Universität Würzburg
Biologische Fakultät
Lehrstuhl für Tierökologie & Tropenbiologie
Phylogeographie des Nebelparders (Neofelis nebulosa,
Griffith 1821) und seine Ökologie und Verbreitung
in Sabah, Malaysia.
Phylogeography of clouded leopards (Neofelis nebulosa,
Griffith 1821) and their ecology and distribution
in Sabah, Malaysia.
Erstgutachter: Prof. Dr. K. E. Linsenmair
Zweitgutachter: Prof. Dr. H. Hofer
Diplomarbeit
Andreas Wilting
Mai 2007
Diplomarbeit
Andreas Wilting
Index
Index
Abbrevations ....................................................................................................................... IV
Zusammenfassung .............................................................................................................. 1
Abstract .................................................................................................................................. 3
General Introduction ......................................................................................................... 5
Large carnivores as vulnerable and indicator species.................................... 6
Large carnivores as umbrella species ............................................................. 6
Large carnivores as keystone species.............................................................. 7
Large carnivores as flagship species............................................................... 7
The Clouded Leopard: a biological review ...................................................................... 7
Distribution...................................................................................................... 7
Description ...................................................................................................... 8
Habitat ............................................................................................................. 9
Behaviour......................................................................................................... 9
Diet ................................................................................................................ 10
Population and protection status................................................................... 11
General Objectives............................................................................................................. 11
Chapter 1 – Clouded leopard phylogeny .................................................................. 12
1. Introduction .................................................................................................................... 12
2. Materials and Methods.................................................................................................. 16
2. 1 Samples and DNA extraction............................................................................ 16
2. 2 Mitochondrial DNA analysis ............................................................................ 18
2. 3 Microsatellite markers....................................................................................... 20
2. 4 Population structure analysis............................................................................. 22
3. Results ............................................................................................................................. 22
3. 1 Mitochondrial DNA analysis ............................................................................ 22
3. 2 Microsatellite analysis....................................................................................... 28
3. 3 Population substructures ................................................................................... 31
3. 4 Estimation of the coalescence time of genetic variations in clouded leopards . 32
4. Discussion....................................................................................................................... 33
Management implications.............................................................................. 35
I
Index
Diplomarbeit
Andreas Wilting
Chapter 2 – Clouded leopard ecology ........................................................................ 37
1. Introduction .................................................................................................................... 37
Non-invasive methods.................................................................................... 37
Scent marking ................................................................................................ 39
Status and behaviour of “Sundaland clouded leopards” .............................. 39
Main goals ..................................................................................................... 40
2. Methods .......................................................................................................................... 40
2. 1 Study area.......................................................................................................... 40
Topography and soils .................................................................................... 42
Climate........................................................................................................... 43
Flora .............................................................................................................. 44
Fauna............................................................................................................. 45
2. 2 Main Research Area .......................................................................................... 45
Determining the size of the area surveyed..................................................... 47
2. 3 Data collection................................................................................................... 48
Transect surveys ............................................................................................ 48
Scent stations ................................................................................................. 49
Night surveys ................................................................................................. 51
2. 4 Track measurement ........................................................................................... 51
2. 5 Laboratory analysis ........................................................................................... 52
2. 6 Statistical and analytical analysis...................................................................... 52
2. 7 Application of the results on landscape level.................................................... 53
3. Results ............................................................................................................................. 54
3. 1 Recorded mammal species ................................................................................ 54
3. 2 Scent stations..................................................................................................... 54
3. 3 Faecal analysis................................................................................................... 55
3. 4 Scent marking behaviour of “Sundaland clouded leopards”............................. 55
3. 5 Individual identification by photographs .......................................................... 57
3. 6 Tracking ............................................................................................................ 59
3. 7 Individual identification by tracks..................................................................... 59
3. 8 Population size and density ............................................................................... 60
3. 9 Distribution in Sabah......................................................................................... 63
II
Diplomarbeit
Andreas Wilting
Index
4. Discussion....................................................................................................................... 66
Mammal species in Tabin .............................................................................. 66
Night surveys ................................................................................................. 66
Scent stations ................................................................................................. 67
Molecular scatology ...................................................................................... 67
Scent marking in clouded leopards................................................................ 68
Clouded leopard abundance.......................................................................... 69
Rigorous track classification method ............................................................ 70
Clouded leopard distribution in Sabah.......................................................... 71
General conclusion............................................................................................................ 74
Acknowledgment ............................................................................................................... 76
References ............................................................................................................................ 79
Appendix .............................................................................................................................. 96
Erklärung ............................................................................................................................. 98
III
Abbreviations
Diplomarbeit
Andreas Wilting
Abbreviations
BS
bootstrap support
CI
confidence interval
CITES
Convention of International Trade in Endangered Species
CFR
commercial forest reserve
Dps / Dkf
genetic distance estimators: proportion of shared alleles / kinship
coefficient
DVCA
Danum Valley Conservation Area
ESU
evolutionary significant unit
IUCN
World Conservation Union (International Union for the Conservation of
Nature and Natural Resources)
LD
linkage disequilibrium
ME / ML / MP
minimum evolution / maximum likelihood / maximum parsimony
mya
million years ago
NJ
neighbor-joining
PC / PCA
principal component / principal component analysis
SWD
Sabah Wildlife Department
TBR
tree-bisection reconnection
TPR
totally protected reserve
TS
track-set
TWR
Tabin Wildlife Reserve
VJR
virgin jungle reserve
W
buffer width
IV
Diplomarbeit
Andreas Wilting
Zusammenfassung
Zusammenfassung
Im Zuge des kontinuierlichen Rückgangs der tropischen Regenwälder werden die
verbleibenden ungestörten Habitate immer kleiner und fragmentierter. Diese ökologischen
Veränderungen bedeuten besonders für viele große Raubtiere eine starke Gefährdung. Auch
der Nebelparder (Neofelis nebulosa, Griffith 1821), der ausschließlich in tropischen und
subtropischen Regenwäldern in Südostasien vorkommt und zu den bisher am wenigsten
untersuchten
Katzenarten
gehört,
ist
dieser
Gefahr
ausgesetzt.
Genetische
und
morphologische Untersuchungen führten kürzlich dazu, dass eine Reklassifizierung der
Nebelparder auf Borneo (N. nebulosa diardi) zu einer eigenen Art (N. diardi) vorgeschlagen
wurde. Da die genetische Studie jedoch nur auf drei Individuen von Borneo basierte, habe ich
in meiner Diplomarbeit die Neueinteilung mit zusätzlichen Proben von Borneo (N = 4)
überprüft. Ich konnte darüber hinaus Museumsmaterial von Tieren von Sumatra (N = 3), die
bisher nicht genetisch untersucht wurden, sammeln. Meine Ergebnisse, die auf Sequenzen von
drei mitochondrialen Genfragmenten (zusammen 900 Bp) und 18 Mikrosatelliten basieren,
unterstützen die Unterscheidung in N. nebulosa und N. diardi. Die beiden Arten wiesen
41 fixierte Nukleotidunterschiede auf und bei acht der analysierten Mikrosatelliten gab es
keine Überlappungen der Allele. Diese genetischen Differenzen sind vergleichbar mit
Unterschieden zwischen anerkannten Arten in der Schwestergattung Panthera. Ferner konnte
ich zeigen, dass auch die Tiere auf Sumatra zu der neu eingeteilten Art N. diardi gehören, da
die analysierten Individuen von Sumatra den Proben von Borneo genetisch ähnelten.
Aufgrund des Ursprungs von N. diardi auf zwei Inseln im Sundaschelf schlage ich den
deutschen Namen „Sundaland Nebelparder“ vor. Außerdem habe ich sowohl in der mtDNS
Analyse als auch in der Mikrosatellitenuntersuchung einen genetischen Unterschied zwischen
den Populationen auf Borneo und Sumatra festgestellt. Die Ursache dafür ist ein reduzierter
Genfluss zwischen den beiden Populationen, und deshalb empfehle ich die Unterteilung von
N. diardi in zwei Unterarten. Aufgrund dieser Reklassifizierung sollte man nicht nur die
beiden Arten N. nebulosa und N. diardi, sondern auch die verschiedenen Populationen auf
Borneo und Sumatra getrennt voneinander behandeln. Eine Unterteilung der Nebelparder in
zwei Arten und Unterarten hat zur Folge, dass sich ihre Verbreitungsgebiete reduzieren und
sich dadurch der Grad ihrer Bedrohung erhöht. Umso wichtiger ist deshalb ein verstärkter
Schutz der unterschiedlichen Populationen. Diese Aufgabe gestaltet sich jedoch aufgrund des
teilweise nachtaktiven und scheuen Verhaltens der Tiere und ihres Vorkommens in geringen
Populationsdichten in schwer zugänglichen Gebieten als äußerst schwierig.
1
Zusammenfassung
Diplomarbeit
Andreas Wilting
Bisher wurden meist sehr kostspielige und zeitaufwändige Methoden angewendet um die
Ökologie großer Raubtiere in Regenwäldern zu erforschen. In dieser Arbeit habe ich verschiedene nicht invasive Methoden im Tabin Wildlife Reserve im Nordosten von Borneo
(Sabah) getestet. Mit Lockstoffen beköderte Haarfallen und molekulare Kotanalyse konnten
nicht erfolgreich angewendet werden. Im Gegensatz dazu stellten sich Nachtfahrten mit
Scheinwerfern und Spurenanalysen als kostengünstige und relativ einfach anzuwendende
Methoden dar. Auf vier Nachtfahrten wurden „Sundaland Nebelparder“ gesichtet. Mit Hilfe
von Fotos gelang es mir zwei Individuen im südlichen Teil des Untersuchungsgebietes
anhand ihrer Fellzeichnung zu identifizieren. Des Weiteren konnte ich in der Feldarbeit zwei,
möglicherweise drei, verschiedene Formen eines Markierungsverhaltens zeigen. Ein solches
Verhalten war zwar von anderen Katzenarten bereits bekannt, ist jedoch bei Nebelpardern
noch nie beschrieben worden. Während meiner täglichen Untersuchungen auf Transekten,
entlang von Schotterstraßen, Bachläufen und Waldwegen habe ich sechs Spurenfolgen von
Nebelpardern aufgenommen. Diese konnten mit Hilfe von multivariater Statistik in vier
Gruppen eingeteilt werden, wobei anzunehmen ist, dass jede Gruppierung einen Nebelparder
repräsentiert. Die Anwendung eines „Fang-Wiederfang“ Modells erlaubte eine ungefähre
Abschätzung der Nebelparderdichte in meinem Untersuchungsgebiet. In dem 56 km² großen
Areal habe ich mittels der Spurenanalyse fünf Individuen ( ± 2,26 SE) und im 19 km² großen
südlichen Teil des Untersuchungsgebietes mittels Fotoanalyse zwei Nebelparder ( ± 0,59 SE)
errechnet. Auf Grundlage dieser Abschätzungen ergab sich eine Dichte von neun ( ± 4,36 SE
für die Spuren) und 10,5 ( ± 3,1 SE für die Fotos) Nebelpardern auf 100 km² im Tabin
Wildlife Reserve. Die ähnlichen Ergebnisse für die zwei unabhängig voneinander kalkulierten
Dichten unterstützen die Annahme, dass die wirkliche Dichte im 95 % Konfidenzintervall von
acht bis 17 Individuen auf 100 km² liegt. Trotzdem möchte ich aufgrund der geringen Anzahl
an “Fängen und Wiederfängen” in beiden Ansätzen betonen, dass diese Dichteangabe als eine
erste grobe Abschätzung und Arbeitshypothese für weitere Forschungen anzusehen sein
sollte. Des Weiteren habe ich unter Berücksichtigung des Schutzstatus der formal geschützten
Gebiete (kommerziell genutzt oder reines Schutzgebiet), ihrer Größe und des bestätigten
Vorkommens an Nebelpardern versucht, seine Verbreitung über ganz Sabah zu bestimmen.
Basierend auf Bestandsaufnahmen vom Sabah Wildlife Department konnte ich zeigen, dass
zurzeit Nebelparder in 25 % der Landfläche Sabahs vorkommen, aber nur wenige dieser
Gebiete unterliegen einem totalen Schutzstatus. Daher schlage ich vor, einen Schwerpunkt auf
das nachhaltige Management der kommerziell genutzten Waldgebiete zu legen, um das
langzeitige Überleben der Nebelparder in Sabah zu garantieren.
2
Diplomarbeit
Andreas Wilting
Abstract
Abstract
Associated with the continuous loss of tropical rainforests, natural habitats become more and
more fragmented leading to rampant ecological changes which place most top carnivores
under heavy pressure. The clouded leopard (Neofelis nebulosa, Griffith 1821) is one of the
least studied cat species and occurs exclusively in subtropical and tropical rainforests in
south-east Asia. Recently, reclassification of Bornean clouded leopards (N. nebulosa diardi)
to species level (N. diardi) was suggested based on molecular and morphological evidence.
Since the genetic results were based on only three Bornean samples I re-evaluated this
partition using additional samples of Bornean clouded leopards (N = 4). I was also able to
include specimens from Sumatra (N = 3), which were lacking in the previous analysis. I found
strong support for the distinction between N. nebulosa and N. diardi based on three fragments
of mtDNA (900 bp) and 18 microsatellites. Forty-one fixed mitochondrial nucleotide
differences and non-overlapping allele sizes in eight of 18 microsatellite loci distinguished
N. nebulosa and N. diardi. This is equivalent to the genetic divergence among recognized
species in the genus Panthera. Sumatran clouded leopards clustered with specimens from
Borneo, suggesting that Sumatran individuals also belong to N. diardi. Referring to their
origin on two Sunda Islands I propose to give N. diardi the common name “Sundaland
clouded leopard”. Additionally, a significant population subdivision was apparent among
N. diardi from Sumatra and Borneo based on mtDNA and microsatellite data. The reduced
gene flow between these islands suggests the recognition of two subspecies of N. diardi.
Based on this reclassification of clouded leopards not only the two species N. nebulosa and
N. diardi, but also the populations of N. diardi on Borneo and Sumatra should be managed
separately. This research will give a good example for the importance of taxonomic splitting
for conservation. The two species and the distinct populations on Borneo and Sumatra face a
much greater risk of extinction due to smaller distribution ranges, than previously assessed
based on the former classification. Therefore more effort is needed to protect the different
populations from extinction. However, censussing and monitoring of these species is
extremely difficult due to their partly nocturnal and far-ranging behaviour as well as their low
densities in densely vegetated and remote areas. Consequently little is known about their
behaviour and status. So far various methods have been used to determine the status of top
carnivore populations in rainforest habitats, most of them costly in terms of equipment and
time. In this study, performed in Tabin Wildlife Reserve in north-eastern Borneo (Sabah) I
evaluated different non-invasive methods for investigating secretive carnivores occurring in
3
Abstract
Diplomarbeit
Andreas Wilting
tropical rainforests. Scent stations as hair-traps as well as the application of molecular
scatology were used unsuccessfully. In contrast, I could show that night surveys and rigorous
track classification are useful, cheap and easy-applied methods for research on elusive
carnivores. During four night spotlight surveys clouded leopards were observed. I detected
two different forms of scent marking for “Sundaland clouded leopards”; micturition, and
cheek rubbing. In contrast to other larger cats territorial marking was virtually unknown for
clouded leopards before. During daily transect surveys along roadways, streams, and jungle
trails six track-sets were recorded. Multivariate analysis of those track-sets grouped the tracks
in four clusters, suggesting that four different individuals left the tracks. On the basis of their
distinctive coat pattern two clouded leopards could be individually identified by the analysis
of photographs, obtained during night drives in the southern part of the research area. I used
these data to apply a capture-recapture analysis to roughly estimate the abundance of clouded
leopards within my study site. The population size in the 56 km² research area was estimated
to be five individuals ( ± 2.26 SE) for the track analysis and two animals ( ± 0.59 SE) in a
19 km² fragment of the research area used for photograph analysis. I obtained densities of
clouded leopards based on the population estimates of nine ( ± 4.36 SE for tracks) and
10.5 ( ± 3.1 SE for photographs) per 100 km² in Tabin Wildlife Reserve. The consistent
population estimates from two independently applied methods support that the density lies
most likely between the approximately 95 % confidence interval of eight to 17 individuals per
100 km². However, due to the low number of captures and recaptures in my study I would like
to emphasise that my calculated density should rather be taken as rough estimates and first
working hypothesis than a true number. I extrapolated my local-scale results to regional
landscape level, taking into account the conservation status of all reserves (totally protected or
commercial forest reserves) in Sabah and their size and presence of clouded leopards. I
showed that to date clouded leopards are still confirmed in approximately 25 % of Sabah, but
that only a few reserves are totally protected and these areas are inhabited by just a few
hundred individuals. The remaining reserves are classified as commercial forest reserves.
Therefore, I suggest placing a higher priority on sustainable management of these commercial
forest reserves to ensure the long term persistence of viable clouded leopard populations.
4
Diplomarbeit
Andreas Wilting
General Introduction
General Introduction
At present, species are becoming extinct at a rate between 100 and 1000 times of natural
background rates (Balmford 1996). Only around 5 % of the planet’s surface is protected in
some form from exploitation (Gittleman et al. 2001). The ongoing habitat loss will produce
much higher extinction rates with potential disappearance of up to half of the world’s species
(Pimm et al. 1995). Of 11 mammal orders, five have a significantly higher number of
threatened species than expected (artiodactyls, insectivores, primates, perrissodactyls,
sirenians) (Mace & Balmford 2000). However, carnivores are not one of them nor does any
carnivore family have an unusually high level of threatened species (Mace & Balmford 2000).
Even though carnivores may fair relatively well in general, historical and current patterns of
extinction clearly indicate that large carnivorous species with restricted ranges are highly
threatened (Gittleman et al. 2001). The extinction vulnerability among species is frequently
caused by particular biological traits (Terborgh 1974; Purvis et al. 2000), e. g. small or
declining population sizes, low population density, large home ranges, large body size, little
genetic variability or species which are hunted by humans. In many ways these summed-up
characteristics reflect exactly the biology of large carnivores (Gittleman et al. 2001).
In conservation biology species are often classified into the following categories (Gittleman
et al. 2001):
•
vulnerable species (species most likely to become extinct),
•
indicator species (reflect critical environmental damage),
•
umbrella species (species requiring large areas and thus, if protected, will in turn
protect other species),
•
keystone species (play a pivotal role in ecosystems) and
•
flagship species (popular species, which attract much attention).
Each classification informs whether a species deserves particular conservation and protection
efforts. Remarkably, all of these labels fit on most of the large carnivorous species. The
following examples emphasise the specialty of carnivores, and give reasons why carnivores
should receive closer attention and disproportionate resources.
5
General Introduction
Diplomarbeit
Andreas Wilting
Large carnivores as vulnerable and indicator species
Fundamentally, the biological niche of large carnivores at the top of the food chain means that
they will always be less abundant than their prey and require relatively large home ranges. As
a consequence these species are the first to suffer when human populations expand and
cultivate previously untouched habitats (Sillero-Zubiri & Laurenson 2001). Therefore top
predators are more vulnerable to habitat destruction and fragmentation than many other
species. Consequently it is believed that the presence and fluctuations of top predators reflect
the status of other species in the community as well as the chemical and/or physical changes
in the environment (Landres et al. 1988). This makes many larger carnivores good indicator
species. Today, many carnivores are confined to protected areas with patchy distributions, due
to dramatic declines in suitable habitats over the past few hundred years. As a result of
isolation of the remaining populations, recolonisation of vacant areas becomes less likely, as
well as the maintenance of sink populations by immigration. The enduring populations, often
less than 100 individuals in size, are expected to be more prone to extinction than larger
populations, partly because deterministic declines can drive them to extinction more rapidly
(Fahrig 1997). Furthermore demographic bottlenecks resulting in a reduction of the molecular
genetic variation can impair the reproductive potential of a population and thus its long term
health and viability (Wildt et al. 1987). The Florida panther (Puma concolor coryi) is a well
documented example of inbreeding consequences in which lower heterozygosity is associated
with a suite of physiological problems. For example sperm viability is 18-38 times lower than
in other panther subspecies and 58 % of the males are cryptorchids (absence of one or both
testes from the scrotum) (Roelke et al. 1993). In addition cardiac defects and disease
incidences are high and growth arrest is indicated by high incidences of stress lines in the
cortical bones (Roelke et al. 1993).
Large carnivores as umbrella species
The protection of large carnivores requires not only huge reserves, but also vital prey
populations. For many carnivores the prey abundance and availability, as well as geographic
variation in food resources, influence the population viability and density (Fuller & Murray.
1998). As a consequence planning assessments and protection of carnivores’ prey are also
important for carnivore conservation. Thus, many other species will fall under that umbrella,
if large tracts of land get managed with the intention to protect large predators. Nepal’s
Chitwan National Park is a well known case study of single species conservation. The unusual
6
Diplomarbeit
Andreas Wilting
General Introduction
forceful blend of protection in the park leads to the highest tiger (Panthera tigris) density in
the world (Dinerstein et al. 1999), but this protection also has a lasting positive effect on the
population density of other species (e. g. one-horned rhinoceros Rhinocerus unicornis, gaur
Bos gaurus).
Large carnivores as keystone species
Large carnivores, as predators, limit the number of herbivores and smaller carnivores (Wright
et al. 1994), a so called ‘top-down’ regulation. Subsequently due to removal of dominant
carnivores smaller carnivores undergo population increases, a phenomenon called
‘mesopredator release’ (Soulé et al. 1988). For example densities of predators of
invertebrates, seed predators and herbivores are 10 to 100 times higher on Barro-Colorado
Island compared to similar habitats on the mainland where top carnivores are present
(Terborgh et al. 2001 and 2006). Hence, there can be no doubt that carnivores, as predators,
play a vital role in the maintenance of biodiversity, stability and integrity of various
communities (Paine 1966; Berger 1999; Crooks & Soulé. 1999; Terborgh et al. 1999 and
2006; Sergio et al. 2005; Johnson et al. 2007).
Large carnivores as flagship species
Many large carnivores can serve as flagship species due to their charismatic nature. These
flagships can be used to anchor a conservation campaign, because they raise public interest
and sympathy. The Florida panther is one of these flagship species. Used as a poster-animal it
became a symbol and leading element of the entire conservation campaign (Simberloff 1998).
Especially large cats galvanize public interest towards a greater goal of habitat conservation.
The Clouded Leopard: a biological review
Distribution
In the past, clouded leopards were distributed in most parts of south-east Asia, ranging from
Nepal, Assam to mainland south-east Asia and southern China. Furthermore clouded leopards
were distributed on the Islands of Borneo, Sumatra and historically they were found on
Taiwan and Java. However, on Java clouded leopards became extinct in the Holocene
(Meijaard 2004). On Taiwan the Formosan clouded leopard is thought to be extinct in the
wild: the last confirmed sighting of a clouded leopard was in 1983 (Rabinowitz 1988) and in
1989 the skin of a small clouded leopard was found in the Tayloko region (Wang et al. 1995).
7
General Introduction
Diplomarbeit
Andreas Wilting
Compared to distribution ranges of other Pantherinae like leopards and lions (Panthera leo),
the extension of clouded leopards is very restricted.
Description
Clouded leopards are medium sized cats, weighing between 11-25 kg, even though on Borneo
males were recorded with a body weight over 30 kg (Sabah Wildlife Department pers.
comm.). The clouded leopard is named after the distinctive cloud-shaped blotches on its fur.
The base colour of the fur is pale yellow to rich brown. The blotches are edged with dark
brown or black and become brighter towards the middle. The animal’s underside is pale or
white with few spots. Neck and back are streaked dark brown or black, whereas the head and
legs are usually spotted. The heavily furred tail is marked with broken black rings.
Completely black specimens, similar to the black panther (Panthera pardus) (Banks 1931;
Davies & Payne 1982; Rabinowitz et al. 1987), or pale, whitish individuals have been
reported anecdotally on Borneo (Davies & Payne 1982).
Several adaptations like flexible joints in their hind feet, which allow them to rotate their feet
more than any other felid, give clouded leopards amazing arboreal skills. Like the margay
a)
b)
Figure 1 Male clouded leopard (Neofelis nebulosa) photographed at Duisburg zoo. (a) shows
the proportionately short legs with large broad paws. (b) shows the exceptionally long and
plushy tail.
8
Diplomarbeit
Andreas Wilting
General Introduction
(Leopardus wiedii) of South America, clouded leopards can climb down tree trunks, squirrellike headfirst (Hemmer 1968). Proportionately short legs (Figure 1 a Page 8) provide excellent
leverage and a low centre of gravity for climbing while large broad paws with sharp claws
allow clouded leopards a good grip on tree branches (Figure 1 a). An exceptionally long and
plushy tail, which usually measures between 75 and 90 cm and is almost equivalent to their
head-body length (Mehta & Dhewaju 1990), is extremely important as a balancing aid
(Figure 1 b Page 8). These arboreal skills of the clouded leopard gave rise to the Malaysian
name “harimau-dahan” meaning branch-tiger.
