Developmental Expression of Mucin Genes in the Human Respiratory Tract
Colm J. Reid, Stephen Gould, and Ann Harris
Paediatric Molecular Genetics, Institute of Molecular Medicine, Oxford University; and Paediatric Pathology,
John Radcliffe Hospital, Oxford, United Kingdom
Mucin glycoproteins play a key role in the normal function of the airway epithelium. We examined the expression of mucin genes, MUC3, 4, 5AC, 5B, 6, 7, and 8 in human fetal tissues to establish the localization
and age of onset of expression of each mucin gene during human development. We detected expression of
MUC4, 5AC, 5B, and 7 in the mid-trimester airway epithelium but did not detect expression of MUC3, 6,
or 8. MUC4 was expressed in the trachea and large airways in the majority of cells in the airway epithelium. Expression of MUC5AC was only seen in individual goblet cells in the trachea, while MUC5B was
expressed in the surface epithelium of the trachea at 13 wk but was largely restricted to submucosal glands
by 23 wk of gestation. Reid, C. J., S. Gould, and A. Harris. 1997. Developmental expression of mucin
genes in the human respiratory tract. Am. J. Respir. Cell Mol. Biol. 17:592–598.
Mucous glycoproteins, mucins, play a key role in the human airways by protecting the epithelial surface from injury and by facilitating removal of materials that enter the
lung. Clearance of the mucous layer is achieved by beating
cilia on ciliated epithelial cells in the airway which move
the secretions up through the airways towards the nose and
throat. The molecular composition of proteins in this mucous layer was poorly characterized until the isolation of a
number of human mucin genes enabled the identification
of those that are expressed in the airway epithelium (1–3).
Nine mucin genes have been identified, MUC1, 2, 3, 4,
5AC, 5B, 6, 7, and 8 (1–12), though only MUC1, 2, and 7
have been fully cloned. Partial sequence, generally from
the tandem repeat, is available for the remainder of the
genes. Studies of tissue localization have been carried out
for a number of mucins using antibodies; however, these
studies have the limitation that many of the antibodies
bind to carbohydrate determinants that are present on different mucin core proteins. Some protein epitopes may
also be masked by glycosylation. Hence, cell-specific localization of mucin gene expression is most reliably determined by using in situ mRNA hybridization with gene-specific oligonucleotides or riboprobes.
Mucins play a fundamental role in the pathogenesis of
many lung diseases, particularly those involving chronic
inflammation of the airways or susceptibility to infection
(Received in original form October 7, 1996 and in revised form January 6,
1997)
Address correspondence to: Dr. Ann Harris, Paediatric Molecular Genetics, Institute of Molecular Medicine, Oxford University, John Radcliffe
Hospital, Oxford OX3 9DU, UK. E-mail: [email protected]
Abbreviation: transfer RNA, tRNA.
Am. J. Respir. Cell Mol. Biol. Vol. 17, pp. 592–598, 1997
such as asthma, chronic bronchitis, and cystic fibrosis. Mucin gene expression has been examined in the postnatal
respiratory system of normal individuals and in a number
of disease states (reviewed in 13). We examined the developmental expression of human mucin genes to establish
which genes are important in the development and differentiation of the human lung epithelium. We previously reported expression of MUC1 and MUC2 in the fetal lung
(14). Data in this report show expression of MUC4,
MUC5AC, and MUC5B in the mid-trimester airway epithelium. Low levels of MUC7 were seen in tracheal submucosal glands at 23 wk. No expression of MUC3, 6, or 8
was observed. MUC4 was detected in the trachea and
large airways where it was expressed in the majority of
cells in the airway epithelium. MUC5AC was only expressed in individual goblet cells in the trachea both within
the surface epithelium and in the necks of submucosal
glands. MUC5B transcripts were detected in the surface
epithelium of the trachea at 13 wk, but were mainly seen in
submucosal gland epithelium by 23 wk of gestation.
