Endoplasmic Reticulum Vacuolization and ValosinContaining Protein Relocalization Result from
Simultaneous Hsp90 Inhibition by Geldanamycin
and Proteasome Inhibition by Velcade
Edward G. Mimnaugh, Wanping Xu, Michele Vos, Xitong Yuan, and Len Neckers
Urologic Oncology Branch, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland
Abstract
Geldanamycin and Velcade, new anticancer drugs with
novel mechanisms of action, are currently undergoing
extensive clinical trials. Geldanamycin interrupts
Hsp90 chaperone activity and causes down-regulation
of its many client proteins by the ubiquitin-proteasome
pathway; Velcade is a specific proteasome inhibitor.
Misfolded Hsp90 clients within the endoplasmic
reticulum (ER) lumen are cleared by ER-associated
protein degradation, a sequential process requiring
valosin-containing protein (VCP) – dependent
retrotranslocation followed by ubiquitination and
proteasomal proteolysis. Cotreatment of cells with
geldanamycin and Velcade prevents destruction of
destabilized, ubiquitinated Hsp90 client proteins,
causing them to accumulate. Here, we report that
misfolded protein accumulation within the ER resulting
from geldanamycin and Velcade exposure overwhelms
the ability of the VCP-centered machine to maintain the
ER secretory pathway, causing the ER to distend into
conspicuous vacuoles. Overexpression of dominantnegative VCP or the ‘‘small VCP-interacting protein’’
exactly recapitulated the vacuolated phenotype
provoked by the drugs, associating loss of VCP function
with ER vacuolization. In cells transfected with a
VCP-enhanced yellow fluorescent protein fluorescent
construct, geldanamycin plus Velcade treatment
redistributed VCP-enhanced yellow fluorescent
protein from the cytoplasm and ER into perinuclear
aggresomes. In further support of the view that
compromise of VCP function is responsible for ER
vacuolization, small interfering RNA interference of VCP
Received 1/19/06; revised 6/19/06; accepted 6/29/06.
Grant support: Intramural Research Program of the Center for Cancer Research,
NIH, National Cancer Institute.
The costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Note: Present address for M. Vos: Division of Extramural Activities, National
Institute of Allergy and Infectious Disease, NIH, Bethesda, MD 20892. Present
address for X. Yuan: Beijing Institute of Disease Control and Prevention, Beijing
100039, China.
Requests for reprints: Len Neckers, Urologic Oncology Branch, Center for
Cancer Research, National Cancer Institute, NIH, 9000 Rockville Pike, Building
10, Room 1-5940, Bethesda, MD 20892-1107. Phone: 301-496-5899. E-mail:
[email protected]
Copyright D 2006 American Association for Cancer Research.
doi:10.1158/1541-7786.MCR-06-0019
expression induced ER vacuolization that was markedly
increased by Velcade. VCP knockdown by small
interfering RNA eventually deconstructed both the ER
and Golgi and interdicted protein trafficking through the
secretory pathway to the plasma membrane. Thus,
simultaneous geldanamycin and Velcade treatment has
far-reaching secondary cytotoxic consequences that
likely contribute to the cytotoxic activity of this
anticancer drug combination.
(Mol Cancer Res 2006;4(9):667 – 81)
Introduction
All organisms have evolved complex mechanisms to protect
themselves from the deleterious consequences of mutated,
oxidized, or otherwise improperly folded proteins. In particular,
the heat shock proteins Hsp90 and Hsp70, also called
chaperones or stress proteins, critically assist newly synthesized
polypeptides (clients) in achieving their functional conformation, localization, activation, and even oligomerization (1, 2).
Currently, >100 Hsp90 client proteins have been described
(see website maintained by Dr. D. Picard),1 including a myriad
of transcription factors, signal-transducing receptor kinases, cell
cycle regulators, and steroid hormone receptors, most of which
are essential for cell proliferation and survival (3-5). Unfortunately, Hsp90 may be a double-edged sword because it also
stabilizes mutated tumor suppressors and inappropriately
activated oncoproteins that contribute to the initiation, growth,
and metastasis of human cancers (6-11).
Geldanamycin and its clinically active analogue, 17allylamino-17-demethoxygeldanamycin (17-AAG), specifically
bind to and profoundly inhibit the protein chaperone function of
Hsp90 (12-14), inducing ubiquitination and proteasomal
destruction of its numerous client proteins (15-17). When cells
are simultaneously exposed to geldanamycin and a proteasome
inhibitor, the degradation of geldanamycin-destabilized Hsp90
clients is unproductive; consequently, ubiquitinated misfolded
proteins accumulate and usually coalesce into highly insoluble,
perinuclear inclusion bodies known as aggresomes (18, 19).
In preclinical experiments, the combination of geldanamycin
and the proteasome inhibitor, Velcade, exhibits selectivity for
transformed cells, inhibits proliferation, and is more cytocidal
to tumor cells than either drug alone (20, 21). These
observations prompted us to hypothesize that a buildup of
1
http://www.picard.ch/downloads/Hsp90interactors.pdf.
