Resident Renal Mononuclear Phagocytes
Comprise Five Discrete Populations with
Distinct Phenotypes and Functions
This information is current as
of June 17, 2017.
Takahisa Kawakami, Julia Lichtnekert, Lucas J. Thompson,
Prasanthi Karna, Hicham Bouabe, Tobias M. Hohl, Jay W.
Heinecke, Steven F. Ziegler, Peter J. Nelson and Jeremy S.
Duffield
Supplementary
Material
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130034
2.DC1
This article cites 39 articles, 25 of which you can access for free at:
http://www.jimmunol.org/content/191/6/3358.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2013 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
J Immunol 2013; 191:3358-3372; Prepublished online 16
August 2013;
doi: 10.4049/jimmunol.1300342
http://www.jimmunol.org/content/191/6/3358
The Journal of Immunology
Resident Renal Mononuclear Phagocytes Comprise Five
Discrete Populations with Distinct Phenotypes and Functions
Takahisa Kawakami,*,†,‡,x,1 Julia Lichtnekert,*,†,‡,x,1 Lucas J. Thompson,{
Prasanthi Karna,*,x Hicham Bouabe,‖ Tobias M. Hohl,# Jay W. Heinecke,**
Steven F. Ziegler,{ Peter J. Nelson,*,x and Jeremy S. Duffield*,†,‡,x
C
onventionally, mononuclear phagocytes (MPCs) have
been shown to comprise monocytes, macrophages, and
dendritic cells (DCs) (1). Monocytes arise in bone marrow, circulate in the blood, and traffic to peripheral organs. In
steady state, these monocytes are believed to differentiate into
resident macrophages, which function to maintain tissue homeostasis through phagocytosis of apoptotic bodies and production of
*Division of Nephrology, University of Washington, Seattle, WA 98109;
†
Institute of Stem Cell and Regenerative Medicine, University of Washington,
Seattle, WA 98109; ‡Center for Lung Biology, University of Washington, Seattle, WA
98109; xKidney Research Institute, University of Washington, Seattle, WA
98109; {Benaroya Research Institute, Seattle, WA 98101; ‖Lymphocyte Signaling
and Development Institute Strategic Programmes, Babraham Institute, Babraham,
Cambridgeshire CB22 3AT, United Kingdom; #Vaccine and Infectious Disease
Division, Fred Hutchinson Cancer Research Center, Seattle, WA 98109; and
**Diabetes and Obesity Center of Excellence, University of Washington, Seattle,
WA 98109
1
T.K. and J.L. contributed equally to this study.
Received for publication February 6, 2013. Accepted for publication July 20, 2013.
This work was supported by the Institute for Stem Cell and Regenerative Medicine
at the University of Washington; National Institutes of Health Grants DK94768,
DK93493, DK84077, and TR000504 and American Heart Association Grant
12040023 (to J.S.D.); National Institutes of Health Grant DK83375 (to P.J.N.); an
overseas research grant from Mochida Memorial Foundation for Medical and Pharmaceutical Research (to T.K.); and Deutsche Forschungsgemeinschaft Grant Li 2074/
1-1 (to J.L.).
Address correspondence and reprint requests to Prof. Jeremy S. Duffield or Dr.
Takahisa Kawakami, University of Washington School of Medicine, S371, Box
358052, 850 Republican Street, Seattle, WA 98109 (J.S.D.) or Division of Nephrology, University of Washington, S371, Box 358052, 850 Republican Street, Seattle, WA
98109 (T.K.). E-mail addresses: [email protected] (J.S.D.) or kawakat-tky@
umin.net (T.K.)
The online version of this article contains supplemental material.
Abbreviations used in this article: BM-DC, bone marrow–derived dendritic cell; BMMf, bone marrow–derived macrophage; cDC, classical dendritic cell; DC, dendritic
cell; LN, lymph node; MPC, mononuclear phagocyte; PDC, plasmacytoid DC;
precDC, preclassical DC; qRT-PCR, quantitative RT-PCR; Treg, regulatory T.
Copyright Ó 2013 by The American Association of Immunologists, Inc. 0022-1767/13/$16.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1300342
growth factors. DCs are cells with specialized capacity to present
Ag to T lymphocytes, along with the capacity to internalize and
process Ag. Unlike macrophages, DCs are not believed to derive
from monocytes in steady state (2). In inflammatory states, however, monocyte efflux from bone marrow and its recruitment into
the affected organs increases and monocytes become inflammatory MPCs, which often have both macrophage and DC characteristics. All of these MPCs have substantial roles in inflammation.
Over the last 10 y, elegant studies have demonstrated that functionally discrete monocyte subpopulations exist with distinct recruitment characteristics and distinct receptor and cytokine repertoires.
Recently, a common precursor in the bone marrow, called
monocyte, macrophage, and DC precursor, was found to give rise to
most of monocytes, macrophages, and DCs (3). It can differentiate
into monocytes and common DC precursor (2). Preclassical DCs
(precDCs) and plasmacytoid DCs (PDC) are believed to derive
from common DC precursor, and traffic to lymphoid and nonlymphoid organs, producing resident DCs, whereas their mode
of recruitment is less well understood. In addition, precDCs are
thought to supply a population of DCs characterized by expression
of the integrin aE, also known as CD103, in nonlymphoid tissue
(4). In intestine, they are potent at Ag cross-presentation, which
can activate or suppress T cell activity according to other environmental cues (5). However, their contribution to homeostasis or
disease outside of the intestine is poorly understood. Finally, recent studies provide evidence that mononuclear phagocytes arising in the yolk sac during the first stages of embryogenesis traffic
to the CNS during development to become permanently residing
microglia, and that these embryonic mononuclear phagocytes also
take up residence in peripheral organs, including the kidney (6).
Although ablation studies and adoptive transfer studies have dissected unequivocal roles for monocytes in regulating responses to
disease in the kidney both favorably and deleteriously (7, 8), the
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Recent reports have highlighted greater complexity, plasticity, and functional diversity of mononuclear phagocytes (MPCs), including monocytes, macrophages, and dendritic cells (DCs), in our organs than previously understood. The functions and origins of
MPCs resident within healthy organs, especially in the kidney, are less well understood, whereas studies suggest they play roles in
disease states distinct from recruited monocytes. We developed an unbiased approach using flow cytometry to analyze MPCs residing in the normal mouse kidney, and identified five discrete subpopulations according to CD11b/CD11c expression as well as F4/
80, CD103, CD14, CD16, and CD64 expression. In addition to distinct marker profiles, these subpopulations have different lineages
and expression of genes involved in tissue homeostasis, including angiogenesis. Among them, the CD11bintCD11cint F4/80high
subpopulation notably exhibited high capacity to produce a representative anti-inflammatory cytokine, IL-10. Each subpopulation
had different degrees of both macrophage (phagocytosis) and DC (Ag presentation) capacities, with a tendency to promote
differentiation of regulatory T cells, whereas two of these showed expression of transcription factors reported to be highly
expressed by classical DCs, and proclivity to exit the kidney following stimulation with LPS. In summary, resident kidney MPCs
comprise discrete subpopulations, which cannot be simply classified into the conventional entities, and they produce antiinflammatory and tissue-homeostatic factors to differing degrees. The Journal of Immunology, 2013, 191: 3358–3372.
The Journal of Immunology
role of mononuclear phagocytes normally residing in the kidney
in health and disease states is relatively unknown. Several studies,
however, indicate that they expand in chronic disease by local
proliferation, that they play different roles from inflammatory monocyte-derived cells in disease with different cytokine profiles, and
that they may regulate organ growth and repair (7, 9).
MPCs are defined functionally by the name macrophage to describe phagocytic properties, or DC to describe Ag presentation
properties, and they are the two main types of resident myeloid
cells across tissues. However, it is well known that macrophages
can show vast heterogeneity in phenotype and function depending
on the context, which includes different tissues and different
disease states. They can present Ags, like DCs, in certain conditions. Thus, even this function, which is often regarded as specific
for DCs, is common to both.
The purpose of this study is to define resident MPC subpopulations in normal kidney to determine their potential functional
contributions.
Animals
C57BL/6 (B6) and BALB/c mice were from Charles River Laboratories.
FVB/N CX3CR1-GFP (CX3CR1gfp/+) (10), B6 CCR2-GFPTr (11), B6
CSF1R-GFPTr (12), B6 GM-CSF2/2 (13), CSF1R2/2 on mixed background strain (14), and B6 IL-10–b-lactamase reporter (ITIB) (15) mice
have been previously described. B6 LysMCre/Cre and B6 Gt(ROSA)
26Sortm14(CAG-tdTomato)Hze (R26RtdTomato) mice were from The Jackson
Laboratory. They were bred to obtain LysmCre/+;R26RtdTomato/+ mice. Mice
with a targeted deletion of RAG22/2 on BALB/c background were from
Taconic Laboratories. OVA-specific DO11.10 TCR-transgenic mice were
provided by A. Abbas (University of California, San Francisco). ITIB mice
with homozygous reporters were used for the experiments. A total of 5 mg/
g body weight of LPS E. coli 0111:B4 (Sigma-Aldrich) suspended in PBS
was injected i.p., and samples were taken after 48 h. All animal studies
were performed under protocols approved by Department of Comparative
Medicine, University of Washington.
Preparation of single cells from kidney or lymph nodes
After systemic perfusion with ice-cold PBS to remove blood, kidney was
resected, decapsulated, diced, then incubated at 37˚C for 30 min in DMEM/
F12 media (Mediatech) including 0.2 mg/ml Liberase TL (Roche Applied
Science) and 100 U/ml DNase (Roche Applied Science), as described (7).