Materials and Methods
Tissues from mid-trimester terminations were obtained
with local ethical committee approval and age was determined on the basis of foot length. Data presented here are
derived from two 13-wk fetuses, one male and one female;
two 17/18-wk fetuses, one male and one female; and one
female fetus of 23-wk gestation. Adult lung was normal tissue adjacent to tumors removed at surgery. Tissues for in
situ hybridization were fixed directly in 4% paraformaldehyde (pH 9.5) overnight at 48C, embedded and frozen in
liquid nitrogen prior to cutting 10-mm sections. Frozen sections were mounted onto Vectabond-treated slides (Vector Laboratories Ltd., Burlingame, CA) and stored desic-
Reid, Gould, and Harris: Mucin Developmental Expression
TABLE 1
Developmental expression of mucins in
human airway tissue
Trachea
MUC 3
MUC 4
MUC 5AC
MUC 5B
MUC 6
MUC 7
MUC 8
Lung
MUC 3
MUC 4
MUC 5B
MUC 6
MUC 7
MUC 8
13 wk
17 wk
23 wk
Adult
2
111
2
111
2
2
2
2
111
11
2
2
2
2
111
1
111
2
1
2
N/A
N/A
N/A
N/A
N/A
N/A
N/A
2
1
2
2
2
2
2
1/2
2
2
2
2
2
111
11
2
2
2
2
111
111
2
1
2
Trachea denotes the epithelium lining the trachea and tracheal submucosal
glands. Lung denotes the airway epithelium lining bronchi and bronchioles and
associated submucosal glands as described in the text. N/A 5 not available.
cated at 2208C until used. For each tissue, a minimum of 9
sections were hybridized with antisense probes for each
mucin gene and 6 sections were hybridized with the respective sense probes.
In situ Hybridization
In situ hybridization was carried out as described previously
(14). The following 74 bp double-stranded oligonucleotide
593
probes were used. MUC3:GACCACATACCACAGTACTCCCAGCTTCACTTCTTTGATCACCATCACTGAGACCACCTCACACAGTACTCCCA (bases 140-213 EMBL
Accession number M55405); MUC4:CACAAGTCACGCCACCTCTCTTCTTGTCACCGACGCTTCCTCAGTATCCACAGGTGACACCACCCCTCTTCCTG (bases 111184 EMBL Accession number M64594); MUC5AC:CCCACGACCAGCACAACCTCTGCCCCTACAACAAGAACAACTTCTGCTCCTAAAAGCAGCACAACCTCTGCCGC (bases 58-131 EMBL Accession number Z34278);
MUC5B:GGACGACCTGGATCCTCACAGAGCTGACCACAACAGACCACTACGACTGCATCCACTGGATCCACGGCCACCCC (bases 221-294 EMBL Accession
number X74955); MUC6:GGTCCACACACACAGCCCCACCAGTGACGCCGACCACCAGTGGGACGAGCCAAGCCGCGAGCTCATTCAGCACA (bases 308-381
EMBL Accession number S57578); MUC7:ACACCACAGCTGCCCCACCCACACCTTCTGCAACTACACCAGCTCCACCATCTTCCTCAGCTCCACCAGAGACC (bases 587-660 EMBL Accession number L13283);
MUC8:CCGGGTTCATGAGCTGCCCACGCCCTTTCCAGGAAGGGACCCCGGGTTCACGAGCTGCCCACGTCCTCTCCAGG (bases 35-109 EMBL Accession number U14383). Each oligonucleotide carried additional bases
to enable direct cloning into the BamH I and Hind III sites
of pBluescript. Antisense and sense probes were generated from the T7 and T3 promoters, respectively. An additional probe for MUC8 mRNA (pAM3-3) that includes
bases 1-312 of the pAM1 clone (12) that encompasses part
of the MUC8 tandem repeat was kindly provided by Dr.
G. Sachdev, Oklahoma. Purified probes were diluted to 5 3
106–2 3 107 cpm/ml in a hybridization solution containing
formamide (final concentration 60–65%), 13 Denhardt’s
Figure 1. Expression of MUC 4 in 13-wk trachea and bronchus. Expression of MUC4 mRNA in trachea (panels A–C) and bronchus
(panels D–F). Panels A and D show brightfield views of sections hybridized with the MUC4 antisense probe and panels B and E show
darkfield images of the same respective sections. Panels C and F show darkfield views of consecutive sections hybridized with the
MUC4 sense negative control probe. For all panels, size bar 5 200 mm.
594
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 17 1997
Figure 2. Expression of MUC 4 in 23-wk trachea and lung. Expression of MUC4 mRNA in trachea (panels A–C) and lung (panels D–F).
