wax and transpiration during ripening and preharvest weight loss. Am. J. Enol.
Vitic. 55: 121-127.
Romero, P., Rodrigo, M.J., Alférez, F., Ballester, A.R., González-Candelas, L., Zacarías, L., et al.
(2012).Unravelling molecular responses to moderate dehydration in harvested fruit of sweet
orange (Citrus sinensis L. Osbeck) using a fruit-specific ABA-deficient mutant. J. Exp. Bot. 63:
2753-2767.
Saladié, M., Matas, A.J., Isaacson, T., Jenks, M.A., Goodwin, S.M., Niklas, K.J., et al. (2007). A
reevaluation of the key factors that influence tomato fruit softening and integrity. Plant
Physiol. 144: 1012-1028.
Salón, J.L., Chirivella, C. and Castel, J.R. (2005). Response of cv. Bobal to timing of deficit irrigation in
Requena, Spain: water relations, yield, and wine quality. Am. J. Enol. Vitic. 56: 1–8.
Samuels, L., Kunst, L. and Jetter, R. (2008). Sealing plant surfaces: cuticular wax formation by epidermal
cells. Annu. Rev. Plant Biol. 59: 683–707.
Šantrůček, J., Šimáňová, E., Karbulková, J., Šimková, M. and Schreiber, L. (2004). A new technique for
measurement of water permeability of stomatous cuticular membranes isolated from Hedera helix
leaves. J. Exp. Bot. 55: 1411–1422.
75
Schreiber L. (2010).Transport barriers made of cutin, suberin and associated waxes. Trends Plant Sci. 15:
546–553.
Schreiber, L. and Riederer, M. (1996).Ecophysiology of cuticular transpiration: comparative investigation of
cuticular water permeability of plant species from different habitats. Oecologia, 107: 426-432.
Schreiber, L. and Schonherr, J. (1993).Mobilities of organic compounds in reconstituted cuticular wax of
barley leaves: determination of diffusion coefficients. Pestic. Sci. 38: 353–361.
Schultz, H.R. (2000).Climate change and viticulture: a European perspective on climatology, carbon
dioxide and UV-B effects. Aust. J. Grape Wine Res. 1: 1-12.
Schultz, H.R. (2003). Differences in hydraulic architecture account for near‐isohydric and anisohydric
behaviour of two field‐grown Vitis vinifera L. cultivars during drought. Plant Cell Environ. 26: 13931405.
Seki, H., Sawai, S., Ohyama, K., Mizutani, M., Ohnishi, T., Sudo, H., et al. (2011). Triterpene functional
genomics in licorice for identification of CYP72A154 involved in the biosynthesis of glycyrrhizin.
Plant Cell 23: 4112–4123.
Seki, M., Umezawa, T., Urano, K. and Shinozaki, K. (2007). Regulatory metabolic networks in drought
stress responses. Curr. Opin. Plant Biol. 10: 296-302.
Seo, P.J., Lee, S.B., Suh, M.C., Park, M.J., Go, Y.S. and Park, C.M. (2011). The MYB96 transcription
factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis. Plant Cell, 23:
1138-1152.
Serra, O., Chatterjee, S., Huang, W., Stark, R.E. (2012). Mini-review: what nuclear magnetic resonance
can tell us about protective tissues. Plant Sci. 195: 120–124.
Shi, J.X., Adato, A., Alkan, N., He, Y., Lashbrooke, J., Matas, A.J., et al. (2013). The tomato SlSHINE3
transcription factor regulates fruit cuticle formation and epidermal patterning. New Phytol.197:
468–480.
Shi, J.X., Malitsky, S., Oliveira, S.D., Branigan, C., Franke, R., Schreiber, L., et al. (2011).SHINE
transcription factors act redundantly to pattern the archetypal surface of Arabidopsis flower
organs. PLoS Genet. 7: e1001388.
Shibuya, M., Hoshino, M., Katsube, Y., Hayashi, H., Kushiro, T., Ebizuka Y. (2006). Identification of βamyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional
expression assay. FEBS J. 273: 948–959.
Sørensen, I., Pettolino, F.A., Bacic, A., Ralph, J., Lu, F., O‘Neill, M. A., et al. (2011). The charophycean
green algae provide insights into the early origins of plant cell walls. Plant J. 68: 201-211.
76
Souza, D.C.R., Maroco, J.P., Dos Santos, T.P., Rodrigues, M.L., Lopes, C.M., Pereira, J.S., et al.
(2005).Grape berry metabolism in field-grown grapevines exposed to different irrigation strategies.
Vitis 44: 103–109.
Sterk, P., Booij, H., Schellekens, G.A., Van Kammen, A., De Vries, S.C. (1991). Cell-specific expression of