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
667
668 Mimnaugh et al.
misfolded, nondegradable Hsp90 client proteins might be
responsible for the enhanced cytotoxicity of this drug
combination (20). Both 17-AAG (5, 10) and Velcade (22-25)
show promising clinical activity against various human cancers,
and these drugs are currently in multiple advanced combinatory
trials with standard first-line anticancer drugs (9, 26). Recently,
a phase I clinical trial of 17-AAG combined with Velcade was
initiated at several cancer research centers.
When protein misfolding occurs within the endoplasmic
reticulum (ER)-Golgi secretory pathway, the stress-recognizing
proteins, Ire1p, PERK, and ATF6, signal for augmented
synthesis of ER residing chaperones to facilitate correction of
protein misfolding and also initiate transcriptional repression of
essentially all other proteins (27, 28). This signaling cascade
specifically responding to protein misfolding in the ER is called
the unfolded protein response (29), and both geldanamycin
(30) and Velcade (31) stimulate powerful unfolded protein
responses. When protein misfolding in the ER fails to be
corrected by the unfolded protein response, cells activate
a secondary defensive mechanism called ER-associated protein
degradation (ERAD; refs. 32, 33). ERAD unblocks the ERGolgi secretory pathway of misfolded polypeptides by retrotransporting them from the ER into the cytoplasm, where they
undergo ubiquitination and proteasomal degradation (34, 35).
This complex yet seamless mechanism of moving misfolded
polypeptides across the ER membrane to undergo destruction
requires the participation of the p97 ATPase, valosin-containing
protein (VCP; Cdc48 in yeast; ref. 36). The hexameric, VCPcentered molecular machine, complemented with Ufd1p and
Npl4p adapter proteins, mechanically ratchets misfolded polypeptides across the ER membrane at the expense of ATP
(37-39). ERAD-specific ubiquitin ligases recruited to the
extraction complex quickly ubiquitinate the emerging polypeptides (40-42) that are then escorted by ubiquitin-binding proteins
to nearby cytosolic proteasomes for disassembly (37, 38, 43).
Consequently, when geldanamycin or 17-AAG binds to Hsp90,
destabilized clients, such as ErbB2 tyrosine kinase (15, 44), the
cystic fibrosis transmembrane conductance regulator (16), or
the mutated epidermal growth factor receptor (45), which
normally pass through the secretory pathway to the plasma
membrane (46), are instead rapidly down-regulated by ERAD.
In addition to initiating profound ER stress, activating the
unfolded protein response and ERAD, and promoting massive
protein ubiquitination, we have noted that simultaneous
geldanamycin and Velcade treatment causes distension of ER
cisternae into numerous conspicuous vacuoles (20). Newly
acquired data now indicate that geldanamycin plus Velcade –
initiated ER vacuolization occurs as a consequence of
overwhelming the ability of the VCP-centered molecular
machine to extract misfolded proteins from the ER. We report
here that VCP overexpression significantly mitigates geldanamycin plus Velcade – induced ER vacuolization. Conversely,
transient transfections of dominant-negative VCP (dnVCP) or
the interfering ‘‘small VCP-interacting protein’’ (SVIP)
recapitulates the drug-induced vacuole phenotype. Knockdown
of VCP by small interfering RNA (siRNA) interference
induces ER vacuolization that is exacerbated by Velcade
cotreatment and demolishes ER and Golgi architectures,
derailing ErbB2 trafficking to the plasma membrane. Compro-
mising the ERAD function of VCP by a massive accumulation
of ubiquitinated and misfolded proteins is a heretofore
unforeseen secondary consequence of combining geldanamycin with Velcade.
Results
Geldanamycin plus Velcade Cotreatment Initiates Cytosolic and ER Stress Responses and Greatly Enhances
Protein Ubiquitination
The binding of geldanamycin to Hsp90 indirectly activates
heat shock factor-1 (47, 48) and Ire1a (49) stress sensor
proteins, which then enter the nucleus and activate multiple
stress response genes. Similarly, intracellular accumulation of
misfolded proteins resulting from proteasome inhibition by
Velcade is known to activate cytosolic and ER stress responses
(50, 51). When COS-7 cells were simultaneously exposed to
geldanamycin and Velcade, the cytosolic heat shock proteins
Hsp70 and Hsp90 and the ER protein chaperone, BiP/GRP78
(30, 52), were elevated as much as 40-fold (Fig. 1A).
Geldanamycin or Velcade alone induced only more modest
cytosolic and ER stress responses (data not shown).
Excessive protein misfolding in the ER initiates compensatory activation of the ERAD pathway, which depends on the
mechanical action of the VCP-centered heterocomplex molecular machine to extract denatured polypeptides from the ER
lumen (53-56). The crucial participation of VCP in this elegant
mechanism prompted us to examine whether overexpression of
VCP would mitigate the ER cellular stress response initiated by
geldanamycin and Velcade. Surprisingly, we found that greatly
elevated levels of VCP achieved by transient transfection
diminished neither ER nor cytosolic cellular stress responses
resulting from simultaneous Hsp90 and proteasome inhibition
(Fig. 1A, lanes 3 and 4).