Addition of DMEM/F12 media, including 10% FBS, was followed by
filtration of the suspension through cell strainer with 40 mm mesh (Fisher
Scientific). The filtrate was then centrifuged at 600 3 g for 5 min, and the
obtained pellet was resuspended as single cells. Kidney draining lymph
nodes (LNs) were identified by injection of 10 ml Evan’s blue dye into the
kidney and identification of nodes, which had taken up the blue dye 5–15
min later. LNs were dissociated by standard trituration methods (16), prior
to washing and resuspending in FACS buffer.
Processing of blood for flow cytometry
The whole blood was drawn into a syringe, including EDTA dissolved in
PBS for anticoagulation. The blood, further diluted in PBS, was centrifuged
at 300 3 g for 3 min. The pellet was treated twice with ACK lysis buffer
(150 mM ammonium chloride, 10 mM potassium bicarbonate, 0.1 mM
EDTA) for RBC lysis and washed with PBS. The obtained pellet was
resuspended as blood leukocytes for flow cytometry.
Flow cytometry
Cell pellets were resuspended in ice-cold FACS buffer (PBS including 1%
BSA, 2 mM EDTA, and 0.01% sodium azide), including 2% mouse serum,
plated in round-bottom 96-well plate, and incubated with Ab mixture on
ice for 30 min. Directly conjugated anti-CD45 (clone 30-F11), anti-CD3e
(clone 145-2C11), anti-CD19 (clone 1D3), anti-CD49b (clone DX5), antiLy6G (clone 1A8), anti-CD11b (clone M1/70), anti-CD11c (clone N418),
anti-F4/80 (clone BM8), anti-MHC class II (clone M5/114.15.2), antiCD103 (clone 2E7), anti-CD86 (clone GL1), anti-CD14 (clone Sa2-8),
anti-CD16/32 (clone 93), anti-CD64 a and b (clone X54-5/7.1), antiLy6C (AL-21), and anti-CD135 (A2F10) Abs were from BioCentury,
eBioscience, or BD Biosciences and used at 1:200 dilution. After incu-
bation, cells were washed with FACS buffer twice, followed by analysis
using BD FACSCanto II (BD Biosciences) or by sorting with BD FACSAria
II (BD Biosciences). To obtain total cell numbers, in some experiments PEconjugated counting beads (Spherotech) were added to the single-cell
suspension for cell counting, according to manufacturer’s guidelines. In
experiments evaluating CD135 expression, cells were incubated for 3 h
after purification prior to application of Abs. Blood monocytes were defined as leukocytes that express CD45 and CD11b, but do not express
Ly6G, CD19, CD3e, or CD49b. Kidney MPCs were defined as cells from
kidneys in which all blood had been flushed, which express CD45, but did
not express Ly6G, CD19, CD3e, or CD49b.
Immunofluorescence microscopy
Normal C57BL/6 kidneys were prepared and labeled, as previously described, and images were captured by confocal microscopy (8).
Quantitative RT-PCR
Total RNA was extracted using RNeasy Mini Kit (Qiagen). cDNA was
synthesized using iScript cDNA Synthesis Kit (Bio-Rad). Quantitative RTPCR (qRT-PCR) assay was performed using an ABI7900HT (Applied
Biosystems) and iTaq SYBR Green Supermix with ROX (Bio-Rad). The
cycling conditions were initial denaturation at 95˚C for 2.5 min, followed
by PCR cycles of 95˚C for 15 s and 58˚C for 30 s. Specificity of each
primer pair was confirmed by verification of single PCR product with
expected size in agarose gel electrophoresis. The sequences of primers are
shown in Supplemental Table I.
T cell differentiation assay
RAG2-deficient DO11.10 (DR) mice were generated as a source of homogenous naive Ag-specific CD4+ T cells containing no effector or regulatory T (Treg) cell populations (17). Purified CD4+ T cells from spleen
and peripheral LNs of donor DR mice were obtained by no-touch magnetic
bead isolation (Miltenyi Biotec), followed by positive cell sorting for CD4+
T cells. Bone marrow–derived dendritic cells (BM-DC) and bone marrow–
derived macrophages (BM-Mf) were prepared as described (18, 19).
Briefly, single-cell suspensions of bone marrow were prepared and cultured with 20 ng/ml GM-CSF for DCs, or 20% L929-conditioned media
for macrophages for 4–6 d. All APC cultures were aliquoted and then
incubated with 5 mg/ml OVA (323–339) peptide for 1 h at 37˚C, and then
washed three times with plain media. A total of 3 3 104 purified CFSElabeled DR T cells was mixed with APC populations at indicated ratios in
complete RPMI 1640 media supplemented with 5% FBS and cultured for 5
d. On day 5, the cultures were restimulated with plate-bound anti-CD3e
(10 mg/ml, clone 145-2C11) and anti-CD28 (1 mg/ml, clone PV-1) for 5 h
in the presence of Golgi inhibitor (BD Biosciences). Cells were harvested
and stained for viability (Fixable Viability Dye; eBioscience), surface CD4
and DO11.10 TCR (KJ1-26 Ab), intracellular Foxp3 (clone FJK-16s), IFNg (clone MG1.2), IL-4 (clone BVD6-24G2), IL-10 (clone JES6-16E3), and
IL-17a (clone TC11-18H10.1) (Abs from eBioscience). Negative control
samples were stained with isotype control Abs. T cells were analyzed by
flow cytometry, as described above.
Phagocytosis assay
Sorted mononuclear phagocytes were incubated in DMEM/F12 medium,
including 10% FBS, 100 IU/ml penicillin, and 100 mg/ml streptomycin,
with latex beads-FITC complex in Phagocytosis Assay Kit (Cayman
Chemical) for 2 h, following analysis by FACSCanto II.
LPS stimulation of renal mononuclear phagocytes
Sorted cell subpopulations were incubated in DMEM/F12 medium, including 10% FBS, 100 IU/ml penicillin, 100 mg/ml streptomycin, and 100
ng/ml LPS (Sigma-Aldrich) for 16 h. The stimulated cells were used for
qRT-PCR analysis, as mentioned above.
IL-10 reporter mouse experiments
Single cells from ITIB mouse kidney were incubated in PBS, including 1.8
mM CCF4-AM (Invitrogen) and 7.2 mM probenecid (Sigma-Aldrich), at
room temperature for 90 min with gentle shaking. Following one wash
with PBS, cells were stained with Abs, as described above, prior to flow
cytometry analysis.
Statistics
All data are given as mean 6 SEM. Significant differences were analyzed
using Student t test between two groups and ANOVA among groups more
than three. The p values ,0.05 were regarded as significant.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Materials and Methods
3359
3360
Results
The integrins CD11b and CD11c in conjunction with F4/80,
CD103, CD16, CD14, and CD64 discriminate five discrete
mononuclear phagocyte populations
The five subpopulations of MPCs expressed distinct patterns of
these receptors. Importantly, CD14 and CD64 were expressed most
highly in the CD11bintCD11cint MPC3 population, whereas
CD11bhighCD11chigh MPC1 population had the highest expression
of CD16 (Fig. 2A, Table I). Although DCs are often defined as
CD11c+ MHCII+ cells, MPC3 cells expressed these receptors, but
concurrently expressed these macrophage markers at high levels
(Table II). CD11b2CD11c2 MPCs were negative in all the
assessed surface markers and excluded in the subsequent studies
(discussed below).
As would be predicted by the flow cytometric analysis, these
distinct subpopulations can be discriminated within the interstitium
of the kidney cortex by fluorescence microscopy and are not
distributed to any particular location by subpopulation (Fig. 2B).
Kidney mononuclear phagocyte subpopulations can be
discriminated by chemokine receptor expression, ontogeny, and
growth factor dependence
Chemokine receptors play an important role in monocyte, macrophage, and DC trafficking. To explore chemokine receptor expression in the MPC subpopulations, we assessed expression of
CX3CR1, a receptor thought to affect steady state trafficking of
monocytes, in Cx3cr1+/GFP mice of FVB/N strain. As noted
above, kidney from FVB/N wild-type mice has reduced numbers
of CD11b2CD11cint MPC5 (Fig. 1B), and this minor population
did not express CX3CR1. The remaining kidney MPCs expressed
different levels of CX3CR1, with CD11bintCD11cint, F4/80high,
MPC3 expressing the highest levels (Fig. 3A–C), and CD11blow
CD11chigh MPC4 expressing these receptors at the lowest levels.
Similarly, we assessed expression of CCR2 (Fig. 3D–F), another
receptor implicated in monocyte trafficking, using CCR2-GFPTr
mice on C57BL/6 background. In most CD11blowCD11chigh and
CD11b2CD11cint MPCs, receptor expression was not detected. All
of the remaining three populations of MPCs expressed CCR2, but
CD11bintCD11cint, F4/80high MPCs had lower levels. The fact that
at steady state key chemokine receptor levels are distinct lends weight
to the hypothesis that these cells exist as separate populations.