Panels A and D show brightfield views of sections hybridized with the MUC4 antisense probe and panels B and E show darkfield images
of the same respective sections. In panel E, MUC4 mRNA is seen in the epithelium lining bronchioles. Panels C and F show darkfield
views of consecutive sections hybridized with the MUC4 sense negative control probe. For all panels, size bar 5 200 mm.
solution, 10% dextran sulphate, 0.5 mg/ml RNase-free
transfer RNA (tRNA), and 10 mM DTT.
Tissue sections were digested with 10 mg/ml proteinase
K for 2 min at 378C, then treated with 25 mM acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min at room
temperature (RT); briefly rinsed in 23 SSC before dehydrating through a graded ethanol series and air dried. As a
control for nonspecific binding of the antisense probe,
some sections were treated with 20 mg/ml RNase A for 15
min at room temperature before incubation with proteinase K.
Hybridization was done overnight at 55–60 8C. Posthybridization, slides were washed four times in 43 SSC at
RT and digested with RNase A for 30 min at 37 8C. Sections were washed at a final stringency of 0.1 3 SSC at
608C or 708C for 30 min and dehydrated. Slides were ex-
Reid, Gould, and Harris: Mucin Developmental Expression
595
posed to Kodak Nuclear Tracking (NTB-2) liquid emulsion for 10–14 days at 4 8C. The slides were developed,
fixed, and counterstained with hematoxylin and eosin.
Results
Mucin gene expression was analyzed at 13 wk, 17/18 wk,
and 23 wk of gestation, and in adult lung. These time
points encompass the crucial phases of epithelial cell development in the lung. Data presented here are from two
fetuses at 13 wk, two at 17/18 wk, and one at 23 wk. Other
fetuses of the same ages have been examined for mucin
gene expression and there was no significant variation in
the patterns between different fetuses of the same gestational age.
MUC3
No expression of MUC3 was detected in fetal trachea or
lung at any stage of gestation that was examined (Table 1).
This is consistent with the previous finding that MUC3 is
an intestinal mucin (6, 8). The MUC3 probe was shown to
be efficient at detecting MUC3 RNA in intestinal tissues
(not shown) and the fetal tissue samples analyzed in this
study were shown to contain intact mRNA for other mucin genes (see below). Hence, the failure to detect MUC3
transcripts in fetal lung tissue is a reliable negative finding.
MUC 3 was not expressed in adult lung epithelium.
MUC4
The expression of MUC4 in fetal trachea and lung is
shown in Figures 1 and 2 and Table 1. MUC4 mRNA was
detected throughout the tracheal epithelium from 13 wk of
gestation (Figures 1A–1C) through 23 wk of gestation (Figures 2A–2C) to term. Expression of MUC4 within the lung
appears restricted to the epithelium of large airways, bronchi, and large bronchioles. It is detected within the epithelium of bronchi as low levels from 13 wk of gestation (Figures 1D, 1E) and expression levels remain low through the
mid-trimester, though by 23 wk there is substantial MUC4
mRNA in the epithelium of large airways (Figures 2D–
2F). In adult lung, MUC4 transcripts were detected in the
epithelium of main bronchi and bronchioles (not shown).
MUC5AC
MUC5AC mRNA was not detected in the airway at 13 wk
gestation in sections adjacent to one that contained abundant levels of MUC4 mRNA (Table 1), but was seen in the
trachea, both in goblet cells of the surface epithelium and
in cells within the neck of submucosal gland ducts, at 17
wk gestation (Figure 3) and at 23 wk. MUC5AC expression appeared more abundant at 17 wk than later in gestation (23 wk) though only one 23-wk fetus was examined.
In adult lung, MUC5AC was expressed at high levels in
the goblet cells of main bronchi and bronchioles (not
shown).
MUC5B
MUC5B was detected in clusters of cells within the tracheal epithelium at 13 wk (Figure 4C and Table 1), both in
the surface epithelium and in subepithelial invaginations.
By 23 wk, MUC5B transcripts were found primarily within
Figure 3. Expression of MUC 5AC in 17-wk trachea. Expression
of MUC5AC mRNA in trachea (panels A–C). Panel A shows a
brightfield view of a section hybridized with the MUC5AC antisense probe and panel B shows darkfield images of the same sections. Panel C shows a darkfield view of a consecutive section hybridized with the MUC5AC sense negative control probe. For all
panels, size bar 5 200 mm.
