Am J Physiol Gastrointest Liver Physiol 301: G877–G886, 2011.
First published August 18, 2011; doi:10.1152/ajpgi.00261.2011.
Exploration of the copper-related compensatory response in the Belgrade rat
model of genetic iron deficiency
Lingli Jiang, Perungavur Ranganathan, Yan Lu, Changae Kim, and James F. Collins
Food Science & Human Nutrition Department, University of Florida, Gainesville, Florida
Submitted 5 July 2011; accepted in final form 15 August 2011
Slc11a2; divalent metal transporter 1; Menkes copper ATPase; ceruloplasmin; metallothionein
THE EXPLORATION OF COPPER/IRON
interactions dates back to the
early 19th century (29, 30). Copper was thought to influence
iron metabolism at the levels of intestinal absorption and
release from body storage sites and by being required for
cellular Fe utilization during erythropoiesis (56). Reciprocally, iron status can influence copper metabolism (17, 55,
58). Recent findings have identified two multi-copper ferroxidases (FOXs), ceruloplasmin (Cp) and hephaestin
(Heph) that represent likely links between iron and copper
homeostasis. Heph is required for intestinal iron transport
(54), and Cp is necessary for iron release from body storage
sites (e.g., hepatocytes, macrophages) (15, 54). Without a
functional multi-copper FOX, Fe2⫹ cannot be oxidized to
Fe3⫹, the transferrin binding form, and Fe2⫹ will be trapped
inside cells (14, 41). Because Cp and Heph are the best
known connections between copper and iron metabolism,
many previous studies have investigated the expression/
regulation of these proteins in various model systems in
which iron or copper levels were manipulated. The results of
some studies found alterations in copper metabolism in
mammals suffering from diet-induced iron deficiency aneAddress for reprint requests and other correspondence: J. F. Collins, Food
Science & Human Nutrition Dept., FSHN Bldg., #441, Newell Dr., PO Box
110370, Univ. of Florida, Gainesville, FL 32611 (e-mail: [email protected]).
http://www.ajpgi.org
mia, suggesting that copper might partially mediate the
compensatory response to low iron intake (6, 19, 23, 25,
53–55).
Recent studies identified other genes/proteins that exemplify additional links between copper and iron homeostasis,
including the Menkes copper ATPase (Atp7a; a copper
exporter) and divalent metal transporter 1 (Dmt1) (10, 11).
Previous investigations have shown that Atp7a and Dmt1
mRNA and protein levels are increased during iron deficiency (11, 16, 43, 59). Moreover, some studies have shown
that Dmt1 can transport copper (2, 52) although the physiological significance of this is unknown. Given the uncertainty of the role of Dmt1 in copper homeostasis, the present
studies were undertaken to assess the effect of an inactivating mutation in Dmt1 on copper metabolism during iron
deficiency. The model chosen was the Belgrade (b) rat,
which resulted from irradiation of 8-day-old female rats,
eventually producing a strain with heritable microcytic,
hypochromic anemia (48, 49). Early studies on this genetic
model of iron deficiency demonstrated a defect in iron
uptake into reticulocytes (18) and enterocytes (24, 39).
Later, genetic approaches led to the discovery that Nramp2
(now termed Dmt1) was the mutated gene responsible for
the Belgrade anemia (21). Surprisingly, the point mutation
in the Belgrade rat is identical to the mutation in the
microcytic (mk) anemia mouse (22). The same protein (i.e.,
Dmt1) was also identified almost simultaneously by an
expression-cloning technique, and it was shown to function
as a transporter of divalent metal ions, including iron (26).
It is now clear that the Belgrade and mk mutation in Dmt1
decrease iron absorption from the diet and iron uptake into
other cells of the body as a result of a defect in the
transferrin cycle, demonstrating an important physiological
role for Dmt1 in overall body iron homeostasis.
The present studies analyzed various genetic and biochemical parameters of iron and copper homeostasis in the
b/b rat compared with ⫹/b rats, which are phenotypically normal. Although several of the measured parameters
were identical between the homozygous mutants and the
heterozygotes, key differences were noted. Perhaps of most
interest are the facts that 1) the b/b rats did not show an
increase in serum and liver copper content, which has been
shown to occur in many mammalian species during anemia,
and 2) that serum FOX activity (i.e., ceruloplasmin activity)
did not increase in the b/b rat, which is in contrast to what
has been documented in wild-type rats with dietary iron
deficiency anemia (31, 42), in iron-deficient humans (53),
and in many species during iron deficiency attributable to
hemorrhage (23).
0193-1857/11 Copyright © 2011 the American Physiological Society
G877
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
Jiang L, Ranganathan P, Lu Y, Kim C, Collins JF. Exploration
of the copper-related compensatory response in the Belgrade rat
model of genetic iron deficiency. Am J Physiol Gastrointest Liver
Physiol 301: G877–G886, 2011. First published August 18, 2011;
doi:10.1152/ajpgi.00261.2011.—The Menkes copper ATPase (Atp7a)
and metallothionein (Mt1a) are induced in the duodenum of irondeficient rats, and serum and hepatic copper levels increase. Induction
of a multi-copper ferroxidase (ceruloplasmin; Cp) has also been
documented. These findings hint at an important role for Cu during
iron deficiency. The intestinal divalent metal transporter 1 (Dmt1) is
also induced during iron deficiency. The hypothesis that Dmt1 is
involved in the copper-related compensatory response during iron
deficiency was tested, utilizing a mutant Dmt1 rat model, namely the
Belgrade (b/b) rat. Data from b/b rats were compared with phenotypically normal, heterozygous ⫹/b rats. Intestinal Atp7a and Dmt1
expression was increased in b/b rats, whereas Mt1a expression was
unchanged. Serum and liver copper levels did not increase in the
Belgrades nor did Cp protein or activity. The lack of fully functional
Dmt1 may thus partially blunt the compensatory response to iron
deficiency by 1) decreasing copper levels in enterocytes, as exemplified by a lack of Mt1a induction and a lesser induction of Atp7a, 2)
abolishing the frequently described increase in liver and serum copper, and 3) attenuating the documented increase in Cp expression and
activity.
G878
COPPER-RELATED COMPENSATORY RESPONSES IN THE BELGRADE RAT
MATERIALS AND METHODS
Chemicals, Reagents, and PCR Primers
Chemicals were obtained mostly from Sigma Aldrich and Fisher
Scientific, and were of analytical grade or high purity. Sequencing
primers were from IDT. Other sources are mentioned as appropriate.
Experimental Animals
Elemental Analyses and Hemoglobin and Hematocrit Measurements
Rat liver and serum samples were submitted to the Diagnostic
Center for Population and Animal Health (DCPAH) at Michigan State
University for mineral analysis. Liver samples were dry-ashed and
digested with nitric acid. The digested tissues/serum samples were
then diluted and analyzed by Inductively Coupled Plasma-Mass Spectrometry. Hemoglobin (Hb) and Hematocrit (Hct) were measured in
house using a HemoCue Hb analyzer (Hemocue AB) and a Readacrit
Hct system, respectively, following the manufacturers’ instructions.