the carrot EP2 lipid transfer protein gene. Plant Cell 3: 907–921.
Sun, L., Zhang, M., Ren, J., Qi, J., Zhang, G. and Leng, P. (2010). Reciprocity between abscisic acid and
ethylene at the onset of berry ripening and after harvest. BMC Plant Biol. 10: 257.
Symons, G.M., Davies, C., Shavrukov, Y., Dry, I., Reid, J. and Thomas, M. (2006). Grapes on steroids.
Brassinosteroids are involved in grape berry ripening. Plant Physiol. 140: 150–158.
Szakiel, A., Pączkowski, C. and Henry, M. (2011). Influence of environmental abiotic factors on the content
of saponins in plants. Phytochem Rev.10: 471-491.
Szakiel, A., Pączkowski, C., Pensec, F. and Bertsch, C. (2012). Fruit cuticular waxes as a source of
biologically active triterpenoids. Phytochem Rev. 11: 263-284.
Tenhaken, R. (2014). Cell wall remodeling under abiotic stress. Front. Plant Sci. 5.
Thomas, T.R., Shackel, K.A. and Matthews, M.A. (2006).Direct in-situ measurement of cell turgor in grape
(Vitis vinifera L.) berries during development and in response to plant water deficits. Plant Cell
Environ. 29:993-1001.
Tira-Umphon, A., Roustan, J.P. and Chervin, C. (2007).The stimulation by ethylene of the UDP glucoseflavonoid 3-Oglucosyltransferase (UFGT) in grape tissues is independent from the MybA
transcription factors. Vitis 46: 210–211.
Todd, J., Post‐Beittenmiller, D. and Jaworski, J.G. (1999). KCS1 encodes a fatty acid elongase
3‐ketoacyl‐CoA synthase affecting wax biosynthesis in Arabidopsis thaliana. The Plant Journal 17:
119-130.
Tsubaki, S. and Azuma, J. (2013). Total fractionation of green tea residue by microwave-assisted alkaline
pretreatment and enzymatic hydrolysis. Bioresource Technol. 131: 485–491.
van Soest, J.G., Tournois, H., de Wit, D. and Vliegenthart, J.F.G. (1995). Short-range structure in
(partially) crystalline potato starch determined with attenuated total reflectance Fourier-transform
IR spectroscopy. Carbohydr Res. 279: 201–214.
Villena, J.F., Domínguez, E. and Heredia, A. (2000). Monitoring biopolymers present in plant cuticles by
FT-IR spectroscopy. J. Plant Physiol. 156: 419-422.
77
Vogg, G., Fischer, S., Leide, J., Emmanuel, E., Jetter, R., Levy, A.A., et al. (2004).Tomato fruit cuticular
waxes and their effects on transpiration barrier properties: functional characterization of a mutant
deficient in a very-long-chain fatty acid β-ketoacyl-CoA synthase. J. Exp. Bot. 55: 1401-1410.
Volokita, M., Rosilio-Brami, T., Rivkin, N. and Zik, M. (2011). Combining comparative sequence and
genomic data to ascertain phylogenetic relationships and explore the evolution of the large GDSLlipase family in land plants. Mol. Biol. Evol. 28: 551-565.
Waters, E.R. (2003). Molecular adaptation and the origin of land plants. Mol. Phylogenet. Evol. 29: 456463.
Wellner, N., Kačuráková, M., Malovíková, A., Wilson, R.H., Belton, P.S. (1998). FT-IR study of pectate and
pectinate gels formed by divalent cations. Carbohydr Res. 308:123–131.
Weng, H., Molina, I. and Shockey, J. (2010). Organ fusion and defective cuticle function in a lacs1 lacs2
double mutant of Arabidopsis. Planta 231: 1089-1100.
Wheeler, S., Loveys, B., Ford, C. and Davies, C. (2009).The relationship between the expression of
abscisic acid biosynthesis genes, accumulation of abscisic acid and the promotion of Vitis vinifera
L. berry ripening by abscisic acid. Aust. J. Grape Wine Res. 15:195–204.
Wilson, R.H., Smith, A.C., Kaèuráková, M., Saunders, P.K., Wellner, N. and Waldron W. (2000). The
mechanical properties and molecular dynamics of plant cell wall polysaccharides studied by
Fourier-transform infrared spectroscopy. Plant Physiol. 124: 397-405.
Xia, Y., Nikolau, B.J., Schnable, P.S.(1996).Cloning and characterization of CER2, an Arabidopsis gene
that affects cuticular wax accumulation. Plant Cell 8:1291–1304.
Yamamura, H. and Naito, R. (1983). The surface wax of several grapes in Japan. J. Jpn. Soc. Hortic. Sci.
52: 266-267.
Yeats, T.H. and Rose, J.K. (2008). The biochemistry and biology of extracellular plant lipid-transfer