The amount of endogenous soluble VCP in COS-7 lysates
was essentially unaltered by geldanamycin, Velcade, or the
combination of the two inhibitors. However, interestingly, a
substantial portion of endogenous VCP was detected in the
detergent-insoluble, pellet fraction (Fig. 1B) from cells treated
with geldanamycin plus Velcade. Velcade alone only slightly
elevated the quantity of detergent-insoluble VCP, and geldanamycin alone had no effect. In cells in which the level of VCP
was augmented by transient transfections, more than half of the
overexpressed VCP protein was found in the detergentinsoluble fraction of cell lysates following geldanamycin
plus Velcade treatment, whereas only a minuscule quantity of
VCP partitioned into the pellet fraction from VCP-transfected
cells not exposed to the drugs (Fig. 1C, top).
Protein ubiquitination in the soluble lysate fraction from
COS-7 cells treated with geldanamycin plus Velcade was only
slightly increased, but in the detergent-insoluble pellet fraction,
protein ubiquitination was extensive (Fig. 1C). Transient
transfection and overexpression of VCP neither attenuated nor
augmented the extent of protein ubiquitination in either fraction
derived from the drug-treated cells. Given that VCP itself, as
well as its ERAD-specific adaptor proteins, Ufd1p and Npl4p,
bind to polyubiquitin chains (57-59), it is probable that the
large quantity of VCP in the detergent-insoluble pellet fraction
from geldanamycin plus Velcade – treated cells cosedimented
with aggregated insoluble ubiquitinated proteins.
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
Protein Misfolding Induced ER Vacuolization
FIGURE 1. Geldanamycin + Velcade treatment induces a powerful stress response and causes ubiquitinated proteins and VCP to become detergent
insoluble. COS-7 cells were treated with 50 nmol/L geldanamycin (GA ), 25 nmol/L Velcade (Vcd ), or both drugs simultaneously (Rx) for 24 hours before
harvesting cells into NP40-containing lysis buffer. Lysates were centrifuged to separate the clarified lysate and detergent-insoluble fractions. A. Hsp70,
Hsp90, and BiP/GRP78 were measured by immunoblotting 50 Ag lysates from control cells (lane 1), cells treated with geldanamycin + Velcade (lanes 2 and
4), and cells in which VCP was highly overexpressed by transient transfections (lanes 3 and 4). These three stress proteins were increased as much as
40-fold by the drug treatments, indicating a powerful stress response occurred in the both cytoplasm and ER in response to the drugs. B. Neither
geldanamycin, Velcade, nor the combination of both drugs altered the endogenous level of VCP in cell lysates; however, geldanamycin + Velcade increased
the amount of endogenous VCP redistributed into the detergent-insoluble fraction. C. Top, only overexpressed transfected VCP was visualized because the
film exposure was sufficiently short to prevent detection of endogenous VCP. Note the tremendous increase in VCP in the detergent-insoluble fraction from
geldanamycin + Velcade – treated cells. Bottom, anti-ubiquitin immunoblot shows a robust increase in ubiquitinated proteins in the lysate fraction and an even
greater increase in ubiquitinated proteins in the detergent-insoluble pellet fraction from cells treated with the drug combination. Note that highly
overexpressed VCP did not alter the quantity of protein ubiquitination in either fraction in either the presence or the absence of the two drugs.
Destabilization of Hsp90 by Geldanamycin Augments
Velcade-Caused Vacuolization of COS-7 Cells
When used at 10 nmol/L, a concentration half-maximally
inhibiting proteasome activity in intact cells within 1 hour (20),
Velcade alone induced cytoplasmic vacuolization in only a small
proportion of COS-7 cells (f2%) within 24 hours, but when
cells were exposed to 200 nmol/L Velcade for 24 hours,
vacuolization was extensive, occurring in as many as 75% of
cells (Fig. 2A). When we examined the concentration dependency of Velcade-induced vacuolization in COS-7 cells, we
found a linear relationship between Velcade concentration and
cell vacuolization, up to f50 nmol/L Velcade (Fig. 2B, left).
Previous experiments in our laboratory indicated that 50 nmol/L
Velcade inhibited proteasome activity in MCF-7 cells by f90%
(20), corresponding reasonably well with this outcome. Geldanamycin alone at 50 nmol/L (Fig. 2A) or even at 3 Amol/L (data
not shown) was incapable of promoting vacuolization in COS-7
cells (Fig. 2A). However, the incidence of vacuolization in cells
exposed to the low 10 nmol/L concentration of Velcade was
enhanced f2-fold by including 50 nmol/L geldanamycin
(Fig. 2A, top right and C). Longer incubations with both drugs
at these concentrations (up to 48 hours) increased the proportion
of vacuolated cells to as much as 75%. But by then, most cells
rounded up, released from the plastic, and developed surface
blebbing indicative of apoptosis (results not shown). Interestingly, pretreatment of cells with geldanamycin for 24 hours followed
by washout and overnight exposure to 10 nmol/L Velcade also
effectively increased the incidence of vacuolization. The ability
of geldanamycin to synergize with Velcade to induce cell
vacuolization, even when the drugs are used sequentially,
illustrates the durability of Hsp90 inhibition and suggests that
client protein destabilization persists well after the drug is
removed from the medium.