Enterocyte Isolation and Subcellular Fractionation
Enterocytes were isolated from rat duodenum and proximal jejunum as previously described (9), with modifications. Briefly, an
⬃15-cm segment of the rat proximal intestine was removed immedi-
Table 1. Genotype, sex, and age of all rats used in this
study
Genotype
Sex
Age, Mo
Number
⫹/b
⫹/b
⫹/b
⫹/b
⫹/b
⫹/b
⫹/b
b/b
b/b
b/b
b/b
⫹/b
⫹/b
⫹/b
b/b
b/b
b/b
M
M
M
M
M
M
M
M
M
M
M
F
F
F
F
F
F
22
19
12
9
6
3.5
3
9
6
3.5
3
4
3.5
3
4
3.5
3
1
1
2
3
1
4
3
5
2
2
1
3
2
3
3
1
3
Procedure
A
A
A,
A
A,
A,
A,
A
A,
A,
A,
A,
A,
A,
A,
A,
A,
B, C, D
B, C, D
B, C, D, G
B, C, E, F, G
B,
B,
B,
B,
B,
B,
B,
B,
B,
C,
C,
C,
C,
C,
C,
C,
C,
C,
D
D, G
E, F, G
D
D
E, F, G
D
D
E, F, G
A, hemoglobin and hematocrit, liver qRT-PCR; B, enterocyte qRT-PCR; C,
immunoblots; D, para-Phenylenediamine assay; E, ferrozine assay; F, mineral
analysis; G, immunohistochemistry analysis.
AJP-Gastrointest Liver Physiol • VOL
Quantitative Real-Time PCR
Total RNA was purified from rat liver by TRIzol reagent (Invitrogen), and qRT-PCR was performed as previously described (13).
Briefly, 1 ␮g of RNA was converted to cDNA with the Bio-Rad
iScript cDNA synthesis kit, in a 20-␮l reaction. One microliter of the
cDNA reaction was used with 10 ␮l of SYBR Green master mix
(Bio-Rad), 0.75 ␮l (0.25 pM) of each forward and reverse genespecific primer (sequences listed in Table 2), in a 20-␮l reaction.
Primers were designed to span large introns to minimize the chances
of amplification from genomic DNA. Reactions were run in 96-well
plates on a Bio-Rad iCycler with the following cycling parameters:
95°C for 3 min, and 39 cycles with 95°C for 10 s and 58°C for 30 s.
A melt curve was performed after 39 cycles of amplification; single
amplicons were detected in all cases. Preliminary experiments established the validity of each primer pair in that each set was able to
linearly amplify each singular transcript across a range of template
concentrations. Each RT reaction was analyzed in duplicate for 18S
rRNA, Atp7a (Menkes copper ATPase), Dmt1, transferrin receptor 1
(Tfrc), metallothionein 1A (Mt1a), copper transporter 1 (Ctr1), Wilson’s copper ATPase (Atp7b), Heph, Cp, and hepcidin (Hamp) in
each experiment. Next, the average of 18S was subtracted from the
experimental gene average to generate the cycle threshold (Ct) value.
Data were analyzed by routine methods. Briefly, ⌬⌬Ct values were
calculated for experimental genes and 18S, for b/b vs. ⫹/b groups.
Mean fold induction equates to 2⫺⌬⌬Ct. Student’s t-test was used to
determine significance between means. Statistical significance was set
at P ⬍ 0.05.
301 • NOVEMBER 2011 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
All animal studies were approved by the University of Florida
IACUC committee before commencing the investigation. Belgrade
rats used in the present studies were adult males and females between
the ages of 3.5 and 22 mo, obtained from a breeding colony at the
University at Buffalo maintained by Dr. Laura Garrick. The different
groups of rats obtained and a description of how they were utilized in
the current studies are shown in Table 1. The use of different sexes
and ages was necessary because of the expense of maintaining the
breeding colony and the smaller litter sizes (24). The ⫹/b rats were
fed a normal chow (⬃200 ppm Fe), whereas the b/b rats were fed a
high-iron-containing chow (⬃300 ppm Fe), per the usual husbandry
routine. In some experiments, control and iron-deficient, wild-type
Sprague Dawley (SD) rats were utilized for comparison. These animals were male rats obtained at weaning from Harlan Laboratories,
which were housed in overhanging cages and fed either a semipurified
AIN93G-based diet containing 198 ppm (Ctrl) or 3 ppm (FeD) iron
for 35 days. This feeding regimen leads to development of iron
deficiency anemia, with significantly decreased iron-related hematological parameters (11). All rats were anesthetized by CO2 exposure
and killed by cervical dislocation. Blood was collected by cardiac
puncture with an 18-gauge stainless-steel needle and transferred into
a prechilled Falcon 5 ml polypropylene tube. After 1 h to allow for
clotting, the tubes were centrifuged at 1,500 g for 10 min at 4°C. The
supernatants (sera) were separated and stored at 4°C for FOX activity
assays, which were performed within 48 h. Previous studies demonstrated that the Cp enzyme was stable under these conditions, with no
significant decrease in activity noted with storage at 4°C for up to 72
h (42).
ately after death and flushed with ice-cold 1⫻ PBS. It was then cut
into three 5-cm-long pieces and everted on wooden sticks. After a
brief rinse in 1⫻ PBS, gut segments were incubated on ice in 1⫻ PBS
containing 1.5 mM EDTA for 20 min with occasional gentle rotation
to release enterocytes, which were subsequently pelleted at 500 g for
5 min. Enterocytes were washed with 1⫻ PBS three additional times
and were then used for FOX enzyme analysis, qRT-PCR, and mineral
and protein analysis. Enterocytes and portions of livers were snap
frozen in liquid N2, then stored at ⫺80°C for RNA isolation, or stored
at ⫺20°C for mineral analysis. Cytosol and solubilized particulate
membrane fractions were prepared as previously described (13).
Briefly, cells were homogenized in buffer 1 (0.05 M Tris·HCl, pH 7.4
at 4°C, 0.05 M NaCl, ⫹ protease inhibitor cocktail) and centrifuged at
16,000 g for 15 min. The supernatant was recentrifuged at 110,000 g
for 1 h. The resulting supernatant was termed “cytosol”, and the pellet
was resuspended in buffer 2 [buffer 1 plus 0.25% (vol/vol) Tween20]. The suspension was then sonicated for 10 s in an ice water slurry
twice, with 5 s chilling in between, at an output power of 5 watts,
followed by centrifugation at 16,000 g for 30 min. This supernatant
was the solubilized particulate membrane fraction, which was subsequently used for immunoblotting experiments and FOX/amine oxidase activity assays. Activity assays were performed immediately
after purification because of the propensity of the membrane fractions
to precipitate out of solution (likely attributable to the presence of the
detergent).