the epithelium of submucosal glands both within the trachea (Figures 4A, 4B, 4D) and in bronchioles (Figures 4F–
4H). In addition, cells at the neck of tracheal submucosal
gland ducts and individual cells elsewhere in the surface
epithelium of trachea and bronchioles expressed MUC5B
at 23 wk. Abundant expression of MUC5B was seen in adult
596
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 17 1997
Figure 4. Expression of MUC5B in 13-wk trachea, 23-wk bronchus, and adult bronchiole. Expression of MUC5B mRNA in trachea
(panels A–D) and bronchus (panels F–H). Panels A, B, and D, 23-wk trachea; panel C, 14-wk trachea; panel E, adult lung bronchiole;
panels F–H 23-wk bronchus. Panels A and C–F show brightfield views of sections hybridized with the MUC5B antisense probe; panel B
shows a darkfield image of the section shown in A; panel G shows a darkfield image of the section shown in F. Panel H shows a darkfield
view of a section consecutive to that shown in panels F and G hybridized with the MUC5B sense negative control probe. For panels A–
C and F–H, size bar5 200 mm; for panel D, size bar 5 100 mm.
Reid, Gould, and Harris: Mucin Developmental Expression
bronchiolar epithelium (Figure 4E) and in submucosal gland
epithelium (not shown).
MUC6
MUC6 was not seen in lung epithelium at any gestational
age or in adult tissue, though adjacent sections were shown
to contain intact mRNA for other mucin genes. The MUC6
tandem repeat probe was shown to be effective at detecting MUC6 mRNA in several organs from the fetal digestive system, including stomach.
MUC7
MUC7 was detected at low levels in tracheal submucosal
gland epithelium at 23 wk gestation (not shown), but was
not detected elsewhere in the lung at any gestational age.
MUC8
No MUC8 mRNA was detectable in lung epithelium at
any gestational age (using either the MUC8 74-bp tandem
repeat probe or the pAM3-3 probe) (Table 1). However,
as we did not detect expression of MUC8 in adult lung, we
cannot be certain whether either probe was effective at detecting MUC8 mRNA in situ.
Discussion
The profile of mucin genes that are expressed in the developing lung epithelium is of relevance to lung diseases that
manifest early in life such as perinatal infections and cystic
fibrosis.
Development of the human lung can be divided into
three overlapping stages: the embryonic period between 4
and 7 wk, when the lung buds off the foregut and the epithelial tube appears, divides, and starts invading the surrounding mesenchyme; the fetal period from 5 wk to birth;
the postnatal period. The fetal period encompasses three
developmental stages: during the pseudoglandular stage
(5–17 wk), the conductive airway tissue and its associated
vasculature develops; the canalicular stage (16–26 wk) is
associated with the further branching of airways and vasculature, the differentiation of type I and type II pneumocytes, appearance of submucosal glands, and the start
of surfactant synthesis; and the saccular stage from 25 wk
to birth is associated with the formation of more airway
generations, dilation of the future gas exchange spaces,
and maturation of the surfactant system. Epithelial differentiation occurs outwards from the most central airways,
with ciliated and goblet cells, smooth muscle cells, and cartilage arising initially in the large airways and later in
smaller airways as they develop. Alveoli start to form between 36 wk and birth and maturation of the lung continues into the postnatal period. Hence an examination of
mucin synthesis between 13 and 23 wk of gestation encompasses key phases of lung epithelial differentiation.
We previously examined the developmental expression
of human MUC1 and MUC2 (14). MUC1 expression was
detected by 12.5 wk of gestation within the epithelium of
the respiratory system. The pattern of expression remained
similar from this age until late in gestation with most MUC1
mRNA being found within the more proximal portion of
the airways. MUC1 expression was seen within the epithe-
597
lium lining the small bronchi, bronchioles, and more distal
parts of the developing airway, but at lower levels moving
towards the terminal sacs. Within the adult lung, MUC1 is
expressed at high levels within the epithelium of the bronchi, bronchioles, and at slightly lower levels in alveoli.
Expression of MUC2 in the developing respiratory epithelium was restricted to larger bronchioles relatively late
in development (after 19 wk) and levels of MUC2 mRNA
were very low. In adult lung, MUC2 was clearly seen in
goblet cells of the epithelia of the main bronchus and of
bronchioles.
We now show that MUC4, MUC5AC and MUC5B are
major components of the airway mucus in the developing
human lung. MUC4, like MUC1, was expressed in the majority of the epithelial cells lining the airway in the regions
where it was detected. However, unlike MUC1, MUC4
was only seen in the tracheal epithelium and in the epithelium lining the bronchi and larger bronchioles. No MUC4
expression was seen in the small airways.