Geldanamycin plus Velcade – Induced Vacuolization of
COS-7 Cells Results from ER Dilation
Cytoplasmic vacuolization of various types of cells treated
with proteasome inhibitors has been ascribed to result from
extensive dilation of ER cisternae (20, 59, 60). To verify that
vacuoles induced by Hsp90 and proteasome inhibition in
COS-7 cells originated from the ER, we transfected those cells
with a plasmid vector expressing a red fluorescent protein fused
to the KDEL ER localization sequence of calreticulin 48 hours
before exposing them to geldanamycin and Velcade. In control
cells, the fluorescent ER marker visualized the typical membranous ER architecture, which was concentrated near the nucleus
and dispersed net-like throughout the cytoplasm, extending
outward to the plasma membrane (Fig. 3A). When COS-7 cells
were treated with geldanamycin plus Velcade, the fluorescent
ER marker was strongly localized exclusively within the lumen
of the drug-induced vacuoles, and essentially none of the
normal reticulated ER structure remained (Fig. 3B). Beginning
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
669
670 Mimnaugh et al.
FIGURE 2. Geldanamycin
greatly increases the ability of
Velcade to induce vacuolization of cells. A. Cells were
treated with either Velcade
alone at 10 and 200 nmol/L,
geldanamycin alone at 50
nmol/L, or 10 nmol/L Velcade
+ 50 nmol/L geldanamycin
simultaneously for 24 hours.
The low concentration of Velcade induced vacuolization in
f5% to 10% of COS-7 cells,
whereas Velcade at 200 nmol/
L prompted f90% of cells to
become heavily vacuolated.
The extent of vacuolization
caused by 10 nmol/L Velcade
(a concentration that inhibits
proteasome activity by f50%)
was greatly enhanced by
either the simultaneous or
sequential inclusion of geldanamycin. B. Concentrationdependent induction of cell
vacuolization caused by Velcade alone. Following Velcade exposure for 24 hours,
cells were photographed and
the numbers of cells having
numerous vacuoles (arbitrarily set at eight or more per cell)
were counted in four separate
microscopic fields. Points,
mean of four separate determinations. C. Percentage of
vacuolated cells induced by
Velcade at 10 nmol/L for 22
hours was more than doubled
by the simultaneous inclusion
of 50 nmol/L geldanamycin.
Longer exposure times, up to
48 hours, increased the percentage of vacuolated cells,
but beyond 48 hours, most
of the cells rounded up and
released from the plastic surface.
at f16 hours, small vacuoles first originated at or near the
nuclear envelope, then expanded outward, and became more
numerous as they further distorted the normal ER architecture. In
some cells, especially at later times, several vacuoles seem to
have fused together. Most commonly, the distribution of
cytoplasmic vacuoles appeared random, but occasionally in
some cells they seemed to radiate outward linearly from the
nucleus (Fig. 3B, top left). In nonresponding geldanamycin plus
Velcade – treated cells that failed to form cytoplasmic vacuoles,
the fluorescent ER marker visualized only the normal ER
architecture (data not shown). Thus, we conclude that the
geldanamycin and Velcade – induced vacuolization of COS-7
cells resulted from extensive dilation of the ER.
Tunicamycin-Caused Protein Misfolding in the ER
Induces Vacuolization in Proteasome-Inhibited
COS-7 Cells
We reasoned that if geldanamycin plus Velcade induced cell
vacuolization by promoting protein misfolding and retention in
the ER lumen, then exposing cells to tunicamycin, a protein
glycosylation inhibitor known to induce substantial ER protein
misfolding and the unfolded protein response (61), should
recapitulate the geldanamycin plus Velcade –induced vacuolated
phenotype. Whereas exposure to tunicamycin alone promoted no
COS-7 cell vacuolization, when tunicamycin was combined with
as little as 5 nmol/L Velcade, extensive vacuolization (>90% of
cells) occurred within as little as 16 hours (Fig. 4A). Although the
dynamics of vacuole development was more rapid, the overall
appearance of the vacuoles induced by tunicamycin combined with
Velcade was identical to the vacuolization induced by geldanamycin plus Velcade, including the initial perinuclear emergence,
size distribution, and eventual congestion of the entire cytoplasm.
These common traits reinforce the notion that geldanamycin
plus Velcade –caused vacuoles are a predictable consequence of
excessive protein misfolding within the ER. We have noted
previously that incubating cells at 43jC in the presence of
Velcade, but not heat shock alone, likewise caused cytoplasmic
vacuolization (20), an outcome consistent with the accumulation
of heat-denatured, misfolded proteins within the ER compartment (62, 63).
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
Protein Misfolding Induced ER Vacuolization
dnVCP or SVIP Overexpression Promotes Cell
Vacuolization
A vacuolated cellular phenotype has been shown to occur
when endogenous wild-type VCP is compromised by overexpression of mutated, ATPase-inactivated dnVCP (64).
Consistent with this observation, transient transfections of
COS-7 cells with a plasmid vector expressing mutated dnVCP
induced a vacuolated phenotype that was morphologically
identical to that induced by geldanamycin and Velcade
(Fig. 4B). Importantly, this result shows that specific interdiction of VCP function alone is sufficient to promote ER-derived
cellular vacuolization.