Recent studies on skull morphology revealed some saber-tooth characters in clouded leopards
(Christiansen 2006). Christiansen & Adolfssen (2005) measured various typical skull
characteristics and found that Neofelis has the largest gape of any extant carnivores. Gapes
approaching an angle of 90° are similar only to extinct saber-tooth cats whereas all other
extant felids can only open their mouth up to an angle of 55 - 65° (Christiansen 2006). This
huge gape in clouded leopards is linked to the longest canines in proportion to body weight of
all extant felids (Guggisberg 1975).
Habitat
Based on anecdotal observations clouded leopards have been described as inhabiting
principally evergreen tropical rainforest (Pocock 1939; Wood 1949; Prater 1971), but more
recently clouded leopards have also been reported in other types of forests such as secondary
and logged forest (Davies & Payne 1982; Rabinowitz et al. 1987; Santiapillai & Ashby 1988).
In subtropical Nepal the clouded leopard occurs in marginal dry woodland, but it has also
been recorded in shrub forest and tall grasslands (Dinerstein & Mehta 1989). Davies and
Payne (1982) confirmed the presence of clouded leopards in mangrove swamps on Borneo. In
the Himalayan foothills clouded leopards have been recorded up to an elevation of 2,600 m
(Choudhury 1997), possibly as high as 3,000 m (Jerdon 1874). All these sightings suggest that
the species might be more flexible in its habitat needs than previously thought.
Behaviour
Compared to other big cats very little is known about the natural history of clouded leopards.
Most available information is anecdotal, based on local surveys, sightings and interviews
(Rabinowitz et al. 1987; Davies 1990) or stems from captive observations (Hemmer 1968;
Nowell & Jackson 1996; Law & Tatner 1998; Wielebnowski et al. 2002). A total of only
9
General Introduction
Diplomarbeit
Andreas Wilting
seven clouded leopards have ever been radio-collared (Dinerstein & Mehta 1989; Austin &
Tewes 1999; Grassman et al. 2005). Many early accounts depict this carnivore as an arboreal
and nocturnal denizen of dense primary forest (Pocock 1939; Wood 1949). Despite their
arboreal talents there is no field evidence to support this assumption. Recent studies showed
that clouded leopard movements are usually terrestrial (Rabinowitz et al. 1987; Dinerstein &
Mehta 1989; Austin & Tewes 1999; Grassman et al. 2005) and that clouded leopards use trees
mainly for resting (Rabinowitz et al. 1987; Davies 1990). According to Davies and Payne
(1982) and Rabinowitz et al. (1987), clouded leopards were seen following jungle trails and
roads in Borneo. Daily distances of 1,000-2,700 meters and home ranges between 23 and
45 km² (Grassman et al. 2005; Austin & Tewes 1999) cannot be covered without spending
much time on the ground. These home-ranges exceed home-range sizes of male leopards in
Thailand (Rabinowitz 1989; Grassman 1999). Early accounts which classified the clouded
leopard as strictly nocturnal got temporary confirmed by photographs obtained by camera
trapping in Sumatras’ Gunung Leuser National Park at night (Griffiths 1993). There were
speculations that clouded leopards are more strictly nocturnal in areas where they occur
sympatrically with tigers like in Gunung Leuser National Park (NP) and that they are less
nocturnal on Borneo in absence of other large carnivores (Selous & Banks 1935; Rabinowitz
et al. 1987). However recent data from Thailand, where the clouded leopard occurs
sympatrically with superior carnivores, indicate that the clouded leopard is not as strictly
nocturnal as previously thought and is more crepuscular (Grassman et al. 2005). Due to their
extremely secretive nature, virtually nothing is known of their social behaviour in the wild.
Most likely they live solitary, similar to most other big cats, unless associated with a mate for
breeding or females accompanied by cubs.
Diet
Pocock (1939) surmised from the deep penetration of its bite, attested by the long canines and
from its powerful build that clouded leopards are obviously adopted for preying relatively
large ungulate prey. However, their chief prey has been reported to consist of birds, primates
and small mammals, as well as larger prey, such as porcupines, deer and pigs (Sus sp.) (Banks
1931; Selous & Banks 1935; Prater 1971; Griffiths 1993; Grassman et al. 2005). In a riverine
forest in Sabah, a clouded leopard was observed feeding on a proboscis monkey (Nasalis
larvatus) in the branches of a small tree (C. Prudente, pers. com.) and in Thailand clouded
leopards were sighted hunting pig-tailed macaques (Macaca nemestrina) (Davies 1990).
10
Diplomarbeit
Andreas Wilting
General Introduction
Interestingly Grassman et al. (2005) found a pangolin (Manis javanica) which was killed by a
clouded leopard.
Population and protection status
The clouded leopard is listed, at present, by IUCN as vulnerable (IUCN 2006), as endangered
under the United States Endangered Species Act and it is listed on CITES Appendix I, which
bans international commerce. Due to a lack of research information, population estimates do
not exist, and still little known is about the actual status in any part of its geographic range
(Sunquist & Sunquist 2002). However, it is thought that the number of wild clouded leopards
is declining throughout its range (Sunquist & Sunquist 2002). The foremost threat is
deforestation and cultivation of previously untouched habitats (Nowell & Jachson 1996).
Secondly, in some areas clouded leopards are widely hunted for their teeth and decorative pelt
or for bones for traditional Asian medicine (Tan Bangjie 1984; Nowell & Jackson 1995). In
surveys of south-east Asian black markets clouded leopard pelts were traded openly on a
regular base (Tan Bangjie 1984; Nowell & Jackson 1995; Sunquist & Sunquist 2002).
General Objectives
In one part of this study I tried to collect as many genetic samples of Bornean and Sumatran
clouded leopards as possible to contribute to the taxonomic designation of clouded leopards.
Recently reclassification of Bornean clouded leopards (N. nebulosa diardi) to species level
(N. diardi) was suggested based on molecular and morphological evidence (Buckley-Beason
et al. 2006; Kitchener et al. 2006). Since the genetic results were based solely on three
Bornean samples I re-evaluated this partition utilising different molecular markers.
In a second part of this study I investigated the status of clouded leopards in a part of its
natural habitat. The field work was conducted in Tabin Wildlife Reserve which forms a totally
protected area in north-eastern Borneo. During this field study I examined different noninvasive methods to study clouded leopards in a tropical rainforest. Main goals included
estimation of population size and of density of clouded leopards in my study area. An
extrapolation of this information to other forested areas in Sabah was performed to provide a
first rough assessment of the status of clouded leopards region wide.
The aim of this study was to contribute to effective conservation of one of the most threatened
cat species in Asia.
11
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Introduction
Chapter 1
Clouded leopard phylogeny revisited: Support for
species recognition and population division between
Borneo and Sumatra
1. Introduction
The taxonomic history of clouded leopards is complex and their systematic classification and
phylogenetic status remained obscure for a long time (Pocock 1917; Haltenorth 1936;
Hemmer 1964; Hemmer 1968). The clouded leopard was first described by Griffith (Griffith
1821) as Felis nebulosa, based on a captive individual most probably from southern China.
Later the genus name was changed to Neofelis (Gray 1867). After this description a
controversial discussion on the systematic position of clouded leopards within the family
Felidae started. For example Leyhausen (1990) listed Neofelis as a full genus, but also
included the tiger within that genus. Due to a resembling coat pattern Corbet and Hill (1992)
placed clouded leopards and marble cats (Pardofelis marmorata) in the genus Pardofelis.
Despite this past disputes Neofelis’ morphological characteristics and vocalizations finally led
to the conclusion that the Neofelis and the Panthera genus form one monophyletic group
named Pantherinae (Werdelin 1983; Peters & Hast 1994). Later phylogenetic studies
confirmed that clouded leopards belong to the Panthera lineage but separated first from their
common ancestor approximately 6 million years ago (mya) (Johnson & O’Brien 1997;
Mattern & McLennan 2000; Yu & Zhang 2005; Johnson et al. 2006). However, based on a
broad analysis of felid skull morphologies Christiansen (2006) showed, that clouded leopards
are standing out from the genus Panthera as well as from all other extant felids.
Two years after Griffith described Felis nebulosa (Griffith 1821), Cuvier (1823) depicted an
individual from Sumatra and due to morphologically differences he classified it as an
additional species Felis diardi. Hodgson (1853) characterised a specimen from Nepal as a
third species Felis macrosceloides and Swinhoe (1862) described another species Leopardus
brachyurus based on a specimen from Formosa (Taiwan). Those regional species have
subsequently been regarded as subspecies of Felis nebulosa, whereas the genus name was
changed to Neofelis (Gray 1867) (Table 1). Figure 2 shows the geographical range of the four
12
Chapter 1: Clouded leopard phylogeny
Introduction
Diplomarbeit
Andreas Wilting
putative subspecies. However, this
old classification was only based on
a single or few specimens, but
modern taxonomic classifications
require extensive sampling from
throughout the species range (Corbet
1970; Groves 2001).
Recently Buckley-Beason
et
al.
(2006) and Kitchener et al. (2006)
reanalysed
the
phylogenetic
relationship among clouded leopards
due to a lack of molecular and Figure 2 shows the geographical distribution of clouded
leopards in south-east Asia. Different colours stand for
the four putative clouded leopard subspecies based on
comparisons. A reclassification of historical descriptions.
broadly
based
morphological
Bornean and Sumatran clouded leopards N. nebulosa diardi to species level N. diardi was
suggested (Kitchener et al. 2006). Morpholometric analysis of pelages by Kitchener et al.
(2006) showed that Sumatran clouded leopards as well as Bornean individuals differ in a
similar manner to individuals from mainland south-east Asia, with the size of the cloud
markings being the primary factor for distinction. Kitchener et al. (2006) did not find any
evidence for recognition of the subspecies N. nebulosa macrosceloides and N. nebulosa
brachyurus. Buckley-Beason et al. 2006 supported this reclassification based on mtDNA,
nuclear DNA sequences, microsatellite analysis, and fixed chromosomal differences for
Table 1 Recognised subspecies of the clouded leopard (Neofelis nebulosa) by the IUCN
Cat Specialist Group (Nowell & Jackson 1996).*
Subspecies
Geographical distribution
N. nebulosa macrosceloides
Nepal, India, Bhutan, Bangladesh, Myanmar
N. nebulosa nebulosa
Myanmar, Thailand, Cambodia, Vietnam, southern China,
Peninsula Malaysia
N. nebulosa brachyurus
Taiwan
N. nebulosa diardi
Sumatra, Borneo
* recent reclassification suggestions by Buckley-Beason et al. (2006) and Kitchener et al. (2006) are not
considered
13
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Introduction
Bornean specimens. However, a small sample size of only three Bornean samples
(microsatellite analysis of only two specimens) and a total lack of Sumatran samples reduced
confidence in the reclassification of N. diardi to species status in this phylogenetic analysis.
Further sampling from Borneo and especially Sumatra is necessary for secure reclassification
to species status on the Sunda Islands.
Understanding of taxonomic distinctions among clouded leopard populations is relevant not
only for systematic issues, but it is also of utmost importance for conservation and
management purposes (Mace 2004). The definition of geographically isolated populations as
evolutionary significant units on and below species level is fundamental to set the stage for
further ex situ breeding programs and in situ conservation plans (Ryder 1986; Waples 1991
and 1995 ; Avise 1994; Moritz 1994; Fraser & Bernatchez 2001).
A further investigation of Sumatran and Bornean specimens is also of special interest given
the background of the evolutionary history of the Sunda shelf. At present, shallow seas
separate Sumatra, Borneo, Java and the Malay Peninsula (Figure 3 a Page 15). Due to their
position on a shallow continental shelf these areas were connected via land bridges during
periods of low sea levels in the late Pliocene and Pleistocene (e. g. Tjia 1980; Heaney 1991;
Voris 2000). Voris (2000) pointed out that the sea-levels were at their minimum (< 116 m) for
only relatively short periods of time, but sea-levels were at or below intermediate levels
(≤ 40 m) for more than half of the time during the past 250,000 years Figure 3 b & c (Page
15). During these intervals at intermediate sea levels all three major Sunda Islands Borneo,
Sumatra and Java remained connected to each other and to mainland south-east Asia (Figure
3 b). Corresponding to expanded boundaries of land areas during these glacial periods many
authors suggest that most species should have been able to move freely across Sundaland up
until approximately 10,000 years ago when higher sea-levels started to separate the islands
(Heaney 1985; Koopman 1989). Studies on different taxa show evidence, that Pleistocene
land bridges can explain their current distribution on the Sunda shelf (e. g. Koopman 1989 for
bats; Ruedi 1996 for shrews; Karns et al. 2000 for Asian water snakes). In contrast
Gorog et al. (2004) did not support the hypothesis of broad Pleistocene migrations for three
Sunda shelf murine rodents instead suggesting a deep history of vicariant evolution. Similar
discontinuities in their distribution have been noted for Asian Colobinae (Brandon-Jones
1996) and for orang-utans for which morphological and genetic studies showed that Sumatran
(Pongo abelli) and Bornean (P. pygmaeus) species have separated 1 - 5 million years ago
(mya) (Warren et al. 2001; Steiper 2006). Although land connections existed during the late
14
Chapter 1: Clouded leopard phylogeny
Introduction
Diplomarbeit
Andreas Wilting
Figure 3 Maps of tropical south-east Asia showing the extent of land area of (a) present
(b) 40 m (c) 116 m below present. Maps are based on a geographical projection in ArcView
(Voris 2000) and are adapted from The Field Museum (2006).
15
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Introduction / Materials and Methods
Pleistocene these data point out that there appear to have been considerable topographical
barriers between the islands for animal movements, especially for terrestrial species (Voris
2000; Hewitt 2000; Inger & Voris 2001). Recent phylogenetic results by Buckley-Beason
et al. (2006) suggest that Bornean clouded leopards diverged from mainland individuals at
about 1.41 mya. This long time of separation indicates that the clouded leopard might be
another example for populations, which were prevented to mix across available land bridges
by ecological or geographical barriers.
Owing to the limited sampling of only three Bornean specimens in the study by BuckleyBeason et al. (2006) I will present here a phylogenetic analysis including additional
individuals from Borneo. Furthermore, the phylogenetic relationships among clouded
leopards are examined more closely by including Sumatran samples, because Sumatran
individuals have to date not been investigated genetically. Furthermore the phylogeographical
approach contributes to the reconstruction of the history of clouded leopards in the Sunda
shelf. This information might add to resolve questions on the history of isolation and
fragmentation among forested regions of the shelf during Pleistocene glaciation periods.
2. Materials and Methods
2. 1 Samples and DNA extraction
I sampled seven specimens (defined as individuals that were verified as wild-born from a
specific geographical location or captive-born from geographically verified wild-born parents)
from the islands of Borneo (N = 4) and Sumatra (N = 3) and four animals from mainland
south-east Asia (Table 2 Page 17). For outgroup comparison I used one leopard and two
domestic cats (Felis catus) (Table 2).
Samples were collected in different German and Malaysian museums and zoos (Table 2).
Faecal samples from zoos were freshly collected and a hazelnut sized piece was taken and
preserved in ethanol p.a.. Whole blood samples of domestic cats and the leopard were taken
by veterinarians for medical examinations and sub-samples were provided for my analysis.
From ancient museum specimens small hide samples (~ 0.1 cm²) were taken from different
body parts. Preferably, I sampled close to the mouth, eyes and at the paws, because those
parts of the skin showed in most skins a reddish colouration indicating rests of blood clots.
16
Chapter 1: Clouded leopard phylogeny
Materials and Methods
Diplomarbeit
Andreas Wilting
17
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Materials and Methods
DNA was extracted from faecal samples using QiAmp Stool Mini Kit (Qiagen, Hilden,
Germany). To increase the amount of DNA the protocol of the manufacturer was modified.
Of each faecal sample I weighed three times 200 mg and transferred them into three separate
2 ml Eppendorf tubes. I added 1.4 ml Buffer ASL to each tube, vortexed the tubes
continuously until the faecal sample was thoroughly homogenized. After I centrifuged the
tubes, I pipetted 1.4 ml of the supernatant into a new 2 ml microcentrifuge tube. I added only
half InhibitEX tablet to each tube. Thereafter I followed the manufacturers extraction protocol
until the lysate was applied to the QIAamp spin columns. At this step I repeated to load
aliquots of 600 µl of all three tubes of one faecal sample stepwise onto one single spin column
to increase the amount of DNA. DNA was resuspended with 150 µl Buffer AE in two
separate steps of 75 µl each. DNA was extracted from whole blood using QiAmp DNeasy
(Qiagen, Hilden, Germany) according to extraction protocol. For extraction of DNA from
historical museum samples hide and dry tissue samples were cut into small pieces using a
sterile scalpel and then a standard proteinase K digestion with an extended incubation interval
at 56°C for up to 72 hours was applied (Sambrook et al. 1989). During the incubation the
tubes were gently agitated. The incubation was stopped, when only little solid tissue
remained. After the digestion a standard phenol/chloroform extraction procedure was used to
extract DNA from this solution (Sambrook et al. 1989). DNA was suspended in 50 µl of
double distilled H2O.
2. 2 Mitochondrial DNA analysis
I used a 426 bp portion of a central conserved region, within the D-loop of the control region
(Jae-Heup et al. 2001) in addition to two mtDNA genes (ATPase-8 and Cyt-b) (BuckleyBeason et al. 2006). The control region primers were modified by Janecka JE (pers. comm.).
Table 3 Mitochondrial primers with the size of the sequences for clouded leopards
and the forward and reverse primer sequences
Primer Name
Size [bp]
Primer sequence
ATPase-8*
185
F: ACAACTAGATACATCCACCTGA
R: GGCGAATAGATTTTCGTTCA
Cytochrome-b*
286
F: ATGACCAACATTCGAAAATC
R: TGTATAGGCAGATAAAGAATATGGA
Control region§
429
F: CTCAACTATCCGAAAGAGCTT
R: CCTGTGGAACATTAGGAATT
Total size
900
* Buckley-Beason et al. 2006
§
Jae-Heup et al. 2001, modified by JE Janecka (pers. comm.)
18
Chapter 1: Clouded leopard phylogeny
Materials and Methods
Diplomarbeit
Andreas Wilting
Table 3 (page 18) shows a list of the mtDNA primers and the length of the sequence
fragments. In total I amplified 900 bp of mtDNA. PCR reactions were performed in a final
volume of 25 µl containing:
2.5 µl MolTaq 10x PCR Buffer
2 mM MgCl2
0.2 mM dNTPs
1 µM of each primer
2 units of MolTaq polymerase (Molzym GmbH, Bremen, Germany)
2 µl of genomic DNA.
PCR reactions were performed in an Eppendorf Mastercycler (Eppendorf GmbH, WesselingBerzdorf, Germany) with an initial denaturation step at 95°C for 3 min, followed by 35 cycles
of denaturation at 94°C for 30 s, annealing at 56°C for 45 s, elongation at 72°C for 45 s and
were completed with a final elongation step at 72°C for 10 min. PCR products were purified
by ultrafiltration through Montage TM filter devices (Millipore GmbH, Schwalbach,
Germany) and sent to Seqlab (Seqlab Laboratories, Göttingen, Germany) for sequencing.
Sequences were edited, assembled and aligned using ClustalW (Thompson et al. 1994)
implemented in BioEdit (Version 7.0.5.2) (Hall 1999) before being exported to PAUP
(Version 4.0b10) (Swofford 2001) for phylogenetic analysis. Phylogenetic relationships
among haplotypes were estimated using minimum evolution (ME), maximum likelihood
(ML) and maximum parsimony (MP) (Saitou & Nei 1987; Swofford 2001). I used Kimura
2-parameter distance with neighbor-joining (NJ) algorithm followed by tree-bisection
reconnection branch-swapping procedure (TBR) for the ME analysis. MP trees were
conducted using a heuristic search, with 10 random taxon addition replicates and TBR branch
swapping. The ML approach was performed using the HKY85 model (Hasegawa et al. 1985).
Each phylogenetic tree was rooted with the domestic cat sequence. Reliability of all trees was
tested with bootstrap values by 1000 replicates of heuristic search and TBR branch swapping.
Measures of population genetic variation, such as mean number of pairwise differences and
nucleotide diversity (µ) were estimated after Tajima (1983) using Arlequin 3.1 (Excoffier
et al. 2005).
Based on the combined 900 bp mtDNA sequences the approximate age of separation between
N. nebulosa and N. diardi was estimated using LINTREE (Takezaki et al. 1995). A neighborjoining tree (Saitou & Nei 1987) was generated with Kimura 2-parameter γ-corrected
19
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Materials and Methods
distances (Kimura 1980). The coalescence point between clouded leopards and the Panthera
genus, being 6.37 mya based upon a comprehensive analysis of nuclear gene sequences and
multiple fossil dates (Johnson et al. 2006), was chosen to be the calibration point for this
study. I used a range of two standard errors to calculate a 95 % confidence interval.
2. 3 Microsatellite markers
I used 10 felid dinucleotide microsatellite primers (FCA 8, FCA 45, FCA 77, FCA 80,
FCA 82, FCA 126, FCA 132, FCA 144, FCA 261, FCA 310) (Menotti-Raymond et al. 1999),
which were already used in a previous study on clouded leopards (Buckley-Beason et al.
2006) (Table 4 Page 20). Those microsatellites are located on eight felid autosomes and all of
them are at least 5 centimorgans apart from each other (Menotti-Raymond et al. 1999). In
addition to those ten microsatellite loci of known allele size ranges for clouded leopards, I
applied eight microsatellites of unknown allele sizes for clouded leopards, FCA 23 and
FCA 43 (Menotti-Raymond et al. 1999), and HDZ 3, HDZ 57, HDZ 64, HDZ 89, HDZ 817,
HDZ 859 (Williamson et al. 2002) (Table 4 Page 20). PCR amplifications were performed in
a final reaction volume of 10 µl utilizing described methods (Menotti-Raymond et al. 1999;
Williamson et al. 2002). The IR-dye-labelled PCR products were diluted and analyzed on a
LI-COR 4300 DNA-Analyser (LI-COR Bioscience GmbH, Bad Homburg, Germany). Data
were collected and analyzed using Saga Generation 2 (Version 3.2.1).
To determine the performance of all microsatellites as population genetic markers I tested for
deviations from linkage disequilibrium (LD) using GENEPOP on the web version 3.4
(http://wbiomed.curtin.edu.au/genepop/
Raymond
&
Rousset
1995).
Measures
of
microsatellite genetic variation in terms of observed and expected heterozygosities were
estimated with Arlequin 3.1 (Excoffier et al. 2005).
Pairwise genetic distances among clouded leopards and to two outgroup species was
estimated with two microsatellite genetic distance estimators: the proportion of shared alleles
(Dps) and the kinship coefficient (Dkf) with the [1 - ps/kf] option in MICROSAT (Minch
et al. 1995). Phylogenetic NJ-trees were constructed from the Dps and Dkf distance matrixes
using NEIGHBOR (included in PHYLIP version 3.66 Felsenstein 2006). Bootstrap values for
1000 bootstrap replicates in MICROSAT were calculated using CONSENSE TREE (included
in PHYLIP version 3.66 Felsenstein 2006). Trees were drawn using the programme
TREEVIEW (version 1.6.6 Page 1996).
20
Chapter 1: Clouded leopard phylogeny
Materials and Methods
Diplomarbeit
Andreas Wilting
Table 4 Microsatellite markers utilised in this study with the forward and reverse
primer sequences, depiction of the microsatellite location and size ranges.
Marker
Name
Primer sequence
Domestic cat
Chromosome
FCA 8*†
F: ACTGTAAATTTCTGAGCTGGCC
R: TGACAGACTGTTCTGGGTATGG
A1
135 -155
FCA 23*
F: CAGTTCCTTTTTCTCAAGATTGC
R: GCAACTCTTAATCAAGATTCCATT
B1
128 – 146
FCA 43*
F: GAGCCACCCTAGCACATATACC
R: AGACGGGATTGCATGAAAAG
C2
115 – 131
FCA 45*†
F: TGAAGAAAAGAATCAGGCTGTG
R: GTATGAGCATCTCTGTGTTCGTG
A1
140 – 158
FCA 77*†
F: GGCACCTATAACTACCAGTGTGA
R: ATCTCTGGGGAAATAAATTTTGG
C2
135 – 145
FCA 82*†
F: TCCCTTGGGACTAACCTGTG
R: AAGGTGTGAAGCTTCCGAAA
E1
257 – 279
FCA 105*†
F: TTGACCCTCATACCTTCTTTGG
R: TGGGAGAATAAATTTGCAAAGC
A2
179 – 197
FCA 126*†
F: GCCCCTGATACCCTGAATG
R: CTATCCTTGCTGGCTGAAGG
B1
113 – 137
FCA 132*†
F: ATCAAGGCCAACTGTCCG
R: GATGCCTCATTAGAAAAATGGC
D3
156 – 174
FCA 144*†
F: GGAAATCCTGGAAACTTCTGC
R: CCCGGCAAAATTATGAAGG
D1
166 – 202
FCA 261*†
F: CATCTCCATAATTGTGTGAGCC
R: AGGACTGTGTTTGCAATCTGG
D3
194 – 214
FCA 310*†
F: TTAATTGTATCCCAAGTGGTCA
R: TAATGCTGCAATGTAGGGCA
C2
115 – 135
HDZ 3§
F: GCATGGAGCCTGATTAAGATTC
R: TCCCCAAGAAGTGATACTAAGCA
UNK
242 – 256
HDZ 57§
F: CTACCTTTCTTTCACCTTCTTTTTG
R: TCGTGCGTTAGAGGAATTGG
UNK
86 – 94
HDZ 64§
F: ATGGTATTTGCCATTCTCTGAC
R: CAGATTTAATTGTGTGTAGTATATGAGC
UNK
126 – 160
HDZ 89§
F: GCATAAAACTCTAACACAGCATCT
R: TTCTGAAATAGGATTGGCAAA
UNK
213 – 223
HDZ 817§
F: TCAGATTCCAGACCCTCGTG
R: AGCCAGCCAGAAAGAGTTTATG
UNK
235 – 239
HDZ 859§
F: TGCCAAAAAAGGAACAGTCTC
R: CACCACCATTTCATCTTGTCC
UNK
262 – 326
* Menotti-Raymond et al. 1999.