The pattern of expression of MUC5AC resembled that of
MUC2, being restricted to individual goblet cells in the airway epithelium. MUC5AC transcripts, like those of MUC2
in the airway were not detected at 13 wk gestation. By 17/18
wk gestation, MUC5AC mRNA was seen in tracheal goblet cells through expression levels appeared lower at 23 wk
gestation. MUC5AC mRNA was not detected in the small
bronchioles or in distal parts of the lung.
MUC5B shows a distinct pattern of expression from
MUC5AC in the airways both prenatally and in adult lung.
In adult lung, MUC5B transcripts are seen in submucosal
gland epithelium, the epithelium lining the submucosal
gland ducts and in the bronchiolar epithelium, primarily in
goblet cells. The pattern of expression of MUC5B during
fetal development is interesting as it appears to follow the
differentiation pathway of submucosal glands. The glands
develop as invaginations from precursor cells within the
surface epithelium during the second trimester of gestation. By the late second trimester individual glands are
morphologically well-differentiated. MUC5B mRNA is
detected in populations of the tracheal epithelial cells at 13
wk gestation. By 23 wk it is primarily seen in the epithelium of submucosal glands, both in trachea and bronchi.
MUC5B is also expressed at high levels in cells lining the
neck of the submucosal gland ducts and at lower levels in
individual cells in the surface epithelium of both trachea
and bronchi.
This pattern of expression is consistent with MUC5B
being transcribed in multiple submucosal gland progenitor
cells in the surface airway epithelium at the start of the
second trimester. By the end of the second trimester of
gestation, the MUC5B transcripts are largely restricted to
differentiated epithelial cells within the submucosal gland
and gland duct, though a small number of MUC5B-expressing cells remain within the surface epithelium. These data
would support models of submucosal gland development in
which progenitor cells persist in the adult airway rather than
being restricted to a transient phase during proximal airway development (15).
During the early pathology of cystic fibrosis (CF), the
lung is not severely affected in comparison to the intestine
and the pancreas. Lung pathology is often not evident un-
598
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 17 1997
til after the first postnatal lung infection, though mild distention of submucosal gland cells may be present at birth.
In contrast, pancreatic pathology is already evident in the
early mid-trimester, with obstruction of small pancreatic
ducts with mucoid material. Intestinal obstruction during
the late mid-trimester is not uncommon in CF and about
15% of CF babies are born with meconium ileus. In this
context, it is of interest that the goblet cell mucins MUC2
and MUC5AC are not expressed until towards the end of
the mid-trimester of gestation in the airway epithelium.
Further, though MUC5B is expressed in the surface epithelium of trachea at 13 wk, its appearance in submucosal
glands accompanies their morphologic differentiation in
the late second trimester. Abundant expression of intestinal and pancreatic mucins genes (including MUC2) is seen
from at least 13 wk gestation and hence this might provide
an explanation for these tissues exhibiting CF-associated
pathology from the early mid-trimester.
Another mucin cDNA, MUC8, has been isolated from
adult human airway and has been shown to be expressed
in this tissue by Northern blot analysis (12). We have been
unable to detect expression of this gene during development of the human lung with 2 different probes, though as
neither probe detected MUC8 mRNA in adult lung, it is
possible that the expression levels of this mucin are too
low to be detected by mRNA in situ hybridization.
In summary, mRNAs for MUC1, MUC2, MUC4, MUC5AC, MUC5B, and MUC7 mucins are expressed in the
developing human fetal lung. MUC1, MUC4, and MUC5B
mRNAs are seen at 13 wk gestation which is the earliest age
that we have examined. MUC4 expression is seen in the majority of airway epithelial cells that line the trachea and larger
airways though, in contrast to MUC1, is not seen in smaller
airways. MUC5AC transcripts are not detected before 17
wk and, like MUC2 transcripts, are highly restricted in their
pattern of expression. MUC5AC mRNA is seen in individual goblet cells in tracheal surface epithelium and in the
necks of submucosal glands. MUC5B and MUC7 are primarily submucosal gland mucins and MUC5B mRNA expression follows the differentiation path of these glands.
Acknowledgments: The writers are grateful to Simon Biddolph, Zahra Madgwick,
and Dr. Michael Dunhill for their assistance; also to Dr. M. A. Hollingsworth
for helpful discussions and Professor R. Moxon for his support. This work was
supported by the Cystic Fibrosis Research Trust, UK.