COPPER-RELATED COMPENSATORY RESPONSES IN THE BELGRADE RAT
Table 2. qRT-PCR primer sequences
Direction
Sequence (5= to 3=)
18S
18S
Atp7a
Atp7a
Atp7b
Atp7b
Ctr1
Ctr1
Cp
Cp
Hamp
Hamp
Heph
Heph
Mt1a
Mt1a
Tfrc
Tfrc
FOR
REV
FOR
REV
FOR
REV
FOR
REV
FOR
REV
FOR
REV
FOR
REV
FOR
REV
FOR
REV
TCCAAGGAAGGCAGCAGGC
TACCTGGTTGATCCTGCCA
TGAACAGTCATCACCTTCATCGTC
GCGATCAAGCCACACAGTTCA
TTAGCATCCTGGGCATGACTTG
TTGGTGTGTGAGGAGTCCTCTAGTGT
CTACTTTGGCTTTAAGAATGTGGACC
AACATTGCTAGTAAAAACACTGCCAC
ACTTATGCAGATCCTGTGTGCCTATC
TGCATCTTGTTGGACTCCTGAAAG
GCAAGATGGCACTAAGCACTC
GCAACAGAGACCACAGGAGGAAT
ACACTCTACAGCTTCAGGGCATGA
CTGTCAGGGCAATAATCCCATTCT
CTTCTTGTCGCTTACACCGTTG
CAGCAGCACTGTTCGTCACTTC
ATTGCGGACTGAGGAGGTGC
CCATCATTCTCAGTTGTACAAGGGAG
FOR, forward; REV, reverse; Atp7a, Menkes copper transporting ATPase;
Atp7b, Wilson’s copper transporting ATPase; Cp, ceruloplasmin; Ctr1, copper
transporter 1; Hamp, hepcidin; Heph, hephaestin; Mt1a, metallothionein 1A;
Tfrc, transferrin receptor 1.
Western Blot Analysis.
For Western blot experiments, four validated antibodies against
Atp7a, Dmt1, Heph, and Cp were utilized. The Atp7a antiserum
(called 54 –10) has been extensively validated (13, 43). The Dmt1
antibody was a kind gift from Dr. Michael Garrick, University at
Buffalo. This affinity-purified reagent is a polyclonal antibody raised
in rabbits against a NH2-terminal peptide, which was modeled after a
recent publication (20). Validation in the Garrick laboratory includes
studies in HEK293 cells overexpressing Dmt1 (or not), experiments
with brain-specific Dmt1 knockout mice, as well as studies performed
in control and iron-deficient rats, and in b/b vs. ⫹/b rats (personal
communication with Dr. Michael Garrick). All indications are that
this reagent specifically recognizes the rat Dmt1 protein. The thoroughly characterized Heph antibody (called D4) (8) was a kind gift
from Dr. Chris Vulpe, University of California, Berkeley. A wellestablished chicken anti-Cp antibody and a peroxidase-coupled secondary antibody were kind gifts from Sigma-Aldrich (cat. nos.
GW20074F and A9046, respectively).
Identical quantities of enterocyte membrane or serum proteins from
⫹/b and b/b rats were electrophoresed, blotted, and blocked following
published methods (12, 42) with the following variations: 1:4,000
dilution of primary antisera (except 1:5,000 for Cp) and 1:6,000
dilution of horseradish peroxidase-conjugated anti-rabbit (secondary)
antibody. Blots were stained with Ponceau S solution to confirm equal
sample loading and efficient transfer. The optical density of immunoreactive bands on film and proteins on stained blots were quantified
using the digitizing software UN-SCAN-IT (Silk Scientific), and the
average pixel numbers were used for normalization and comparison.
The intensity of immunoreactive bands on film was normalized to the
intensity of total proteins on stained blots.
10-min wash in PBS. The Atp7a and Dmt1 polyclonal antisera were
then applied at a 1:1,000 and 1: 6,000 dilutions, respectively, overnight in a humidified chamber, followed by a 10-min wash in PBS. A
secondary antibody (Alexa Fluor 647 goat antirabbit IgG; Invitrogen
Molecular Probes) was then applied for 30 min at a 1:1,000 dilution.
After another brief wash in PBS, coverslips were mounted with a
fluorescent mounting medium. Slides were visualized in the Confocal
and Flow Cytometry Facility in the McKnight Brain Institute at the
University of Florida with an Olympus IX81-DSU confocal microscope. A 633-nm line from a green HeNe laser was used for sample
excitation along with a Cy5 emission filter set. The confocal settings
were kept identical across the different samples, so direct comparison
of fluorescence intensity was possible.
Oxidase Activity Assays
Principal. Heph and Cp activity can be measured by in gel assays
or with a spectrophotometer; both approaches were utilized in the
present investigation. For FOX activity assays, the spectrophotometric
approach was utilized. After samples were reacted with ferrous iron at
37°C, they were incubated with ferrozine (Fz); when Fz interacts with
ferric iron, a color change ensues that can be quantified on a spectrophotometer. Heph and Cp, in addition to having FOX activity, possess
amine oxidase activity, which serves as a surrogate for FOX activity.
In this assay, the substrate para-Phenylenediamine (pPD), a sixcarbon phenyl derivative, is oxidized to a fused-ring, aromatic compound (C18H18N6), with an absorption maxima at ⬃530 nm, which
was either visualized as a dark band in a gel or measured quantitatively in a spectrophotometer (44).
In-gel pPD assay. One milligram of serum proteins per lane was
electrophoresed through a native 7.5% polyacrylamide gel at a constant 80 V in 1⫻ native running buffer (0.12 M Tris and 0.04 M
glycine) in an ice-water bath. The gel was then briefly rinsed in water,
incubated in 30 ml 0.1% pPD in 0.1 M Na2CO3-CH3COOH buffer,
pH 5.0, for 2–3 h in the dark with gentle shaking, rinsed again, and
air-dried overnight, as previously described in detail (42).
Spectrophotometric pPD assay. The reaction mix contained 500 ␮g
of serum (15–20 ␮l) or 60 ␮g of membrane proteins isolated from
duodenal enterocytes with 0.1% pPD in 0.1 M Na2CO3-CH3COOH
buffer, pH 5.0, which was incubated at 37°C. After consideration of
the kinetic properties of the enzyme and based on results of extensive
pilot experiments, a 1-h reaction time, end-point assay was chosen
(42). The reaction was stopped by addition of NaN3 to a final
concentration, of 10 mM, the sample was mixed, and absorbance was
read at 530 nm in a Beckman DU 640 spectrophotometer. Blank
(complete reaction buffer devoid of serum, i.e., enzyme source)
readings were subtracted from sample readings.