Similarly, overexpression of SVIP protein interferes with
VCP function and causes cells to become vacuolated (65).
Within 48 hours after transfections with a plasmid expressing
SVIP, COS-7 cells developed prominent vacuoles resembling
those induced by geldanamycin plus Velcade treatment
(Fig. 5A, top). When SVIP-transfected cells were cotreated
with geldanamycin, twice to thrice as many cells became
vacuolated (Fig. 5A, bottom ), consistent with protein
misfolding as a consequence of geldanamycin inhibition of
Hsp90 chaperone function. SVIP was expressed as a FLAG
fusion protein and anti-FLAG immunocytofluorescence
revealed that the SVIP fusion protein was strongly localized
on the drug-induced vacuoles, where it may have bound
to VCP (Fig. 5B, top and bottom). Collectively, these data
support the concept that misfolded polypeptide accumulation
within the ER of Hsp90- and proteasome-inhibited cells
necessarily occurs when the polypeptide extraction function of
VCP is compromised by overexpressed dnVCP or SVIP or
when VCP is overwhelmed by misfolded nondegradable
proteins.
Overexpression of VCP Diminishes Geldanamycin plus
Velcade – Induced ER Vacuolization
VCP is a relatively abundant protein compromising as much
as 1% of total cellular proteins (66). However, the much lower
quantity of VCP localized on ER membranes that participates in
ERAD might become saturated with ubiquitinated proteins after
cells are treated with geldanamycin and Velcade. Alternatively,
VCP might even be depleted from the ER, given that a
substantial quantity of VCP is relocated to the detergentinsoluble pellet fraction of cells in response to these two drugs.
If ER vacuolization resulting from geldanamycin and Velcade
exposure results from interference with the ERAD function of
VCP, then supplemental VCP would be expected to attenuate
the vacuolated phenotype induced by these two drugs. To
explore this possibility, we transfected COS-7 cells with a
vector expressing wild-type VCP-green fluorescent protein
(GFP) fusion protein, waited 48 hours to permit the overexpressed VCP protein to accumulate, and then exposed cells to
geldanamycin plus Velcade for an additional 24 hours. In those
cells expressing abundant VCP-GFP protein (green in the
overlayered images), exposure to the drugs did not induce ER
vacuolization (Fig. 6, left and right ). Although small
percentage of drug-treated cells developed vacuoles, those
cells uniformly failed to express detectable levels of the VCPGFP fusion protein (Fig. 6, left and right). There were no
obvious phenotypic changes in cells transfected with the VCPexpressing plasmid but not exposed to the drugs (data not
shown). These data showing protection against ER vacuolization by exogenous VCP, especially when juxtaposed with the
contrasting dnVCP and SVIP results, argue strongly that the
ERAD function of VCP was susceptible to inhibition by
geldanamycin plus Velcade – dependent protein misfolding.
FIGURE 3. Cytoplasmic vacuoles in COS-7 cells induced by geldanamycin + Velcade treatment are ER derived. COS-7 cells were transiently transfected
with a plasmid vector expressing the KDEL sequence of the ER resident protein, calreticulin, fused to red fluorescent protein before being treated with
10 nmol/L Velcade + 50 nmol/L geldanamycin for 24 hours. A. Fluorescent ER marker visualized the normal ER architecture in control cells. B. Reticulated
ER structure was dramatically altered in cells exposed to the two drugs. Note that the fluorescent calreticulin-KDEL sequence-derived ER marker was
localized inside the vacuoles, suggesting dilation of the ER lumenal space as a consequence of the accumulation of misfolded proteins following Hsp90 and
proteasome inhibition. At early times, vacuolization was predominantly perinuclear, but eventually the vacuoles fill the entire cytoplasmic space.
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
671
672 Mimnaugh et al.
Geldanamycin plus Velcade Redistributes VCP Away
from the ER and Cytoplasm into Aggresomes
Because Hsp90 and proteasome inhibition redistributed both
endogenous and transfected VCP into the detergent-insoluble
fraction of COS-7 cells (Fig. 1B and C), we visually examined
the consequences of geldanamycin plus Velcade treatment on
the disposition of a transiently transfected VCP-GFP fusion
protein. In controls, VCP-GFP-derived fluorescence was predominantly cytoplasmic (Fig. 7A), although a few cells exhibited
faint nuclear fluorescence (data not shown). VCP is known to
associate with the ER and Golgi apparatus membranes (66, 67),
but we were unable to observe VCP-GFP on membranous
structures because of its overpowering cytoplasmic fluorescence.