†
previously used on clouded leopards (Buckley-Beason et al. 2006).
§
Williamson et al. 2002.
UNK = unknown.
21
Size range
[bp]
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Materials and Methods / Results
2. 4 Population structure analysis
A Bayesian clustering method as implemented in BAPS (Corander et al. 2003; Corander &
Marttinen 2006; Corander et al. 2006) was used to infer population structure based on
multilocus microsatellite genotype data. This programme estimates the hidden population
substructure by testing whether the allele frequencies between populations are significantly
different. A major advantage compared to most other methods is that the number of
populations is treated here as an unknown parameter. I performed 10 independent runs of
clustering of individuals with the microsatellite genotypes to ensure homogenous results. In
all runs I obtained similar results. After the clustering of individuals by their allele frequencies
the results were used to perform an admixture analysis. I used 500 iterations and a number of
1000 reference individuals per population each of them with 20 iterations. The estimated
admixture coefficient for an individual in each cluster q (maximum = 1) was used as a
measure of correct assignments. BAPS gives you the Bayesian p-value for each individual.
This tells you the proportion of reference individuals simulated from the population in which
the individual was originally clustered having the admixture coefficient to the cluster smaller
than or equal to the individual (Corander et al. 2006). Individuals having p-values larger than
0.05 are by default considered as having “non-significant” evidence for admixture (Corander
et al. 2006).
3. Results
3. 1 Mitochondrial DNA analysis
In addition to mitochondrial sequences from 11 clouded leopards sampled in this study I
included sequences of 58 clouded leopards (55 mainland south-east Asian and three Bornean
specimens) from Buckley-Beason et al. (2006) in my analysis. For outgroup comparison I
used sequences of Panthera species and Felis catus from Buckley-Beason et al. (2006).
GenBank accession numbers of those adapted sequences are given in Table 5 (Page 23).
A total alignment of all haplotypes was edited by MEGA 3 (Kumar et al. 2004) to show only
variable sites (Table 5 Page 23). The reference sequence was a mainland haplotype (NEB 1)
from Buckley-Beason et al. (2006). I found five new haplotypes among clouded leopards, in
addition to eight haplotypes described by Buckley-Beason et al. (2006). Of those
22
Chapter 1: Clouded leopard phylogeny
Results
Diplomarbeit
Andreas Wilting
23
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Results
Table 6 Estimates of molecular genetic variation in clouded leopards from combined
mtDNA sequences compared to values of other larger cat species.
No. of No. of Variable
No. of
Mean Number
sites
population
Pairwise
Length haplo- variable
[bp]
[%]
types
sites
-specific
Differences
± SD
sites
Nucleotide
diversity (π)
± SD
Species
N
Neofelis sp.
69
900
13
54
6
-
11.45 ± 5.25
0.012745 ± 0.006469
N. nebulosa
59
900
6
4
0.44
39
0.21 ± 0.58
0.000231 ± 0.000318
N. diardi
10
900
7
10
1.11
-
4.27 ± 2.29
0.004741 ± 0.002879
N. diardi (Borneo)
7
900
5
6
0.66
3
2.29 ± 1.41
0.00254 ± 0.001791
N. diardi (Sumatra)
3
900
2
1
0.11
1
0.67 ± 0.65
0.000741 ± 0.000911
Panthera pardus
69
727
33
50
8.18
-
8.67 ± 4.4
0.0121 ± 0.0062
P. p. orientalis
12
727
2
1
0.16
2
0.17 ± 0.24
0.0002 ± 0.0004
P. p. fusca
9
727
6
8
1.31
1
2.61 ± 1.54
0.0036 ± 0.0024
Panthera tigris
100
4,078
25
54
1.32
-
10.11 ± 4.66
0.00248 ± 0.00127
P. t. altiaca
13
4,078
1
0
0
4
0
0
P. t. corbetti
32
4,078
4
3
0.07
4
0.54 ± 0.46
0.000132 ± 0.000125
P. t. jacksoni
22
4,078
5
10
0.25
0
4.83 ± 2.45
0.00118 ± 0.00067
P. t. sumatrae
16
4,078
8
11
0.27
2
2.92 ± 1.62
0.00717 ± 0.00444
P. t. tigris
15
4,078
6
8
0.20
3
1.45 ± 0.93
0.000355 ± 0.000256
P. t. amoyensis
2
4,078
1
0
0
7
0
0
286
891
14
15
1.68
-
3.63
0.0032
87
891
11
11
1.23
-
2.10
0.003
186
891
2
1
0.11
1
2.1
0.0002
6
891
1
0
0
0
0
0
*
#
Puma concolor
§
South American
Puma
North American
Puma
Florida Puma
* From a combined analysis of mtDNA ND5(661 bp) and control region (116 bp) (Uphyrkina et al. 2001)
#
From a combined analysis of mtDNA ND1 (345 bp), ND2 (960 bp), ND5 (1139 bp) ND6 (443 bp) Cyt-b (555 bp),
12S (577 bp), COI (409 bp), and control region (250 bp) (Luo et al. 2004).
§
From a combined analysis of mtDNA 16S (382 bp), ATPase-8 (191 bp) and ND5 (318 bp) (Culver et al. 2000).
13 haplotypes in total N. nebulosa (N = 59) had six haplotypes (NEB 1 - 6), N. diardi
(Borneo, N = 7) had five haplotypes (DIB 1 - 5) and in N. diardi (Sumatra, N = 3) I found two
haplotypes (DIS 1 & 2) (Table 6). Quantitative estimates of mtDNA diversity in clouded
leopards with com-parable estimates from selected felids demonstrate that clouded leopards
24
Chapter 1: Clouded leopard phylogeny
Results
Diplomarbeit
Andreas Wilting
had high levels of mtDNA diversity in percent of variable sites, mean pairwise distance
among individuals, and average nucleotide diversity (π). There was a variable site every
17 bp, with 54 sites in the three mtDNA fragments (185 bp ATPase-8, 286 bp Cyt b and 426
bp control region). This value exceeds that which was observed in tigers (one variable site
every 75 bp) (Luo et al. 2004), but is comparable to values in leopards (one variable site every
15 bp) (Uphyrkina et al. 2001). Of those variable sites among clouded leopards, 39 were fixed
nucleotide differences between specimens from the islands of Borneo/Sumatra (N. diardi) and
specimens from the mainland (N. nebulosa) (Table 6 Page 24). There were 12 nucleotide
differences in the Cyt-b gene (4.2 %), 10 in the ATPase-8 gene (5.4 %) and 17 in the control
region (4 %). In comparison, three Panthera species (P. pardus, P. tigris and P. onca) were
separated by 38-52 nucleotide differences in the same fragment. Therefore the high level of
mtDNA diversity among clouded leopards was mainly a result of nucleotide differences
between mainland individuals and specimens from Borneo and Sumatra. MtDNA diversity
among N. diardi was also moderate to high, whereas separate analyses of the three clouded
leopard populations (Mainland, Borneo and Sumatra) revealed low nucleotide diversity (µ)
for mainland and Sumatran populations (mainland 0.000231, and Sumatra 0.000741), and
only the population from Borneo had a moderate nucleotide diversity (µ) of 0.00254 (Table 6
Page 24). Besides the fixed nucleotide differences between N. nebulosa and N. diardi I found
population specific sites in Bornean and Sumatran specimens (Table 6 Page 24). Four fixed
nucleotide differences distinguished individuals from Sumatra and Borneo.
Separate phylogenetic analysis for each of the three mtDNA gene fragments showed identical
topologies (Figure 4 a – c Page 26). Therefore, and because mitochondrial genes usually do
not recombine (Eyre-Walker & Awadalla 2001), sequences from each gene fragment could be
concatenated into 900 bp sequences (Huelsenbeck et al. 1996). Phylogenetic analysis of the
contiguous sequences using minimum evolution (ME), maximum parsimony (MP) and
maximum likelihood (ML) approaches produced congruent topologies that strongly support
the reciprocally monophyletic status of mainland individuals (N. nebulosa) and individuals
from the islands of Borneo and Sumatra (N. diardi) with high bootstrap values (100 %
ME/MP, 98 % ML) (Figure 5 Page 27). Furthermore, a geographic partition between
Sumatran individuals and Bornean clouded leopards were defined. This separation was
supported by high bootstrap values; except for the ME approach (46 % ME, 85 % MP, and
81 % ML).
25
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Results
Figure 4
26
Chapter 1: Clouded leopard phylogeny
Results
Diplomarbeit
Andreas Wilting
Figure 4 (Page 26) Phylogenetic relationship among clouded leopards from mtDNA haplotypes.
Phylogenetic relationship based on minimum evolution (ME) among the clouded leopard mtDNA haplotypes
from the mitochondrial sequences of (a) ATPase-8 (186 bp), (b) Cyt-b (286 bp) and (c) control region (426 bp)
gene fragments. Panthera samples and Felis catus samples were taken as outgroups. Trees constructed with
PAUP (Swofford 2001) obtained under maximum parsimony (MP) and maximum likelihood (ML) criteria
have identical topologies. Numbers above the branches represent bootstrap support (1000 replicates) for each
three methods (ME/MP/ML); only those with > 80 % are shown. Numbers in parentheses represent the number
of individuals sharing the same haplotype. We used Kimura 2-parameter distance with neighbor-joining (NJ)
algorithm followed by tree-bisection reconnection branch-swapping procedure (TBR) for the ME analysis. MP
trees were constructed using a heuristic search, with a random addition of taxa and TBR branch swapping. The
ML approach was performed using a HKY85 model (Hasegawa et al. 1985). Haplotype codes are shown in
Table 2 (Page 16). NEB 1 - 5, DIB 1 and 2, and outgroups have been described previously (Buckley-Beason et
al. 2006).
Figure 5
Figure 5 Phylogenetic relationship among clouded leopards from mtDNA haplotypes.
Phylogenetic relationship based on minimum evolution (ME) among the clouded leopard mtDNA haplotypes
from the concatenated 900 bp mitochondrial sequences comprising Cyt-b (286 bp), ATPase-8 (186 bp) and
control region (426 bp) gene fragments. Panthera samples and Felis catus samples were taken as outgroups.
Trees constructed with PAUP (Swofford 2001) obtained under maximum parsimony (MP) and maximum
likelihood (ML) criteria have identical topologies. Numbers above the branches represent bootstrap support
(1000 replicates) for each three methods (ME/MP/ML); only those with > 80 % are shown. Numbers in
parentheses represent the number of individuals sharing the same haplotype. We used Kimura 2-parameter
distance with neighbor-joining (NJ) algorithm followed by tree-bisection reconnection branch-swapping
procedure (TBR) for the ME analysis. MP trees were constructed using a heuristic search, with a random
addition of taxa and TBR branch swapping. The ML approach was performed using a HKY85 model (Hasegawa
et al. 1985). Haplotype codes are shown in Table 2 (Page 16). NEB 1 - 5, DIB 1 and 2, and outgroups have been
described previously (Buckley-Beason et al. 2006). * Sequences of only two mtDNA genes (ATPase-8 and
Cyt b) were included.
27
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Results
3. 2 Microsatellite analysis
Composite genotypes from 18 felid-specific microsatellite loci (Menotti-Raymond et al. 1999;
Williamson et al. 2002) were obtained from 11 clouded leopard samples (four mainland
specimens NNE 1 - 4, four Bornean specimens NDB 1 - 4 and three Sumatran specimens
NDS 1 - 3), two domestic cats (FCA 1 - 2) and one leopard (PPA 1). Of the 10 loci, which
were used before in clouded leopards (Table 4 Page 21), Buckley-Beason et al. (2006)
Table 7 Number and size ranges of observed alleles separating N. nebulosa and
N. diardi. For non-overlapping microsatellite markers the number of base pairs,
which separate the species are given. In N. diardi Sumatran and Bornean allele size
ranges were overlapping except for FCA 126.
Marker
name
Size range [bp]
N. nebulosa
Size range [bp]
N. diardi
Separation between the
species [bp]
FCA 8*†
6 (135 – 155)
6 (145 – 155)
overlapping
FCA 23
3 (142 – 146)
2 (128 – 130)
12
FCA 43
3 (115 – 119)
2 (129 – 131)
10
FCA 45
3 (148 – 156)
6 (140 – 158)
overlapping
FCA 77
5 (135 – 145)
2 (139 – 143)
overlapping
FCA 82†
3 (257 – 261)
4 (267 – 279)
6
FCA 105†
4 (179 – 185)
3 (193 – 197)
8
FCA 126
7 (113 – 137)
2 (113 – 115) Sumatra
3 (117 – 123) Borneo
overlapping
Sumatra – Borneo 2
FCA 132†
4 (168 - 174)
1 (156)
12
FCA 144†
1 (166)
4 (194 - 202)
28
FCA 261†
5 (194 - 214)
4 (198 - 204)
overlapping
FCA 310†
4 (115 - 119)
5 (127 – 135)
8
HDZ 3
5 (242 - 256)
3 (248 - 256)
overlapping
HDZ 57
1 (94)
2 (86 - 94)
overlapping
HDZ 64
3 (148 – 160)
4 (126 – 160)
overlapping
HDZ 89
3 (219 – 223)
4 (213 – 219)
overlapping
HDZ 817
2 (235 – 239)
2 (237 – 239)
overlapping
HDZ 859
6 (284 – 326)
4 (262 – 280)
4
†
had non-overlapping allele sizes between N. nebulosa and N. diardi in BuckleyBeason et al. (2006).
28
Chapter 1: Clouded leopard phylogeny
Results
Diplomarbeit
Andreas Wilting
showed that six microsatellite loci (FCA 82, FCA 105, FCA 132, FCA 144, FCA 261,
FCA 310) had non-overlapping allele sizes between N. nebulosa (mainland) and N. diardi
(Borneo). For only one of these six loci, FCA 261, non-overlapping allele-sizes could not be
confirmed by wider sampling of Bornean and Sumatran specimens (Table 7). Out of eight
microsatellite loci, which were not tested in clouded leopards before, three (FCA 23, FCA 43
and HDZ 859) did not overlap in allele sizes. Due to non-overlapping allele size ranges
between N. nebulosa and N. diardi the number of population specific alleles was very high in
the two species (N. nebulosa 70.1 %, and N. diardi 65.6 %) (Table 8). Bornean and Sumatran
populations had also high frequencies of private alleles, with 26 % and 34 %, compared to
values ranging from 1.4 % to 14.6 % in different tiger subspecies (Luo et al. 2004). However
it has to be considered that the low number of individuals in each population might cause a
higher number of private alleles, because genetic diversity in the populations was not
adequately sampled. Therefore the frequency of private alleles is less relevant. Overall
expected heterozygosity HE in clouded leopards ranged from 0.488 in the Bornean population
to 0.652 in N. nebulosa and exceeds the observed heterozygosity H0 in all three populations,
with Bornean specimens having the lowest observed heterozygosity H0 with 0.361 (Table 8).
Table 8 Measure of genetic variance among 18 microsatellite loci in clouded leopards. As
a diagnostic character of the three clouded leopard populations the number of
population-specific alleles is given.
Species
Expected
Observed
Average number Unique Alleles
Loci
N
heterozygosity heterozygosity of alleles / loci / No. of alleles
Typed
± SD
± SD
± SD
(%)
Neofelis sp.
11
18
0.743 ± 0.125
0.439 ± 0.223
6.056 ± 1.811
-
Neofelis nebulosa
4
16
0.651 ± 0.277
0.542 ± 0.292
3.722 ± 1.626
47 / 67 (70.1 %)
Neofelis diardi
7
16
0.56 ± 0.252
0.378 ± 0.253
3.556 ± 1.383
42 / 64 (65.6 %)
N. diardi (Borneo)
4
16
0.488 ± 0.241
0.361 ± 0.291
2.556 ± 0.896
12 / 46 (26.1 %)
N. diardi (Sumatra)
3
15
0.493 ± 0.267
0.407 ± 0.343
2.278 ± 0.870
14 / 41 (34.2 %)
Neighbor-joining analysis of individual clouded leopard genotypes based on two
microsatellite genetic distance estimators (Dps & Dkf) produced concordant topologies. Both
trees support the species distinction among clouded leopards (Figure 6). Individuals from
Borneo and Sumatra form a monophyletic clade with 100 % (Dps & Dkf) bootstrap support
(BS) distinguishing them from mainland specimens and the outgroups. The microsatellite
29
30
100
dps
NNE2
NNE1
FCA2
76
77/
0
/10
100
N. nebulosa
NNE3
NNE4
FCA1
Felis catus
NDS2
99/99
NDS3
PPA1
NDB1
N. diardi
(Sumatra)
NDS1
NDB4
N. diardi
(Borneo)
NDB2
NDB3
Panthera pardus
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Results
Figure 6
Chapter 1: Clouded leopard phylogeny
Results
Diplomarbeit
Andreas Wilting
Figure 6 (Page 30) Phylogenetic relationship among the individual clouded leopards from
composite microsatellite genotypes of 18 loci.
Trees are based on the proportion of shared alleles (Dps) and kinship coefficient (Dkf) genetic distances with
1 - (kf/ps) option in MICROSAT (Minch et al. 1995) produced identical topologies. Dps tree is shown here.
Bootstrap values over 70 % are shown on the divergence node (Dps/Dkf). One Panthera pardus sample and two
Felis catus samples were included as outgroups. Branches of the same colour represent individuals from the
same geographical region. ID codes are shown in Table 2 (Page 17).
analysis lends further support to the phylogeographic subdivision observed in mtDNA
analysis between Borneo and Sumatra individuals, however with lower bootstrap support
values (Sumatra clade with 69 % Dps / 61 % Dkf BS, and Borneo clade with 50 / 46 % BS).
3. 3 Population substructures
To evaluate population distinctiveness I tested the microsatellite data using a Bayesian
algorithm as implemented in BAPS version 4.14 (Corander et al. 2003). To estimate hidden
substructures, within clouded leopards BAPS suggested to partition the clouded leopards into
five populations (p > 0.99) three different mainland populations, Sumatra and Borneo.
However mtDNA results and previous analysis based on a broader sampling, including more
microsatellite loci found no substructure among mainland populations (Buckley-Beason et al.
2006). Therefore I assume that the population partition within my four mainland individuals is
NNE2
NNE3
NNE4
N. nebulosa
NNE1
NDB1
NDB2
NDB3
N. diardi (Borneo)
NDB4
NDS2
NDS3
NDS1
N. diardi (Sumatra)
Figure 7 Bayesian analysis of microsatellite genotypes.
Coloured bars are from the Bayesian admixture analysis of the microsatellite analysis. Different colours stand
for different genetic groups. Admixture analysis was conducted with BAPS (Corander et al. 2003; Corander &
Marttinen 2006; Corander et al. 2006). After clustering of individuals by their allele frequencies the results were
used to perform an admixture analysis. I used 500 iterations and a number of 1000 reference individuals per
population each of them with 20 iterations. ID codes are shown in Table 2 (Page 16).
31
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Results
a result of the small sampling size and thus set a maximum of three populations. BAPS then
grouped all mainland, Sumatra, and Borneo individuals together, respectively (p = 1). I
confirmed the individual assignments to each population with admixture analysis in BAPS
(Corander & Marttinen 2006; Corander et al. 2006). In this scenario all individuals were
assigned to three unique clusters N. nebulosa, N. diardi (Borneo) and N. diardi (Sumatra)
with very high admixture coefficients (all q > 0.98, except for one Sumatran individual
(NDS1) q > 0.95) (Figure 7 Page 30). No individual had a Bayesian p-value less than 0.05
(all p > 0.91) revealing no evidence of admixed background and none or very low degrees of
past and present gene flow between all three populations.
Figure 8 shows the new classification of clouded leopards, which I would suggest on the basis
of my molecular analysis.
Figure 8 New classification
of
clouded
leopards
suggested based on own
molecular analysis and data
obtained from BuckleyBeason et al. 2006 and
Kitchener et al. 2006.
3. 4 Estimation of the coalescence time of genetic variations in clouded leopards
MtDNA sequence differences were used to estimate the divergence time of N. nebulosa and
N. diardi and the time of origin of Sumatran clouded leopards. The molecular clock test
implemented in LINTREE (Takezaki et al. 1995) showed that sequences did not deviate
significantly from the rate constancy test (p > 0.05), suggesting that the divergence of mtDNA
32
Chapter 1: Clouded leopard phylogeny
Results / Discussion
Diplomarbeit
Andreas Wilting
sequences were compatible with a molecular clock hypothesis. Thus, all sequences were used
to construct the linearised tree. Based on a calibration of 6.37 mya for the divergence of
clouded leopards from the Panthera lineage (Johnson et al. 2006) I estimate that N. diardi
diverged from N. nebulosa about 2.86 mya ago (95 % CI of 1.71 - 4.02 mya) and Sumatran
and Bornean clouded leopards diverged about 437,000 years ago (95 % CI of
30,000 - 845,000 years ago).
4. Discussion
My results strongly support the recent reclassification of extant clouded leopards into two
distinct species N. nebulosa and N. diardi. The observed high levels of mtDNA diversity in
clouded leopards were primarily a consequence of a high number of nucleotide differences
between the two species. Based on mtDNA data clouded leopards on the islands of Sumatra
and Borneo have been reproductively isolated from the mainland species since middle to late
Pliocene (~ 2.86 mya). I am aware that recent studies show that mtDNA is least robust in
node resolution (Johnson et al. 2006), which might lead to an overestimation of my calculated
length of separation time. Previously estimated divergence time of 1.41 mya between
N. nebulosa and N. diardi (Buckley-Beason et al. 2006) is still within the same range (1 - 3
mya) as species level distinctions across Panthera (Johnson et al. 2006). The mtDNA
distinction was supported by phylogenetic analysis of composite microsatellite genotypes that
also assorted individuals into the two species. The wider sampling of Bornean individuals
dispels the doubt that the high distinction between N. nebulosa and N. diardi described before
was only a consequence of inadequate sample size (Buckley-Beason et al. 2006). Referring to
their origin on two Sunda Islands, I would propose to give N. diardi the common name
“Sundaland clouded leopard” (Figure 8 Page 32).
Furthermore, the consistent results of mtDNA and microsatellite data provide an evidence for
a reduced gene flow between the islands of Borneo and Sumatra. Therefore, I suggest the
recognition of two distinct subspecies of N. diardi, considering previous criteria for the
designation of subspecies (Avise & Ball 1990; O'Brien & Mayr 1991) (Figure 8 Page 32). I
estimated that since the middle to late Pleistocene Bornean and Sumatran clouded leopards
were most likely isolated from each other and supposedly unable to move freely between the
islands. However, it has to be considered that my sample size of Sumatran specimens is small
33
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Discussion
and further molecular genetic and morphological studies will be needed to confirm my
findings. The reduction of observed heterozygosity (0.439 compared to an expected
heterozygosity of 0.743) within Neofelis lends further support for a geographical barrier
between N. nebulosa and N. diardi followed by genetic drift of the populations. The effect of
a reduction in heterozygosity caused by population substructures is called Wahlund effect
(Maynard Smith 1998). This effect can also be observed in N. diardi, where the observed
heterozygosity with a value of 0.378 is reduced compared to an expected heterozygosity of
0.560. This fact supports a hypothesised disconnection of gene flow by geographical barriers
between clouded leopard populations on the Islands of Borneo and Sumatra.
The degree of mtDNA diversity for the mainland population only (N. nebulosa;
µ = 0.000231), was lower than that reported for other cat species, such as leopards
(µ = 0.0121; Uphyrkina et al. 2001), tigers (µ = 0.00248; Luo et al. 2004) and mountain lions
(µ = 0.0032; Culver et al. 2000). The genetic diversity was more comparable to that reported
in recognised subspecies of the other cat species (Table 6 Page 24). It has to be considered
that the presented mtDNA diversity estimates cannot be directly compared to other felids,
because data on the equivalent gene segments is unavailable for other cat species and different
genes are know to evolve with different substitution rates (e. g. Pesole et al. 1999). However,
the reduced mtDNA diversity even compared to populations on Borneo and Sumatra is
remarkable and might be a hint for a recent bottlenecking among mainland clouded leopards,
but larger geographic sampling is needed to confirm this hypothesis. In tigers molecular
analysis revealed that the Pleistocene centrum of radiation is located within northern
Indochina and southern China (Luo et al. 2004), and on the basis of our data this could also be
the case for N. nebulosa. However, a larger geographic sampling is necessary to test the
hypotheses of a recent bottlenecking as well as the location of the Pleistocene centrum of
radiation.