Spectrophotometric Fz assay. All Fz assays were initial velocity
assays at a 1-min time point. The reaction conditions were as mentioned above except the reaction was stopped by addition of Fz to a
final concentration of 3 mM. The sample was then mixed, and
absorbance was read at 570 nm in a Beckman DU 640 spectrophotometer. Blank readings were subtracted from sample readings. In
both spectrophotometric methods, sera were also assayed in the
presence of 10 mM NaN3, a well-studied FOX inhibitor, to confirm
the identity of the enzyme.
Immunohistochemical Analysis of Intestinal Tissue.
RESULTS
Transverse sections of intestinal tissues were harvested from the
duodenum of ⫹/b and b/b and of control and iron-deficient SD rats.
Tissues were fixed overnight in 10% buffered formalin and then
transferred to 70% ethanol. Samples were then embedded in paraffin,
and slices were cut and affixed to slides. Tissue sections on slides
were subsequently deparaffinized with xylene and a series of ethanol
washes. Sections were then blocked for 30 – 45 min with immunofluorescence blocking solution (Bethyl Laboratories) followed by a
Hematological Status as a Function of Diet
AJP-Gastrointest Liver Physiol • VOL
Hb (Fig. 1A) and Hct (Fig. 1B) values were followed as
markers of hematological status. Because the Belgrade rats
used for this study were mixed sex and age, appropriate
statistical analysis was chosen to remove bias and justify
combining the data from all rats of each genotype for each
parameter studied. Because there was no a priori reason to
301 • NOVEMBER 2011 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
Gene Symbol
G879
G880
COPPER-RELATED COMPENSATORY RESPONSES IN THE BELGRADE RAT
expect interaction between sex and genotype, the rats were
divided into four independent groups (M ⫹/b, M b/b, F ⫹/b,
and F b/b; M ⫽ male, F ⫽ female) and data were analyzed by
one-way ANOVA followed by Tukey analysis to test the
difference between each group. As expected, Hb and Hct levels
in the b/b rats were significantly lower than in the ⫹/b rats
(Fig. 1, A and B). No differences were noted between males
and females. Thus the b/b rats showed a significant irondeficient phenotype, whereas ⫹/b rats had normal hematological parameters. Next, to test whether different ages could
affect hematological status, correlation analysis was applied
between age and Hb/Hct levels (Fig. 1, C and D). As results
show, there was no correlation, demonstrating that age had no
affect on hematological parameters. On the basis of these
statistical approaches showing no effect of sex or age on
hematological status, it was concluded that it was reasonable to
group data from all animals of each individual genotype.
Serum Copper Levels and Hepatic Iron and Copper Levels
Genetic iron deficiency attributable to Dmt1 mutation
slightly reduced serum copper in b/b rats (Fig. 2A), whereas
hepatic copper was the same in both genotypes (Fig. 2B).
These results showed a different pattern from what has been
documented in multiple mammalian species including rats,
namely that serum and hepatic copper levels increase during
moderate to severe iron deficiency (23, 28, 43, 53). Moreover,
AJP-Gastrointest Liver Physiol • VOL
liver iron was reduced by ⬃70% in the b/b rats compared with
the ⫹/bs.
Expression of Cu and Fe Homeostasis-Related Genes
qRT-PCR analysis of intestinal and hepatic genes related to
iron and copper homeostasis was performed in all rats to
determine whether a lack of fully functional Dmt1 caused
altered gene expression. Expression of genes quantified in
intestine encoded potential copper importers (Dmt1; Ctr1), an
intracellular copper binding protein (Mt1a), and a copper
exporter (Atp7a). Expression of genes encoding proteins related to iron transport were also quantified, including Dmt1 and
Tfrc, as well as a basolateral iron oxidase (Heph) and the
hepatic iron regulatory hormone Hamp. In liver, expression of
the copper importer Ctr1 and the copper exporter, Atp7b, were
also quantified. In enterocytes from the proximal small bowel,
Dmt1 (⬃11.5-fold), Tfrc (⬃3-fold), and Atp7a (⬃2-fold) were
all induced in b/bs compared with ⫹/bs (Fig. 3A). There was
no significant change, however, in the expression of Heph,
Ctr1, and Mt1a mRNAs. In the liver, Hamp was significantly
decreased (⬎40-fold), whereas Tfrc was induced (⬃3-fold) in
b/bs compared with ⫹/bs (Fig. 3B). Mt1a and Cp mRNA levels
in liver were not different between genotypes. Other hepatic
Cu homeostasis-related genes, Atp7b and Ctr1, showed a slight
reduction in the b/bs.
301 • NOVEMBER 2011 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
Fig. 1. Hematological status of experimental animals. Hemoglobin (Hb) (A) and hematocrit (Hct) (B) levels are shown graphically. M, male; F, female.
a,b
Statistically different from one another (P ⬍ 0.05). Means ⫾ SD are shown. Correlation analysis was performed to compare Hb and Hct to age, as seen in
C and D, respectively. r, Pearson Correlation coefficient. n ⫽ 24 for ⫹/bs; n ⫽ 18 for b/bs.
COPPER-RELATED COMPENSATORY RESPONSES IN THE BELGRADE RAT
G881
Fig. 2. Copper content in rat serum and hepatic iron and copper content. A: serum copper level. B: liver copper content. Serum, n ⫽ 3 for ⫹/b and n ⫽ 4 for
b/b; Liver, n ⫽ 6 for ⫹/b and n ⫽ 4 for b/b. C: hepatic iron content (n ⫽ 6 for ⫹/b and n ⫽ 4 for b/b). Means ⫾ SD are shown. *Statistically significant
differences between genotypes (P ⬍ 0.05).
Immunoblot analyses of membrane proteins isolated from
enterocytes showed increased expression of Atp7a and Dmt1
(⬃2- fold) in b/b rats (Fig. 4, A and B). Heph protein expression in enterocyte membrane preps was slightly increased
(⬍2.0-fold) in the b/b rats (Fig. 4C) compared with ⫹/bs.
Finally, there was no difference in serum Cp protein levels
between genotypes (Fig. 4D).
Immunohistochemical Analyses of Atp7a and Dmt1 Protein
Expression in Rat Duodenum
Because the subcellular location is also important for protein
function, immunolocalization studies were performed in fixed
intestinal tissue samples from proximal small intestine, utilizing anti-Atp7a and -Dmt1 antibodies. Control (Ctrl) and irondeficient (FeD) SD rat samples were used for comparison.
Confocal microscopic imaging revealed robust Atp7a protein
expression along the basolateral membrane of enterocytes in
FeD and b/b rats with little expression observed in Ctrl or ⫹/b
rats (Fig. 5A). Dmt1 expression was very low in Ctrl and ⫹/b
rats and was much higher in the FeD rats and b/bs. Robust
Dmt1 expression was noted along the apical surface of villus
enterocytes in iron-deficient rats, whereas the protein was
detected intracellularly and on the apical surface in the b/b rats.