The receptor for the growth factor CSF-1, which is also called MCSF, is thought to be critical in MPC differentiation and functions
(14). In CSF1R-GFPTr mice that report CSF-1 receptor expression
by GFP fluorescence, the distribution of CSF-1R expression was
also discriminatory (Fig. 3G–I). Whereas the CD11bhighCD11clow
MPC2 and CD11bintCD11cint MPC3 expressed high levels of the
receptor, CD11bhighCD11chigh MPC1 and CD11blowCD11chigh,
CD103+ MPC4 expressed intermediate levels, and the CD11b2
CD11cint MPC5 did not express it. The absence of the receptor on
this latter population suggests that it may have silenced expression
or that it functions independently of CSF-1 receptor signaling. To
test whether any of the MPCs had absolute dependence on the
receptor expression for differentiation and survival, we evaluated
MPCs in kidneys from P14 Csf1r2/2 mice, because these mice
rarely survive beyond weaning and because P14 is the time point
when kidney development is complete. In P14 Csf1r2/2 mice,
CD11bintCD11cint, F4/80high subpopulation was selectively absent, suggesting that such cells may require CSF1R for differentiation (Fig. 3J, 3K). The absence of F4/80high cells was also
observed in Csf1r2/2 mice at day 0 after birth (Fig. 3L). Importantly, all other subpopulations were preserved. MPC4 was increased in these juvenile mice, although the difference was not
significant.
CSF-2, GM-CSF, is another growth factor that plays important
roles in myeloid cell differentiation and activation. To test its role in
the appearance/maintenance of kidney MPCs, we evaluated kidney
MPCs in Csf22/2 mice of C57BL/6 background compared with
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Although it has been thought that CD11b is expressed by macrophages, whereas CD11c is expressed by DCs, no clear functional
correlate has been demonstrated for these receptors, and recent
studies have challenged the specificity, particularly in nonlymphoid
organs. We analyzed all tissue leukocytes from normal adult kidneys
by flow cytometry from C57BL/6, FVB/N, and BALB/c strains
of mice. After excluding all lymphocytes and granulocytes, the
remaining cells were identified as MPCs (Fig. 1A). Kidney MPCs
were assessed for cell surface expression of the markers CD11b
and CD11c (Fig. 1B). In each strain, five populations of MPCs were
discriminated according to expression levels of CD11b and CD11c,
as follows: CD11bhighCD11chigh (MPC1); CD11bhighCD11clow
(MPC2); CD11bintCD11cint (MPC3); CD11blowCD11chigh (MPC4);
and CD11b2CD11cint (MPC5). However, the ratio of each subpopulation was distinct in the different strains, and young mice
(P14) also showed distinct distribution of subpopulations. To evaluate this further, total leukocyte numbers were quantified (Fig. 1C),
and these showed substantially higher levels of MPC1 and MPC3
that could not be explained simply by increased kidney size (Fig.
1D). Moreover, MPC5 was the smallest population and was lower
in BALB/c and FVB/N mice.
The separation of these MPC populations was readily apparent
with concurrent use of F4/80 expression, which has been used as
a classical cell surface marker of kidney macrophages, and more
recently has been found to be expressed by CD11c+ MPCs residing
in the kidney (20, 21). We found that F4/80high MPCs were predominantly in the population of CD11bintCD11cint MPC3 (Fig.
1E), whereas lower expression of F4/80 was observed in CD11bhigh
CD11clow MPC2 and CD11bhighCD11chigh MPC1 populations (Figs.
1E, 2, Table I). The remaining populations did not express F4/80.
CD11blow, CD11chigh MPC4 population was more readily discriminated by concurrent detection of the integrin CD103 (Fig.
1F). CD103+ MPCs represent 4–6% of kidney resident MPCs, but
the vast majority are found in the MPC4 population. Nevertheless,
in mice at postnatal day 14 (P14), and in adults, CD103 was also
expressed in a minority of CD11b2 CD11cint cells (Fig. 1F).
CD103+ MPCs have been reported elsewhere to be derived from
a distinct precursor that expresses the receptor Flt3 (CD135) (4).
At P14, Flt3 expressing MPCs represented ,5% of all MPCs, and
they were detected predominantly with the MPC4 population, but
a second population of Flt3+ MPCs was detected as a minor
subpopulation within MPC1 (Fig. 1G). In adults, these minor Flt3+
populations persisted, but represented fewer cells within MPC4
and MPC1 (Fig. 1G). A minority of Flt3+ MPCs were CD11b2
CD11cint MPC5. Together with the findings that some CD103+
MPCs are also in MPC5 suggests that MPC5 cells may be in a
state of flux with MPC4, depending on circumstances.
Expression of MHC class II (MHCII) has been used as a conventional marker of DCs. All subpopulations except CD11b2
CD11cint MPC5 expressed MHCII, but highest expression was
restricted to CD11bhighCD11chigh (MPC1) and CD11bintCD11cint
(MPC3) cells (Fig. 2A, Table I). Interestingly, expression of the
costimulatory molecule CD86 did not correlate well with MHCII,
but it was expressed at highest level by the minor population of
CD11blowCD11chigh cells (MPC4) (Fig. 2A). All of these subsets
lacked the PDC marker B220 (data not shown), suggesting that
PDCs do not populate the normal kidney.
The markers CD14, CD16, and, to some extent, CD64 have been
used to discriminate macrophages and monocyte subpopulations.
FIVE SUBSETS OF KIDNEY RESIDENT MPCs
The Journal of Immunology
3361
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 1. Five distinct subpopulations of resident MPCs in normal kidney show both macrophage and DC markers by flow cytometry. (A) Gating
strategy for identification of MPCs in normal mouse kidney concluded by a representative CD11b/CD11c flow cytometry plot of resident MPCs in normal
kidney with right-hand plot showing key and nomenclature for each population. (B) Representative CD11b/CD11c MPC plots for three different strains of
adult mice and 14-d-old C57BL/6 mice with representative percentages. (C) Total number of each MPC subpopulation per kidney. (D) Average kidney
weight by mouse strain. (E) Representative CD11b, F4/80 plot of total MPCs (left) and CD11b/CD11c plots for F4/80high MPCs (right, upper) and F4/80low
MPCs (right, lower). Most F4/80high MPCs reside in CD11bintCD11cint subpopulation. Graphs show total numbers of F480high and F4/80low MPCs in each
MPC population. (F) Plots showing CD103+ cells in young and adult kidneys and their distribution in CD11b/CD11c plots. (G) Plots (%) showing rare Flt3+
MPCs in young and adult normal kidney and their distribution (red events) in CD11b/CD11c plots. For (A) and (B), experiments were independently
performed .30 times, using a total of .80 mice. For others, experiments were independently performed twice or more, using three or more mice each time.
3362
FIVE SUBSETS OF KIDNEY RESIDENT MPCs
strain-matched controls. In these adult mice, CD11blowCD11chigh
MPC4 were markedly reduced (Fig. 3M, 3N), as were CD11b2
CD11cint MPC5 (Fig. 3M, 3O), suggesting they are dependent on
the expression of GM-CSF for differentiation and/or survival. In
addition, the proportion of CD103+ MPCs was reduced to ,1%
from 4–6% in controls. Recent studies have suggested that
CD103+ MPC may derive from a circulating precDC rather than
monocyte (4). Consistent with that, some CD11blowCD11chigh,
CD103+ MPCs express Flt3 (Fig. 1G), but these observations in
Csf22/2 kidney suggest that the majority of MPC4 are not Flt3
dependent, rather they are GM-CSF dependent. In addition, in
Csf22/2 mice, there was a trend toward an increase in MPC1,
although this was not significant.
When monocyte-DC precursors in bone marrow differentiate
into monocytes, they activate expression of the lysosomal protein,
lysozyme M (2). To test the origins of the five MPC subpopulations, we assessed whether they had ever been monocytes
by fate mapping monocytes by their expression of LysM during
bone marrow monocyte differentiation using LysMCre/+;R26RtdTomato/+
reporter mice (Fig. 3P). Compared with monocytes, the
MPC2 showed similar levels of tdTomato reporter and MPC3
showed increased levels. These suggest that MPC2 bears a close
relationship to monocytes, and, consistent with that, many express
low levels of Ly6C (Fig. 2A). MPC1 population showed somewhat
lower proportion with tdTomato reporter and MPC4 (CD11blow
CD11chigh, CD103+), and MPC5 (CD11b2CD11cint) comprised
fewer that have previously expressed the monocyte marker LysM.
These findings indicate that MPC4 and MPC5 populations appear
in the kidney without having trafficked as monocytes, suggesting
they either arise in development from precDCs or arise from an-
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 2. Heterogeneous expression of typical DC and macrophage markers by kidney MPCs. (A) Histogram plots showing expression of cell surface
markers in resident MPC subpopulations in normal C57BL/6 mouse kidney. Representative plots from three independent experiments are shown. Bars show
percentage in gated area. (B) Fluorescence confocal micrographs (3400) showing CD11b, CD11c, F4/80, and CD103 expression in kidney cortex. Within
the cortex, F4/80high and F4/80low cells can be seen. Rare CD103+CD32 cells can be seen, and colabeling with CD11b and CD11c identifies cells that
express CD11b alone (arrowhead), CD11b and CD11c at high levels (broad arrows), CD11c alone (upper panel, small closed arrow), and CD11c at high
levels with CD11b at low levels (lower panel, small closed arrow). g, Glomerulus; v, venule.
The Journal of Immunology
3363
Table I. Mean fluorescence intensity of surface markers in MPC subpopulations
1: CD11bhighCD11chigh
F4/80
CD103
MHCII
CD86
CD14
CD16
CD64
Ly6C
2,933
523
90,043
1,633
6,229
32,893
3,929
92
6
6
6
6
6
6
6
6
2: CD11bhighCD11clow
224
52
6,707
157
484
5,721
1,194
9
4,115
360
26,134
2,171
8,297
13,460
3,292
2,473
6
6
6
6
6
6
6
6
1,336
91
11,707
902
5,539
4,040
1,223
68
3: CD11bintCD11cint
6
6
6
6
6
6
6
6
8,462
764
60,825
3,257
21,402
8,087
4,381
212
2,681
218
15,701
1,200
7,608
3,922
1,846
35
4: CD11blowCD11chigh
576
6,180
18,026
3,647
714
15,727
427
118
6
6
6
6
6
6
6
6
5: CD11b2CD11cint
35
1,013
11,080
168
40
6,625
303
20
573
487
2,619
1,368
222
904
378
135
6
6
6
6
6
6
6
6
38
26
427
99
17
36
44
10
ANOVA
0.011
,0.0001
,0.001
0.15
0.031
0.0075
0.077
,1 3 10216
Mean 6 SEM is shown (n = 3).