When VCP-GFP-transfected COS-7 cells were exposed to
geldanamycin plus Velcade for 24 hours, we observed that
VCP-GFP had been completely redistributed into highly
condensed, perinuclear bodies resembling aggresomes (Fig. 7B;
refs. 18, 19, 26). Longer image capture (exposure) revealed that
essentially all of the VCP-GFP fusion protein had been depleted
from the cytoplasm, and no residual VCP-GFP fluorescence
remained on ER membranes or on drug-induced vacuoles (data
not shown). A previous report described condensation of VCPGFP into perinuclear aggresomes after cells were treated with a
proteasome inhibitor (59). VCP may have redistributed from the
cytoplasm, ER, and Golgi, as a consequence of Hsp90 and
proteasome inhibition, because the VCP-centered extraction
complex remained bound to ubiquitinated proteins that could not
undergo proteolysis by inactive proteasomes (57). When
stabilized by proteasome inhibition, ubiquitinated ER transiting
and cytosolic Hsp90 client proteins frequently aggregate and
accumulate in large insoluble aggresomes (18, 68). Given that
ubiquitinated proteins and VCP were both greatly increased in the
detergent-insoluble fraction of geldanamycin plus Velcade –
treated cells (Fig. 1C), we suggest that VCP-GFP fusion protein
in the drug-treated cells was segregated into aggresomes.
FIGURE 4. Tunicamycin-induced protein misfolding within the ER
lumen and overexpression of mutated, ATPase-inactive dnVCP both
cause vacuolization. As they traverse the ER pathway, plasma membrane – residing polypeptides become misfolded when they fail to undergo
glycosylation in cells treated with tunicamycin. A. Although tunicamycin
alone failed to induce vacuolization, when cells were exposed to the
combination of tunicamycin + Velcade, essentially all of the cells became
heavily vacuolated. B. Further evidence that protein misfolding in the ER is
responsible for ER vacuolization, which show extensive vacuolization in
cells transfected with a plasmid expressing a mutated, ATPase-inactivated, dominant-negative acting VCP. Displacement of wild-type VCP
from ER membranes by the mutated, inactive VCP would be expected to
promote the accumulation of misfolded proteins inside the ER lumen as
observed previously (63).
Targeting VCP with siRNA Greatly Increases
Vacuolization of Velcade-Treated Cells
COS-7 cells were exposed to VCP siRNA sequences for 72
hours, and separate dishes of cells were also exposed to the
drugs for an additional 22 hours. Although siRNA decreased
VCP protein by >90%, as estimated by anti-VCP immunoblotting (shown in Fig. 8C), VCP knockdown by siRNA induced
vacuolization in only a few cells (Fig. 9, middle). In contrast,
when cells treated with both VCP siRNA and Velcade (Fig. 9,
right), ER vacuolization was increased as much as 10-fold
when compared with cells treated with Velcade alone (Fig. 9,
left). Neither irrelevant siRNA nor the si-Importer transfecting
reagent induced any vacuoles in cells (data not shown). This
observation of synergistic induction of cell vacuolization as a
consequence of VCP knockdown and proteasome inhibition by
Velcade recapitulates the observations of Wojcik et al. (69).
Those authors reported that proteasome inhibition by MG-132
greatly enhanced HeLa cell vacuolization in cells pretreated
with VCP siRNA. To our surprise, treating siRNA-VCP
knockdown cells with geldanamycin did not further increase
the proportion of cells displaying vacuoles, suggesting that
sufficient residual VCP was capable of delivering misfolded ER
Hsp90 clients to proteasomes (data not shown).
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
Protein Misfolding Induced ER Vacuolization
FIGURE 5. SVIP causes vacuolization
that is enhanced by Hsp90 inhibition.
Recently discovered, a protein known as
SVIP is thought to specifically regulate the
ERAD function of VCP. SVIP binding to
VCP interferes with its ability to extract
polypeptides from the ER and promotes
cell vacuolization (64). We therefore
transfected COS-7 cells with a plasmid
expressing SVIP and 24 hours later
examined them for the appearance of
vacuoles. SVIP overexpression caused
vacuolization in a small percentage of
cells (A), but interestingly, when SVIPoverexpressing cells were cotreated with
50 nmol/L geldanamycin, the incidence of
vacuolization was enhanced f4-fold.
Because SVIP was expressed as a FLAG
fusion protein, it was visualized by antiFLAG/Cy3 immunofluorescence; (B) in
SVIP-transfected, geldanamycin-treated
cells, SVIP was localized in the cytoplasm
and concentrated on the membranes
surrounding vacuoles where presumably
it was VCP bound.
siRNA Knockdown of VCP Markedly Changes the
Architecture of Both ER and Golgi Apparatus
To more precisely determine how VCP participated in the
ER morphologic alterations brought about by geldanamycin
plus Velcade treatment, we treated COS-7 cells with siRNA
directed against VCP and then transfected cells with vectors
expressing either fluorescent ER or Golgi apparatus markers.
The ER and Golgi in control cells were normal in
appearance (70); however, in cells in which VCP had been
depleted by siRNA, the structures of the ER and Golgi were
dramatically changed (Fig. 10A-D). Instead of its normal
interconnected, net-like ER structure, in VCP knockdown
cells, the fluorescent ER marker instead revealed a punctate
pattern of small irregular bodies (Fig. 10B). In addition to
its role in ERAD, and in conjunction with its p47 and
VCIP135 effectors, VCP regulates homotypic ER and Golgi
membrane fusion, which reconstitutes the membranes of
these organelles following their disassembly during cell
division (71-73). In the absence of VCP following cell
division, ER transition vesicles may have been unable to
fuse to reconstruct normal ER architecture (74). Similarly, in
cells exposed to siRNA-VCP, the fluorescent Golgi marker
revealed dispersed small bodies instead of the normal
condensed perinuclear Golgi architecture that was seen in
the control cells (Fig. 9C and D). Finally, depletion of VCP
by siRNA interference increased overall protein ubiquitination 3- to 4-fold (data not shown) as has been observed
previously (69). Further experiments are required to determine whether there is a relationship between the greatly
enhanced protein ubiquitination and the profound morphologic changes to the ER and Golgi structures in VCP
knockdown cells.