The mtDNA diversity among N. diardi was higher than the comparable measures for
N. nebulosa, mainly due to nucleotide differences between Sumatra and Borneo. Bornean
mtDNA diversity exceeds the one in Sumatran specimens, but conclusions about the origin of
“Sundaland clouded leopards” cannot be drawn without a broader sampling.
In this study I presented a very interesting aspect of clouded leopards' evolutionary history.
The wider sampling of Bornean and the inclusion of Sumatran samples provide more
34
Chapter 1: Clouded leopard phylogeny
Discussion
Diplomarbeit
Andreas Wilting
confidence that Bornean and Sumatran animals were reproductively isolated from the
mainland individuals even during glaciation periods in the Pleistocene with accompanying
low sea levels and postulated land bridges. Therefore, I cannot support the hypothesis of one
geographical unit for the clouded leopard, because clouded leopards were most probably not
able to mix genetically across available land-bridges since the middle to late Pliocene. Our
data indicate that the clouded leopard had a deep history of vicariant evolution, comparable to
other forest dwelling species (Brandon-Jones 1996 for Asian Colobinae; Gorog et al. 2004 for
murine rodents; Warren et al. 2001 & Steiper 2006 for orang-utans).
In contrast to mainland individuals “Sundaland clouded leopards” were able to move
throughout the exposed shelf between Borneo and Sumatra at least once during the early or
middle Pleistocene. During the late Pleistocene clouded leopards seemed to be unable to mix
across the available land bridges. Therefore present-day distribution patterns, exemplarily
shown here for the clouded leopard, indicate that dispersal was restricted and there appeared
to have been considerable barriers for animal migrations (Hewitt 2000; Voris 2000; Inger &
Voris 2001). A wider sampling in this study, in addition to previous studies (Buckley-Beason
et al. 2006; Kitchener et al. 2006), have provided a better insight into phylogeographic history
of one of the least known cat species in south-east Asia.
Management implications
My genetic results have several implications for the conservation and management strategies
for clouded leopards. N. nebulosa and N. diardi should be managed separately, and treated as
different species as suggested before (Buckley-Beason et al. 2006; Kitchener et al. 2006).
Furthermore, on the basis of the population division between Bornean and Sumatran clouded
leopards I suggest that these populations should also be managed separately. Considering
previous criteria for the designation of evolutionarily significant units (ESU) (Ryder 1986;
Waples 1991 and 1995; Avise 1994; Crandall et al. 2000; Fraser & Bernatchez 2001),
Bornean and Sumatran clouded leopards should be treated as different conservation units with
separate management plans. Both populations are on the one hand reproductively isolated
from each other and monophyletic for mtDNA and microsatellites and on the other hand
Bornean and Sumatran individuals represent an important component of the evolutionary
legacy of the species. Waples (1995) pointed out that this represents the reservoir upon which
future evolutionary potential depends.
35
Diplomarbeit
Andreas Wilting
Chapter 1: Clouded leopard phylogeny
Discussion
The continued depletion of tropical rainforests and fragmentation of natural habitats in
Borneo and Sumatra put the reclassified species N diardi under severe pressure of extinction
(Santiapillai & Ashby 1988). Therefore, a higher priority should be placed on effective
conservation of “Sundaland clouded leopards” and their shrinking habitats. Further research is
urgently needed to reveal the distribution and status of different species in situ, because
smaller distribution ranges associated with reduced gene pools of the reclassified species put
clouded leopards under a greater risk of extinction. The current IUCN Red Data category
“vulnerable” (IUCN 2006) might underestimate the actual threat these cats are facing and a
new assessment of N. nebulosa and N. diardi taking into account the different populations on
Borneo and Sumatra is desperately needed.
36
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Introduction
Chapter 2
Reclassified and what now? Some insights into the
ecology of “Sundaland clouded leopards” from Tabin
Wildlife Reserve; their distribution and conservation
needs in Sabah, Malaysia
1. Introduction
Many large carnivores are under severe threat from permanent loss of suitable habitat as well
as direct persecution, making their protection a top conservation priority. Detailed
management plans are a prerequisite for their effective conservation. These plans need to be
based on information regarding the ecology of species as well as the status and health of the
population. Hence, reliable methods providing accurate data on abundance, population trends
and threats are of extreme importance. However, for many carnivores basic information on
life history parameters and population ecology is still lacking. This shortcoming is a
significant challenge for wildlife managers (Weber & Rabinowitz, 1996). In the recent past,
most studies on large carnivores applied radio telemetry and camera trapping to estimate
home range sizes and densities. (e. g. Karanth et al., 2004; Grassman et al., 2005). These
methods, however, are very costly, time consuming, labour intensive and require experienced
investigators. In the case of radio telemetry individuals have to be captured and tranquilised
with all problems and risks associated. Many carnivores show a secretive behaviour making it
an extremely difficult task to capture a sufficient number of individuals. In remote
mountainous areas or in dense forests extensive logistic assistance may be required that can
be too costly for a conservation programme. For example Grassman et al. (2005) were only
able to capture one marbled cat, two Asian golden cats (Catopuma temminckii) and four
clouded leopards in a four years lasting study on wild felids in Thailand.
Non-invasive methods
The value of simpler methods such as track counts is often underestimated, even though
recent studies have shown the power of such techniques (Smallwood & Fitzhugh 1993;
Riordan 1998). So far sign surveys were mostly used to determine species distribution (e. g.
37
Chapter 2: Clouded leopard ecology
Introduction
Diplomarbeit
Andreas Wilting
Schaller & Crawshaw 1980 for felids; Macdonald & Mason 1982 for mustelids) or relative
abundances of most carnivore groups (e. g. Crête & Messier 1987 for gray wolf Canis lupus;
Stander 1998 for leopard, lion and wild dog Lycaon pictus; Kendall et al. 1992 for grizzly
bear Ursus arctos). With repeated sampling over long time periods those relative indices can
be used to monitor population trends (Gese 2001). However, a technique described by
Smallwood and Fitzhugh (1993) showed that individual mountain lions can be identified and
distinguished by their tracks only. By this discrimination of individuals track surveys would
become valuable non-invasive methods to determine the absolute abundance of a population
of interest. Other methodological studies on felids affirm the feasibility of the rigorous track
classification method (Riordan 1998; Grigione et al. 1999; Lewison et al. 2001; Sharma et al.
2005). This approach allows inventorying and monitoring carnivores at low costs and with
relatively little effort (Grigione et al., 1999). In this study I applied this method to a small
population of “Sundaland clouded leopards”.
The application of non-invasive genetic sampling to study carnivores became more popular
during the last ten years due to methodological improvements in DNA-isolation and PCR,
which allow the use of hair and feces as source of DNA. So called “hand-off” genetic
sampling methods are of particular interest for conservation biology and ethology, because
these genetic studies can be initiated without having to capture, disturb or even observe the
animal. However, technical difficulties like genotyping errors were described in using hair
and feces (Gerloff et al. 1995; Taberlet et al. 1996; Goossens et al. 1998; Mills et al. 2000)
explaining the fact that only a few comprehensive studies have been published to date (Woods
et al. 1999; Kohn et al. 1999; Ernest et al. 2000; Lucchini et al. 2002; Wilson et al. 2003;
Perez et al. 2006). Beside these technical problems sampling of feces and hair often
represents a challenging difficulty in studying secretive carnivores. Scats can only be
collected along roadways or clearings and only of those species travelling there, because most
probably inside dense forested habitats the detection of a sufficient number of scats is
impossible. To bypass this problem scent station surveys are commonly applied. While these
can be utilized for indexing carnivore abundances, they can also be applied to obtain hairs as a
source of DNA for molecular analysis (Lorenzini et al. 2004; Frantz et al. 2004). Scentstation surveys involve attracting individuals by scent-lures. Studies on several felids revealed
that cats get attracted by baits and rub their bodies against the station losing some hairs (Hill
et al. 1976; McDaniel et al. 2000; Schmidt & Kowalczyk 2006).
38
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Introduction
Beside the problems associated with non-invasive genetic sampling, hairs and feces may
represent the only mean to gather genetic information, if capturing animals entails too much
risk for an endangered carnivore population or funding is limited.
Scent marking
In mammals intraspecific chemical communication plays an important role in ensuring
reproductive success, maintaining social and spatial organization and partitioning of resources
(Ralls 1971). Several studies focused on the function of scent marking behaviour especially in
solitary felids (Seidensticker et al. 1973; Whittle 1981; Smith et al. 1989; Naidenko &
Serbenyuk 1995; Molteno et al. 1998; Okamura et al. 2000). Urine spraying, and in certain
species defecation, are very important for chemo-communication between conspecifics within
the Felidae (Macdonald 1980). Whereas there is plenty of information on scent marking in
larger felids in savannas and subtropical forests, little is known about similar behaviours of
cats living in dense tropical rainforests. So far there is no published report on any kind of
scent marking behaviour in clouded leopards.
Status and behaviour of “Sundaland clouded leopards”
Even though the “Sundaland clouded leopard” is the largest cat on Borneo, very little is
known about their status and behaviour in situ. Owing to its highly secretive nature, this cat is
rarely encountered. To date no comprehensive study on “Sundaland clouded leopards” has
been conducted on Borneo and therefore all available information is based on questionnaires,
interviews and anecdotal reports of sightings (Rabinowitz et al. 1987). Rabinowitz et al.
(1987) concluded over 20 years ago, that “Sundaland clouded leopards” seemed not to be in
imminent danger of extinction in this part of Borneo. However, due to ongoing deforestation
and logging this may have changed. The only known fact is that large tracts of their habitats
are shrinking and many of the remaining forest areas might be too small to ensure the longterm persistence of clouded leopard populations.
On Sumatra between 65 % and 85 % of the lowland forests disappeared already caused by
clearing for agricultural requirements (Whitten et al. 1984). Between 2000 and 2002, 1.3
million ha forest vanished each year on Borneo and, based on conservative estimation, by
2020 only one third of the forests and presumably no lowland tropical rainforests outside
protected areas will remain on Borneo (Holmes 2000; Jepson et al. 2001; Fuller et al. 2004;
Curran et al. 2004).
39
Chapter 2: Clouded leopard ecology
Introduction / Methods
Diplomarbeit
Andreas Wilting
This rapid loss of suitable habitat necessitates effective monitoring and management measures
of “Sundaland clouded leopards”.
The recent taxonomic splitting of clouded leopards into two species and the suggestion for a
further subdivision of N. diardi into two distinct subspecies of this thesis make the already
rare clouded leopards even more threatened. Therefore research and conservation efforts on
behalf of these subspecies are of even greater importance.
Main goals
Specific goals of the field work in Tabin Wildlife Reserve were to:
1.
investigate the feasibility of different non-invasive techniques to monitor
carnivore populations in tropical rainforests. Molecular scatology, hairtrapping for genetic analysis and a rigorous track classification method were
tested in the field.
2.
refine and develop a reliable and cost-effective monitoring technique that
could be widely transferred to other protected areas and to other species.
3.
determine the local population density of “Sundaland clouded leopards” in
my study site.
4.
extrapolate the local results to a landscape level to draw inferences on the
distribution of clouded leopards region-wide.
5.
contribute to the knowledge of the ecology and behaviour of “Sundaland
clouded leopards”.
Ultimate goals of the study were to be conducive to fill a tremendous knowledge gap on
“Sundaland clouded leopards” and to give a first status assessment for the Malaysian state of
Sabah.
2. Methods
2. 1 Study area
The fieldwork was carried out in Tabin Wildlife Reserve (Tabin or TWR) (5°10’-5°15’N,
118°30’-118°45’E), a 1,205 km² protected area in the eastern part of the Malaysian State of
Sabah in north-eastern Borneo (Figure 9 Page 41). Tabin is a near-rectangular forest reserve,
officially gazetted as a Wildlife Reserve in 1984 (Payne 1986; Sale 1994). The reserve is
40
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Methods
Figure 9 Location of Tabin Wildlife Reserve and the study site in south-east Sabah, Malaysia.
Sabah’s largest and oldest wildlife reserve (Payne 1986; Sale 1994) and currently managed by
the Sabah Wildlife Department and the Sabah Forestry Department. A gravel road running
north to south forming the western boundary separates the forest reserve from the adjacent oil
palm (Elaeis guineensis) plantations. This road is the main access road to Tabin and
Tomanggong (a village located north of the reserve) from the nearest town, Lahad Datu,
which is located approximately 50 km south-west of Tabin.
Excluding a so-called core area and seven smaller Virgin Jungle Reserves (VJRs), all other
areas of Tabin (more than 80 % of the reserve) have been selectively logged between
1969 - 1989 (Sale, 1994; Ecotone Management, 1998). Except these patches (totally
encompassing about 100 km²) and Sepilok Orang-utan Reserve, extreme lowland dipterocarp
forest (< 200 m) had been logged and replaced by plantations or grasslands all over Sabah
(Sheldon et al. 2001). Most of the remaining dipterocarp forest is located in upland and
highland areas away from the coast (Sheldon et al. 2001).
41
Chapter 2: Clouded leopard ecology
Methods
Diplomarbeit
Andreas Wilting
In Sabah, selective logging typically involves felling and extraction of large (at least > 120 cm
girth, but usually > 180 cm girth) commercially valuable tree species by bulldozer-type
tractors (Davies & Payne 1982; Marsh & Greer 1992). Although only 3 - 7 % of the trees are
felled, over 50 - 80 % of smaller trees (< 90 cm girth) are destroyed or damaged by logging or
by building access roads for transporting logs (Lamber 1992; Marsh et al. 1996). Since 1989
no legal logging has taken place in Tabin (Malim & Maryati, 1999), but illegal logging has
been reported from various areas, latest reports in the southern part of the reserve in spring
2005 (Sabah Wildlife Department (SWD) pers. comm.).
All old logging roads running through TWR are deteriorated and can now only be followed on
foot. TWR is surrounded by oil palm plantations on its southern, eastern and western
boundaries (Figure 10). The north-east is bordered by mangrove forest and the north-western
side is flanked by a mix of
forest and oil palm plantations.
In March 2003 a 3,640 ha large
wildlife
corridor
between
TWR and Kulamba Wildlife
Reserve (Figure 11 Page 43)
was
proposed
International
(Japan
Cooperation
Agency (JICA) & SWD pers.
comm.). This area consists
mostly of freshwater swamp
forest around Sungai Segama Figure 10 Southbound road separating Tabin Wildlife Reserve
from a delimitated oil palm plantation in the southern part of
(Sungai: Malay for river).
the research area. Photograph adapted from Google Earth
2007.
Topography and soils
Tabin Wildlife Reserve consists of moderate undulating terrain ranging from 80 - 571 meters
above sea level. Mount Hatton (571 m) forms the highest peak. Most areas are dominated by
small hills divided by ravines and steep slopes with angles of up to 45 degrees. The northeastern part of Tabin is mainly flat and swampy whereas the north-western corner consists of
limestone formations (Sale 1994).
42
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Methods
Figure 11 Satellite image
showing Tabin and Kulamba
Wildlife Reserve and the
proposed wildlife corridor
between the two reserves.
The scene is a Landsat 7
ETM+ number P116 and
R056 showing band 3 / 2 / 1
(Date 09/12/2001). Image
adopted from the U.S.
Geological Survey (USGS).
There is an extensive network of waterways which drains the reserve. Larger rivers such as
Sungai Tabin and Sungai Lipad are perennial whereas smaller streams only contain
mentionable water levels after heavy rainfalls and during the wet season (Høybye-Mortensen
2004). All rivers head from the reserve to the adjacent oil palm plantations and therefore no
pollutants are carried by surface water into TWR (Høybye-Mortensen 2004).
The parent rock throughout Tabin consists of sandstones and mudstones (Payne 1986). There
are several mud-volcanoes and mineral rich springs scattered around TWR. These mudvolcanoes are visited by a diversity of wildlife on a regular base since it provides them with
essential minerals particularly sodium, manganese and calcium (Dalimin & Ahmad 1999).
Climate
Sabah is located close to the equator and possesses a relatively constant tropical climate.
Although rain is regular and frequent throughout the year, rainfall patterns are influenced by
the Indo-Australian monsoon system, which leads to northern winds from November to
March and south-western winds from May to October (Walsh 1996). The northern winds tend
to soak the east coast (including Tabin) having less effect on the west coast due to the Crocker
Range rain shadow (Walsh 1996). The south-west monsoon has the opposite, though
generally weaker, effect (Walsh 1996). Sabah lies within the area affected by El Niño
Southern Oscillation (ENSO) events, which leads to droughts in south-east Asia. In the past,
Bornean rain forests recovered easily from these droughts, because of the protection of the
43
Chapter 2: Clouded leopard ecology
Methods
Diplomarbeit
Andreas Wilting
understory provided by the primary forest canopy. However, since the advent of large-scale
logging, droughts have had a more devastating effect leading to a higher susceptibility to
forest fire (Beaman et al. 1986; Woods 1989; Siegert et al. 2001; Van Nieuwstadt & Sheil
2005).
There are no current climatic data for Tabin, caused by problems with the weather station in
Tabin station, but data from the 1990 to 1997 indicate a mean annual rainfall of about
3000 mm. Monthly rainfall ranged from 41.3 mm (February 1992) to 700.6 mm (December
1993). Humidity is high throughout the year and the mean annual humidity in 1988 was
82.9 % (Ecotone Management 1998). The mean monthly temperature in the shade between
1990 and 1997 did not fall below 26.6°C and did not exceed 28.3°C (Ecotone Management
1998). Along roads (north-south road and core area road), which are exposed to the sun
during daytime humidity drops below 40 % on sunny days and temperature rises above 50°C
with surface temperatures of up to 60°C (pers. obs.).
Flora
Sabah features some of the most diverse and spectacular forests in the world (Whitmore
1984). The old lowland forests of eastern Sabah are dominated by large hardwood species of
Dipterocarpaceae e. g. Dipterocarpus sp. and Shorea sp. (Whitmore, 1984). These trees have
high commercial value and thus have been extensively logged in TWR over many areas (Sale
1994). This has dramatically changed the face of Tabin. Typically, pioneering species have
taken over after removal of commercial timber. Such species include Macaranga sp. and
Mallotus sp. of the Euphorbiaceae family (Whitmore 1998). Due to the dominance of these
fast growing colonizing trees in secondary growth, canopy height generally does not exceed
25 - 30 m and is relatively open with the lower strata being very dense. This kind of plant
community slows down the regeneration of the forest by shading out slower growing
Dipterocarpaceae. In places where the forest has been totally damaged from clear-cut
practices or along logging roads, the vegetation is dominated by Leguminosae, Rubiaceae,
Euphorbiaceae and Zingiberaceae (Sale 1994).
Only the VJRs and the core area exhibited little anthropogenic disturbance and can be
classified as “pristine” or “primary” forests showing an original tree composition. There, the
main canopy reaches heights of 25-45 m and emergents grow up to 60-80 m high (Mitchell
1994). Today TWR is a mosaic of forest types in different succession stages.
44
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Methods
Fauna
A main reason for TWR being declared a wildlife reserve is its faunal diversity. Tabin plays
an important role as a dedicated ground for conservation of protected mammals in Sabah.
Tabin is home to three endangered big mammals, the Borneo pygmy elephant (Elephas
maximus borneoensis), only recently shown to be a subspecies of the Asian elephant
E. m. maximus (Fernando et al. 2003), the Sumatran rhinoceros (Dicerorhinus sumatrensis
harrissoni) and the Tembadau or Banteng (Bos javanicus lowi) an indigenous wild ox. The
subspecies of those herbivores are endemic to Borneo.
It is estimated that TWR holds a stable population of 250 - 300 elephants (Sale, 1994) and
about 15 Sumatran rhinoceroses (SOS Rhino, pers. comm.). Especially the Sumatran
rhinoceros arouse public interest as TWR is one of the last places on earth with a potential
viable population of this highly endangered species. Besides these big mammals a variety of
primates such as orang-utans, Bornean gibbons (Hylobates muelleri), langurs (Presbytis sp.),
macaques (Macaca sp.) and slow lorises (Nycticebus coucang) are frequently spotted. So far,
81 species of mammals have been identified within the reserve (Ambu & Abu Bakar 2004),
including 18 species of carnivores. In total 220 bird species of 42 different families are listed
for Tabin at the moment (SWD pers. comm.). These numbers have to be taken as preliminary
as only limited research activities have taken place in TWR. For reptiles, amphibians and
other classes little or no research has been conducted and those checklists are even more
incomplete.
2. 2 Main Research Area
The study site was located adjacent to the Tabin field station on the western boundary of the
reserve extending 12 km along the north-south road and another 6 km east and west along an
old logging road (Figure 12 Page 46). The research area encompassed mostly secondary
growth, but also the Lipad VJR (11 km²) including the Lipad mud-volcano (Figure 13
Page 47). The study area is gently undulating at an elevation of about 120 m above sea level.
The main river is the Lipad river with several streams flowing into it.
The following reasons supported the selection of this area:
•
Questionnaires of senior rangers at the Wildlife Department and of tourist guides
at the adjacent wildlife resort reveal the presence of clouded leopards.
45
Chapter 2: Clouded leopard ecology
Methods
•
Diplomarbeit
Andreas Wilting
The study area encompasses the main habitat types, which occur in and around
Tabin, mainly disturbed secondary forest. This habitat is more representative for
forests in Sabah than the small remains of pristine forest.
•
Within the research area are various jungle trails, streams and roads, which were
believed to serve as travel routes for clouded leopards.
•
The resort conducts almost daily night drives, which were used for spotlight
surveys.
•
Tabin station best satisfied the logistic needs and constraints of this study.
Figure 12 Main research area in Tabin Wildlife Reserve. The location of the
track sets (TS) and sightings of “Sundaland clouded leopards” are indicated.
46
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Methods
Figure 13 Lipad mud volcano,
located approximately 2 km north
of Tabin station in Tabin Wildlife
Reserve (see Figure 12).
Determining the size of the area surveyed
An existing road, trail and stream system was used for all tracking operations. This method
promised to be more successful than a square-based area approach with a straight transect
grid, because large cats are likely to travel on existing paths (Rabinowitz et al. 1987; Mills
1997; Wilson & Delahay 2001; Henschel & Ray 2003). A buffer was created around each
transect to estimate the size of the surveyed area as accurately as possible. To calculate the
buffer width, ecological factors of the target species were required (Wilson & Anderson,
1985). Recent studies on tigers use the distance moved by individuals between two photorecaptures to calculate this parameter (Karanth & Nichols 1998; Kawanishi & Sunquist 2004).
However, Soisalo and Cavalcanti (2006) recently pointed out that, due to an underestimation
of the distance moved by the animals, the calculations might overestimate the true densities.
In contrast, other studies use functions of home range size, density and trap spacing to
calculate the buffer width (Wilson & Anderson, 1985). To overcome these uncertainties I
considered both approaches and designed the following equation to determine the buffer
width W in my study:
W =
C
+ x(M )
2
2
(1)
where C is the core area of home range sizes and x (M) is the average daily movement. Values
for C (C = 6 km²) and M (M =1.932 km) were obtained from Grassman et al. (2005) in Phu
Khieo Wildlife Sanctuary, Thailand, since there were no data available of these parameters
from Borneo. I preferred to use the core area instead of the total home ranges to calculate the
47
Chapter 2: Clouded leopard ecology
Methods
Diplomarbeit
Andreas Wilting
size of the area surveyed, owing to the fact that long distances travelled by large cats may
increase the total home range size significantly.
The north-south road forms the boundary separating TWR from the adjacent oil palm
plantations. A buffer calculated by equation 1 would have overestimated the surveyed area,
because it would have included the nearby plantations which do not constitute suitable habitat
for clouded leopards (SWD pers. comm.). Although clouded leopards were observed entering
plantations in Borneo (SWD pers. comm.; pers. obs.), presumably following their prey, they
were never seen deeper than 300 m inside oil palm plantations (SWD pers. comm.; pers.
obs.). Thus it was assumed that a smaller buffer width of 300 m to the west of this road
transect would be adequate to describe the survey area.
2. 3 Data collection
Transect surveys
During March and August 2005, eight transects crossing different habitats were established
and each transect was surveyed 20 times. In addition to two transects along the gravel road
and one along the old logging road towards the reserve’s centre, two transects followed
existing jungle trails and three transects followed streams. The total length of all transects was
approximately 35 km. Every 250 m a GPS coordinate was taken and a digital map showing all
transects was produced using the programme ArcGIS 9.1 (ESRI Inc.) (Figure 12 Page 46)
These transects were used for the collection of feces left by clouded leopards and for the track
surveys.
I only collected carnivore scats with a diameter above 18 mm assuming that clouded leopard
droppings would have a larger diameter. Suitable faecal samples were ethanol-preserved at a
4:1 ratio by volume (12 ml ethanol p. a.: 2 - 3 ml feces) as suggested by Murphy et al. (2002).
Alcohol stops degradation of DNA immediately, which otherwise is a serious problem in hot
and humid environments.