CD11blowCD11chigh and CD11bhighCD11chigh subpopulations
have higher expression of transcription factors characteristic
of classical DCs
A single study has reported that two kinds of classical DCs (cDCs)
exist in nonlymphoid tissues, as follows: CD103+ DCs and CD11b+
DCs (4). Several transcription factors have been found to be involved in their development. We analyzed expression of these
transcription factors in purified kidney MPC subpopulations.
Zbtb46 is a transcription factor that has been identified as a marker
specifically expressed by both CD103+ DCs and CD11b+ DCs, but
not by other MPCs (22, 23). It was expressed in CD11blow
CD11chigh, CD103+, MPC4, and CD11bhighCD11chigh MPC1 at
significantly higher levels (Fig. 4A), suggesting that the former
subpopulation is equivalent to the reported CD103+ DCs and the
latter is equivalent to CD11b+ DCs. Other transcription factors,
BATF3 and Id2, are reported as indispensable for development
of CD103+ DCs, but not CD11b+ DCs, although they are expressed
in both types of DCs in peripheral tissues (4, 24). This is consistent
with our findings that MPC4 had significantly higher expression of
these two transcription factors and MPC1 had intermediate expression (Fig. 4A). However, only MPC4 expressed Irf8 (Fig. 4A),
a transcription factor necessary for development of both CD103+
and CD11b+ cDCs, but reported to be expressed only in CD103+
DCs in peripheral tissues (4, 25). These results are consistent with
CD11blowCD11chigh MPC4 corresponding to CD103+ DCs and
CD11bhighCD11chigh MPC1 corresponding to CD11b+ DCs.
Kidney mononuclear phagocytes differentially express
angiogenic, developmental, and migratory genes
Macrophages are well known for their roles in angiogenesis and
organ growth, as well as roles in innate immunity and phagocytosis.
To explore whether kidney MPCs play roles in these processes, we
assessed gene transcript levels for functionally related genes in each
purified subpopulation, together with blood monocytes as control.
The angiogenic factor, vascular endothelial growth factor-A
(Vegfa), was expressed in all MPCs at higher levels than monoTable II. Summary of markers in MPC subpopulations
1:
2:
3:
4:
5:
high
high
CD11b CD11c
CD11bhighCD11clow
CD11bintCD11cint
CD11blowCD11chigh
CD11b2CD11cint
N.A., Not applicable.
F4/80
Ly6c
CD14
CD16
CX3CR1
CCR2
CSF1R
MHCII
CD103
Zbtb46
Batf3
Irf8
CCR7
IL-10
+
+
++
2
2
2
+
2
2
2
+
+
++
2
2
++
+
+
+
2
+
+
++
6
N.A.
+++
++
+
6
6
+
++
+++
+
2
++
2∼+
++
+
2
2
2
2
+
2
++
2
2
++
2
6
6
6
++
2
2
6
6
++
+
+
2
2
++
6
6
+
++
2
2
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
cytes (Fig. 4B), indicating the resident MPC potential for angiogenesis. Although blood monocytes are similar to CD11bhigh
CD11clow MPCs in CD11b and CD11c expression, CD11bhigh
CD11clow MPC2 express significantly higher levels of Vegfa. In
addition, MPC4 population had significantly higher expression
of another angiogenic factor, Angiopoietin-1 (Angpt1) (Fig. 4B).
These cells also had a tendency to have higher expression of
platelet-derived growth factor B and C (Pdgfb and Pdgfc) (Fig. 4B).
As well as roles in angiogenesis, macrophages play important
roles in organogenesis and determining organ size (9). They also
can promote repair (8). Two developmental pathways implicated
in these processes are the insulin-like growth factor pathway and
the Wingless/Int (WNT) pathway. As with angiogenic factors,
CD11blowCD11chigh MPC4 expressed significantly more Igf1 and
Wnt7b than other subpopulations (Fig. 4C).
Because CD68, a lysosome-associated phagocytic receptor, is
often used as macrophage marker, but not DC marker, we assessed its
expression level in each MPC subset. Strikingly, all MPC populations express similar levels of CD68 (Fig. 4D).
Next, we assessed in more detail chemokine receptors, CCR7 and
CCR8, implicated in emigration of MPCs to LNs, where they can
function as APCs (26, 27). CD11blowCD11chigh MPC4 and CD11b2
CD11cint MPC5 had higher expression of Ccr7 and Ccr8 (Fig. 4E).
Ccr7 is also highly expressed in CD11bhighCD11chigh MPC1. These
results suggest that these three subpopulations might present Ags to
T cells in vivo.
CXCR4 plays a role in angiogenic myeloid cell recruitment (28).
All MPC populations express similar levels of this receptor (Fig.
4E), implicating potential functions in angiogenesis. The IL-4R has
been implicated in reactive proliferation of resident macrophages
(29) and DC maturation (30), and it is also expressed in all MPC
populations (Fig. 4E).
Macrophages and DCs are sentinels in mounting innate immune
responses to tissue injury. In addition, macrophages can play an
anti-inflammatory role, depending on the context. However, little is
known about the pro- and anti-inflammatory proclivity of resident
kidney MPCs. Thus, we assessed the transcriptional expression of
representative cytokines in MPC subpopulations. Tnf and Il1b,
proinflammatory cytokine genes, were significantly highly
expressed in CD11bhighCD11chigh MPC1 and CD11bhighCD11clow
other tissue resident progenitor. In addition, MPC1 may comprise
two subsets, one of which may arise from pre-DCs or another tissue
progenitor. Consistent with this, a subpopulation within MPC1 expresses Flt3 (Fig. 1G).
3364
FIVE SUBSETS OF KIDNEY RESIDENT MPCs
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 3. MPC subpopulations show differential expression of chemokine receptors, CSF dependency, and distinct ontogeny. Histograms (A, D, G) and
graphs of percent positive (B, E, H), or mean fluorescence intensity (MFI) (C, F, I) of GFP in MPC subpopulations from CX3CR1GFP/+ kidneys (n = 3),
CCR2-GFPTr mice (n = 4), and CSF1R-GFPTr mice (n = 3), respectively. (J) Representative plots of P14 juvenile kidney MPCs in control Csf1r+/2 and
Csf1r2/2 mice at day 14. In right plots, gated cells (%) are shown as red events, whereas total events (%) are shown in gray. Note that in juvenile kidneys
MPC4 expresses CD11b at lower levels compared with adults. (K and L) Graphs showing the proportion of MPCs that are F4/80high CD11bint MPCs
(corresponding to CD11bintCD11cint MPC3) in control Csf1r+/2 and Csf1r2/2 mice at day 14 (K) (n = 3) or at day 0 (L) after birth. (M–O) Representative
plots (%) of kidney MPCs (M) and a graph showing the proportion (N, O) of MPCs that are the CD11blowCD11chigh subpopulation (MPC4) and CD11b2
CD11cint (MPC5) in adult control and adult Csf22/2 knockout mice (n = 3). (P) A graph showing the ratio of tdTomato-positive (Figure legend continues)
The Journal of Immunology
MPC2 (Fig. 4F). In contrast, CD11blowCD11chigh MPC4 and
CD11b2CD11cint MPC5 subsets had higher expression of other
proinflammatory cytokines, Il6 and Ifng. Anti-inflammatory cytokines were also produced at differing levels. CD11bhighCD11clow
MPC2 and CD11bintCD11cint MPC3 had significantly more transcripts of Il10, whereas Tgfb1 was highly expressed in CD11blow
CD11chigh cells (Fig. 4G). Interestingly, RALDH2, an enzyme that
regulates retinoic acid synthesis and has been implicated in stimulating Treg cells, and macrophage polarization were expressed at high
levels by all MPC subsets (Fig. 4G). Overall, these results suggest
that MPC subpopulations have distinct functions in innate immunity.
It is well known that macrophages have much heterogeneity,
including highly polarized examples named M1 and M2 macrophages, which promote and suppress inflammation, respectively.
Surprisingly, CD11blowCD11chigh subpopulation had significantly
higher expression in both a representative M1 marker Nos2 and
M2 marker Arg1 (Fig. 4H, 4I).