FIGURE 6.
Overexpression of
VCP diminishes geldanamycin + Velcade – induced vacuolization. We reasoned that overexpression of wildtype VCP might augment the ability
of cells to remove misfolded proteins
from the ER compartment. Therefore,
cells were transiently transfected with
a plasmid vector expressing a fluorescent VCP-GFP fusion protein and 24
hours later were exposed to 10 nmol/L
Velcade + 50 nmol/L geldanamycin for
an additional 24 hours. Fluorescent
images layered over phase-contrast
photographs revealed that cells
expressing high levels of exogenous
VCP-GFP failed to form vacuoles.
Conversely, cells with drug-induced
vacuoles expressed little or no VCPGFP-derived fluorescence.
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
673
674 Mimnaugh et al.
FIGURE 7. Geldanamycin + Velcade
causes VCP to relocalize to aggresome-like
bodies. Even in proteasome-inhibited cells,
VCP might be able to ratchet misfolded
polypeptides from the ER into the cytoplasm.
To investigate the fate of VCP itself in Hsp90and proteasome-inhibited cells, we first transfected COS-7 cells to express a VCP-GFP
fusion protein and then exposed them to 50
nmol/L geldanamycin + 10 nmol/L Velcade. In
control cells (A, top and bottom ), VCP-GFP
fluorescence was distributed throughout the
cytoplasm. Following Velcade + geldanamycin
treatment for 24 hours, essentially all of the
VCP-GFP was relocalized into condensed,
irregular, perinuclear structures resembling
aggresomes.
Geldanamycin and Velcade Treatment Depletes ErbB2
from the Plasma Membrane and Relocates the Bulk of
ErbB2 into Aggresomes
The ErbB2 plasma membrane – residing tyrosine kinase is a
Hsp90 client protein known to be rapidly down-regulated by
ubiquitin-dependent proteasomal degradation in cells treated
with geldanamycin (15, 44, 75). As it is translated at ER
membrane-bound ribosomes, immature ErbB2 protein is
inserted directly into the ER membrane as a transmembrane
polypeptide. Hsp90 binds to its cytoplasmic moiety and
regulates the trafficking of nascent ErbB2 (76). The ER
lumenal portion of ErbB2 becomes glycosylated and the
molecule moves on to the Golgi apparatus where glycosylation
trimming takes place. Finally, mature ErbB2 traffics to the
plasma membrane, where it functions as a transmembrane
signal transducer (76, 77). We reasoned that a fluorescent
ErbB2-enhanced yellow fluorescent protein (EYFP) fusion
protein would be useful to visualize changes in ER architecture
promoted by geldanamycin plus Velcade treatment and to
document consequences of the drug treatment on protein transit
through the secretory pathway.
In control cells, ErbB2-EYFP was localized predominantly
on the plasma membrane, where it was frequently highly
concentrated in membrane folds and projections (Fig. 8A). It
was impossible to visualize ErbB2-EYFP on ER or Golgi
apparatus membranes because the intense cell surface
fluorescence of the fusion protein obscured these organelles.
However, in cells treated with geldanamycin plus Velcade,
where the quantity of ErbB2-EYFP residing on the plasma
membrane was substantially diminished, residual ErbB2EYFP could be seen on the ER membranes, especially in
cells containing prominent vacuoles (Fig. 8B). Whereas the
fluorescent calreticulin-derived ER fusion protein marker
shown in Fig. 3 filled the lumen of the geldanamycin plus
Velcade – induced vacuoles, ErbB2-EYFP clearly was localized on the membranes outlining the vacuoles (Fig. 8B). Note
the frequent and easily observed characteristic tripartite
intersections of ER membranes in the drug-treated vacuolated
cells. Visualization by the fluorescent ErbB2-EYFP fusion
protein on intact and interconnected ER membranes surrounding the drug-induced vacuoles supports an interpretation that
the drug-induced vacuoles were formed by dilation of ER,
rather than from a swelling and pinching-off process, as we
had hypothesized previously (20).