Activity Assays for Cp and Heph
Serum and enterocyte FOX and amine oxidase activity
assays were performed to determine whether enzyme function
was altered by genetic iron deficiency. No differences in
activity between genotypes were noted in serum representing
Cp activity (data not shown; spectrophotometric assays: pPD,
⫹/b n ⫽ 6, b/b n ⫽ 4; Fz, ⫹/b n ⫽ 13, b/b n ⫽ 9) or enterocyte
membrane representing Heph activity (data not shown; spectrophotometric assays: pPD, ⫹/b n ⫽ 6, b/b n ⫽ 4; Fz, ⫹/b n ⫽
9, b/b n ⫽ 5). Furthermore, rat serum FOX/amine oxidase
activity was almost completely abolished in the presence of 10
mM NaN3 (not shown), consistent with a recent publication
(42), whereas inhibition of enterocyte membrane Heph activity
was consistently ⬃75% (data not shown).
Fig. 3. qRT-PCR analysis of intestinal and hepatic gene expression. qRT-PCR was performed with RNA samples extracted from isolated enterocytes (left) and
liver (right) of ⫹/b and b/b rats. Experimental repetitions utilizing different groups of ⫹/b or b/b animals were as follows: ⫹/b, n ⫽ 19 and b/b, n ⫽ 13 for
intestine; ⫹/b, n ⫽ 24 and b/b, n ⫽ 18 for liver. Y-axis shows fold change in b/bs compared with ⫹/bs. The dashed line corresponding to 1.0-fold change (i.e.,
no change) on the y-axis is shown in both panels; bars below 1.0 indicate decreases, and bars above indicate increases in the b/b compared with the ⫹/bs. *P ⬍
0.05, **P ⬍ 0.01, ***P ⬍ 0.001; all indicating significant differences between genotypes. Means ⫾ SD are shown. Atp7a, Menkes copper transporting ATPase;
Atp7b, Wilson’s copper transporting ATPase; Cp, ceruloplasmin; Ctr1, copper transporter 1; Dmt1, divalent metal transporter 1; Hamp, hepcidin; Heph,
hephaestin; Mt1a, metallothionein 1A; Tfrc, transferrin receptor 1.
AJP-Gastrointest Liver Physiol • VOL
301 • NOVEMBER 2011 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
Western Blot Analysis of Cu and Fe
Homeostasis-Related Proteins
G882
COPPER-RELATED COMPENSATORY RESPONSES IN THE BELGRADE RAT
In-Gel Serum Amine Oxidase Activity Assays
To further confirm enzymatic activity utilizing a complementary experimental approach, in-gel assay was performed
under native conditions. Results showed the product of the
reaction catalyzed by serum protein using pPD as a substrate
(Fig. 6). As seen, activity in the b/bs was almost identical to
that in the ⫹/bs. Purified human Cp (Sigma; cat no. C4519),
used as a positive control, showed a strong band.
DISCUSSION
Previous studies documented induction of the Atp7a and Mt1a
genes in the duodenum of iron-deficient rats (11). This observation, combined with observed increases in serum and hepatic
copper levels in several mammalian species during iron deficiency, leads to speculation that increased copper export from
enterocytes via Atp7a may be involved in this phenomenon.
Moreover, it seems likely that alterations in copper homeostasis
AJP-Gastrointest Liver Physiol • VOL
reflect some aspect of the compensatory response to maximize
iron absorption from the diet and release from body stores to
support normal erythropoiesis. In this scenario, one would predict
that there would also be increases in the copper import machinery,
with Dmt1 being a potential player in this process. The possibility
that iron deficiency enhances intestinal copper absorption, which
contributes to hepatic copper loading, has in fact been previously
proposed (51), and increased copper levels in duodenal tissue
were reported in iron-deficient rats (43); however, the role of
Dmt1 is not clear. The present studies were designed to examine
the role of Dmt1 in copper homeostasis during iron deficiency by
taking advantage of a naturally occurring Dmt1 mutation in the
Belgrade rat. Part of the approach was to compare/contrast with an
extensive body of data obtained in a wild-type rat (SD) dietary
iron deficiency model (11, 13).
The Belgrade rats used in this study were highly iron
deficient as exemplified by significant reductions in blood Hb
301 • NOVEMBER 2011 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
Fig. 4. Western blot analysis of iron/copper-related proteins. In each panel, a representative Western blot is shown along with quantitative data from all rats
studied. Numbers beside the Western blots indicate the placement of the closest molecular weight marker. Band intensities were normalized vs. total protein on
the stained blots (shown below each lane of the Western blots). In A, B and C, membrane proteins extracted from enterocytes were reacted with antibodies against
the respective proteins. A: anti-ATP7A antibody (⫹/b, n ⫽ 12 and b/b, n ⫽ 7). B: anti-DMT1 antibody (⫹/b, n ⫽ 10 and b/b, n ⫽ 6). The band just above 55
kDa was quantified (See DISCUSSION for explanation). C: anti-HEPH antibody (⫹/b, n ⫽ 15 and b/b, n ⫽ 8). D: serum proteins were reacted with anti-Cp antibody
(⫹/b, n ⫽ 13 and b/b, n ⫽ 7). *P ⬍ 0.05, **P ⬍ 0.01, ***P ⬍ 0.001; all indicating significant differences between genotypes. Means ⫾ SD are shown.
COPPER-RELATED COMPENSATORY RESPONSES IN THE BELGRADE RAT
G883
and Hct and hepatic iron levels. Unexpectedly, copper levels
were not increased in the liver or serum of the b/b rats, findings
that are inconsistent with a host of studies done in many
mammalian species (e.g., humans, dogs, rats) documenting
increased body copper during moderate to severe iron deficiency (7, 31, 35, 42, 46, 50, 53, 58) and hemorrhagic anemia
(5, 32, 40, 45). One might thus speculate that Dmt1 plays a role
in hepatic copper loading and the subsequent increase in blood
copper, which is likely the result of increased production and
secretion of holo-ceruloplasmin (42).
AJP-Gastrointest Liver Physiol • VOL
Gene expression studies revealed many similar alterations in
mRNA expression between the b/b rats and iron-deficient SD
rats, including induction of Dmt1, Atp7a, and Tfrc in duodenum and strong downregulation of Hamp in liver. Of note was
a lack of induction of Mt1a in duodenum and liver, an observation that varies from studies in SD rats in which there was a
strong upregulation of Mt1a mRNA expression in both tissues
(⬃50-fold in intestine and ⬃10-fold in liver; L. Jiang, J.