My sampling unit for clouded leopard tracks was a track-set (TS) (Figure 14 a), defined as
one or more contiguous pugmarks from any paw made by the same clouded leopard. Tracks
were photographed with a digital camera (4 mega pixel, Nikon Coolpix 4300). An umbrella
was used to adjust the light conditions. A scale was placed on two sides of the track to
standardize measurements (Figure 14 b). Only tracks in good condition with clear edges and
48
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Methods
in flat terrain were included in the analysis to ensure accurate measuring. GPS coordinates
were taken of each track-set and later digitized in ArcGIS 9.1 (ESRI Inc.).
a)
b)
Figure 14 a) Track-set and made by a
“Sundaland clouded leopard” along the old
logging road in Tabin Wildlife Reserve,
Sabah, Malaysia (Date 06/09/2005). 14 b) Left
front (bottom) and left rear (top) tracks of
this track-set.
Scent stations
Along each transect every 500 m a scent station was placed next to the road, stream or trail.
Scent stations were usually fixed on small trees, approximately 50 cm girth, of different tree
species, to exclude a repulsive effect of one particular tree species. First boles were modified
about 50 cm above the ground with a wire brush to roughen the bark to ensure that hair gets
snagged at the tree. Within this rough area four to five holes were drilled in the tree, and filled
with different scent lures. I always used a mix of catnip (Nepeta cataria) powder (Armitage
Pet Care, Nottingham, UK; and GimPet, Emmerich, Germany) and valerian roots (Valeriana
officinalis) (Krautrausch, Berlin, Germany), since it has been known for a long time that
odours of these plants attract cat species (Todd 1962; Palen & Goddard 1966; Hatch 1972;
Hart & Leedy 1985; Bland 1979; Childers-Zadah 1998). During preliminary studies in two
Zoos (Duisburg and Wuppertal) these lures proved to be very attractive to captive clouded
leopards. After carpet tiles, baited with odours, were fixed in the enclosures clouded leopards
rapidly started to sniff at the carpet squares. Checkups after a few days revealed that clouded
49
Chapter 2: Clouded leopard ecology
Methods
Diplomarbeit
Andreas Wilting
leopards scratched at the carpets and rubbed their bodies against them, leaving some hairs.
Besides valerian and catnip, urine or dissolved urine scale of conspecifics were very attractive
to most captive individuals. Therefore fresh urine and urine scale were sampled at zoos.
However, I expected that urine from male conspecifics could also keep subadult males and
females away trying to avoid entering the territory of a dominant male. Thus I only baited a
scent station with urine every two kilometres. Distinction of male and female urine was not
possible during the collection, because all females were kept paired with males.
After filling the holes, cotton strings were soaked in valerian sap (Allpharm Vertriebs-GmbH,
Messel, Germany), catnip oil (Europet, Gemert-Bakel, The Netherlands) or urine,
respectively. The one end of the strings was stuffed in the holes with the aid of tweezers
where the other end hang down the boles (Figure 15 a). By this way it was easy to check if an
animal got in contact with the scent station, because the animal would have removed the
string. All scent stations were re-baited, by spraying valerian sap and catnip oil on the boles
during each transect survey (every 6 - 7 days). In addition, I fixed perforated film containers
filled with lures about 2 m high in a tree close to the scent station, to guarantee that wind
spreads out the smell over a longer distance (Figure 15 b). During the second part of the field
work I started to use the perfume Calvin Klein Obsession for men (Phillips van Heusen
Corporation, New York, USA) additionally to the other lures. This perfume showed a high
attractiveness on other cat species (Marker & Dickman 2003).
a)
b)
Figure 15 (a) Scent station fixed on a tree close to one of the transects in Tabin Wildlife Reserve.
(b) Perforated film container filled with catnip, valerian and/or Calvin Klein Obsession perfume,
hanging up in the tree to attract passing “Sundaland clouded leopards”.
50
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Methods
Night surveys
During six months field work a total of 100 night drives were conducted using a bright
spotlight from the back of a pick-up car. The total night drive period was partitioned into
10 sampling occasions, each consisting of drives at 10 consecutive nights to keep the trapping
effort equal. The area surveyed during the nights covered only a small proportion of the total
research area. Due to logistical restrictions night drives could only be carried out along the
southbound road. On each night survey I recorded all mammal species which could be
identified with certainty. Photographs of clouded leopards taken during night drives were used
to distinguish individuals by their cloud-shaped markings on the flanks and their facial
features.
2. 4 Track measurement
To discriminate individual animals, 14 linear and five area measurements were taken of each
track (Figure 16). Measurement techniques were adopted from a variety of previous studies
(Smallwood & Fitzhugh 1993; Riordan 1998; Grigione et al. 1999; Lewison et al. 2001;
Sharma et al. 2005) with the intention to increase the level of discrimination. The units of
linear and area measurements were millimetres with a 1 mm and 1 mm² level of precision
respectively. Angle measurements, which proved in previous studies to have a high level of
discrimination potential (Riordan 1998; Lewison et al. 2001), varied greatly among tracks of a
Figure 16 Fourteen linear and 5 area measurements of the tracks.
A = heel pad width, B = heel pad length, C = heel to second toe length, D = outer toes spread length,
E = inner toe width, F = inner toe length, G = second toe width, H = second toe length, I = third toe width,
J = third toe length, K = outer toe width, L = outer toe length, M = total width, N = total length, a = area of
heel pad, b = area of inner toe, c = area of second toe, d = area of third toe, e = area of outer toe.
51
Chapter 2: Clouded leopard ecology
Methods
Diplomarbeit
Andreas Wilting
given individual thus making this tool inadequate for discriminating individuals in my study.
All digital track photographs were analysed and measured using Adobe Acrobat 7.0
Professional™ (Adobe Systems, Inc.).
2. 5 Laboratory analysis
DNA from faecal samples was extracted using modified protocols described in chapter 1. The
286 bp region of Cyt-b of mtDNA was amplified. These sequences were aligned with
reference sequences in GenBank to facilitate species identification.
2. 6 Statistical and analytical analysis
For track analysis, it was presumed that I could differentiate between pugmarks made by front
and rear feet as well as by left and right feet. No other large cats are present on Borneo, and
thus confusion with pugmarks from other cat species could be excluded as a possible source
of error. Confusion with tracks of bay cats (Catopuma badia), which might have track sizes
similar to small clouded leopards, can be ruled out because no confirmed observations of bay
cats have been made in Tabin (SWD pers. comm.). In order to determine if left and right
tracks could be combined for the analysis to enlarge the data set, I used a paired t-test to
compare the means of the total width from left and right tracks of each TS. This was done
independently for front and rear tracks. I tested all other linear and area measurements as well
to determine any differences between the variables. It was assumed that the means have a
normal distribution and therefore the t-test could be applied.
To achieve an optimal separation of each TS, a standardized principal component analysis
(PCA) was applied. The PCA reduced the complexity by taking many measurements in one
sampling unit by identifying which combination of variables explains the largest amount of
variation between the tracks. Principal component (PC) 1 against PC 2 separates individuals
better in a scatter plot than two of the original variables did (Riordan 1998). I excluded the
width of the heel pad and of each toe in my analysis, because the information in these
variables highly correlates with the length and area of the heel pads and toes, respectively.
The remaining 14 variables were treated as being equally important, having the advantage of
coping with linear and area measurements. The PCA does not require that the number of
clouded leopards is known prior to the analysis and therefore I favoured the PCA over a
discriminant analysis, which has been applied in similar studies (Smallwood & Fitzhugh
1993, Grigione et al. 1999, Lewison et al. 2001). The PCA does not classify data into fixed
52
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Methods
groups of clouded leopards, because the number of groups was unknown. Rather it associates
each track with another, even if they derive from the same TS. Tracks from the same TS
should cluster together in space, as will tracks from different TSs made by the same
individual. All data were analyzed using STATISTICA 6 (StatSoft, Inc. 2001).
After matching tracks and photographs to individual clouded leopards the capture history for
each animal was developed, separately for tracks and photographs, in a manner utilized by
camera-trapping studies (Karanth 1995; Karanth & Nichols 1998; Silver et al. 2004;
Kawanishi & Sunquist 2004; Karanth et al. 2004). The capture history data were analysed
using the software CAPTURE (Otis et al. 1978; White et al. 1982; Rexstad & Burnham 1991)
developed to implement closed population capture-recapture models. This programme uses a
number of different models to generate abundance estimates for a sampled area, based on the
number of individual animals captured and the frequency of recaptures. The available models
differ in assumed sources of variation in capture probability, including individual
heterogeneity, behavioural response (trap happiness and trap shyness), variation over time and
various combinations of these. CAPTURE uses a discriminant function model selection
algorithm to provide an objective criterion for selecting the best approximating model. In
addition, CAPTURE statistically tests the closure assumption, whether the studied population
is closed without death, birth and migration to or from other populations. Tracks and
photographs of clouded leopards had to be analyzed separately because the two applied
approaches comprised different assumptions.
Calculated abundance estimates were used to estimate clouded leopard densities, defined as
D = N/A, where N is animal abundance and A is the effective surveyed area sampled.
2. 7 Application of the results on landscape level
Digital maps of all protected areas within Sabah and results of the last faunal survey
(2000-2001) provided by the Sabah Wildlife Department were used for the large scale
analysis. To estimate future prospects of clouded leopards in various protected areas different
variables were taken into account. Most important for the evaluation were the presence of
clouded leopards, the reserve size, connectivity and the classification of the protected areas. I
classified the reserves as a) totally protected reserves and b) commercial forest reserves,
where the commercial forest reserves are consistent with class 2 of the classification by Sabah
Forestry Department. I pooled the classifications of class 5 (mangrove forests) and class 7
(wildlife reserves) within the designation of class 1 (totally protected areas), because in all of
53
Chapter 2: Clouded leopard ecology
Methods / Results
Diplomarbeit
Andreas Wilting
these classes hunting and selective logging are prohibited making them subject to protective
conditions. Only areas which were estimated to be large enough to hold a minimum
population of 50 individuals (Shaffer 1981; Allen et al. 2001) were included in the analysis
since smaller populations of large cats, such as the Florida panther, might experience reduced
viability and fecundity caused by inbreeding (Roelke et al. 1993). Furthermore, smaller
populations are more susceptible to environmental and demographic stochasticity. Therefore,
a minimum reserve size was calculated based on my density estimation in TWR. Due to a lack
of detailed data, I assumed densities to be similar in all protected areas and calculated a rough
number of clouded leopards within each reserve as a first working hypothesis, based on the
reserve sizes and the density obtained in TWR.
3. Results
3. 1 Recorded mammal species
During field work I recorded in total 51 mammal species within my study site (Appendix 1). I
only included species which were directly observed and could be identified with certainty.
Due to difficulties in the identification of Chiroptera and Muridae on sight I excluded these
two highly diverse groups from the checklist. Twenty-six of those species were recorded
during night surveys and the others 25 species during research along transects. I recorded
three new species for Tabin. Two specimens of the South-East Asian white-toothed shrew
(Crocidura fuliginosa) were found to be killed by cars along the north-south road.
Furthermore, two flying squirrels, the Temminck’s flying squirrel (Petinomys setosus) and the
Black flying squirrel (Aeromys tephromelas) were seen twice during night surveys. No
checklist of species for Tabin lists these flying squirrels and questionnaires of senior rangers
in Tabin revealed that they did not know that these species occur in Tabin (SWD pers.
comm.). Of 18 carnivores recorded for TWR 14 were observed during the field work.
3. 2 Scent stations
At none of the scent stations any signs (scratches, hairs) of a clouded leopard or any other
animal could be recorded. Although the different lures smelt strong even after several days,
they seem not to be attractive to clouded leopards and other animals in the wild. Only some
film containers were removed by macaques as bite marks revealed.
54
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Results
3. 3 Faecal analysis
Altogether I collected 24 faecal samples of which five could most probably be assigned to
clouded leopards and the remaining were potentially deposited by clouded leopards. However,
molecular scatology did not show promising results. DNA extracted from feces was highly
degraded and sequences could not be read properly. The legible mtDNA fragments were too
short in length to guarantee correct species assignment. Only two questionable samples (Scat
S102, S106) could be clearly assigned to feral dogs by molecular analysis. These were
collected along the southbound road next to the oil palm plantation. Due to the low total
number of collected scats, which were likely to be deposited by clouded leopards, I performed
no further analysis of these samples. Although with additional time and higher expenses it
might be possible to analyse some of the collected scats. If required, those analyses can still
be conducted.
In the two samples assigned to feral dogs, hairs, bone and/or hoof remains of bearded pigs /
piglets (Sus barbatus) were found in diet analysis. Scat S106 also contained hairs of murids,
which could not be assigned to a particular species. The other faecal samples were not
analysed for prey contents, because of the ambiguous molecular analysis, which could not
help to assign scats to a particular carnivorous species.
3. 4 Scent marking behaviour of “Sundaland clouded leopards”
During this field work two different forms of scent
markings were recorded for “Sundaland clouded
leopards”. Close to the end of the field work one fresh
kill of a clouded leopard was found on the first floor of
a five storey observation tower about 2 km away from
the field station (Figure 17). Beside various tracks
allocated to a clouded leopard claw and bite marks
proved that a clouded leopard killed the bearded pig
(Figure 18 a & b). The platform is located close to the
Lipad mud-volcano that is visited on a regular basis by
many animals as a natural salt lick (Figure 13 Page 47).
The killed pig weighed about 20 kg and I suppose that
Figure 17 Five storey observation
the male clouded leopard (confirmed by its large track tower located at the Lipad mudsizes) brought it up on the tower, because it might have volcano in Tabin Wildlife Reserve.
55
Chapter 2: Clouded leopard ecology
Results
Diplomarbeit
Andreas Wilting
a)
b)
Figure 18 (a) Dead bearded pig killed by a “Sundaland clouded leopard” at Lipad mud volcano
in Tabin Wildlife Reserve. (b) Clouded leopard claw marks on the flank of the bearded pig.
been too heavy for typical tree-caching behaviour of clouded leopards. The kill might have
been abandoned due to disturbance by constructors fixing the tower, who found the kill at
3 pm. Unfortunately the constructors removed it from the tower before my research assistant
and I arrived at the tower at about 10 pm. I brought the pig back closer to the platform and
observed it all night, but could not record
any animal activities associated with the
kill. At 6 am the next morning I checked
the tower in daylight and found fresh
urine (Figure 19). The urine was sprayed
on a crossbar about 40 cm above the first
storey. I assume that the clouded leopard
returned just before I arrived at 10 pm and
left the odourous signal after it was not
able to find its kill. During the night the
Figure 19 Urine of a “Sundaland clouded
urine did not evaporate due to the high leopard” sprayed on a crossbar about 40 cm
above the first floor of the five storey observation
humidity. Interestingly a lot of hair stuck tower at the Lipad mud volcano in Tabin Wildlife
to the same crossbar, indicating cheek Reserve. (Date 07/16/2005).
rubbing behaviour by the clouded leopard.
A third scent marking behaviour might be the deposition of scats along the road, but without
the evidence by the molecular analysis this can’t be proven. During a night survey an adult
male was encountered lying about three meters next to the north-south road in the grass
(Figure 20). In consequence of the disturbance the clouded leopard vanished into the oil palm
plantation. Search for signs along the road directly after the sighting remained unsuccessful.
56
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Results
However, the next morning a fresh scat was found in
the middle of the road, probably placed there by the
aforementioned individual. About two weeks later
another large carnivore scat, was detected just about
20 m from the first one, again placed in the middle
of the road.
Neither
micturition,
and
cheek
rubbing
nor
defecation was performed in combination with
scratch marking behaviour.
3. 5 Individual identification by photographs
During the field work four direct observations of
clouded leopards were possible, including three
times when tourists were able to photograph or film
the animal (Figure 20 & 21). Magnification of the
Figure 20 Adult male “Sundaland
clouded leopard” lying about 3 m next cloud-shape markings on the flanks and facial
to the southbound road in the grass. features revealed that one individual was
(Date 04/11/2005) Photographed by
Anders Ramqvist in Tabin Wildlife photographed twice (Figure 22 a & b Page 58). The
Reserve.
film proved that this adult individual was a male.
This male was seen on two occasions
about 500 m apart both times entering the
delimited oil palm plantation. The other
clouded leopard was a juvenile possessing
a less distinct coat pattern with shorter
hair and a relatively small head (Figure
22). Two weeks before this individual was
photographed
in
the
resort
area,
Figure 21 Young “Sundaland clouded leopard”
presumably the same young individual was characterized by less distinct coat pattern with
shorter hair and a relative small head.
seen crossing the road from the oil palm Photographed by Horst Flotow in Tabin Wildlife
Resort. (Date 08/15/2005).
plantation heading towards the reserve
(pers. obs.) (Figure 12 Page 46).
57
Chapter 2: Clouded leopard ecology
Results
Diplomarbeit
Andreas Wilting
a)
b)
58
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Results
Figure 22 (Page 58) a) Identification of a male clouded leopard based on flank pelage pattern.
The spot pattern shows that specimen 1 and 2 comprise the same individual. Both photographs were taken along
the southbound road, during two different night drives. Photographs taken by Anders Ramqvist and Stefan Kolb.
(Dates 04/11/2005 and 05/02/2005).
b) Identification of two separate clouded leopards based on the facial spot markings.
Photographs 1 and 2 show the male clouded leopard of a) and photograph 3, a young individual. Photographes
taken by Anders Ramqvist, Stefan Kolb and Horst Flotow in Tabin Wildlife Reserve. (Date of photograph 3
08/15/2005).
3. 6 Tracking
During field work six track-sets consisting of one, four, eight, 10, 13 and 14 pugmarks were
recorded. All tracks were in good condition, recorded on similar substrates and flat terrain and
had comparable depth. I measured all tracks several times. Track-set 3 consisted of only one
mark but was found after a sighting of an adult male and could therefore be assigned to this
individual. TS 1 and TS 4 were smaller in size. The last three TSs (TS 2, 5, 6) were larger and
similar to the one track found after the above-mentioned sighting of the male. The left front
pugmarks of these TSs were always smaller in size than the right front tracks of the same TSs.
Two of those three TSs, TS 5 and TS 6, were recorded on the mud-volcano (Figure 12 Page
46). TS 3 and TS 4 were recorded along the southbound road, whereas TS 1 and TS 2 were
found along the old logging road running east to west. Although two transects followed
existing jungle trails, which were supposed to be frequently used by clouded leopards, no
tracks were spotted there. This might have been caused by leaves covering most of the
ground. In addition to tracks observed on the roads, eight TSs were detected along stream
transects. These tracks were of poor quality and could neither be allocated without doubt to
clouded leopards nor measured accurately. In addition those tracks were found on substrates
differing from those of the other TSs. Thus these tracks had to be excluded from the analysis.
3. 7 Individual identification by tracks
A paired t-test indicated that the means of the total width from each TS from left and right
front tracks differed significantly (n = 5, t = -3.3, p = 0.03). Although all other track
characteristics appeared to be similar for respective left and right measures (all p < 0.05), I
analyzed left and right front marks independently to account for the differences in track sizes.
In contrast, means from left and right rear tracks of the same clouded leopard were not
statistically different (n = 4, t = -0.5, p = 0.65). Thus I combined left and right rear tracks for
the analysis to increase the level of statistical power. Due to the small sample size, tracks
59
Chapter 2: Clouded leopard ecology
Results
Diplomarbeit
Andreas Wilting
found on slightly different substrates were combined for analysis, but substrates differed more
within one track-set than between the track-sets.
In my analysis in each of the three cases (independent analysis for rear, left and right front
tracks) the first two PCs explained over 97 % (eigenvalues for rear tracks x1 =13.4, x2 = 0.3;
for left front tracks x1 = 13.5, x2 = 0.3; for right front tracks x1 = 13.8, x2 = 0.1) of the total
variation within all 14 variables with PC 1 explaining always over 96 %. This finding
suggested that the first PC would already be sufficient to differentiate the tracks, but a twodimensional graph with the first two PC was preferred for better illustration.
Figure 23 a (Page 61) shows the scatter plot for the rear tracks. All tracks from both TS 1 and
TS 4 form clusters, but are spatially separated from each other within the scatter plots,
suggesting that these track-sets were left by two different clouded leopards. The tracks of
TS 2, TS 5 and TS 6 intersected with each other and grouped together in space suggesting that
those track-sets, found at different locations and dates, were of the same individual. Since
TS 3 consisted of just one pugmark it is only found on Figure 23 b (Page 61), which shows
the principal component analysis (PCA) of left front marks. The track from TS 3 is spatially
separated in the scatter plot suggesting that this track was produced by a different clouded
leopard. In summary, all track-sets were probably formed by four different clouded leopards.
3. 8 Population size and density
The track classification technique resulted in a calculated minimum number of four clouded
leopards present in the surveyed area between March and August 2005. The results of the
closure test (tracks: z = -0.118, p = 0.453; photographs: z = 1.492, p = 0.932) provided no
evidence of violation of the closure assumption neither for tracks nor for photographs
(Table 9 Page 62). The model selection algorithm of capture identified M0 as the most
appropriate model for both analyses. I adhere to this suggestion and present population
estimates obtained by application of the M0 model (see discussion). The analysis determined
average capture probabilities to be 0.06 for the tracks and 0.20 for the photographs (Table 9
Page 62). The estimated probability that a clouded leopard was recorded at least once was
0.80 for the tracks and 1.00 for the photographs (Table 9 Page 62).
I estimated five ( ± 2.26 SE) clouded leopards to be present in the research area on the basis
of a capture-recapture analysis of the tracks. Capture-recapture analysis of the photographs
led to a population estimate of two animals ( ± 0.59 SE) in the southern part of the research
60
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Results
a)
b)
Figure 23 Principal component loadings of “Sundaland clouded leopard”tracks.
Tracks were taken in Tabin Wildlife Reserve, Sabah, Malaysia derived from (a) left and right rear and (b) left front
pugmarks. Same symbols indicate tracks belonging to the same track set (TS).
61
Chapter 2: Clouded leopard ecology
Results
Diplomarbeit
Andreas Wilting
Table 9 Estimated abundance of “Sundaland clouded leopards” and other relevant
statistics for capture-recapture analysis based on the null model M0 at the research site
in Tabin Wildlife Reserve, Sabah, Malaysia.
No. of occasions
Closure test
Selection criteria
M0$
Mh§
Estimated capture probability per sampling occasion
Estimated capture probability over all sampling occasions
No. of animals captured
Population estimate ± SE
Approximately 95 % confidence interval#
Surveyed area (km²)
Density (per 100 km²) ± SE
Tracks
Photographs
20
0.45
1.00
0.93
0.06
0.80
4
5 ( ± 2.26)
4 to 9
56
8.93 ( ± 4.36)
10
0.93
1.00
0.86
0.20
1.00
2
2 ( ± 0.59)
2 to 3
19
10.53 ( ± 3.10)
$
Null model with constant capture frequencies.
Jackknife population estimator incorporates variable capture probabilities of individuals.
#
using a range of 2 SE.
§
area. To estimate the upper and lower margins of the density I calculated an approximately
95 % confidence interval. I used a range of 2 SE on the upper side of the point estimates. I did
not use 2 SE on the lower side of the point estimate, because a calculated number below the
threshold of identified individuals would not be reasonable. Thus I set the number of
differentiated individuals as the lower limit. I did not use the confidence interval calculated by
CAPTURE, because the guidelines of CAPTURE noted that low capture probabilities will
lead to extremely wide confidence intervals that hold little information on the true population
size (Otis et al. 1978).
In order to calculate the population density within the reserves, the effective surveyed area
also had to be estimated. Applying equation 1 and data from Grassman et al. (2005) a buffer
width (W) of 1.58 km was generated. Buffering all transects resulted in a surveyed area (A) of
about 56 km² (Figure 12 Page 46). The southern part of the research area enclosed an area of
about 19 km².
The density of clouded leopards based on similar population estimates of two independent
abundance estimates are nine individuals based on tracks and 10.5 individuals based on
photographs per 100 km² within Tabin Wildlife Reserve. The density lies most likely between
62
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Results
my approximately 95 % confidence interval of eight to 17 individuals per 100 km² for the
track estimation and 10 to 17 individuals for photographs.
3. 9 Distribution in Sabah
Based on a rough density estimation of nine individuals per 100 km², I assumed that all areas
smaller than 350 km² might be too small to contain a stable population of clouded leopards
(> 50 individuals). Thus, only protected reserves larger than 350 km² as well as reserves
connected to others can be considered as potential clouded leopard refuges. Table 10
(Page 65) shows the list and status of all of these protected areas in Sabah. In total they
comprise an area of about 30,000 km² which covers about 41 % of Sabah’s land surface. The
presence of clouded leopards is confirmed in approximately 25 % of Sabah, based on the last
faunal survey 2000 - 2001 and direct observations by rangers of the SWD (Figure 24
Page 64). About 12 % of Sabah’s forest reserves were not included in the last faunal survey,
thus no information about the clouded leopard’s status in these areas is available. Taking this
into account, the potential distribution of clouded leopards is about 37 % of Sabah. Only six
reserves are totally protected (Table 10 Page 65), covering an area of only 7 % of Sabah. One
of these reserves, Crocker Range NP, is divided by a mountain range with elevations higher
than 1,500 m. Based on information of previous faunal surveys, clouded leopards in Borneo
only populate areas below 1,300 m (Davies & Payne 1982). I believe that the areas in Crocker
Range NP below 1,300 m are too small and too fragmented to sustain a viable clouded
leopard population. For the same reasons I completely excluded Kinabalu Park as a potential
refuge. The Kinabatangan Wildlife Sanctuary consists of small forest fragments which are too
small and isolated to sustain a viable clouded leopard population. Even clouded leopards have
been recorded in Kinabatangan Wildlife Sanctuary and Crocker Range NP I classified those
as totally protected reserve (TPR) b in Figure 24 (Page64), due to their fragmentation. The
last remaining four refuges (TPRa in Figure 24 Page 64), covering only 5 % of Sabah, are
isolated from each other with only one connection via commercial forest reserves between
Maliau Basin and Danum Valley. Therefore, most of the potential distribution range of
clouded leopards is located in commercial forest reserves, where selective logging and
licensed hunting is permitted.