Kidney mononuclear phagocyte populations show differential
capacity for phagocytosis
Kidney mononuclear phagocyte populations show differential
capacity for stimulation of naive T cells and driving T cell
polarization
The capacity to successfully present Ag to naive T cells is the gold
standard of APC or DC function. Because all MPC populations
expressed some level of MHC class II and costimulatory molecule
CD86, we assessed the capacity of kidney MPC subpopulations to
present Ag, in steady state, successfully to naive T cells from the
DO11.10 mice with the Rag22/2 mutation on the BALB/c background. These T cells can only respond to I-Ad MHC class II–
restricted OVA peptide 323–339 epitope because they have only
the OVA-specific TCR expressed by the transgene and lack other
TCRs due to deficiency of its recombination. Cultured BM-DC
and BM-Mf were used as controls. Purified kidney MPC populations or aliquots of bone marrow–derived cells, previously
pulsed with OVA peptide, were incubated with CFSE-labeled
naive T cells for 5 d in nonpolarizing conditions, and restimulated with anti-CD3e and anti-CD28 Abs, followed by assessment
of T cell proliferation (Fig. 6). As expected, BM-DC showed
a much higher capacity to stimulate Ag-specific T cell proliferation compared with BM-Mf. Intriguingly, however, there were
marked differences in the capacity of kidney MPC populations to
stimulate T cell proliferation. CD11bhighCD11clow MPCs (MPC2)
had a low capacity to stimulate T cells, similar to BM-Mf, but
CD11bhighCD11chigh MPCs (MPC1) had a much higher capacity,
similar to BM-DC, whereas CD11bintCD11cint, F4/80high MPCs
(MPC3) had an intermediate capacity to stimulate T cells. Even
more surprising was the finding that CD11blowCD11chigh, CD103+
cells (MPC4) showed pronounced APC capacity, much greater than
CD11bhighCD11chigh, implicating these nonmonocyte-derived
MPCs as the most potent APCs in the kidney. CD11b2CD11cint
MPCs were too few in number to collect from BALB/c mice.
Next, we studied the polarization of naive T cells induced by
MPC subpopulations, by assessing Th1 (IFN-g), Th2 (IL-4), Th17
(IL-17), and Treg (Foxp3) differentiation (Fig. 6B, 6C). No Th17
differentiation was observed (data not shown), but CD11bhigh
CD11chigh MPCs induced a high proportion of Treg and did not
stimulate Th2 differentiation. By contrast, CD11blowCD11chigh,
CD103+ MPC4 induced a low proportion of Treg and a higher
proportion of Th1 cells. In addition, CD11bintCD11cint, F4/80high
MPCs, the most abundant subpopulation in steady-state kidney,
induced a high proportion of Treg differentiation. By contrast, BMDC stimulated higher proportions of Th1 and Th2 and lower
proportions of Treg. Collectively, these studies implicate MPC1, 3,
and 4 in maintenance of immunological tolerance.
In response to the pathogen-associated molecule, LPS, kidney
mononuclear phagocyte populations show distinct cytokine
repertoires
We were interested to understand how resident kidney MPCs respond to a proinflammatory agent. To test this, MPC subpopulations and autologous blood monocytes were purified, and gene
expression was assessed after 16-h exposure, ex vivo, to the innate activator LPS, which activates cells via TLR4 and CD14 (32)
(Fig. 7). CD11bhighCD11chigh and CD11bintCD11cint subpopulations
had higher expression of proinflammatory Tnf and Il1b, especially
compared with monocytes, whereas another proinflammatory cytokine Il6 was more highly expressed in CD11bhighCD11clow and
CD11blowCD11chigh (Fig. 7A). The expression of an anti-inflammatory cytokine, Il10, showed a similar pattern to Il6 (Fig.
7B). The expression of another anti-inflammatory cytokine Tgfb1
was extremely low or could not be detected (data not shown).
LPS is a typical inducer of M1 activation in macrophages. M1
markers, Cxcl10 and Il23a, were highly expressed in CD11blow
CD11chigh and CD11bhighCD11clow MPCs (Fig. 7C). These two MPC
subsets also had higher expression of another M1 inducer, Ifng. Intriguingly, a typical M2 activation marker, Arg1, was also expressed
in these two subpopulations with significantly higher levels (Fig. 7D).
We also assessed other M1 markers, Nos2, Il12a, and Il12b, but their
expression levels were extremely low (data not shown).
Next, we evaluated expression of inflammatory chemokines,
including Cxcl2, Ccl2, and Ccl3, which showed differential expression in MPC subpopulations (Fig. 7E). Ccr7, a chemokine
receptor related to MPC migration to LNs, was highest in
CD11blowCD11chigh, CD103+ cells (Fig. 7F). This population as
well as CD11bhighCD11clow cells had higher expression of genes
related to tissue repair, Vegfa, Pdgfb, and Igf1 (Fig. 7G).
CD11bint CD11cint, F4/80high mononuclear phagocytes are the
main IL-10–producing MPCs in vivo
Because the resident MPCs predominantly stimulated Treg cell
proliferation in APC assays, we reasoned that some of the MPCs
kidney MPCs normalized to monocytes in LysmCre/+;R26RtdTomato/+ monocyte fate reporter mice. 1, CD11bhighCD11chigh; 2, CD11bhighCD11clow;
3, CD11bintCD11cint; 4, CD11blowCD11chigh; 5, CD11b2CD11cint. Data are represented as mean 6 SEM.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
The detailed expression profiles of these kidney MPC populations
suggest they all may have both phagocytic and APC functions. We
therefore assessed function in ex vivo assays. Phagocytosis of latex
beads has been used as a gold standard to experimentally uncover
phagocytic function typical of macrophages, because only professional phagocytes have the capacity to phagocytose inert beads
(31). MPCs were collected together and incubated with fluorescent latex beads for 2 h at 37˚C. Internalization of beads in respective subpopulations was assessed by flow cytometry. All the
MPC subpopulations showed phagocytic function, but to differing
degrees (Fig. 5A). CD11bhighCD11clow MPC2 exhibited the
highest capacity to phagocytose whether assessed as proportion of
phagocytosing cells or the mean fluorescence intensity (Fig. 5B,
5C). The rare population of CD11blowCD11chigh, CD103+ MPC4
also showed significant phagocytic capacity, whereas CD11b2
CD11cint MPC5 showed a much lower capacity. Collectively, all
MPC subpopulations can be considered to be phagocytic cells.
3365
3366
FIVE SUBSETS OF KIDNEY RESIDENT MPCs
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 4. qRT-PCR analysis of gene expression in normal kidney MPC subpopulations. (A–I) The expression levels of the gene relative to GAPDH are
shown (n = 3). 1, CD11bhighCD11chigh; 2, CD11bhighCD11clow; 3, CD11bintCD11cint; 4, CD11blowCD11chigh; 5, CD11b2CD11cint; Mo, blood monocytes.
Data are represented as mean 6 SEM. *p , 0.05, #p , 0.01, {p , 1 3 1023.
may play an anti-inflammatory role. To study this, we analyzed
IL-10 production in vivo using a novel, highly sensitive IL-10
reporter mouse. These mice have the knock-in transgene b-lactamase under the IL-10 promoter, endogenous IL-10 gene, and an
internal ribosomal entry site, and b-lactamase expression in re-
spective cells can be detected by flow cytometry due to its enzymatic ability to convert green fluorescence to blue (15). In
steady state, most MPCs do not synthesize IL-10, but a proportion
of CD11bintCD11cint, F4/80high MPCs generate IL-10 in healthy
kidneys (Fig. 8A), suggesting they may have a unique role in
The Journal of Immunology
3367
FIGURE 5. The capacity of kidney
MPCs to phagocytose latex beads ex
vivo. (A) Representative histograms
of kidney MPC subpopulations after
incubation with FITC-conjugated latex beads. (B and C) Graphs showing
the proportion of MPCs with phagocytosed beads (B) and of mean fluorescence intensity (C) in each subpopulation (n = 4). Data are represented as
mean 6 SEM.
Mononuclear phagocyte populations show differential
evanescence from the kidney following systemic LPS
administration in vivo
To study the in vivo response of MPCs to systemic administration
of LPS, we compared resident kidney MPC populations with those
48 h after LPS treatment. Over a 48-h time period, two MPC
populations showed almost complete disappearance from the
kidney in response to LPS (Fig. 8D, 8E). These populations are the
CD11bhighCD11chigh MPC1 and CD11blowCD11chigh, CD103+
MPC4. CD11b2 CD11cint MPC5 also declined in number, although this was not complete (Fig. 8E). In addition, there was
a significant reduction in the number of CD11bintCD11cint F4/
80high MPC3 population (Fig. 8E). Although this population did
not disappear, numerically, the greatest number of MPCs disappeared from the kidney from this population of cells. To evaluate the meaning of this evanescence, we assessed kidney draining
LNs for the migration of MPCs. Forty-eight hours after LPS
administration, there was a substantial increase in CD11bhigh,
CD11chigh, F4/80high MPCs in the LNs, but no clear population of
CD103+ MPCs (Fig. 8F, 8G). Although this is not a fate map, these
studies are consistent with a substantial number of MPC1 and
MPC3 cells migrating to LNs to present Ag. The fate of MPC4
cells is unclear.
Discussion
We used an unbiased approach to identify five distinct subpopulations of resident MPCs in the normal kidney, based on the different CD11b/CD11c integrin expression patterns in conjunction
with F4/80, CD103, and CD14. By using this strategy, we were able
to discriminate five distinct subpopulations. To our knowledge, this
is the first study that comprehensively analyzed and classified kidney
MPCs, although other studies have previously discriminated MPCs
in other organs (16, 33). These kidney subpopulations also show
different patterns in MPC-related surface markers, monokine receptor expression, and gene expression profiles at steady state, and
respond to LPS stimulation with distinct cytokine expressions.
However, these resident subpopulations all express a range of
growth factors that may regulate vasculature and tissue homeostasis. A potent anti-inflammatory cytokine, IL-10, is expressed by
these resident MPCs, and it is remarkably elevated with LPS
stimulation. They also share the capacity of phagocytosis and Ag
presentation to naive T cells, but to different degrees. The presentation to naive T cells predominantly promotes differentiation
of Treg cells. These results therefore identify discrete resident
MPC subpopulations that share both macrophage and DC functions as well as macrophage and DC markers even within each
subpopulation. A major conclusion of these findings is that conventional dichotomous macrophage and DC functions, phagocytosis
and Ag presentation, respectively, are context-specific functions of
resident MPCs rather than functions restricted to distinct cells such
as macrophages or DCs.