Collins, unpublished observation) (10, 11). The lack of copper
accumulation and a lesser induction of Atp7a in the Belgrades
301 • NOVEMBER 2011 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
Fig. 5. Immunohistochemical analysis of Atp7a and
Dmt1 protein expression in rat duodenum. Fixed tissue
sections were reacted with the anti-Atp7a- or -Dmt1specific antiserum followed by a fluorescent-tagged secondary antibody and imaged with a confocal microscope. A: Atp7a protein is depicted by the red color.
B: autofluorescence is shown (green) along with the
specific signal (red color) depicting the Dmt1 protein.
The confocal settings remained constant across all images. Images are typical of several experiments. Ctrl,
control Sprague Dawley (SD) rat; FeD, iron-deficient
SD rat.
G884
COPPER-RELATED COMPENSATORY RESPONSES IN THE BELGRADE RAT
(⬃2-fold vs. 6 – 8-fold in iron-deficient SD rats), suggests that
Mt1a induction may be linked to copper accumulation in these
tissues, which does not occur in the Belgrades. Mt1a is in fact
strongly induced by copper and is thought to be involved in
intestinal (33) and liver (3) copper homeostasis.
Immunoblot analyses exemplified the physiological relevance of increases in transcript expression in that the Atp7a
and Dmt1 proteins also increased significantly in the Belgrades. Again, the induction of Atp7a was much less than the
increases noted in iron-deficient SD rats (43). In the present
investigation, the Dmt1 band, which was much stronger in the
b/b rats, was noted at slightly ⬎55 kDa; other bands on blots
were of similar intensity in ⫹/bs and b/bs, likely representing
nonspecific signals. A survey of the primary literature reveals
a wide discrepancy in the molecular weight of Dmt1 in Western blot analyses, with variations in rodent and human intestine
noted from ⬃43 to 85 kDa (34, 36, 37, 57, 59). The molecular
weight of the Dmt1 detected in the present studies thus falls
within ranges reported elsewhere, and its strong induction in
the b/b rats lends confidence to it being specific. Consistent
with the immunoblots, Atp7a and Dmt1 protein expression was
noted to increase in intestinal tissue sections derived from b/b
rats, which is consistent with the increase observed in irondeficient SD rats. Atp7a protein was detected intracellularly,
most likely in the trans-Golgi, and also on the basolateral
membrane of enterocytes in the iron-deficient condition. Dmt1
expression was observed along the apical surface of villus
enterocytes in iron-deficient SD rats, but the protein was
abnormally distributed in the b/b rats. This finding is consistent
with a previous publication that showed mislocalization of the
mutant Dmt1 protein in the mk mouse (harboring the exact
same point mutation as in the Belgrade rat) (4). It should be
noted that, although the cellular machinery that mediates the
induction of Dmt1 mRNA and protein expression during iron
deficiency is obviously intact in the Belgrade rat, it is without
functional consequence, as the mutant protein is mislocalized
AJP-Gastrointest Liver Physiol • VOL
301 • NOVEMBER 2011 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
Fig. 6. In-gel serum Cp activity assays. Serum samples were separated by
native gel electrophoresis and subsequently reacted with the substrate (paraPhenylenediamine, pPD) to estimate enzyme activity levels. The site of
enzyme activity is represented by the dark bands just below the midpoint of the
gel. The blue, diffuse bands at the bottom of the gel are loading dye. Each
genotype is represented by samples from 5 individual rats. Purified human Cp
protein was used as positive control (CP).
in the intestine and has a greatly diminished capacity to
transport iron, as exemplified by the iron-deficient phenotype.
Given the role of the multi-copper FOXs Cp and Heph in
body iron homeostasis and based on the fact that they are
copper-dependent enzymes, it was important to consider the
expression/activity of these proteins in the present investigation. Heph is a membrane-bound protein found on the basolateral surface of enterocytes, which is considered necessary for
optimal iron absorption (9, 54). Previous reports have suggested that Heph, while not being strongly regulated, is upregulated during iron deficiency (⬍2-fold) (1). Consistent with
this observation, in the present studies, a moderate increase in
enterocyte membrane Heph protein was detected on Western
blots; however, no change in membrane FOX or amine oxidase
activity was noted. This finding is consistent with observations
made by the authors in iron-deficient SD rats (P. Ranganathan,
Y. Lu, J. Collins, unpublished observation). Dmt1 thus does
not seem to play a role in regulating the expression or activity
of intestinal Heph during iron deficiency.
The second FOX, Cp, is a liver-derived, circulating protein
involved in iron release from sites of storage (38). Serum Cp
activity increases during iron deficiency in humans (53), and a
similar increase in immunoreactive protein and activity was
recently documented in iron-deficient SD rats (42). However,
in the Belgrades, no change in Cp protein expression or serum
FOX or amine oxidase activity (both presumably contributed
by circulating Cp) was observed, compared with the phenotypically normal ⫹/b rats. The most likely explanation for this
observation relates to the lack of hepatic copper loading in the
Belgrades, as discussed above, again implicating Dmt1 in this
process. Another possible interpretation of these data relates to
the degree of iron deficiency. The Belgrades used in these
studies exhibited significant iron deficiency as indicated by an
⬃70% reduction in liver iron, whereas iron-deficient SD rats in
which previous studies were performed showed slightly greater
decreases in liver iron (⬃83%) (42). It is, however, important
to point out that various degrees of iron deficiency in a host of
mammalian species have been shown to lead to increases in
liver and serum copper, including moderate iron deficiency in
rats with an ⬃18% reduction in Hb levels (11, 43) and with a
56% reduction in liver iron but no change in Hb levels (47).
Additional examples of such exist in moderately iron-deficient
rats (46, 50). Furthermore, iron deficiency anemia has been
extensively associated with increased serum copper levels in
humans (17, 27); many other examples have also been documented. The key point here is that iron deficiency anemia in
humans is a moderate iron deficiency, with Hbs reduced by
perhaps 50%, similar to the reduction seen in the Belgrade rats
used in the present studies. On the basis of these facts, we feel
that the most likely explanation for there being no increases in
body copper levels in the Belgrades, despite a level of iron
deficiency that alters copper levels in wild-type rats and other
mammalian species, is the lack of fully functional Dmt1.
In summary, data presented in this article reveal aspects of
Dmt1 function that are necessary for the normal, copperdependent compensatory response to iron deficiency. Lack of
Mt1a induction in the intestine and liver, lesser induction of
duodenal Atp7a, and a lack of hepatic copper loading demonstrate that alterations in copper homeostasis during iron deficiency are less pronounced in the absence of fully functional
Dmt1. Furthermore, increases in holo-Cp levels do not occur in
COPPER-RELATED COMPENSATORY RESPONSES IN THE BELGRADE RAT
the b/b rats, a finding that may also be explained by a previously unrecognized property of Dmt1 that permits hepatic
copper loading to occur during iron deficiency. Overall, this
investigation has revealed potentially novel physiological aspects of Dmt1 function and has provided additional evidence of
the utility of the Belgrade rat model of iron deficiency to reveal
novel aspects of mammalian iron homeostasis.