In total, I estimated a very rough number of 1,500-3,200 clouded leopards inhabiting reserves
in Sabah, based on the density of eight to 17 individuals per 100 km² (see discussion). Areas
with no data on the presence of clouded leopards or reserves which are smaller than 350 km²
63
Chapter 2: Clouded leopard ecology
Results
Diplomarbeit
Andreas Wilting
and not connected to other reserves were excluded. According to my analysis, the four
remaining reserves of total protection in Sabah harbour less than 20 % of the entire clouded
leopard population.
Figure 24 Protected areas in Sabah, ranked according to their protection status and importance
for “Sundaland clouded leopard” conservation. Names of reserves are shown in Table 10, Page
65.
TPR a = Totally protected reserve with a stable “Sundaland clouded leopard” population, TPR b = Fragmented
TPR, CFR 1 = Commercial forest reserve “Sundaland clouded leopards” present, CFR 2 = CFR unknown
“Sundaland clouded leopard” status, CFR 3 = CFR “Sundaland clouded leopards” absent.
64
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Results
Table 10 Protected areas in Sabah larger than 350 km² or connected to other reserves.
The potential numbers of “Sundaland clouded leopards” are calculated based on a
local density of 8 – 17 individuals per 100 km², which was computed for the Tabin
Wildlife Reserve. Restrictions of this extrapolation have to be considered (see
discussion).
No.
Class
Size [km²]
Tabin & Kulamba WR.
1
1
1,409
CL
presence
yes
no
Potential
no. of CL
113-240
Danum Valley FR.
2
1
459
yes
no
37-78
Maliau Basin FR.
Tawau Hill & Ulu
Kalumpang FR.
Crocker Range NP
3
1
630
yes
no
50-107
4
1
943
yes
no
75-160
5
1
1,406
yes
no
112-239
Kinabatangan WS.
6
1
~ 450
yes
no
36-77
Ulu Tungud FR.
7
2
1,233
yes
yes
99-210
Trus Madi FR.
8
2
1,759
yes
yes
141-299
Segaluid Lokan FR.
9
2
573
yes
yes
46-97
Deramakot FR.
10
2
551
yes
yes
44-94
Tangkulap FR.
11
2
275
yes
yes
22-47
Malua FR.
12
2
340
yes
yes
27-58
Sg. Pinangah FR.
13
2
2,355
yes
yes
188-400
Gunung Rara FR.
14
2
2,172
yes
yes
174-369
Kalabakan FR.
15
2
2,240
yes
yes
179-381
Pensiangan FR.
16
2
1,031
yes
yes
82-175
Sg. Tagul FR.
17
2
1,058
yes
yes
85-185
Ulu Sg. Milian FR.
18
2
777
unknown
no
unknown
Kuamut FR.
19
2
1,152
unknown
no
unknown
Ulu Segama FR.
20
2
2,013
unknown
no
unknown
Sipitang FR.
21
2
2,589
unknown
no
unknown
Salpulut FR.
22
2
2,419
unknown
no
unknown
Paitan FR.
23
2
711
no
yes
-
Lingkabau FR.
24
2
713
no
yes
-
Mt. Mandalom FR.
25
2
379
no
yes
-
Ulu Sg. Padas FR.
26
2
605
no
yes
-
Name
Total
30,242
FS
1,511-3,210
CL = “Sundaland clouded leopard”, FS = faunal survey, WR = Wildlife Reserve, FR = Forest Reserve,
WS = Wildlife Sanctuary, 1 = totally protected area, 2 = commercial forest reserves
65
Chapter 2: Clouded leopard ecology
Discussion
Diplomarbeit
Andreas Wilting
4. Discussion
Mammal species in Tabin
The occurrence of 51 mammal species recorded during six months of field work is relatively
low compared to a complete mammal list in other protected areas in Sabah e. g. 126 mammal
species in Danum Valley Conservation Area (DVCA) (Marsh 1995). However, many of those
species in DVCA belonged to the order Chiroptera or the family Muridae, which were not
included in the list from Tabin. It also has to be considered that all records were sightings and
no explicit trapping or survey had been conducted to complete the mammal list. Furthermore,
only a small part of Tabin was included in this study consisting of mostly secondary forest
habitats. The small VJR around the Lipad mud-volcano was officially not selectively logged,
but huge gaps in the canopy indicate that in this part illegal selective logging has taken place.
Regarding these constraints the occurrence of 51 mammal species recorded during this short
time period is surprisingly high, especially because parts of the study site were still at the first
stages of regeneration after logging activities in the late 80s.
The fact that during this short study already three new species for TWR were recorded
revealed a huge knowledge deficit on the occurrence of mammals. The lists of other taxa are
even more incomplete and faunal surveys are urgently needed to asses the biodiversity in
Tabin. During those surveys not only the edges of the reserve, where this study took place,
should be sampled accurately, but also the interior core area has to be included. I expect that
various species are restricted to the remaining pristine forests in the core area or that they do
have their source populations there. To protect the total biodiversity in Tabin every endeavour
has to be made to prevent illegal logging within and around the core area.
Night surveys
Performing night surveys resulted in the record of 26 nocturnal mammal species including the
clouded leopard. Four direct clouded leopard sightings gave some insights into their
behaviour in situ. Stefan Kolb a tourist joining one night survey filmed for one of the first
times a clouded leopard in the wild. This film shows a male clouded leopard jumping over a
small water puddle and entering an oil palm plantation. I conclude that night surveys with
spotlights along small roads proved useful in elucidating the secretive nature of clouded
leopards and to confirm the presence of cryptic nocturnal species.
66
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Discussion
Scent stations
Unforeseeable neither any clouded leopard, despite of one passing a scent station (confirmed
by tracks), nor any other mammal except macaque monkeys got attracted by the hair-traps.
The promising results from preliminary studies in German zoos made me believe that those
scent stations might be a cheap and easy technique to study even secretive carnivores in
tropical rainforests. However, the clear results show that this technique seems to be not
feasible for field research on clouded leopards. I doubt that this method can be used in future
research on leopard cats (Prionailurus bengalensis) or on different civet species, which were
very common and in my study site. It might even be possible, that fixing hair traps is
counterproductive for the research on clouded leopards. Their sensitive reactions on
environmental changes could keep them away from the stations. My study neither supports,
nor refuses this hypothesis.
Molecular scatology
Although clouded leopards used existing gravel or former roads for their movements,
indicated by tracks and direct observations, only a small number of large scats was found
during transect surveys. All scats were found along roads or streams and no carnivore feces
were detected along jungles trails. There are two major reasons for this; first leaves are
covering the ground inside the forest, which make the search for scats extremely difficult.
Second the abundance of coprophagous insects, mainly dung beetles of the family
Scarabaeidae, is much higher inside the forest. Therefore scats get removed much faster. Pilot
studies with faecal samples from domestic dogs proved that scats were usually eliminated
inside the forest within 24-48 hours. Along roads the scats dried very quickly, caused by the
lower humidity and solar radiation, making the feces unattractive for dung beetles. Those
scats could be found even two weeks after deposition and were usually only washed away by
the next heavy rainfall.
During this study each transect was surveyed once a week, so some of the scats were already
a few days old when collected. I suppose that this sampling design is one of the major
reasons, why the laboratory analysis did not show promising results. A long exposure of feces
to a tropical warm and humid climate accelerates DNA degradation.
Nevertheless, I believe that molecular scatology can be a promising method in the future.
Further methodological developments in the laboratory protocols can be expected and these
67
Chapter 2: Clouded leopard ecology
Discussion
Diplomarbeit
Andreas Wilting
will provide this method with additional potential. Considering the following suggestions
might help to increase the success by the application of molecular scatology in tropical
rainforests:
•
Only areas with an extensive network of roadways or clearings should be considered
as suitably study sites due to the problems in detecting scats inside the forest.
•
At least 50 – 100 km of road should be sampled to increase the probability to find
sufficient faecal samples of the species of interest.
•
Each transect should be surveyed every second day to guarantee that scats are
collected shortly after deposition and therefore limit DNA degradation. Hence, a high
number of field assistants or rangers will be necessary to sample roads regularly.
•
Special trained detection dogs might help to find scats along roads. For example
trained dogs found about four times as many kit fox scats as an experienced person
searching for scats visually (Smith et al. 2001). In addition those dogs were able to
distinguish the odours of different species (Smith et al. 2001; Smith et al. 2003;
Wasser et al. 2004). This would reduce the costs for laboratory analysis enormously
by avoiding the analyses of scats of non-target species. The discrimination between
species might be of even greater value because I experienced that scats lose their
particular shape, which is the main characteristic for species identification, e. g. due
to nuzzling dung beetles or heavy rainfalls.
Scent marking in clouded leopards
Intraspecific chemical communication between conspecifics plays an important role within
the Felidae and urine spraying and defecation have been reported for various solitary felids
(Seidensticker et al. 1973 for mountain lions; Whittle 1981 and Smith et al. 1989 for tigers;
Naidenko & Serbenyuk 1995 for European lynxes Lynx lynx; Molteno et al. 1998 for blackfooted cats Felis nigripes). In my study I found for the first time indications that clouded
leopards perform scent marking behaviours. Other larger cats mark their major territorial
boundaries by defecation. Therefore I assume that the two large scats, found along the
southbound road, were dropped there by a clouded leopard on marking purposes, even I could
not exclude that these droppings were defecated by a different species. This road may
function as territorial boundary since the nearby plantation does not constitute suitable habitat
for this species. I believe that the marking of the observation tower by micturition and cheek
rubbing was done on purpose by the individual to carve out its territory, because constructers
68
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Discussion
removed the bearded pig. Large clouded leopard tracks at the mud-volcano indicate that most
probably an adult male killed the pig and marked the tower.
This first observations of marking behaviour of Neofelis diardi is a promising start to
elucidate how marking influences territoriality and social organization of a secretive rainforest
key predator. However, in order to understand the role of various forms of scent marking
behaviour in this species, additional research needs to be conducted.
Clouded leopard abundance
Davies and Payne (1982) provided the only previous, but very rough, density estimate of
clouded leopards in Sabah. They assumed that 12 one-square kilometre study areas were
surveyed accurately enough to detect clouded leopards. On the basis of three observations
(tracks or sightings), they concluded a density of one individual / 4 km2 or 25 animals /
100 km². This estimation was intended as a base for further research, but became a “quoted
fact” in literature (Jackson 2001).
My results lead to the assumption that Davies’ and Payne’s (1982) approach most likely
overestimated the true density even though I cannot prove that Tabin’s clouded leopard
population is representative for other areas in Sabah. The expected relatively large and
overlapping home-ranges of clouded leopards (Grassman et al. 2005) might be just one of the
reasons why Davies’ and Payne’s method is not accurate. My density estimate incorporates
inaccuracies as well, mainly due to a limited number of good track-sets and photographs
which could be obtained in this relatively short study period. I chose the null model M0 with
constant capture frequencies similar to Trolle and Kéry (2003) for their study on ocelots,
although I am aware that due to the small sample size, selection criteria were defaulted to the
null model M0 with minimum parameters involved. I am also conscious that the M0 is
sensitive to violations of the underlying model assumption of homogeneous capture
probabilities (Otis et al. 1978; White et al. 1982) leading to underestimates of the true density
and of the standard error. In contrast to the M0 model, the Jackknife population estimator Mh
incorporates variable capture probabilities of individuals (Otis et al. 1978; White et al. 1982).
This model tends to be the most robust to deviations from model assumptions (Karanth &
Nichols 1998; Nichols & Karanth 2002; Karanth et al. 2004). However, the Jackknife
estimator does not provide an adequate estimation of population sizes if only a few animals
are recaptured (Otis et al. 1978). Based on my experience in the research area, the Jackknife
estimator tends to overestimate the true density. I am more concerned about overestimating
69
Chapter 2: Clouded leopard ecology
Discussion
Diplomarbeit
Andreas Wilting
the true density, since this will automatically lead to an underestimation of the risk the
population faces (Soisalo & Cavalcanti 2006). Even though the Chao Mh estimator is more
robust against low capture probabilities compared to Jackknife it could not be applied,
because the capture frequencies did not satisfy the conditions asked for. Due to the low
number of recaptures in my study I would like to emphasise that my calculated density of nine
and 10.5 individuals per 100 km², respectively, should rather be taken as rough minimum
estimates and not as true values. Although these estimates are based on more precise data and
might come closer to the true density than those achieved in previous studies (Davies & Payne
1982), upcoming research activities have to re-evaluate the calculated abundances given in
this study.
Rigorous track classification method
I demonstrated that the rigorous technique used to identify individuals via a thorough
quantitative track survey is a feasible method to study even secretive cats in tropical
rainforests. This is the first study that applied this method combined with a capture-recapture
model in a study on elusive cats. Earlier studies pointed out some disadvantages of identifying
individuals by their tracks (Panwar, 1979; Karanth, 1987; Kawanishi, 2002). Karanth et al.
(2003) reviewed that 30 years of “pugmark census method” (Choudhury 1970 and 1972) to
estimate abundances of tigers in India failed because the statistical assumptions for abundance
estimates were not considered. In my study, however, I improved the data recording with
digital images of the tracks, I enhanced the statistical analysis to separate the individuals and I
incorporated the capture probabilities to estimate the abundances. I am aware that in my study
only two of six track-sets fulfil the criteria by Sharma et al. (2005) of a minimum number of
pugmarks within a track-set. The authors suggest the inclusion of at least 10 pugmarks per
track-set when in total c. 20 track-sets are used in the analysis to obtain a high certainty
(Sharma et al. 2005). I assume that the lower number of track-sets in my study and the large
distances between the principal component loadings of the different track-sets allowing me to
work with a smaller number of pugmarks without sacrificing a high level of reliability.
Therefore, I feel safe to presume a minimum number of four clouded leopards in my study
site. Owing to difficulties in recognising individual felids from their tracks it has to be
ensured that study areas are small and contain only a few individuals of the target species in
further studies. The researcher has to take into account that only a small fraction of the entire
population can be distinguished by their tracks. As a rough guideline I would suggest that the
study area should not exceed a size that more than ten individuals inhabit it. But even in small
70
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Discussion
populations two animals might have very similar track measurements and cannot be separated
with certainty by a multivariate analysis. Hence, the calculated abundances should always be
treated as minimum numbers. In my study only three track-sets clustered with each set having
different measurements of right and left front paws. Because this is very unusual, these tracks
can almost certainly be assigned to the same individual.
Furthermore, I would like to emphasise the different suitability of substrates to exactly mirror
the individual properties of pugmarks as a crucial factor in the application of the track
classification method. Different substrates will affect the size of tracks significantly and might
lead to wrong measurements. During my study the substrates and their decisive properties,
especially soil type, humidity and substrate depth were very similar in the different track-sets.
Thus I believe that the substrate did not bias my results. But the exclusion of eight track-sets
might have affected my results. Nevertheless an inclusion of these track-sets, which first
could not be allocated without doubt to clouded leopards and secondly were found on
substrates differing from those of the other track-sets, would bias my results even more. I
found all assignable tracks along gravel or former logging roads or on a mud-volcano. For
further research this needs to be considered as another limitation of the track classification
method because it might be impossible to find enough track-sets in densely vegetated habitats.
River beds and sand banks along small streams might provide a particularly good opportunity
to find tracks in forests during prospective research.
Mostly I did not distinguish between the sexes and various age groups, because the
differentiation between sub-adult male pugmarks and adult female tracks is extremely
difficult. Therefore I believe that track surveys cannot provide information about sex and age
of the individuals with high confidence. Nevertheless, I suppose, fully in line with previous
methodological publications (e. g. Riordan 1998; Grigione et al. 1999; Lewison et al. 2001;
Sharma et al. 2005), that the track classification method has a high potential for further
research activities as long as the limitations of this method are well considered.
Clouded leopard distribution in Sabah
In my analysis I extrapolated my local-scale results to other protected areas in Sabah. I am
concerned and well aware of the fact that without any detailed information about the other
areas such extrapolations are based on very weak evidence and lead to wrong conclusions for
some reserves. Consequences of different legal hunting and poaching pressures, different
forest structures and protection status of the reserves and different prey abundances in the
71
Chapter 2: Clouded leopard ecology
Discussion
Diplomarbeit
Andreas Wilting
reserves could not be taken into account in my extrapolation. I also could not account effects
of the close proximity of my study site to the delimitated oil palm plantation affecting the
density of potential prey species. However, without any information about the extent of
regional differences and without any knowledge about clouded leopards preferable prey
species in Borneo, I was not able to consider this in my rough calculation.
My extrapolation is based on the latest faunal survey, which proved the presence of the
species by tracks at one locality only and did not provide any information on population sizes
or on the spatial distribution of clouded leopards within the different reserves. Therefore my
calculations most likely lead to an overestimation. On the other hand the exclusion of the
small reserves and of those reserves from which no data was available might have led to an
underestimate of actual clouded leopard numbers in Sabah.
Being aware of all these uncertainties I still suppose that these figures are of great value for
future research projects as a first working hypothesis. It is a first tentative step to fill a
tremendous knowledge gap. For a species with such limited available information concerning
its distribution and status, even very rough estimates, based on limited data, are valuable and
important. I want to point out, that these numbers should not become a “quoted fact”. They
should rather motivate researchers to test these numbers during intensive field studies and
help to set priorities for future research plans.
My results show that only four totally protected reserves covering only 5 % of Sabah possess
the potential to hold a stable clouded leopard population. However, two of these refuges,
Maliau Basin and Danum Valley, cover areas of only 630 km² and 459 km², respectively,
hence they might be populated by only 50 to 107 and 37 to 78 individuals each, if assuming
similar densities as calculated for Tabin. These numbers lie only slightly above my assumed
minimum viable population size of 50 individuals.
Since only a small number of animals inhabit totally protected reserves I recommend that
higher priority should be placed on sustainable management of commercial forest reserves. To
ensure the long term persistence of viable clouded leopard populations the harvest of natural
resources from these areas should be limited and controlled. It has to be assumed that clouded
leopard densities declined in the recent past as a result of disturbance by logging activities. In
contrast to other carnivores such as leopards or mountain lions, clouded leopards seem to be
less able to adapt to human encroachment. They rarely prey on domestic animals and avoid
habitats around human settlements (SWD pers. comm.). Those behavioural traits lead to the
72
Diplomarbeit
Andreas Wilting
Chapter 2: Clouded leopard ecology
Discussion
assumption that commercial forest reserves harbour a significant lower density of clouded
leopards and that my calculations most probably overestimated their actual numbers.
Consequently, those areas have to be larger in order to host viable populations. Illegal hunting
of prey animals in some of those areas might also have a negative effect on clouded leopard
densities. In contrast direct persecution does not seem to have a substantial negative effect on
clouded leopards in Sabah (Rabinowitz et al. 1987). Further research activities in these
harvested areas are needed to reveal to what extent my calculations overestimated the
abundances in such commercial forest reserves and what impact logging activities, forest
structure and hunting have on the clouded leopard population and its prey.
Compared to other areas on Borneo and Sumatra, Sabah has the potential to protect
“Sundaland clouded leopards”. If the vast commercial forest reserves are protected and
sustainably managed, they will serve as refuges for clouded leopards, playing an important
role to prevent inbreeding depression by allowing genetic exchange through dispersing
animals.
The phylogenetic findings in Chapter 1 suggest the recognition of a different subspecies of
N. diardi on Borneo. To protect the evolutionary potential of Bornean clouded leopards,
research and conservation efforts on behalf of this distinct population are of even higher
importance.
73
Diplomarbeit
Andreas Wilting
General conclusion
General conclusion
The results presented in this study will contribute significantly to a better understanding and
an effective management of clouded leopards. The phylogenetic revision of clouded leopards
I presented in Chapter 1 will be of utmost importance for further in situ and ex situ
conservation strategies. By the recognition of different species and subspecies among clouded
leopards this already rare species turns out to consist of two even rarer species with a further
taxonomic splitting of N. diardi into two distinct subspecies. The smaller distribution ranges
of those populations associated with reduced gene pools put clouded leopards under a higher
risk of extinction than assessed before. The different species N. nebulosa and N. diardi as well
as the two distinct populations on Borneo and Sumatra should be managed separately to
protect the genetic diversity upon which future evolutionary potential depends. Furthermore
my genetic results answer a major question of the evolutionary history of clouded leopards;
vicariance or dispersal? The long isolation of N. diardi and N. nebulosa revealed that the
clouded leopard had a deep history of vicariant evolution. The results presented raise the
question about the phylogeographic history of other taxa in the Sunda shelf. Only the
investigation of further taxa can help to identify geographical barriers and Pleistocene
refugias in Sundaland.
As a second part of this project the field work in Sabah, Malaysia contributed to the
knowledge of the reclassified “Sundaland clouded leopard” on Borneo. For the first time I
record signs of scent marking behaviours of clouded leopards. This is of particular interest
because similar behaviours are unknown for most felids occurring in tropical rainforests.
During the course of this study I tested various non-invasive methods to study carnivores in
tropical rainforests. I showed that scent stations baited with different lures are not practical for
the research on clouded leopards. For the successful application of molecular scatology under
hot and humid conditions, some restrictions have to be considered. I demonstrated that the
technique to identify individuals using a thorough quantitative track survey is a feasible
method to study even secretive cats in tropical rainforests. The combination of this kind of
track survey with a capture-recapture analysis holds a high potential for further studies, if the
limitations are well considered. Night surveys with spotlights helped to assess the presence of
elusive nocturnal mammals and resulted in four direct sightings, which provided some
insights into the behaviour of clouded leopards. Based on tracks and photographs I presented
rough density estimates of “Sundaland clouded leopards” in TWR. The up-scaling of these
74
General conclusion
Diplomarbeit
Andreas Wilting
results to a landscape level showed that to date clouded leopards may be still confirmed in
25 % of Sabah, but only a few of the remaining reserves were totally protected, inhabiting
most probably just a few hundred individuals. Although the calculated numbers of clouded
leopards in the reserves are very rough estimates I believe that my calculations are of great
value for further management plans. Since my results indicated that only a small number of
animals inhabit totally protected reserves, I suggest that a higher priority should be placed on
sustainable management of commercial forest reserves.
Further research will be of high importance to understand the ecology of “Sundaland clouded
leopards” on Borneo and their role as top predator within the ecosystem. More surveys are
needed throughout Sabah and other parts of Borneo to clarify threats of this elusive species
and to assess the status of the distinct subspecies on Borneo.
75
Diplomarbeit
Andreas Wilting
Acknowledgement
Acknowledgment
Special thanks go to Prof. K. Eduard Linsenmair, who kindly gave me the opportunity to
work at his department. I am deeply grateful to him for being my tutor and trusting me to be
able to complete this work successfully. I am greatly in debt to Dr. Frauke Fischer and
Dr. Heike Feldhaar for more than just supervising my diploma thesis and for their tireless
guidance and encouragement. I’d like to thank Frauke for her patience and help during the
whole process of the field work, which included reviewing various applications for grants and
for the research permission. Although Frauke doesn’t know the ropes of real “Doppelkopf”
she was a great companion in some highly competitive gambling nights. Heike let me carry
out the genetic work within her laboratory. Without her, I would not have learned half as
much about molecular methods, the analysis of these data and the way of writing scientific
manuscripts; neither would I have been half as happy in conducting the lab work. The
sometimes killingly funny cake-breaks helped to get away from the small daily problems in
the lab, although I still disagree to my new nickname “PooPoo-Mann”. Without either of them
this thesis would not have been possible.
Prof Dr. Heribert Hofer thankfully overtook the task of being second assessor of this diploma
thesis.
Furthermore I want to thank all members of the Department of Animal Ecology and Tropical
Biology and the working group of Dr. Heike Feldhaar for their moral and professional
support. For help and advice in the lab I want to thank Martin Helmkampf, Dr. Martin
Kaltenpoth and Karin Möller, the fairy godmother in our lab. Many thanks go to
Prof. Dr. Jürgen Gadau for his support in my first preliminary laboratory analysis. Statistical
advice by PD Dr. Frank Marohn, Prof. Dr. Michael Falk, Prof. Dr. Hans Joachim Poethke and
PD Dr. Thomas Hovestadt was instrumental in completing this project.
I am also grateful to Dr. Alexander Sliwa and Achim Winkler from Wuppertal and Duisburg
Zoo, respectively, and the carnivores keepers for their assistance during my preliminary
studies on clouded leopards in their zoos. I also thank Nick Marx for collecting and parcelling
clouded leopard samples from Cambodia. I’m indebted to Prof. Dr. Thomas Martin of the
Naturmuseum Senckenberg, Dr. Doris Mörike of the Staatliches Museum für Naturkunde
Stuttgart, Dr. Richard Kraft of the Zoologische Staatssammlung München, Jaffit Majuakim of
the Sabah Museum and Marklarin Lakim of Sabah Parks for the permission to collect
biological specimens in their institutions, upon which my genetic work is based.