Among the five MPC subpopulations, CD11bintCD11cint, F4/
80high MPC3 are the most abundant in normal kidney. Their most
striking feature is high proclivity for IL-10 production both at
steady state and in response to pathogenic stimulus. This subpopulation also has a tendency to stimulate differentiation of Treg cells.
Furthermore, these MPCs appear to be the same MPCs described by
Schulz et al. (6, 34) as arriving from yolk sac progenitors, adding
further weight to their distinct function in kidney. Lower CCR2
expression in this population than in CD11bhigh F4/80low populations (CD11bhighCD11chigh and CD11bhighCD11clow) might reflect the difference of their ontogeny. In addition, only this CD11bint
CD11cint MPC3 subpopulation requires CSF1R for their existence
in the kidney, although other subpopulations also express this receptor at a lower level than CD11bintCD11cint population. A recent
study reported that CSF1R signaling promotes repair from kidney
injury through skewing MPC functions (35). Collectively, these
findings have several important implications. First, CD11bint
CD11cint, F4/80high MPC3 may serve as endogenous defenders
against inflammation. Second, because resident MPCs may expand
in chronic diseases (7), it is quite possible that they represent a
significant population of reparative macrophages (also known as
regulatory or M2 macrophages). In addition, because the number
of MPC3 cells differs significantly between mouse strains, it is
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
preventing inflammatory responses. To investigate IL-10 upregulation in kidney MPCs in the context of systemic inflammation,
we used a model of systemic administration of LPS to mice. It is
known that IL-10 is elicited as a counterbalance against systemic
inflammatory response. Following systemic LPS administration,
∼40% of MPCs activated IL-10 production (Fig. 8B). Analysis of
the MPC subpopulations that expressed IL-10 indicated that the
CD11bintCD11cint, F4/80high subpopulation showed the highest
ratio of IL-10–producing cells (Fig. 8C). These findings show that
this subpopulation has a greater capacity to IL-10 production in
vivo.
3368
FIVE SUBSETS OF KIDNEY RESIDENT MPCs
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 6. Kidney MPC populations exhibit unique differential capacities for stimulating Ag-specific CD4+ T cell proliferation and polarization. (A) Graph
showing the proportion of viable DO11.10/RAG22/2 T cells that have proliferated, as measured by CFSE dilution after incubation with aliquots of OVA
peptide-pulsed MPCs from each purified kidney MPC subpopulation (MPC1, CD11bhighCD11chigh; MPC2, CD11bhighCD11clow; MPC3, CD11bintCD11cint;
MPC4, CD11blowCD11chigh), or from BM-Mf or BM-DC. (B) Representative flow cytometric plots showing T cell survival and proliferative responses (CSFE
dilution) and expression of markers of differentiation (FoxP3, IFN-g, IL-4) in response to incubation of 30,000 naive T cells with 2,000 OVA peptide-pulsed
APCs. Gates were set using isotype control and no APC experimental control. (C) Graphs showing the proportion of viable proliferated T cells that expressed
intracellular Foxp3 (left panel) or produced intracellular IFN-g (middle) or IL-4 (right) after restimulation following initial incubation with 2,000 APCs. BMMF and BM-DC were used as controls. MPC2 and BM-MF were excluded due to failure to stimulate .75% of T cells to proliferate. Data are represented as
mean 6 SEM. The experimental conditions were reproduced in duplicates or triplicates, and the experiment was performed twice.
possible that some of the immunological differences noted between
these strains relate to the differences in this cell population. Finally,
although MPC3 have many characteristics of macrophages, nevertheless, numerically, they leave the kidney in greatest numbers after
systemic LPS injection and have significant APC capacity.
A second major finding from this study is that there exists a
relatively rare resident population of CD103+ (CD11blowCD11chigh)
MPCs that have extremely higher capacity for Ag presentation with
a potentially greater tendency to stimulate Th1 cells. These CD103+
MPCs also express the migratory chemokine receptor CCR7 and
have an inclination to disappear from the kidney in response to LPS
exposure, although at this time their fate is unclear. These findings
suggest that they may have distinct APC roles in the kidney, potentially in local Ag presentation. In addition, relatively few of these
The Journal of Immunology
3369
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 7. qRT-PCR analysis of gene expression in MPC subpopulations stimulated ex vivo with LPS. (A–G) The expression levels of the gene relative
to GAPDH are shown (n = 3). 1, CD11bhighCD11chigh; 2, CD11bhighCD11clow; 3, CD11bintCD11cint; 4, CD11blowCD11chigh; 5, CD11b2CD11cint; Mo,
blood monocytes. Data are represented as mean 6 SEM. *p , 0.05, #p , 0.01, {p , 1 3 1023, xp , 1 3 1024.
MPCs appear to derive from monocytes. Consistent with this, some
of the MPC4 population also express Flt3, a receptor central for
DC development, and had the highest expression of all the cDC
development-related transcription factors that we assessed, including Zbtb46, Batf3, Id2, and Irf8 (36). Nevertheless, this population
was selectively dependent on GM-CSF for its existence. These
results suggest that CD11blowCD11chigh MPC4 correspond to
CD103+ cDCs, although the latter cells have been conventionally
limited to populations of CD11c+ MHCII+ cells. Furthermore,
CD11blowCD11chigh MPCs had higher expression of angiogenic
factors, especially the ones related to pericyte recruitment, including
Angpt1, Pdgfb, and Pdgfc, and, in response to LPS, activate genes
consistent with M2 macrophage phenotype. Therefore, they may
also have an important role in angiogenesis and/or maintaining the
homeostasis of vasculature as well as regulating inflammation.
In addition to this relatively rare, but functionally important
population, there is a small population of CD11b2CD11cint MPC5
that expresses CD11c, but most do not express CD103 or Flt3.
These cells also do not derive from a monocyte precursor. The
function of this subpopulation is currently unclear because it is
rare, and this has rendered functional studies incomplete. They are
also dependent on CSF2 (GM-CSF), which has a role in development of DCs in vivo (37). One possibility is that they are
a quiescent precursor of CD11blowCD11chigh, CD103+ MPCs,
which is also supported by the finding that they have intermediate
expression of Irf8, a transcription factor known to be expressed
in earlier stages of DC development (25). However, further studies
will be required to validate this hypothesis. The alternative is that
they represent a novel population of MPCs that have higher Ccr8
expression and capacity to emigrate from the kidney.
3370
FIVE SUBSETS OF KIDNEY RESIDENT MPCs
The CD11bhighCD11chigh MPC1 subpopulation exhibits complicated characteristics. A minority of these cells express Flt3 and
MPC1 and have high expression of Zbtb46, suggesting that they
are equivalent to CD11b+ DCs. Indeed, they have high capacity
for Ag presentation, stimulating differentiation of Treg cells; they
express the migratory chemokine receptor Ccr7 highly; and they
appear to migrate avidly to kidney LNs in response to LPS (Table
II). In contrast, this subpopulation has monokine receptor CX3CR1
and CCR2 expression at high levels, whereas the CD11blowCD11chigh,
CD103+ subpopulation does not. These two subsets also differ in
inflammatory cytokine expression, suggesting the possibility that
they have distinct roles in inflammatory states, although further
studies are needed to clarify their lineage and features in detail.
One possibility is that the Flt3+ subpopulation within MPC1 are
CD11b+ DCs derived from a pre-DC, as described elsewhere (4),
but that the remaining Flt32 cells within MPC1 can also function
as CD11b+ DCs. Other studies support the notion that circulating
monocytes can give rise to nonconventional DCs in nonlymphoid
tissues (16, 33, 38), and MPC1 bears similarities to CD64+ monocytederived tissue DCs described by others (39, 40). Our studies indicate
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 8. IL-10 expression and
quantification of kidney MPC subpopulations in vivo in steady state or
following systemic LPS exposure.
(A) Representative flow cytometry
plots of kidney MPCs in highly
sensitive IL-10 reporter (Il10IB/IB)
and control (Il10+/+) mice. The right
panel shows the distribution of IL10–positive cells by F4/80 and
CD11b (n = 4). (B) Representative
plots and a graph of IL-10–positive
cells showing a remarkable increase
in IL-10 expression of kidney MPCs
with systemic LPS treatment, with
the right panel showing the distribution of IL-10+ cells by F4/80 and
CD11b. (C) IL-10 histograms in
CD11bhighCD11clow (2), CD11bint
CD11cint (3), and CD11blowCD11cint
(5) cells, and a graph showing the
proportion of IL-10–positive cells
within each subpopulation (n = 3),
indicating that the majority of IL10+ cells are MPC3. (D) Representative flow cytometry panels showing the distribution of MPCs with or
without systemic LPS stimulation. (E)
The graph showing the changes in
the absolute number of MPCs within
each subpopulation normalized to
kidney weight. The filled bars correspond to those treated with vehicle,
whereas the blank bars correspond to
those treated with LPS (n = 3). (F and
G) Representative plots showing nonlymphocyte cells in LNs in steady
state or 48 h after LPS injection. Note
marked increase in F4/80+ CD11b+
cells as well as CD11c+ cells. Data
are represented as mean 6 SEM. *p
, 0.05, #p , 0.01, {p , 1 3 1023.
that MPCs that are not derived from pre-DCs have the capacity to
function as DCs in the normal kidney. Further studies are required to
dissect the origins of these MPC populations in the normal kidney
and their differential responses to homeostatic and inflammatory
stimuli.