proteins (LTPs). Protein Sci. 17: 191–198.
Yeats, T.H. and Rose, J.K. (2013).The formation and function of plant cuticles. Plant Physiol. 163: 5-20.
Yeats, T.H., Buda, G.J., Wang, Z., Chehanovsky, N., Moyle, L.C., Jetter, R., et al. (2012a).The fruit
cuticles of wild tomato species exhibit architectural and chemical diversity, providing a new model
for studying the evolution of cuticle function. Plant J. 69: 655–666.
Yeats, T.H., Martin, L.B., Viart, H.M., Isaacson, T., He, Y., Zhao, L., et al. (2012b).The identification of
cutin synthase: formation of the plant polyester cutin. Nat. Chem. Biol. 8: 609–611.
78
Yonekura-Sakakibara, K. and Saito, K. (2009). Functional genomics for plant natural product
biosynthesis. Nat. Prod. Rep. 26: 1466-1487.
Zarrouk, O, Pinto-Marijuan, M., Francisco, R., Genebra, T., Brossa, R., Santos, R.R., et al. (2015).Deficit
irrigation induces changes in abscisic acid and flavonoids bosynthesis/content in grape berry
during ripening (in Press).
Zarrouk, O., Francisco, R., Pinto-Marijuan, M., Brossa, R., Santos, R.R., Pinheiro, C., et al. (2012). Impact
of irrigation regime on berry development and flavonoids composition in Aragonez (Syn.
Tempranillo) grapevine. Agricult. Water Manag. 114:18-29.
Zhao, H., Zhang, H., Cui, P., Ding, F., Wang, G., Li, R., et al. (2014). The Putative E3 Ubiquitin Ligase
ECERIFERUM9 Regulates Abscisic Acid Biosynthesis and Response during Seed Germination
and
Postgermination
Growth
in
Arabidopsis. Plant
79
Physiol. 165:
1255-1268.
Appendix I
Figure 1: General Field Plan of Vineyard
80
Appendix II
The pre-dawn water potential data are kindly provided by ―Agriciencia‖, Portugal, WIP5 partners of
Innovine Project.
Figure 2: Plant water status of vines subjected to two different irrigation regimes (SDI and RDI). Water
status is expressed as pre-dawn water potential (ΨPD).
81
Appendix III
The temperature data are kindly provided by ―Agriciencia‖, Portugal, WIP5 partners of Innovine
Project.
Figure 3A: Maximum air and berry temperature on east and west sides of the vine canopy for SDI
Treatment.
Figure 3B: Maximum air and berry temperature on east and west side of the vine canopy for RDI
treatment.
82
Appendix IV
The cuticular water permeance gravimetric data
Figure 4A: Gravimetric data of cuticular water permeance of untreated(a-b) and de-waxed(c-d) grape
berries from pea size stage. East (‘a’ and ‘c’); West (‘b’ and‘d’).
83
Figure 4B: Gravimetric data of cuticular water permeance of untreated(a-d) and de-waxed(e-h) grape
berries from véraison. SDIE (‘a’ and ‘e’); SDIW (‘b’ and ‘f’); RDIE (‘c’ and ‘g’); RDIW (‘d’ and ‘h’).
84
Figure 4C: Gravimetric data of cuticular water permeance of untreated grape berries from mid ripening
stage SDIE (a), SDIW (b), RDIE (c), RDIW (d).
85
Figure 4D: Gravimetric data of cuticular water permeance of untreated(a-d) and de-waxed(e-h) grape
berries from full maturation. SDIE (‘a’ and ‘e’); SDIW (‘b’ and ‘f’); RDIE (‘c’ and ‘g’); RDIW (‘d’ and ‘h’).
86
Appendix V
RNA extraction Buffer
DEPC H2O (0.1M)  100mL H2O + 100uL DEPC (4ºC)
Tris-HCl  Stock 1M in 100mL  12.11g Tris Base in 80mL MilliQ H2O + 4.2mL
0.3M; MW
HCl complete to 100mL
EDTA  Stock 0.5M in 50mL  9.306g and complete to 50mL with DEPC H2O
0.025M; MW 372.24
NaCl  Stock 5M in 100mL  29.22g and complete to 100mL with DEPC H2O
2M; MW 58.44
Extraction Buffer (100 mL)

30mL Tris HCl 1M

5 mL EDTA 0.5M

40 NaCl 5M

0.2g CTAB

0.2g PVP

0.05 Spermidine (4ºC)
 Complete to 100 mL with DEPC H2O
TE (25 mL)
10mM Tris (277uL) + 1mM EDTA (25uL)  complete to 25mL with DEPC H2O
NaOAc  Stock 3M in 25mL  6.15g complete to 25mL with DEPC H2O
3M; MW82.03
87
Appendix VI
Figure 6: Changes in the ABA concentration in cuticle of Vitis vinifera cv. Aragonez. SDI: Sustained
Deficit Irrigation; RDI: Regulated Deficit Irrigation. E- East; W- West. PS- Pea size; V- Véraison; MR- Mid
Ripening; FM- Full Maturation. The values are represented as mean± SE.
88