76
Acknowledgement
Diplomarbeit
Andreas Wilting
I thank the Economic Planning Unit in Malaysia for issuing a research permit for Sabah as
well as the CITES authorities in Germany, Sabah and Cambodia for issuing import and export
permits for clouded leopard tissue, hide and blood samples. For their support in Sabah I want
to thank the Sabah Wildlife Department especially Soffian Abu Bakar. Without his support
this project would not have been realised. Soffian helped me to organise the field work and he
provided me kindly with GIS data and their results from the last faunal survey for my
landscape analysis. I also say thank you to all the rangers at the Tabin station and to their
families, that helped to make Tabin my second home for a few months. I will never forget my
“Farewell-Jungle-Party”, with the delicious Saté and I thank them a lot for teaching me how
to dance “Sumazau”, although I believe that the “orang putih” was the most untalented person
in the whole of Sabah. Thanks also for the exhausting badminton matches and sorry that even
after seven months of training I was still at a lack of power. Special thanks go to David
Antonius and Herman Stawin for their assistance in the field and for becoming friends despite
our controversial discussions about football (I hope that after the World Cup 2006 they have
changed their minds about a defensively playing German team). I am most grateful to Arthur
my field assistant for his significant contribution to this study. For the daily dinner and the
help in conducting the night surveys I’d like to thank the Tabin Wildlife Resort and all of their
staff. I’m deeply grateful to Lucy and her homestay in Kota Kinabalu. Lucy was a perfect
second mother; she coped with the difficult task to wash my really dirty jungle pants, she was
a pleasant hiking companion and she even visited her “fourth son” in the jungle. I really
enjoyed that someone took care of me. Thanks a lot.
Financial support for data collection was provided by Point Defiance Zoo and Aquarium and
Duisburg Zoo. Without the German Academic Exchange Service (DAAD) scholarship I
would not have been able to finance my thesis abroad.
I’m deeply grateful to Antonie Wilting, Laura Sandberger, Dr. Konstans Wells, Karen Povey,
Valerie Buckley-Beason, Prof. Dr. Stephen J. O`Brien, and particularly Prof. Dr. Linsenmair,
Dr. Frauke Fischer, Dr. Heike Feldhaar and Deike Hesse for their valuable comments and
suggestions on earlier drafts of this thesis or on manuscripts this thesis is based upon. I really
appreciate that Deike coped with the difficult task to correct the “clouded” first drafts. I also
want to thank her for her moral support and her unlimited understanding for my project, even
though this meant that I sometimes attended more to my work than to her. Thanks a lot to all
my friends, who on the one side showed a great interest in my work and on the other side
helped me to take breaks when the work got stuck again. Special thanks go to Mo
(Prof. Dr. Mark-Oliver Rödel) and Jochen Drescher for the hard-fought football matches and
77
Diplomarbeit
Andreas Wilting
Acknowledgement
discussions, although Jochen was only half as much on the pitch as promised and Mo supports
a football team, which I don’t want to mention in this thesis. Special thanks also go to the
other “Doppelkopf” gamblers, Philipp Schievenhöfel, Laura Sandberger and Kolja Kreutz.
Besides outplaying my well planned “Solo” they helped to improve this work in various
intensive discussion.
Last but not least I thank my parents for their love, their never ending support and their trust
in me over all the years!!
Terima kasih!
Danke!
Thank you!
78
Diplomarbeit
Andreas Wilting
References
References
Allen C.R., Pearlstine L.G., & Kitchens W.M. (2001). Modelling viable mammal populations
in gap analysis. Biological Conservation 99, 135-144.
Ambu L.N. & Abu Bakar S. (2004). Checklist of Mammals found in and around the Tabin
Wildlife Reserve. Sabah Wildlife Department, Kota Kinabalu, Malaysia.
Austin S.C. & Tewes M.E. (1999). Ecology of the clouded leopard in Khao Yai National
Park, Thailand. Cat News/IUCN SSC 31, 19-20.
Avise J.C. (1994). Molecular markers, natural history and evolution. Chapman & Hall, New
York.
Avise J.C. & Ball R.M. (1990). Principles of genealogical concordance in species concepts
and biological taxonomy. Oxford Surveys in Evolutionary Biology 7, 45-67.
Balmford A. (1996). Extinction filters and current resilience: the significance of past selection
pressures for conservation biology. Trends in Ecology & Evolution 11, 193-196.
Banks E. (1931). A popular account of the mammals of Borneo. Journal of the Malaysian
British Royal Asiatic Society 9, 1-139.
Beaman R.S., Beaman J.H., Marsh C.W., & Woods P.V. (1986). Drought and forest fires in
Sabah in 1983. Sabah Society Journal 8, 10-30.
Berger J. (1999). Anthropogenic extinction of top carnivores and interspecific animal
behaviour: implications of the rapid decoupling of a web involving wolves, bears, moose, and
ravens. Proceedings of the Royal Society of London B. 266, 2261-2267.
Bland K.P. (1979). Tom-cat odour and other pheromones in feline reproduction. Veterinary
Science Communications 3, 125-136.
Brandon-Jones D. (1996). The Asian Colobinae (Mammalia: Cercopithecidae) as indicators of
Quaternary climatic change. Biological Journal of the Linnean Society 59, 327-350.
Buckley-Beason V.A., Johnson W.E., Nash W.G., Stanyon R., Menninger J.C., Driscoll C.A.,
Howard J.G., Bush M., Page J.E., Roelke M.E., Stone G., Martelli P.P., Wen C., Ling L.,
Duraisingam R.K., Lam V.P., & O'Brien S.J. (2006). Molecular evidence for species-level
distinctions in clouded leopards. Current Biology 16, 2371-2376.
Childers-Zadah V. (1998). Use of valerian plant and/or root as a scent attractant for
stimulating canines and felines. US Patent 5,786,382.
Choudhury A. (1997). The clouded leopard in Manipur and Nagaland. Journal of the Bombay
Natural History Society 94, 389-391.
79
References
Diplomarbeit
Andreas Wilting
Choudhury S.R. (1972). Tiger census in India. Cheetal 15, 67-84.
Choudhury S.R. (1970). Let us count our tigers. Cheetal 14, 41-51.
Christiansen P. (2006). Sabertooth characters in the clouded leopard (Neofelis nebulosa
Griffiths 1821). Journal of Morphology 267, 1186-1198.
Christiansen P. & Adolfssen J.S. (2005). Bite forces, canine strength and skull allometry in
carnivores (Mammalia, Carnivora). Journal of Zoology 266, 133-151.
Corander J. & Marttinen P. (2006). Bayesian identification of admixture events using
multilocus molecular markers. Molecular Ecology 15, 2833-2843.
Corander J. Marttinen P., Sirén J., & Tang J. (2006). BAPS: Bayesian Analysis of Population
Structure, Manual v. 4.14. Department of Mathematics and Statistics, University of Helsinki.
Corander J., Waldmann P. & Sillanpaa M.J. (2003). Bayesian analysis of genetic
differentiation between populations. Genetics 163, 367-374.
Corbet G.B. (1970). Patterns of subspecific variation. Symposium of the Zoology Society
London 26, 105-116.
Corbet G.B. & Hill J.E. (1992). Family Felidae - Cats. In: 'The Mammals of the Indo-Malayan
Region: A systematic review'. pp. 219-228. Oxford University Press for British Natural
History Museum, London.
Crandall K.A., Bininda-Emonds O.R.P., Mace G.M. & Wayne R.K. (2000) Considering
evolutionary processes in conservation biology. Trends in Ecology & Evolution 17, 390-395.
Crête M. & Messier F. (1987). Evaluation of indices of gray wolf, Canis lupus, density in
hardwood-conifer forest in southwestern Quebec. Canadian Field-Naturalist 101, 147-152.
Crooks K.R. & Soulé M.E. (1999). Mesopredator release and avifaunal extinctions in a
fragmented system. Nature 400, 563-566.
Culver M., Johnson W.E., Pecon-Slattery J. & O'Brien, S. J. (2000). Genomic ancestry of the
American puma (Puma concolor). Journal of Heredity 91, 186-197.
Curran L.M., Trigg S.N., McDonald A.K., Astiani D., Hardiono Y.M., Siregar P., Caniago I.
& Kasischke E. (2004). Lowland forest loss in protected areas of Indonesian Borneo. Science
303, 1000-1003.
Cuvier G. (1823). Recherches sur les Ossemens Fossiles, où l'on Rétablit les Charactéres de
Plusiers Animaux dont les Révolutions du Globe ont détuit les Espéces. Dufour and
D'Ocagne. Paris.
80
Diplomarbeit
Andreas Wilting
References
Dalimin M.N. & Ahmad R. (1999). Mud volcano of Tabin Wildlife Reserve, Lahad Datu,
Sabah. In: 'Tabin Scientific Expedition'. Eds: Mohamed M., Andau M., Dalimin M.N. &
Malim T.P.; pp. 7-18. Universiti Malaysia Sabah, Kota Kinabalu.
Davies G. & Payne J. (1982). A faunal survey of Sabah. IUCN/WWF Project No.1692.WWF
Malaysia.
Davies R.G. (1990). Sighting of a clouded leopard (Neofelis nebulosa) in a troop of pig-tail
macaques (Macaca nemestrina) in Khao Yai National Park, Thailand. Natural History
Bulletin Siam Society 28, 95-96.
Dinerstein E. & Mehta J.N. (1989). The clouded leopard in Nepal. Oryx 23, 199-201.
Dinerstein E., Rijal A., Bookbinder M., Kattel B. & Rajuria A. (1999). Tigers as neighbours:
efforts to promote local guardianship of endangered species in lowland Nepal. In: 'Riding the
Tiger - Tiger Conservation in Human-Dominated Landscapes'. Eds: Seidensticker J. &
Jackson P.; pp. 316-333. Cambridge University Press. Cambridge.
Ecotone Management (1998). Preliminary environmental assesments for upgrading of 23 km
forest road in Tabin Wildlife Reserve, Lahad Datu, Sabah. Ecotone Management. Lahad Datu,
Malaysia.
Ernest H.B., Pen Edo M.C.T., May B.P., Syvanen M. & Boyce W.M. (2000). Molecular
tracking of mountain lions in the Yosemite Valley region in California: genetic analysis using
microsatellites and faecal DNA. Molecular Ecology 9, 433-441.
Excoffier L., Laval G., & Schneider S. (2005). Arlequin (version 3.0): An integrated software
package for population genetics data analysis. Evolutionary Bioinformatics online 1, 47-50.
Eyre-Walker A. & Awadalla P. (2001). Does human mtDNA recombine? Journal of
Molecular Evolution 51, 430-435.
Fahrig L. (1997). Relative effects of habitat loss and fragmentation on population extinction.
Journal of Wildlife Management 61, 603-610.
Felsenstein J. (2006). PHYLIP (Phylogeny inference package) version 3.66. Distributed by
the author. Department of Genome Sciences. University of Washington, Seattle.
Fernando P., Vidya T.N.C., Payne J., Stuewe M., Davison G., Alfred R.J., Andau P., Bosi E.,
Kilbourn A. & Melnick D.J (2003). DNA analysis indicates that Asian elephants are native to
Borneo and are therefore a high priority for conservation. PLOS Biology 1, 110-115.
Frantz A.C., Schaul M., Pope L.C., Fack F., Schley L., Muller C.P. & Roper T.J. (2004).
Estimating population size by genotyping remotely plucked hair: the Eurasian badger. Journal
of Applied Ecology 41, 985-995.
81
References
Diplomarbeit
Andreas Wilting
Fraser D.J. & Bernatchez L. (2001). Adaptive evolutionary conservation: towards a unified
concept for defining conservation units. Molecular Ecology 10, 2741-2752.
Fuller D.O., Jessup T.C. & Salim A. (2004). Loss of forest cover in Kalimantan, Indonesia,
since the 1997-1998 El Niño. Conservation Biology 18, 249-254.
Fuller T.K. & Murray D.L. (1998). Biological and logistical explanations of variation in wolf
population density. Animal Conservation 1, 153-157.
Gerloff U., Schlötterer C., Rassmann K., Rambold I., Hohmann G., Fruth B. & Tautz, D.
(1995). Amplification of hypervariable simple sequence repeats (microsatellites) from
excremental DNA of wild living bonobos (Pan paniscus). Molecular Ecology 4, 515-518.
Gese E.M. (2001). Monitoring of terrestrial carnivore populations. In: 'Carnivore
Conservation'. Eds: Gittleman J.L., Funk S.M., Macdonald D.W. & Wayne R.K.; pp. 372396. Cambridge University Press. Cambridge.
Gittleman J.L., Funk S.M., Macdonald D.W. & Wayne R.K. (2001). Why 'carnivore
conservation'? In: 'Carnivore Conservation'. Eds: Gittleman J.L., Funk S.M., Macdonald
D.W. & Wayne R.K.; pp. 1-7. Cambridge University Press. Cambridge.
Goossens B., Waits L.P. & Taberlet P. (1998). Plucked hair samples as a source of DNA:
reliability of dinucleotide microsatellite genotyping. Molecular Ecology 7, 1237-1241.
Gorog A.J., Sinaga M.H. & Engstrom M.D. (2004). Vicariance or dispersal? Historical
biogeography of three Sunda shelf murine rodents (Maxomys surifer, Leopoldamys sabanus
and Maxomys whiteheadi). Biological Journal of the Linnean Society 81, 91-109.
Grassman L.I. Jr. (1999). Ecology and behavior of the Indochinese leopard in Kaeng Karchan
National Park, Thailand. Natural History Bulletin Siam Society 47, 77-93.
Grassman L.I. Jr., Tewes M.E., Silvy N.J. & Kreetiyutanont K. (2005). Ecology of three
sympatric felids in a mixed evergreen forest in North-Central Thailand. Journal of
Mammalogy 86, 29-38.
Gray J.E. (1867). Notes on the skulls of the cats (Felidae). Proceedings of the Zoological
Society of London 258-277.
Griffith E. (1821). General and particular descriptions of the vertebrated animals arranged
conformably to the modern discoveries and improvements in zoology. Baldwin, Cradock and
Joy. London.
Griffiths M. (1993). Final Report: Management of Large Mammals. WWF Indonesia: Medan.
82
Diplomarbeit
Andreas Wilting
References
Grigione M.M., Burman P., Bleich V.C., & Pierce B.M. (1999). Identifying individual
mountain lions Felis concolor by their tracks - refinement of an innovative technique.
Biological Conservation 88, 25-32.
Groves C.P. (2001). Primate Taxonomy. Smithsonian,Washington, D.C..
Guggisberg C.A.W. (1975). Wild cats of the world. David and Charles. London.
Hall T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series 41, 95-98.
Haltenorth T. (1936). Die verwandschaftliche Stellung der Großkatzen zueinander. Zeitschrift
für Säugetierkunde 11, 32-105.
Hart B.L. & Leedy M.G. (1985). Analysis of the catnip reaction: mediation by olfactory
system, not vomeronasal organ. Behavioral and Neural Biology 44, 38-46.
Hasegawa M., Kishino H., & Yano T. (1985). Dating of the human-ape splitting by a
molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22, 160-174.
Hatch R.C. (1972). Effect of drugs on catnip (Nepeta cataria) - induced pleasure behavior in
cats. American Journal of Veterinary Research 33, 143-155.
Heaney L.R. (1985). Zoogeographic evidence for Middle and Late Pleistocene land bridges to
the Philippine islands. Modern Quaternary Research SE Asia 9, 127-143.
Heaney L.R. (1991). A synopsis of climatic and vegetational change in southeast Asia.
Climatic Change 19, 53-61.
Hemmer H. (1964). Zur systematischen Stellung des Nebelparders, Neofelis nebulosa
(Griffith 1821). Säugetierkundliche Mitteilungen München 12, 13-17.
Hemmer H. (1968). Studien zur Ethologie des Nebelparders Neofelis nebulosa (Griffith 1821)
und des Irbis Uncia uncia (Schreber 1775). Veröffentlichungen der Zoologischen
Staatssammlung München 12, 155-247.
Henschel P. & Ray J. (2003) Leopards in African rainforests: survey and monitoring
techniques. pp. 1-50. WCS Global Carnivore Program. New York.
Hewitt G. (2000). The genetic legacy of the Quaternary ice ages. Nature 405, 907-913.
Hill J.O., Pavlik E.J., Smith G.L.III, Burghardt G.M. & Coulson P.B. (1976). Speciescharacteristic responses to catnip by undomesticated felids. Journal of Chemical Ecology 2,
239-253.
83
References
Diplomarbeit
Andreas Wilting
Hodgson B.H. (1853). Observations on some rare Indian mammals. In ‘Proceedings of the
Zoological Society of London’ Eds: Gray J.E.; 35-38, pp. 190-192.
Holmes D.A. (2000). Deforestation in Indonesia: a review of the situation in Sumatra,
Kalimantan, and Sulawesi. World Bank. Jakarta.
Høybye-Mortensen K. (2004). The tortoise Manouria emys emys: behaviour and habitat in the
wild. M.Sc. University of Southern Denmark.
Huelsenbeck J.P., Bull J.J. & Cunningham C.W. (1996). Combining data in phylogenetic
analysis. Trends in Ecology & Evolution 11, 152-157.
Inger R.F. Voris H.K. (2001). The biogeographical relations of the frogs and snakes of
Sundaland. Journal of Biogeography 28, 863-891.
IUCN The World Conservation Union (2006). Neofelis nebulosa - status accessed 2002. In:
'2006 IUCN Red List of Threatened Species.'.
Jackson R. (2001). Clouded leopard. In: 'The new Encyclopedia of Mammals'. Eds:
Macdonald D.W.; pp. 31. Oxford University Press. Oxford.
Jae-Heup K., Eizirik E., O'Brien S.J. & Johnson W.E. (2001). Structure and patterns of
sequence variation in the mitochondrial DNA control region of the great cats. Mitochondrion
1, 279-292.
Jepson P., Jarvie J.K., MacKinnon K. & Monk K.A. (2001). The end for Indonesia's lowland
forests? Science 292, 859-861.
Jerdon T.C. (1874). The mammals of India: natural history. John Wheldon. London.
Johnson C., Isaac J., & Fisher D. (2007). Rarity of a top predator triggers continent-wide
collapse of mammal prey: dingoes and marsupials in Australia. Proceedings of the Royal
Society B: Biological Sciences 274, 341-346.
Johnson W.E., Eizirik E., Pecon-Slattery J., Murphy W.J., Antunes A., Teeling E., & O'Brien
S.J. (2006). The late Miocene radiation of modern Felidae: a genetic assessment. Science 311,
73-77.
Johnson W.E. & O'Brien S.J. (1997). Phylogenetic reconstruction of the Felidae using 16S
rRNA and NADH-5 mitochondrial genes. Journal of Molecular Evolution 44 (Suppl 1), 98116.
Karanth K.U. (1987). Tigers in India: a critical review of field censuses. In: 'Tigers of the
world.'. Eds: Tilson R.L. & Seal U.S.; pp. 118-133. Noyes Publication: Park Ridge, New
Jersey, USA.
84
Diplomarbeit
Andreas Wilting
References
Karanth K.U. (1995). Estimating tiger populations from camera-trap data using capturerecapture models. Biological Conservation 71, 333-338.
Karanth K.U., Chundawat R.S., Nichol J.D. & Kumar N.S. (2004). Estimation of tiger
densities in the tropical dry forests of Panna, Central India, using photographic capturerecapture sampling. Animal Conservation 7, 285-290.
Karanth K.U. & Nichols J.D. (1998). Estimation of tiger densities in India using photographic
captures and recaptures. Ecology 79, 2852-2862.
Karanth K.U., Nichols J.D., Seidensticker J., Dinerstein E., Smith J.L.D., McDougal C.,
Johnsingh A.J.T., Chundawat R.S. & Thapar V. (2003). Science deficiency in conservation
practice: the monitoring of tiger popoulations in India. Animal Conservation 6, 141-146.
Karns D.R., O'Bannon A., Voris H.K., & Weigt L.A. (2000). Biogeographical implications of
mitochondrial DNA variation in the Bockadam snake (Cerberus rynchops, Serpentes:
Homalopsinae) in Southeast Asia. Journal of Biogeography 27, 391-402.
Kawanishi K. (2002). Population status of tigers (Panthera tigris) in a primary rainforest of
peninsular Malaysia. Ph.D. University of Florida.
Kawanishi K. & Sunquist M.E. (2004). Conservation status of tigers in a primary rainforest of
Peninsular Malaysia. Biological Conservation 120, 329-344.
Kendall K.C., Metzgar L.H., Patterson D.A., & Steele B.M. (1992). Power of sign surveys to
monitor population trends. Ecological Applications 2, 422-430.
Kimura M. (1980). A simple method for estimating evolutionary rates of base substitutions
through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16,
112-120.
Kitchener A.C., Beaumont M.A. & Richardson D. (2006). Geographical variation in the
clouded leopard, Neofelis nebulosa, reveals two species. Current Biology 16, 2377-2383.
Kohn M.H., York E.C., Kamradt D.A., Haught G., Sauvajot R.M., & Wayne R.K. (1999).
Estimating population size by genotyping faeces. Proceedings of the Royal Society of London
Series B. 266, 657-663.
Koopman K.F. (1989). Distributional patterns of the Indo-Malayan bats (Mammalia:
Chiroptera). American Museum Novitates 2942, 1-19.
Kumar S., Tamura K. & Nei M. (2004). MEGA3: Integrated software for Molecular
Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5, 150163.
85
References
Diplomarbeit
Andreas Wilting
Lamber F.R. (1992). The consequences of selective logging for Bornean forest birds.
Philosophical Transactions of the Royal Society of London series B 335, 443-457.
Landres P.B., Verner J. & Thomas J.W. (1988). Ecological uses of vertebrate indicator
species: a critique. Conservation Biology 2, 316-325.
Law G. & Tatner P. (1998). Behaviour of a captive pair of clouded leopards (Neofelis
nebulosa): introduction without injury. Animal Welfare 7 (1), 57-76.
Lewison R., Fitzhugh E.L. & Galentine S.P. (2001). Validation of a rigorous track
classification technique: identifying individual mountain lions. Biological Conservation 99,
313-321.
Leyhausen P., Grzimek B. & Zhivotchenko V. I. (1990). Panther-like cats and their relatives.
In 'Grzimek's Encyclopaedia, Vol. 4, Mammals'. Eds: Grzimek B. pp. 1-49. McGraw-Hill,
New York.
Lorenzini R., Posillico M., Lovari S. & Petrella, A. (2004). Non-invasive genotyping of the
endangered Alpennine brown bear: a case study not to let one's hair down. Animal
Conservation 7, 199-209.
Lucchini V., Fabbri E., Marucco F., Ricci S., Boitani L., & Randi E. (2002). Noninvasive
molecular tracking of colonizing wolf (Canis lupus) packs in the western Italian Alps.
Molecular Ecology 11, 857-868.
Luo S.-J., Kim J.-H., Johnson W.E., van der Walt J., Martenson J., Yuhki N., Miquelle D.G.,
Uphyrkina O., Goodrich J.M., Quigley H.B., Tilson R., Brady G., Martelli P., Subramaniam
V., McDougal C., Hean S., Huang S.-Q., Pan W., Karanth K.U., Sunquist M., Smith J.L.D., &
O'Brien S.J. (2004). Phylogeography and genetic ancestry of tigers (Panthera tigris). PLOS
Biology 2, 2275-2293.
Macdonald D.W. (1980). Patterns of scent marking with urine and faeces amongst carnivore
communities. Symposium of the Zoology Society London 45, 107-139.
Macdonald S.M. & Mason C.F. (1982). The otter Lutra lutra in central Portugal. Biological
Conservation 22, 207-215.
Mace G.M. (2004). The role of taxonomy in species conservation. Philosophical Transactions
of the Royal Society B: Biological Sciences 359, 711-719.
Mace G.M. & Balmford A. (2000). Patterns and processes in contemporary mammalian
extinction. In: 'Future Priorities for the Conservation of Mammalian Diversity'. Eds:
Entwhistle A. & Dunstone N.; pp. 27-52. Cambridge University Press. Cambridge.
Malim T.P. & Mohamed M. (1999). Butterfly monitoring using point count method at Tabin
Wildlife Reserve, Lahad Datu, Sabah. In: 'Tabin Scientific Expedition'. Eds: Mohamed M.,
86
Diplomarbeit
Andreas Wilting
References
Andau M., Dalimin M.N. & Malim T.P.; pp. 99-110. Universiti Malaysia Sabah, Kota
Kinabalu.
Marker L.L. & Dickman A.J. (2003). 1st: Will Asiatic cheetahs fall for Calvin Klein perfume?
& 2nd: Ocelot obsession. Cat News/IUCN SSC 38, 25.
Marsh C.W. (1995). Management plan (1995–2000): Danum Valley Conservation Area,
Sabah, Malaysia. Yayasan Sabah/Innoprise Corporation. Kota Kinabalu.