The CD11bhighCD11clow subpopulation is similar to blood monocytes in terms of CD11b and CD11c expression. However, we
found clear and significant differences between these two types
of cells. The former resident cells have significantly higher expression of Vegfa, Tnf, Il1b, and Il10 at steady state than the latter
circulating cells, suggesting that CD11bhighCD11clow subpopulation
plays a role as sentinels in tissues relevant to maintaining homeostasis.
We did not analyze CD11b2CD11c2 MPC subpopulation because they lack all the MPC-related markers that we assessed.
According to the gating strategy that we used, they also lack
lymphocyte (T, B, and NK cells) and granulocyte markers. One
possibility is that they are atypical lymphocytes, such as innate
lymphoid cells, although further studies are needed for their characterization.
The Journal of Immunology
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Acknowledgments
22.
We thank Dr. E. Richard Stanley (Albert Einstein College of Medicine) for
providing transgenic mice, and Jen-Feng Lai (Benaroya Research Institute)
and Deby Kumasaka (Fred Hutchinson Cancer Research Center) for technical assistance with experiments.
23.
Disclosures
J.S.D. holds patents related to leukocytes in kidney repair after injury and is
cofounder of Muregen LLC. The other authors have no financial conflicts of
interest.
24.
25.
References
1. Geissmann, F., M. G. Manz, S. Jung, M. H. Sieweke, M. Merad, and K. Ley. 2010.
Development of monocytes, macrophages, and dendritic cells. Science 327: 656–661.
2. Liu, K., G. D. Victora, T. A. Schwickert, P. Guermonprez, M. M. Meredith, K. Yao,
F. F. Chu, G. J. Randolph, A. Y. Rudensky, and M. Nussenzweig. 2009. In vivo
analysis of dendritic cell development and homeostasis. Science 324: 392–397.
3. Fogg, D. K., C. Sibon, C. Miled, S. Jung, P. Aucouturier, D. R. Littman,
A. Cumano, and F. Geissmann. 2006. A clonogenic bone marrow progenitor
specific for macrophages and dendritic cells. Science 311: 83–87.
4. Ginhoux, F., K. Liu, J. Helft, M. Bogunovic, M. Greter, D. Hashimoto, J. Price,
N. Yin, J. Bromberg, S. A. Lira, et al. 2009. The origin and development of
nonlymphoid tissue CD103+ DCs. J. Exp. Med. 206: 3115–3130.
5. del Rio, M. L., G. Bernhardt, J. I. Rodriguez-Barbosa, and R. Förster. 2010.
Development and functional specialization of CD103+ dendritic cells. Immunol.
Rev. 234: 268–281.
6. Schulz, C., E. Gomez Perdiguero, L. Chorro, H. Szabo-Rogers, N. Cagnard,
K. Kierdorf, M. Prinz, B. Wu, S. E. Jacobsen, J. W. Pollard, et al. 2012. A
lineage of myeloid cells independent of Myb and hematopoietic stem cells.
Science 336: 86–90.
7. Lin, S. L., A. P. Castaño, B. T. Nowlin, M. L. Lupher, Jr., and J. S. Duffield. 2009.
Bone marrow Ly6Chigh monocytes are selectively recruited to injured kidney and
differentiate into functionally distinct populations. J. Immunol. 183: 6733–6743.
8. Lin, S. L., B. Li, S. Rao, E. J. Yeo, T. E. Hudson, B. T. Nowlin, H. Pei, L. Chen,
J. J. Zheng, T. J. Carroll, et al. 2010. Macrophage Wnt7b is critical for kidney
repair and regeneration. Proc. Natl. Acad. Sci. USA 107: 4194–4199.
9. Alikhan, M. A., C. V. Jones, T. M. Williams, A. G. Beckhouse, A. L. Fletcher,
M. M. Kett, S. Sakkal, C. S. Samuel, R. G. Ramsay, J. A. Deane, et al. 2011.
26.
27.
28.
29.
30.
31.
32.
33.
Colony-stimulating factor-1 promotes kidney growth and repair via alteration of
macrophage responses. Am. J. Pathol. 179: 1243–1256.
Jung, S., J. Aliberti, P. Graemmel, M. J. Sunshine, G. W. Kreutzberg, A. Sher,
and D. R. Littman. 2000. Analysis of fractalkine receptor CX(3)CR1 function by
targeted deletion and green fluorescent protein reporter gene insertion. Mol. Cell.
Biol. 20: 4106–4114.
Hohl, T. M., A. Rivera, L. Lipuma, A. Gallegos, C. Shi, M. Mack, and
E. G. Pamer. 2009. Inflammatory monocytes facilitate adaptive CD4 T cell
responses during respiratory fungal infection. Cell Host Microbe 6: 470–481.
Sasmono, R. T., D. Oceandy, J. W. Pollard, W. Tong, P. Pavli, B. J. Wainwright,
M. C. Ostrowski, S. R. Himes, and D. A. Hume. 2003. A macrophage colonystimulating factor receptor-green fluorescent protein transgene is expressed throughout the mononuclear phagocyte system of the mouse. Blood 101: 1155–1163.
Stanley, E., G. J. Lieschke, D. Grail, D. Metcalf, G. Hodgson, J. A. Gall,
D. W. Maher, J. Cebon, V. Sinickas, and A. R. Dunn. 1994. Granulocyte/
macrophage colony-stimulating factor-deficient mice show no major perturbation of hematopoiesis but develop a characteristic pulmonary pathology. Proc.
Natl. Acad. Sci. USA 91: 5592–5596.
Dai, X. M., G. R. Ryan, A. J. Hapel, M. G. Dominguez, R. G. Russell, S. Kapp,
V. Sylvestre, and E. R. Stanley. 2002. Targeted disruption of the mouse colonystimulating factor 1 receptor gene results in osteopetrosis, mononuclear phagocyte deficiency, increased primitive progenitor cell frequencies, and reproductive
defects. Blood 99: 111–120.
Bouabe, H., Y. Liu, M. Moser, M. R. Bösl, and J. Heesemann. 2011. Novel highly
sensitive IL-10-beta-lactamase reporter mouse reveals cells of the innate immune
system as a substantial source of IL-10 in vivo. J. Immunol. 187: 3165–3176.
Varol, C., A. Vallon-Eberhard, E. Elinav, T. Aychek, Y. Shapira, H. Luche,
H. J. Fehling, W. D. Hardt, G. Shakhar, and S. Jung. 2009. Intestinal lamina propria
dendritic cell subsets have different origin and functions. Immunity 31: 502–512.
Thompson, L. J., A. C. Valladao, and S. F. Ziegler. 2011. Cutting edge: de novo
induction of functional Foxp3+ regulatory CD4 T cells in response to tissuerestricted self antigen. J. Immunol. 186: 4551–4555.
Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu,
and R. M. Steinman. 1992. Generation of large numbers of dendritic cells from
mouse bone marrow cultures supplemented with granulocyte/macrophage
colony-stimulating factor. J. Exp. Med. 176: 1693–1702.
Weischenfeldt, J., and B. Porse. 2008. Bone marrow-derived macrophages
(BMM): isolation and applications. CSH Protoc. 2008: pdb.prot5080.
Lee, S., S. Huen, H. Nishio, S. Nishio, H. K. Lee, B. S. Choi, C. Ruhrberg, and
L. G. Cantley. 2011. Distinct macrophage phenotypes contribute to kidney injury
and repair. J. Am. Soc. Nephrol. 22: 317–326.
Dong, X., S. Swaminathan, L. A. Bachman, A. J. Croatt, K. A. Nath, and
M. D. Griffin. 2007. Resident dendritic cells are the predominant TNF-secreting
cell in early renal ischemia-reperfusion injury. Kidney Int. 71: 619–628.
Meredith, M. M., K. Liu, G. Darrasse-Jeze, A. O. Kamphorst, H. A. Schreiber,
P. Guermonprez, J. Idoyaga, C. Cheong, K. H. Yao, R. E. Niec, and
M. C. Nussenzweig. 2012. Expression of the zinc finger transcription factor zDC
(Zbtb46, Btbd4) defines the classical dendritic cell lineage. J. Exp. Med. 209:
1153–1165.
Satpathy, A. T., W. Kc, J. C. Albring, B. T. Edelson, N. M. Kretzer,
D. Bhattacharya, T. L. Murphy, and K. M. Murphy. 2012. Zbtb46 expression
distinguishes classical dendritic cells and their committed progenitors from other
immune lineages. J. Exp. Med. 209: 1135–1152.
Edelson, B. T., W. Kc, R. Juang, M. Kohyama, L. A. Benoit, P. A. Klekotka,
C. Moon, J. C. Albring, W. Ise, D. G. Michael, et al. 2010. Peripheral CD103+
dendritic cells form a unified subset developmentally related to CD8alpha+
conventional dendritic cells. J. Exp. Med. 207: 823–836.
Becker, A. M., D. G. Michael, A. T. Satpathy, R. Sciammas, H. Singh, and
D. Bhattacharya. 2012. IRF-8 extinguishes neutrophil production and promotes
dendritic cell lineage commitment in both myeloid and lymphoid mouse progenitors. Blood 119: 2003–2012.
Ohl, L., M. Mohaupt, N. Czeloth, G. Hintzen, Z. Kiafard, J. Zwirner, T. Blankenstein,
G. Henning, and R. Förster. 2004. CCR7 governs skin dendritic cell migration under
inflammatory and steady-state conditions. Immunity 21: 279–288.
Qu, C., E. W. Edwards, F. Tacke, V. Angeli, J. Llodrá, G. Sanchez-Schmitz,
A. Garin, N. S. Haque, W. Peters, N. van Rooijen, et al. 2004. Role of CCR8 and
other chemokine pathways in the migration of monocyte-derived dendritic cells
to lymph nodes. J. Exp. Med. 200: 1231–1241.