GRANTS
This study was supported by NIH grant R01 DK074867 (J. Collins).
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
REFERENCES
AJP-Gastrointest Liver Physiol • VOL
19. Fay JCG, Wintrobe MM. Studies on free erythrocyte protopotphyrin,
serum iron, serum iron-binding capacity and plasma copper during normal
pregnancy. J Clin Invest 487–491, 1949.
20. Ferguson CJ, Wareing M, Ward DT, Green R, Smith CP, Riccardi D.
Cellular localization of divalent metal transporter DMT-1 in rat kidney.
Am J Physiol Renal Physiol 280: F803–F814, 2001.
21. Fleming MD, Romano MA, Su MA, Garrick LM, Garrick MD,
Andrews NC. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence
of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA
95: 1148 –1153, 1998.
22. Fleming MD, Trenor CC 3rd, Su MA, Foernzler D, Beier DR, Dietrich
WF, Andrews NC. Microcytic anaemia mice have a mutation in Nramp2,
a candidate iron transporter gene. Nat Genet 16: 383–386, 1997.
23. Fox PL. The copper-iron chronicles: the story of an intimate relationship.
Biometals 16: 9 –40, 2003.
24. Garrick M, Scott D, Walpole S, Finkelstein E, Whitbred J, Chopra S,
Trivikram L, Mayes D, Rhodes D, Cabbagestalk K, Oklu R, Sadiq A,
Mascia B, Hoke J, Garrick L. Iron supplementation moderates but does
not cure the Belgrade anemia. Biometals 10: 65–76, 1997.
25. Gubler CJ, Lahey ME, Cartwright GE, Wintrobe MM. Studies on
copper metabolism. IX. The transportation of copper in blood. J Clin
Invest 32: 405–414, 1953.
26. Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron
WF, Nussberger S, Gollan JL, Hediger MA. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388:
482–488, 1997.
27. Gurgoze MK, Olcucu A, Aygun AD, Taskin E, Kilic M. Serum and hair
levels of zinc, selenium, iron, and copper in children with iron-deficiency
anemia. Biol Trace Elem Res 111: 23–29, 2006.
28. Hahn PF, Whipple GH. Iron metabolism in experimental anemia:
“Availability of iron”. J Exp Med 67: 259 –265, 1938.
29. Hart EB, Steenbock H, Elvehjem CA, Waddell J. Nutritional anemia on
whole milk diets and the utilization of inorganic iron in hemoglobin
building. J Biol Chem 65:67–80, 1925.
30. Hart EB, Steenbock H, Waddell J, Elvehjem CA. Iron in nutrition. VII.
Copper as a supplement to iron for hemoglobin building in the rat. J Biol
Chem 277: 797–812, 1928.
31. Iwanska SSD. Copper metabolism in different states of erythropoiesis
activity. Acta Physiol Pol 465–474, 1978.
32. Johnson DA, Osaki S, Frieden E. A micromethod for the determination
of ferroxidase (ceruloplasmin) in human serums. Clin Chem 13: 142–150,
1967.
33. Kelly EJ, Palmiter RD. A murine model of Menkes disease reveals a
physiological function of metallothionein. Nat Genet 13: 219 –222, 1996.
34. Knopfel M, Zhao L, Garrick MD. Transport of divalent transition-metal
ions is lost in small-intestinal tissue of b/b Belgrade rats. Biochemistry 44:
3454 –3465, 2005.
35. Lahey ME, Gubler CJ, Cartwright GE, Wintrobe MM. Studies on
copper metabolism. VII. Blood copper in pregnancy and various pathologic states. J Clin Invest 32: 329 –339, 1953.
36. Liu YQ, Duan XL, Chang YZ, Wang HT, Qian ZM. Molecular analysis
of increased iron status in moderately exercised rats. Mol Cell Biochem
282: 117–123, 2006.
37. Millard KN, Frazer DM, Wilkins SJ, Anderson GJ. Changes in the
expression of intestinal iron transport and hepatic regulatory molecules
explain the enhanced iron absorption associated with pregnancy in the rat.
Gut 53: 655–660, 2004.
38. Miyajima H, Nishimura Y, Mizoguchi K, Sakamoto M, Shimizu T,
Honda N. Familial apoceruloplasmin deficiency associated with blepharospasm and retinal degeneration. Neurology 37: 761–767, 1987.
39. Oates PS, Morgan EH. Defective iron uptake by the duodenum of
Belgrade rats fed diets of different iron contents. Am J Physiol Gastrointest Liver Physiol 270: G826 –G832, 1996.
40. Pagliardi E, Giangrandi E, Vinti A. Behavior of plasmatic & erythrocytic copper in morbid conditions. Rass Fisiopatol Clin Ter 29: 907–921,
1957.
41. Pinkerton PH, Bannerman RM. Hereditary defect in iron absorption in
mice. Nature 216: 482–483, 1967.
42. Ranganathan P, Lu Y, Jiang L, Kim C, Collins JF. Serum ceruloplasmin (CP) protein expression and activity increases in iron deficient rats
and is further enhanced by higher dietary copper intake. Blood 2011, July
18. [Epub ahead of print].
43. Ravia JJ, Stephen RM, Ghishan FK, Collins JF. Menkes Copper
ATPase (Atp7a) is a novel metal-responsive gene in rat duodenum, and
301 • NOVEMBER 2011 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
1. Anderson GJ, Frazer DM, McKie AT, Vulpe CD. The ceruloplasmin
homolog hephaestin and the control of intestinal iron absorption. Blood
Cells Mol Dis 29: 367–375, 2002.
2. Arredondo M, Munoz P, Mura CV, Nunez MT. DMT1, a physiologically relevant apical Cu1⫹ transporter of intestinal cells. Am J Physiol
Cell Physiol 284: C1525–C1530, 2003.
3. Bremner I. Involvement of metallothionein in the hepatic metabolism of
copper. J Nutr 117: 19 –29, 1987.
4. Canonne-Hergaux F, Fleming MD, Levy JE, Gauthier S, Ralph T,
Picard V, Andrews NC, Gros P. The Nramp2/DMT1 iron transporter is
induced in the duodenum of microcytic anemia mk mice but is not
properly targeted to the intestinal brush border. Blood 96: 3964 –3970,
2000.
5. Cartwright GE, Huguley CM Jr, Aschenbrucker H, Fay J, Wintrobe
MM. Studies on free erythrocyte protoporphyrin, plasma iron and plasma
copper in normal and anemic subjects. Blood 3: 501–525, 1948.
6. Cartwright GE, Lauritsen MA, Humphreys S, Jones PJ, Merrill IM,
Wintrobe MM. The anemia of infection. II. The experimental production
of hypoferremia and anemia in dogs. J Clin Invest 25: 81–86, 1946.