Marsh C.W. & Greer A.G. (1992). Forest land-use in Sabah, Malaysia: an introduction to
Danum Valley. Philosophical Transactions of the Royal Society of London series B 335, 331339.
Marsh C.W., Tay J., Pinard M.A., Putz F.E. & Sullivan T.E. (1996). Reduced impact logging:
a pilot project in Sabah, Malaysia. In: 'Dipterocarp forest ecosystems'. Eds: Schulte A. &
Schöne D.. World Scientific. Singapore.
Mattern M.Y. & McLennan D.A. (2000). Phylogeny and speciation of felids. Cladistics 16,
232-253.
Maynard Smith J. (1998). Evolution in diploid populations. In 'Evolutionary Genetics.'. Eds
Maynard Smith J. pp. 31-46. Oxford University Press.
McDaniel G.W., McKelvey K.S., Squires J.R. & Ruggiero L.F. (2000). Efficiency of lures
and hair snares to detect lynx. Wildlife Society Bulletin 28, 119-123.
Mehta J.N. & Dhewaju R.G. (1990). A note on the record of clouded leopards in Nepal. Tiger
Paper 21-22.
Meijaard E. (2004). Biogeographic history of the Javan leopard Panthera pardus based on a
craniometric analysis. Journal of Mammalogy 85, 302-310.
Menotti-Raymond M., David V.A., Lyons L.A., Schäffer A.A., Tomlin J.F., Hutton M.K., &
O'Brien S.J. (1999). A genetic linkage map of microsatellites in the domestic cat (Felis catus).
Genomics 57, 9-23.
Mills M.G.L. (1997). Census techniques for large carnivores. In: 'Proceedings of a symposium
on lions and leopards as game ranch animals.'. Eds: van Heerden J.; Wildlife Group of the
South African Veterinary Association. Onderstepoort.
Mills L.S., Citta J.J., Lair K.P. & Schwartz M.K. (2000). Estimating animal abundance using
noninvasive DNA sampling: promise and pitfalls. Ecological Applications 10, 283-294.
Minch E., Ruiz-Linares A. & Goldstein D.B. (1995). MICROSAT. Available:
http://hpgl.stanford.edu/projects/microsat/ via internet. Accessed 13 November 2006.
87
References
Diplomarbeit
Andreas Wilting
Mitchell A.H. (1994). Ecology of the hose's langur, (Prebytis hosei), in mixed logged and
unlogged dipterocarp forest of northeast Borneo. Ph.D. Yale University.
Molteno A.J., Sliwa A. & Richardson P.R.K. (1998). The role of scent marking in a freeranging, female black-footed cat (Felis nigripes). Journal of Zoology 245, 35-41.
Moritz C. (1994). Defining 'evolutionary significant units' for conservation. Trends in Ecology
& Evolution 9, 373-375.
Murphy M.A., Waits L.B., Kendall K.C., Wasser S.K., Higbee J.A. & Bodgen R. (2002). An
evaluation of long-term preservation methods for brown bear (Ursus arctos) faecal DNA
samples. Conservation Genetics 3, 435-440.
Naidenko S.V. & Serbenyuk M.A. (1995). Urine marking in the European lynx (Felis lynx
L.). Lutreola 13-20.
Nichols J.D. & Karanth K.U. (2002). Statistical concepts: estimating absolut densities of
tigers using capture-recapture sampling. In: 'Monitoring Tigers and their Prey'. Eds: K. U.
Karanth K.U. & Nichols J.D.; pp. 121-137. Centre of Wildlife Studies. New York.
Nowell K. & Jackson P. (1996). Wild cats: status, survey and conservation action plan.
Gland, IUCN.
Nowell K. & Jackson P. (1995). Clouded leopard - Taiwan: status of clouded leopard and role
in aboriginal traditions on Taiwan. In: 'Clouded leopard - Taiwan (Neofelis nebulosa
brachyurus): Population and Habitat Viability Assessment Workshop.'. Eds: Wang Y. Chu S.W., Wildt D.E.& Seal U.S,; pp. 25-30. Taipei Zoo. Taipei, Taiwan.
O'Brien S.J. & Mayr E. (1991). Bureaucratic mischief: recognizing endangered species and
subspecies. Science 251, 1187-1188.
Okamura M., Doi T., Sakaguchi N. & Izawa M. (2000). Annual reproductive cycle of the
Iriomote cat Felis iriomotensis. Mammal Study 25, 75-85.
Otis D.L., Burnham K.P., White G.C. & Anderson D.R. (1978). Statistical inference from
capture data on closed populations. Wildlife Monographs 62, 1-135.
Page R.D.M. (1996). TreeView: An application to display phylogenetic trees on personal
computers. Computer Applications in the Bioscience 12, 357-358.
Paine R.T. (1966). Food web complexity and species diversity. American Naturalist 100, 6575.
Palen G.F. & Goddard G.V. (1966). Catnip and oestrous behaviour in the cat. Animal
Behaviour 14, 372-377.
88
Diplomarbeit
Andreas Wilting
References
Panwar H.S. (1979). A note on tiger census technique based on pugmark tracings. Indian
Forester 18-36.
Payne J. (1986). Tabin Wildlife Reserve, Sabah: A preliminary managment plan. WWF
Malaysia.
Perez I., Geffen E. & Mokady Y. (2006). Critically endangered Arabian leopards Panthera
pardus nimr in Israel: estimating population parameters using molecular scatology. Oryx 40,
295-301.
Pesole G., Gissi C. & De Chirico A. (1999). Nucleotide substitution rate of mammalian
mitochondrial genomes. Journal of Molecular Evolution 48, 427-434.
Peters G. & Hast M.H. (1994). Hyoid structure, laryngeal anatomy and vocalization in felids
(Mammalia: Carnivora: Felidae). Zeitschrift für Säugetierkunde 59, 87-104.
Pimm S.L., Russel G.L., Gittleman J.L. & Brooks T.M. (1995). The future of biodiversity.
Science 269, 347-350.
Pocock R.I. (1939). Family Felidae. In: 'Fauna of British India (Mammals)'. pp. 190-331.
Taylor and Francis of London.
Pocock R.I. (1917). The classification of existing Felidae. Annals and Magazine of Natural
History 20, 329-350.
Prater S.H. (1971). The Cats. In: 'The book of Indian animals'. pp. 46-81. Bombay Natural
History Society.
Purvis A., Gittleman J.L., Cowlishaw G., & Mace G.M. (2000). Predicting extinction risk in
declining species. Proceedings of the Royal Society of London B. 267, 1947-1952.
Rabinowitz A.R. (1988). The Clouded leopard in Taiwan. Oryx 22, 46-47.
Rabinowitz A.R. (1989). The density and behavior of large cats in a dry tropical forest mosaic
in Huai Kha Khaeng Wildlife Sanctuary, Thailand. Natural History Bulletin Siam Society 37,
235-251.
Rabinowitz A.R., Andau P., & Chai P.P.K. (1987). The Clouded leopard in Malaysian
Borneo. Oryx 21, 107-111.
Ralls K. (1971). Mammalian scent marking. Science 171, 443-449.
Raymond M. & Rousset F. (1995). GENEPOP (Version 1.2): a population genetic software
for exact test and ecumenicism. Journal of Heredity 86, 248-249
89
References
Diplomarbeit
Andreas Wilting
Rexstad E. & Burnham K.P. (1991). User's guide for interactive program CAPTURE.
Abundance estimation of closed populations. Colorado State University: Fort Collins,
Colorado, USA.
Riordan P. (1998). Unsupervised recognition of individual tigers and snow leopards from
their footprints. Animal Conservation 1, 253-262.
Roelke M.E., Martenson J.S. & O'Brien S.J. (1993). The consequences of demographic
reduction and genetic depletion in the endangered Florida panther. Current Biology 3, 340350.
Ruedi M., Auberson M. & Savolainen V. (1996). Biogeography of Sulawesian shrews: testing
for their origin with a parametric bootstrap on molecular data. Molecular Phylogenetics and
Evolution 9, 567-571.
Ryder O.A. (1986). Species conservation and systematics: the dilemma of subspecies. Trends
in Ecology & Evolution 1, 9-10.
Saitou N. & Nei M. (1987). The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4, 406-425.
Sale J.B. (1994). Management plan for Tabin Wildlife Reserve. Wildlife Department,
Ministry of Tourism and Environmental Development, Sabah, Malaysia, Kota Kinabalu,
Sabah.
Sambrook J., Fritsch E., & Maniatis T. (1989). Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory Press, New York.
Santiapillai C. & Ashby K.R. (1988). The clouded leopard in Sumatra. Oryx 22, 44-45.
Schaller G.B. & Crawshaw P.G. (1980). Movement patterns of Jaguar. Biotropica 12, 161168.
Schmidt K. & Kowalczyk R. (2006). Using scent-marking stations to collect hair samples to
monitor Eurasian lynx populations. Wildlife Society Bulletin 34, 466.
Seidensticker J., Hornocker M.G., Wiles W.V. & Messick J.P. (1973). Mountain lion social
organization in the Idaho primitive area. Wildlife Monographs 35, 1-61.
Selous E.M. & Banks E. (1935). The clouded leopard in Sarawak. Sarawak Museum Journal
4, 263-266.
Sergio F., Newton I. & Marchesi L. (2005). Top predators and biodiversity. Nature 436, 192.
Shaffer M.L. (1981). Minimum population sizes for species conservation. BioScience 31, 131134.
90
Diplomarbeit
Andreas Wilting
References
Sharma S., Jhala Y. & Sawarkar V.B. (2005). Identification of individual tigers (Panthera
tigris) from their pugmarks. Journal of Zoology 267, 9-18.
Sheldon F.H., Moyle R.G. & Kennard J. (2001). Ornithology of Sabah: History, gazetteer,
annotated checklist and bibliography. Ornithological Monographs 52.
Siegert F., Ruecker G., Hinrichs A. & Hoffmann A.A. (2001). Increased damage from fires in
logged forests during droughts caused by El Niño. Nature 414, 437-440.
Sillero-Zubiri C. & Laurenson M.K. (2001). Interactions between carnivores and local
communities: conflict or co-existence? In: 'Carnivore Conservation'. Eds: Gittleman J.L.,
Funk S.M., Macdonald D.W. & Wayne R.K.; pp. 282-312. Cambridge University Press.
Cambridge.
Silver S.C., Ostro L.E.T., Marsh L.K., Maffei L., Noss A.J., Kelly M.J., Wallace R.B., Gomez
H. & Ayala G. (2004). The use of camera traps for estimating jaguar Panthera onca
abundance and density using capture/recapture analysis. Oryx 38, 148-154.
Simberloff D. (1998). Flagships, umbrellas, and keystones: Is single-species management
passé in the landscape era? Biological Conservation 83, 247-257.
Smallwood K.S. & Fitzhugh E.L. (1993). A rigorous technique for identifying individual
mountain lions Felis concolor by their tracks. Biological Conservation 65, 51-59.
Smith D.A., Ralls K., Davenport B., Adams B. & Maldonado J.E. (2001). Canine assistants
for conservationists. Science 291, 435b.
Smith D.A., Ralls K., Hurt A., Adams B., Parker M., Davenport B., Smith M.C. &
Maldonado J.E. (2003). Detection and accuracy rates of dogs trained to find scats of San
Joaquin kit foxes (Vulpes macrotis mutica). Animal Conservation 6, 339-346.
Smith J.L.D., McDougal C.W. & Miquelle D.G. (1989). Scent marking in free-ranging tigers,
Panthera tigris. Animal Behaviour 37, 1-10.
Soisalo M.K. & Cavalcanti, S.M.C. (2006). Estimating the density of a jaguar population in
the Brazilian Pantanal using camera-traps and capture-recapture sampling in combination
with GPS radio-telemetry. Biological Conservation 129, 487-496.
Soulé M.E., Bolger D.T., Alberts A.C., Wrights J., Sorice M. & Hill, S. (1988). Reconstructed
dynamics of rapid extinctions of chaparral-requiring birds in urban habitat islands.
Conservation Biology 2, 75-92.
Stander P.E. (1998). Spoor counts as indices of large carnivore populations: the relationship
between spoor frequency, sampling effort and true density. Journal of Applied Ecology 35,
378-385.
91
References
Diplomarbeit
Andreas Wilting
Steiper M.E. (2006). Population history, biogeography, and taxonomy of orangutans (Genus:
Pongo) based on a population genetic meta-analysis of multiple loci. Journal of Human
Evolution 50, 509-522.
Sunquist M.E. & Sunquist F. (2002). Wild Cats of the World. The University of Chicago
Press, Chicago.
Swinhoe R. (1862). On the mammals of the island of Formosa. Proceedings of the Zoological
Society of London, 347-365.
Swofford D.L. (2001). PAUP* phylogenetic analysis using parsimony and other methods.
Sunderland, MA, Sinauer Associates.
Taberlet P., Griffin S., Goossens B., Questiau S., Manceau V., Escaravage N., Waits L.P. &
Bouvet J. (1996). Reliable genotyping of samples with very low DNA quantities using PCR.
Nucleic Acids Research 24, 3189-3194.
Tajima F. (1983). Evolutionary relationship of DNA sequences in finite populations. Genetics
105, 437-460.
Takezaki N., Rzhetsky A. & Nei M. (1995). Phylogenetic test of the molecular clock and
linearized trees. Molecular Biology and Evolution 12, 823-833.
Tan Bangjie (1984). The status of felids in China. In 'The plight of cats. Proceedings of the
meeting and workshop of the IUCN/SSC Cat Specialist Group.'. pp. 33-47. Madhya Pradesh,
India.
Terborgh J. (1974). Preservation of natural diversity: the problem of extinction prone species.
BioScience 24, 715-722.
Terborgh J., Estes J., Paquet P., Ralls K., Boyd-Heger D., Miller B. & Noss R.F. (1999). The
role of top carnivores in regulating terrestrial ecosystems. Wild Earth, 42-56.
Terborgh J., Feeley K., Silman M., Nunez P.V. & Balukjian B. (2006). Vegetation dynamics
of predator-free land-bridge islands. Journal of Ecology 94, 253-263.
Terborgh J., Lopez L., Nunez P.V., Rao M., Shahabuddin G., Orihuela G., Riveros M.,
Ascanio R., Adler G.H, Lambert T.D. & Balbas L. (2001). Ecological meltdown in predatorfree forest fragments. Science 294, 1923-1926.
Thompson J.D., Higgins D.G. & Gibson T.J. (1994). CLUSTAL W: improving the sensitivity
of progressive multiple sequence alignment through sequence weighting, position-specific
gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Tjia H.D. (1980). The Sunda self, Southeast Asia. Zeitschrift für Geomorphologie 24, 405427.
92
Diplomarbeit
Andreas Wilting
References
Todd N.B. (1962). Inheritance of the catnip response in domestic cats. Journal of Heredity 53,
54-56.
Trolle M. & Kery M. (2003). Estimation of ocelot density in the Pantanal using capturerecapture analysis of camera-trapping data. Journal of Mammalogy 84, 607-614.
Uphyrkina O., Johnson W.E., Quigley H.B., Miquelle D.G., Marker L., Bush M.E. & O'Brien
S.J. (2001). Phylogenetics, genome diversity and origin of modern leopard, Panthera pardus.
Molecular Ecology 10, 2617-2633.
Van Nieuwstadt M.G.L. & Sheil D. (2005). Drought, fire and tree survival in a Borneo rain
forest, East Kalimantan, Indonesia. Journal of Ecology 93, 191-201.
Voris H.K. (2000). Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems
and time durations. Journal of Biogeography 27, 1153-1167.
Walsh R.P.D (1996). Drought frequency changes in Sabah and adjacent parts of northern
Borneo since the late nineteenth century and possible implications for tropical rainforest
dynamics. Journal of Tropical Ecology 12, 385-407.
Wang Y., Chu S., Wildt D. & Seal U.S. (1995). Clouded leopard - Taiwan (Neofelis nebulosa
brachyurus): Population and Habitat Viability Assessment Workshop. Taipei Zoo, Taiwan.
Waples R.S. (1991). Pacific salmon, Oncorhynchus spp. & the definition of 'species' under the
endangered species act. Marine Fisheries Reviews 53, 11-22.
Waples R.S. (1995). Evolutionary significant units and the conservation of biological
diversity under the endangered species act. In 'Evolution and the aquatic ecosystem: Defining
unique units in population conservation'. Eds: Nielson J.L. & Powers G.A. pp. 8-27.
American Fisheries Society, Bethesda, Maryland.
Warren K.S., Verschoor E.J., Langenhuijzen S., Heryanto, Swan R.A., Vigilant L. & Heeney
J.L. (2001). Speciation and intrasubspecific variation of Bornean orangutans Pongo pygmaeus
pygmaeus. Molecular Biology and Evolution 18, 471-480.
Wasser S.K., Davenport B., Ramage E.R., Hunt K.E., Parker M., Clarke C. & Stenhouse G.
(2004). Scat detection dogs in wildlife research and management: application to grizzly and
black bears in the Yellowhead Ecosystem, Alberta, Canada. Canadian Journal of Zoology 82,
475-492.
Weber W. & Rabinowitz A.R. (1996). A global perspective on large carnivore conservation.
Conservation Biology 10, 1046-1054.
Werdelin L. (1983). Morphological patterns in the skull of cats. Biological Journal of the
Linean Society 19, 375-391.
93
References
Diplomarbeit
Andreas Wilting
White G.C., Anderson D.R., Burnham K.P. & Otis D.L. (1982). Capture-recapture and
removal methods for sampling closed populations. Los Alamos National Laboratory. Los
Alamos, USA.
Whitmore T.C. (1998). An introduction to tropical rain forests. Oxford University Press.
Whitmore T.C. (1984). Tropical rain forests of the far east. Oxford University Press.
Whitten A.J., Damanik S.J., Anwar J. & Hisyam N. (1984). The ecology of Sumatra. Gadjah
Mada University Press. U.S. Distributer: Sinauer Associates.
Whittle N. (1981). Reactions of tigers to the scent of conspecifics. Journal of Zoology 194,
263-265.
Wielebnowski N.C., Fletchall N., Carlstead K., Busso J.M., & Brown J.L. (2002).
Noninvasive assessment of adrenal activity associated with husbandry and behavioral factors
in the North American clouded leopard population. Zoo Biology 21, 77-98.
Wildt D.E., Bush M.E., Goodrowe K.L., Packer C., Pusey A.E., Brown J.L., Joslin P. &
O'Brien S.J. (1987). Reproductive and genetic consequences of founding isolated lion
populations. Nature 329, 328-331.
Williamson J.E., Huebinger R.M., Sommer J.A., Louis E.E. & Barber R.C. (2002).
Development and cross-species amplification of 18 microsatellite markers in the Sumatran
tiger (Panthera tigris sumatrae). Molecular Ecology Notes 2, 110-112.
Wilson G.J. & Delahay R.J. (2001). A review of methods to estimate the abundance of
terrestrial carnivores using field signs and observations. Wildlife Research 28, 151-164.
Wilson G.J., Frantz A.C., Pope L.C., Roper T.J., Burke T.A., Cheeseman C.L. & Delahay R.J.
(2003). Estimation of badger abundance using faecal DNA typing. Journal of Applied
Ecology 40, 666.
Wilson K.R. & Anderson D.R. (1985). Evaluation of two density estimators of small mammal
population size. Journal of Mammalogy 66, 13-21.
Wood H.S. (1949). The Clouded Leopard. Journal of the Bengal Natural History Society 23,
77-79.
Woods J., Paetkau D., Lewis D., McLellan B., Proctor M. & Strobeck C. (1999). Genetic
tagging free-ranging black and brown bears. Wildlife Society Bulletin 27, 616-627.
Woods P. (1989). Effects of logging, drought, and fire on structure and composition of
tropical forests in Sabah, Malaysia. Biotropica 21, 290-298.
94
Diplomarbeit
Andreas Wilting
References
Wright S.J., Gompper M.E. & DeLeon B. (1994). Are large predators keystone species in
neotropical forests - the evidence from Barro-Colorado Island. Oikos 71, 294.
Yu L. & Zhang, Y.P. (2005). Phylogenetic studies of pantherine cats (Felidae) based on
multiple genes, with novel application of nuclear ß-fibrinogen intron 7 to carnivores.
Molecular Phylogenetics and Evolution 35, 483-495.
95
Diplomarbeit
Andreas Wilting
Appendix
Appendix
Appendix 1 List of mammal species recorded during the course of this study in Tabin
Wildlife Reserve, Sabah, Malaysia.
No
Family
Scientific name
Common name
Record§
Moonrat
NS / Regular
South-East Asian White-Toothed Shrew
Dead animals#
Erinaceidae
1
Echinosorex gymnurus
Soricidae
2
Crocidura fuliginosa*
Scandentia
3
Tupaia glacilis
Slender Treeshrew
TS / Regular
4
Tupaia minor
Lesser Treeshrew
TS / Regular
5
Tupaia glis
Common Treeshrew
TS / Common
6
Tupaia tana
Large Treeshrew
TS / Rare
Slow Loris
NS / Rare
Sunda Flying Lemur or Colugo
NS / Very rare
Horsfield's or Western Tarsier
NS / Rare
Lorsidae
7
Nycticebus coucang
Cynocephalidae
8
Galeopterus variegatus
Tarsiidae
9
Tarsius bancanus
Cercopithecidae
10
Presbytis hosei
Hose's Langur
TS / Rare
11
Macaca nemestrina
Southern Pig-tailed Macaque
TS / Common
12
Macaca fascicularis
Crab-eating or Long-tailed Macaque
TS / Common
Müller's Bornean Gibbon
TS / Common
Bornean Orangutan
TS / Rare
Hylobatidae
13
Hylobates muelleri
Hominidae
14
Pongo pygmaeus
Sciuridae
15
Ratufa affinis
Pale Giant Squirrel
TS / Rare
16
Callosciurus prevostii
Prevost's Squirrel
TS / Common
17
Callosciurus adamsi
Ear-spot Squirrel
TS / Rare
18
Callosciurus notatus
Plantain Squirrel
TS / Regular
19
Sundasciurus lowii
Low’s Squirrel
TS / Regular
20
Sundasciurus hippurus
Horse-tailed Squirrel
TS / Very rare
21
Lariscus hosei
Four-striped Ground Squirrel
TS / Very rare
22
Exilisciurus exilis
Plain Pigmy Squirrel
TS / Regular
23
Petinomys setosus*
Temminck’s Flying Squirrel
NS / Very rare
24
Aeromys tephromelas*
Black Flying Squirrel
NS / Very rare
96
Appendix
Diplomarbeit
Andreas Wilting
25
Aeromys thomasi
Thomas' flying squirrel
NS / Regular
26
Petaurista petaurista
Red Giant Flying Squirrel
NS / Regular
Hystricidae
27
Hystrix brachyura
Common or Malayan Porcupine
NS / Regular
28
Thecurus crassispinis
Boenean or Thick-spined Porcupine
NS / Very rare
29
Trichys fasciculata
Long-tailed Porcupine
NS / Rare
Sun Bear
NS / Rare
Ursidae
30
Helarctos malayanus
Mustelidae
31
Martes flavigula
Yellow-Throated Marten
TS / Rare
32
Mustela nudipes
Malay Weasel
TS / Very rare
33
Mydaus javanensis
Teledu or Malay or Indonesian Skink Badger
NS / Very rare
34
Amblonyx cinereus
Oriental Small-clawed Otter
TS / Rare
Viverridae
35
Hemigalus derbyanus
Banded Palm civet
NS / Rare
36
Arctogalidia trivirgata
Small-toothed or Three-striped Palm Civet
NS / Rare
37
Paguma larvata
Masked Palm Civet
NS / Rare
38
Paradoxurus hermaphroditus
Asian or Common Palm Civet
NS / Common
39
Viverra tangalunga
Malayan or Oriental Civet
NS / Common
40
Prionodon linsang
Banded Linsang
NS / Rare
Short-tailed Mongoose
TS / Rare
Herpestidae
41
Herpestes brachyurus
Felidae
42
Prionailurus bengalensis
Leopard Cat
NS / Common
43
Neofelis diardi
“Sundaland Clouded Leopard”
NS / Rare
Bornean Pygmy Elephant
TS / Regular
Bearded pig
NS / Common
Proboscidae
44
Elephas maximus borneensis
Suidae
45
Sus barbatus
Tragulidae
46
Tragulus javanicus
Lesser Mouse Deer
NS / Rare
47
Tragulus napu
Greater Mouse Deer
NS / Regular
Cervidae
48
Cervus unicolor
Sambar Deer
NS / Regular
49
Muntiacus muntjak
Common Muntjac or Barking Deer
TS / Rare
50
Muntiacus atherodes
Bornean Yellow Muntjac
TS / Very rare
Bovidae
51
Bos javanicus
Tembadau or Banteng
NS / Very rare
all records were direct sightings on NS = night survey or TS = Transect surveys. Sighting frequency was
classified from very rare, rare, regular to common.
#
Two animals were found dead along the north-south road run over by vehicles.
* New records for Tabin Wildlife reserve.
§
97
Diplomarbeit
Andreas Wilting
Erklärung
Erklärung
Hiermit erkläre ich, dass ich diese Diplomarbeit selbständig verfasst und keine anderen als die
angegebenen Quellen und Hilfsmittel verwendet habe.
Würzburg, Mai 2007
Andreas Wilting
98