Grunewald, M., I. Avraham, Y. Dor, E. Bachar-Lustig, A. Itin, S. Jung, S. Chimenti,
L. Landsman, R. Abramovitch, and E. Keshet. 2006. VEGF-induced adult neovascularization: recruitment, retention, and role of accessory cells. Cell 124: 175–189.
Jenkins, S. J., D. Ruckerl, P. C. Cook, L. H. Jones, F. D. Finkelman, N. van
Rooijen, A. S. MacDonald, and J. E. Allen. 2011. Local macrophage proliferation, rather than recruitment from the blood, is a signature of TH2 inflammation. Science 332: 1284–1288.
Lutz, M. B., M. Schnare, M. Menges, S. Rössner, M. Röllinghoff, G. Schuler,
and A. Gessner. 2002. Differential functions of IL-4 receptor types I and II for
dendritic cell maturation and IL-12 production and their dependency on GMCSF. J. Immunol. 169: 3574–3580.
Desjardins, M., and G. Griffiths. 2003. Phagocytosis: latex leads the way. Curr.
Opin. Cell Biol. 15: 498–503.
Zanoni, I., R. Ostuni, L. R. Marek, S. Barresi, R. Barbalat, G. M. Barton,
F. Granucci, and J. C. Kagan. 2011. CD14 controls the LPS-induced endocytosis
of Toll-like receptor 4. Cell 147: 868–880.
Bogunovic, M., F. Ginhoux, J. Helft, L. Shang, D. Hashimoto, M. Greter, K. Liu,
C. Jakubzick, M. A. Ingersoll, M. Leboeuf, et al. 2009. Origin of the lamina
propria dendritic cell network. Immunity 31: 513–525.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Another major observation is that all of the MPCs most likely
play concurrent roles in vascular homeostasis. All of the subpopulations express typical angio-regulatory factors Vegf, Angpt1,
and Pdgf genes in steady state. Recent studies have implicated
macrophages and CSF-1 in tissue growth, including kidney during
development (9). A major factor in organ size is angiogenesis, but
it will be interesting to understand whether the MPC subpopulations
play similar or distinct roles in vascular regulation.
Inflammatory cytokines are expressed with different levels
among MPC subpopulations in normal kidney. For example, Tnf
and Il1b are more highly expressed in CD11bhighCD11chigh,
CD11bhighCD11clow, and CD11bintCD11cint populations, whereas
Il6 and Ifng are more highly expressed in CD11blowCD11chigh and
CD11b2CD11cint populations. However, when they are stimulated
with LPS ex vivo, proinflammatory cytokines Tnf and Il1b are
generally downregulated compared with steady state. Furthermore, an M1 marker Nos2 is remarkably decreased (undetectable
by qRT-PCR), whereas an M2 marker Arg1 is increased by LPS
stimulation. Taken together, these findings may further support the
idea that resident MPCs have anti-inflammatory and reparative
roles in tissue injury.
We conclude that the normal kidney has five discrete MPC
subpopulations that exhibit distinct characteristics, functions, and
ontogeny. These functions are likely to be important in homeostasis
and immunological tolerance. Overall, the subpopulations share
both macrophage and DC characteristics, suggesting that these
functions are more related to context than separate lineage. Finally,
in response to systemic pathogenic exposure, kidney MPCs may
serve as critical sentinels for the adaptive immune response and
play important anti-inflammatory and tissue-reparative roles that
are distinct from monocytes.
3371
3372
34. Ginhoux, F., M. Greter, M. Leboeuf, S. Nandi, P. See, S. Gokhan, M. F. Mehler,
S. J. Conway, L. G. Ng, E. R. Stanley, et al. 2010. Fate mapping analysis reveals
that adult microglia derive from primitive macrophages. Science 330: 841–845.
35. Zhang, M. Z., B. Yao, S. Yang, L. Jiang, S. Wang, X. Fan, H. Yin, K. Wong,
T. Miyazawa, J. Chen, et al. 2012. CSF-1 signaling mediates recovery from acute
kidney injury. J. Clin. Invest. 122: 4519–4532.
36. Jojic, V., T. Shay, K. Sylvia, O. Zuk, X. Sun, J. Kang, A. Regev, D. Koller,
A. J. Best, J. Knell, et al; Immunological Genome Project Consortium. 2013.
Identification of transcriptional regulators in the mouse immune system. Nat.
Immunol. 14: 633–643.
37. Kingston, D., M. A. Schmid, N. Onai, A. Obata-Onai, D. Baumjohann, and
M. G. Manz. 2009. The concerted action of GM-CSF and Flt3-ligand on in vivo
dendritic cell homeostasis. Blood 114: 835–843.
FIVE SUBSETS OF KIDNEY RESIDENT MPCs
38. Khandelwal, P., T. Blanco-Mezquita, P. Emami, H. S. Lee, N. J. Reyes,
R. Mathew, R. Huang, and D. R. Saban. 2013. Ocular mucosal CD11b+ and
CD103+ mouse dendritic cells under normal conditions and in allergic immune
responses. PLoS One 8: e64193.
39. Langlet, C., S. Tamoutounour, S. Henri, H. Luche, L. Ardouin, C. Grégoire,
B. Malissen, and M. Guilliams. 2012. CD64 expression distinguishes monocytederived and conventional dendritic cells and reveals their distinct role during
intramuscular immunization. J. Immunol. 188: 1751–1760.
40. Tamoutounour, S., S. Henri, H. Lelouard, B. de Bovis, C. de Haar, C. J. van der
Woude, A. M. Woltman, Y. Reyal, D. Bonnet, D. Sichien, et al. 2012. CD64
distinguishes macrophages from dendritic cells in the gut and reveals the Th1inducing role of mesenteric lymph node macrophages during colitis. Eur. J.
Immunol. 42: 3150–3166.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Table SI. Primer sequences used for quantitative RT-PCR.
Gene
Forward
Reverse
Zbtb4
CCCACTCACTGTCTCTGAACG
AGTATGTGAGCGCATGTGTCG
Batf3
CAGAAGGCTGACAAGCTCCAC
CACATCTTCTCGTGCTCCTTCAG
Id2
ACTCGCATCCCACTATCGTCAG
ATTCAGATGCCTGCAAGGACAG
Irf8
TATGACCAAGAGGAGCCCATCC
GGGAGAAAGCTGAATGGTGTGTG
Vegfa
TACCTCCACCATGCCAAGTGGTCCC
AGGGTCTCAATCGGACGGCAGTAGC
Angpt1
ACAGGGACAGCAGGCAAACAGAGC
AGGCATCGAACCACCAACCTCCTG
Pdgfb
ATGAATCGCTGCTGGGCGCTCTTC
TCAAAGGAGCGGATGGAGTGGTCG
Pdgfc
GCGACAAGGAACAGAACGGAGTGC
AAACTTCGGGCTGTGGATGCTCCC
Igf1
CGTGTGTGGACCGAGGGGCTTTTAC
TCCACAATGCCTGTCTGAGGTGCCC
Wnt7b
ACGGCATCGACTTTTCTCGTCGC
TTCCAGCTTCATGCGGTCCTCCAG
Cd68
AGCCTTGTGTTCAGCTCCAAGCCC
ATGCCCCAAGCCCTCTTTAAGCCC
Ccr7
ACCAAAAGCACAGCCTTCCTGTGTG
ATGACAAGGAGAGCCACCACCAGC
Ccr8
GCAGAGGAGTGGGCAGCTCTGAAAC
AGTCGGTCATCGTGACGTTGGGCTC
Cxcr4
TGAGGCGTTTGGTGCTCCGGTAAC
TCCCGGAAGCAGGGTTCCTTGTTG
Il4r
TGGATCTGCGTGCTTGCTGGTTCTG
TTGGGGACACAAAAGGTGCCTGC
Tnf
CGCTCTTCTGTCTACTGAACTT
GATGAGAGGGAGGCCATT
Il1b
ACCTGTCCTGTGTAATGAAAGACG
TGGGTATTGCTTGGGATCC
Il6
GGTGACAACCACGGCCTTCCC
AAGCCTCCGACTTGTGAAGTGGT
Ifng
ACCTTCTTCAGCAACAGCAAGGCG
AATGCTTGGCGCTGGACCTGTG
Il10
Tgfb1
AAGTGATGCCCCAGGCAGAGAAGC
AGGGGAGAAATCGATGACAGCGCC
GAAGGACCTGGGTTGGAAGTGG
CGTAGTAGACGATGGGCAGTGG
Aldh1a2
GACTTGTAGCAGCTGTCTTCACT
TCACCCATTTCTCTCCCATTTCC
Nos2
AGCCTTGCATCCTCATTGGGCCTGG
ATGCGGCCTCCTTTGAGCCCTTTG
Arg1
CATTGGCTTGCGAGACGTAGAC
GCCTTTTCTTCCTTCCCAGCAG
Cxcl10
GCAAGGACGGTCCGCTGCAA
GGGCAGGATAGGCTCGCAGG
Il23a
TGCAAAGGATCCGCCAAGGTCTGG
ATCCTCTGGCTGGAGGAGTTGGCTG
Cxcl2
TGACCTGGAAAGGAGGAGCC
ACATCAGGTACGATCCAGGC
Ccl2
TCCCTGTCATGCTTCTGGGCCT
TAGCAGCAGGTGAGTGGGGCG
Ccl3
TCTCCACCACTGCCCTTGCT
GGCGTGGAATCTTCCGGCTGT
Gapdh
CTGGAGAAACCTGCCAAGTA
AAGAGTGGGAGTTGCTGTTG