7. Cartwright GE, Wintrobe MM. Studies on free erythrocyte protoporphyrin, plasma copper, and plasma iron in normal and in pyridoxinedeficient swine. J Biol Chem 172: 557–565, 1948.
8. Chen H, Attieh ZK, Dang T, Huang G, van der Hee RM, Vulpe C.
Decreased hephaestin expression and activity leads to decreased iron
efflux from differentiated Caco2 cells. J Cell Biochem 107: 803–808,
2009.
9. Chen H, Su T, Attieh ZK, Fox TC, McKie AT, Anderson GJ, Vulpe
CD. Systemic regulation of Hephaestin and Ireg1 revealed in studies of
genetic and nutritional iron deficiency. Blood 102: 1893–1899, 2003.
10. Collins JF. Gene chip analyses reveal differential genetic responses to
iron deficiency in rat duodenum and jejunum. Biol Res 39: 25–37, 2006.
11. Collins JF, Franck CA, Kowdley KV, Ghishan FK. Identification of
differentially expressed genes in response to dietary iron deprivation in rat
duodenum. Am J Physiol Gastrointest Liver Physiol 288: G964 –G971,
2005.
12. Collins JF, Hu Z, Ranganathan PN, Feng D, Garrick LM, Garrick
MD, Browne RW. Induction of arachidonate 12-lipoxygenase (Alox15)
in intestine of iron-deficient rats correlates with the production of biologically active lipid mediators. Am J Physiol Gastrointest Liver Physiol 294:
G948 –G962, 2008.
13. Collins JF, Hua P, Lu Y, Ranganathan PN. Alternative splicing of the
Menkes copper ATPase (Atp7a) transcript in the rat intestinal epithelium.
Am J Physiol Gastrointest Liver Physiol 297: G695–G707, 2009.
14. Curzon G. Some properties of coupled iron-caeruloplasmin oxidation
systems. Biochem J 79: 656 –663, 1961.
15. Curzon GORS. A coupled iron-ceruloplasmin oxidation system. Biochem
Biophys Res Commun 284 –286, 1960.
16. Dupic F, Fruchon S, Bensaid M, Loreal O, Brissot P, Borot N, Roth
MP, Coppin H. Duodenal mRNA expression of iron related genes in
response to iron loading and iron deficiency in four strains of mice. Gut
51: 648 –653, 2002.
17. Ece A, Uyanik BS, Iscan A, Ertan P, Yigitoglu MR. Increased serum
copper and decreased serum zinc levels in children with iron deficiency
anemia. Biol Trace Elem Res 59: 31–39, 1997.
18. Edwards JA, Garrick LM, Hoke JE. Defective iron uptake and globin
synthesis by erythroid cells in the anemia of the Belgrade laboratory rat.
Blood 51: 347–357, 1978.
G885
G886
44.
45.
46.
47.
48.
49.
51.
immunoreactive protein is present on brush-border and basolateral membrane domains. J Biol Chem 280: 36221–36227, 2005.
Roeser HP, Lee GR, Nacht S, Cartwright GE. The role of ceruloplasmin in iron metabolism. J Clin Invest 49: 2408 –2417, 1970.
Sachs A. The effect of bleeding ulcers and hemmoraghic anemia upon
whole blood copper and iron. Am J Digest Dis Nutr 4: 803–804, 1938.
Sherman AR, Tissue NT. Tissue iron, copper and zinc levels in offspring
of iron-sufficient and iron-deficient rats. J Nutr 111: 266 –275, 1981.
Shukla A, Agarwal KN, Shukla GS. Effect of latent iron deficiency on
the levels of iron, calcium, zinc, copper, manganese, cadmium and lead in
liver, kidney and spleen of growing rats. Experientia 46: 751–752, 1990.
Sladic-Simic D, Martinovitch PN, Zivkovic N, Pavic D, Martinovic J,
Kahn M, Ranney HM. A thalassemia-like disorder in Belgrade laboratory rats. Ann NY Acad Sci 165: 93–99, 1969.
Sladic-Simic D, Zivkovic N, Pavic D, Marinkovic D, Martinovic J,
Martinovitch PN. Hereditary hypochromic microcytic anemia in the
laboratory rat. Genetics 53: 1079 –1089, 1966.
Stangl GI, Kirchgessner M. Effect of different degrees of moderate iron
deficiency on the activities of tricarboxylic acid cycle enzymes, and the
cytochrome oxidase, and the iron, copper, and zinc concentrations in rat
tissues. Z Ernahrungswiss 37: 260 –268, 1998.
Sugawara N, Sugawara C. An iron-deficient diet stimulates the onset of
the hepatitis due to hepatic copper deposition in the Long-Evans Cinnamon (LEC) rat. Arch Toxicol 73: 353–358, 1999.
AJP-Gastrointest Liver Physiol • VOL
52. Tennant J, Stansfield M, Yamaji S, Srai SK, Sharp P. Effects of copper
on the expression of metal transporters in human intestinal Caco-2 cells.
FEBS Lett 527: 239 –244, 2002.
53. Venakteshwara Rao M, Khanijo SK, Chande RD, Chouhan SS,
Bisarya BN. Serum ceruloplasmin in iron deficiency anaemia. J Assoc
Physicians India 23: 571–576, 1975.
54. Vulpe CD, Kuo YM, Murphy TL, Cowley L, Askwith C, Libina N,
Gitschier J, Anderson GJ. Hephaestin, a ceruloplasmin homologue
implicated in intestinal iron transport, is defective in the sla mouse. Nat
Genet 21: 195–199, 1999.
55. Warburg OKH. Uber locker gebundenes Kupfer und Eisen im Blutserum. Biochem Z: 143–149, 1927.
56. Wintrobe MM, Cartwright GE, Lahey ME, Gubler CJ. The role of
copper in hemopoiesis. Trans Assoc Am Physicians 310 –315, 1951.
57. Yeh KY, Yeh M, Watkins JA, Rodriguez-Paris J, Glass J. Dietary
iron induces rapid changes in rat intestinal divalent metal transporter
expression. Am J Physiol Gastrointest Liver Physiol 279: G1070 –
G1079, 2000.
58. Yokoi K, Kimura M, Itokawa Y. Effect of dietary iron deficiency on
mineral levels in tissues of rats. Biol Trace Elem Res 29: 257–265,
1991.
59. Zoller H, Koch RO, Theurl I, Obrist P, Pietrangelo A, Montosi G,
Haile DJ, Vogel W, Weiss G. Expression of the duodenal iron transporters divalent-metal transporter 1 and ferroportin 1 in iron deficiency and
iron overload. Gastroenterology 120: 1412–1419, 2001.
301 • NOVEMBER 2011 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 17, 2017
50.
COPPER-RELATED COMPENSATORY RESPONSES IN THE BELGRADE RAT