References
1. Porchet, N., N. Van Cong, J. Dufosse, J. P. Audie, V. Guyonnet-Duperat,
M. S. Gross, C. Denis, P. Degand, A. Bernheim, and J. P. Aubert. 1991.
Molecular cloning and chromosomal localization of a novel human tracheobronchial mucin cDNA containing tandemly repeated sequences of 48
base pairs. Biochem. Biophys. Res. Comm. 175:414–422.
2. Guyonnet-Duperat, V., J.-P. Audie, V. Debailleul, A. Laine, M.-P. Buisine,
S. Galiegue-Zoutina, P. Pigny, J.-P. Aubert, and N. Porchet. 1995. Characterization of the human mucin gene MUC5AC: a consensus cysteine-rich
domain for 11p15 muscin genes? Biochem. J. 305:211–219.
3. Dufosse, J., N. Porchet, J. P. Audie, V. Guyonnet-Duperat, A. Laine, I.
Van-Seuningen, S. Marrakchi, P. Degand, and J. P. Aubert. 1993. Degenerate 87-base-pair tandem repeats create hydrophilic/hydrophobic alternating domains in human mucin peptides mapped to 11p15. Biochem. J.
293:329–337.
4. Gendler, S. J., C. A. Lancaster, J. Taylor-Papadimitriou, T. Duhig, N. Peat,
J. Burchell, L. Pemberton, E.-N. Lalani, and D. Wilson. 1990. Molecular
cloning and expression of the human tumour-associated polymorphic epithelial mucin, PEM. J. Biol. Chem. 265:15286–15293.
5. Lan, M. S., S. K. Batra, W.-N. Qi, R. S. Metzgar, and M. A. Hollingsworth.
1990. Cloning and sequencing of a human pancreatic tumor cDNA. J. Biol.
Chem. 264:15294–15299.
6. Gum, J. R., J. C. Byrd, J. W. Hicks, N. W. Toribara, D. T. A. Lamport, and
Y. S. Kim. 1989. Molecular cloning of human intestinal mucin cDNAs. J.
Biol. Chem. 264:6480–6487.
7. Gum, J. R., J. W. Hicks, N. W. Toibara, A.-M. Rothe, R. L. Lagace, and
Y. S. Kim. 1992. The human MUC2 intestinal mucin has cysteine-rich subdomains located both upstream and downstream of its central repetitive
region. J. Biol. Chem. 267:21375–21383.
8. Jany, B. H., M. W. Gallup, P.-S. Yan, J. R. Gum, Y. S. Kim, and C. B. Basbaum. 1991. Human bronchus and intestine express the same mucin gene.
J. Clin. Invest. 87:77–82.
9. Gum, J. R., J. W. Hicks, D. M. Swallow, R. L. Lagace, J. C. Byrd, D. T. A.
Lamport, B. Siddiki, and Y. S. Kim. 1990. Molecular cloning of cDNAs derived from a novel human intestinal mucin gene. Biochem. Biophys. Res.
Comm. 171:407–415.
10. Toribara, N. W., A. M. Robertson, S. Ho, W. L. Kuo, E. Gum, J. Hicks, J. C.
Byrd, B. Sidikki, and Y. S. Kim. 1993. Human gastric mucin. J. Biol. Chem.
268:5879–5885.
11. Bobek, L. A., H. Tsai, A. R. Biesbrock, and M. J. Levine. 1993. Molecular
cloning, sequence, and specificity of expression of the gene encoding the
low molecular weight human salivary mucin (MUC7). J. Biol. Chem. 268:
20563–20569.
12. Shankar V., M. S. Gilmore, R. C. Elkins, and G. P. Sachdev. 1994. A novel
human airway mucin cDNA encodes a protein with unique tandem repeat
organization. Biochem. J. 300:295–298.
13. Rose, M. C. 1992. Mucins: structure, function and role in pulmonary diseases. Am. J. Physiol. 263:L413–L429.
14. Chambers, J. A., M. A. Hollingsworth, A. E. O. Trezise, and A. Harris.
1994. Developmental expression of mucin genes MUC1 and MUC2. J. Cell
Sci. 107:413–424.
15. Englehardt, J. F., H. Schlossberg, J. R. Yankaskas, and L. Dudus. 1995. Progenitor cells of the adult human airway involved in submucosal gland development. Development 121:2031–2046.