In the majority of cells treated with geldanamycin plus
Velcade, however, ErbB2-EYFP-derived fluorescence was
nearly absent from both the plasma membrane and ER, and
the bulk of ErbB2-EYFP was highly concentrated in what
appear to be perinuclear aggresomes (Fig. 8C). It is noteworthy
that although inhibition of proteasome activity by Velcade
prevented ErbB2 down-regulation and stabilized the cellular
content of ErbB2, the ability of ErbB2 to function as a plasma
membrane signal-transducing partner in geldanamycin plus
Velcade – treated cells would be prevented by its relocalization
to perinuclear aggresomes.
siRNA Knockdown of VCP Also Prevents ErbB2 from
Trafficking to the Cell Surface
Given that VCP provides the ATP-driven mechanical force
to eliminate misfolded polypeptides from the ER by retrograde
translocation, we wondered whether depletion of VCP would
promote accumulation of proteins within the ER. To examine
this possibility, we first depleted the cellular level of VCP by
siRNA interference and then transiently transfected cells with
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
Protein Misfolding Induced ER Vacuolization
ErbB2-EYFP. Control cells were treated with irrelevant siRNA
(Fig. 11A). Instead of accumulating at the plasma membrane or
within the ER or even the Golgi, VCP knockdown caused the
fluorescent ErbB2-EYFP fusion protein to localize in numerous punctate, perinuclear structures (Fig. 11B). This abnormal
and unexpected ErbB2-EYFP distribution may have resulted
from the cells’ inability to perform homotypic membrane
fusion because of depletion of VCP (72, 78). Notably, the
profound ErbB2-EYFP relocalization brought about by VCP
siRNA recapitulated the pattern shown by the ER fluorescent
marker in VCP knockdown cells (Fig. 9). When siRNA-VCP
knockdown cells were treated with geldanamycin plus Velcade
for an additional 24 hours, the ErbB2-EYFP signal became
extremely weak, and in most cells, residual ErbB2-EYPF was
found only in punctate bodies surrounding the nucleus (data
not shown). Estimated by immunoblotting, VCP siRNA
decreased the VCP content of cells by >90% (Fig. 11C).
VCP siRNA also greatly diminished the cellular content of
ErbB2 (Fig. 11C) most likely because ErbB2 synthesis was
inhibited by the deconstruction of the ER (Fig. 10). As a
control, when cells were treated with an irrelevant siRNA,
neither VCP nor ErbB2 levels were altered (Fig. 11C). Thus,
knockdown of VCP not only disassembled the normal
architecture of the ER and Golgi apparatus but also prevented
ErbB2 trafficking through the ER secretory pathway to its
normal residence on the plasma membrane.
Discussion
Why do cells form vacuoles in response to geldanamycin
plus Velcade? The appearance of membrane-bound, ERderived cytoplasmic vacuoles and the relocalization of VCP
from its normal cytoplasmic and ER membrane locations into
dense, compact aggresomes are major consequences of
abnormal protein misfolding and ubiquitination resulting from
inhibition of Hsp90 and exacerbated by proteasome inhibition. Several lines of evidence reported here provide insights
into and support for this concept. First, geldanamycin plus
Velcade – dependent activation of the cellular stress response,
signaled by the marked increase in Hsp70 and Hsp90 in the
cytoplasm and BiP/GRP78 within the ER, indicates this drug
combination triggered profound cytoplasmic and ER stress,
consistent with an abnormal amount of protein misfolding
(28, 29, 50, 61, 79). Second, the tremendous increase in
FIGURE 8. Geldanamycin + Velcade treatment depletes ErbB2 from the plasma membrane and redirects ErbB2 into aggresomes. To monitor the
disposition of a Hsp90 client protein that normally transits the ER secretory pathway to its plasma membrane residence following geldanamycin + Velcade
treatment, we created an ErbB2-EYFP fluorescent construct and overexpressed this fusion protein in COS-7 cells before treating them with 25 nmol/L
Velcade + 50 nmol/L geldanamycin for 24 hours. In control cells (A, top to bottom ), ErbB2-EYFP-derived fluorescence was predominantly localized
homogeneously on the cell surface or concentrated in surface patches and membrane folds. In cells treated with geldanamycin + Velcade (B, top to bottom ),
most of the ErbB2-EYFP fusion protein was depleted from the cell surface, although Velcade blocked its proteasomal degradation, and ErbB2-EYFP was
observed on membranes surrounding the drug-induced vacuoles and in large perinuclear aggresomes. Finally, in geldanamycin + Velcade – treated cells
devoid of vacuoles, ErbB2-EYFP fluorescence was strongly concentrated in perinuclear aggresomes (C, top to bottom ). We have reported previously that
the ErbB2 kinase in cells treated with geldanamycin + Velcade becomes extensively ubiquitinated before it is degraded by proteasomes (15). It is interesting
to compare the localization of VCP-GFP following geldanamycin + Velcade shown in Fig. 7 with the localization of ErbB2-EYFP in the drug-treated cells
shown here.
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
675
676 Mimnaugh et al.
FIGURE 9. Knockdown of VCP with siRNA combined with Velcade induces extensive ER vacuolization. COS-7 cells were exposed to 100 nmol/L siRNA
sequences targeting VCP for 3 days, 25 nmol/L Velcade alone for 22 hours, or the combination of siRNA with Velcade and then examined for vacuolization by
phase-contrast microscopy. As expected, Velcade induced vacuolization in a small proportion of cells (left, arrows ) as did siRNA-VCP treatment (middle,
arrows ). However, the incidence of ER vacuolization was markedly increased by the combination of VCP knockdown and proteasome inhibition by Velcade
(right ), illustrating how the ERAD function of VCP is linked to proteasomal protein degradation.
protein ubiquitination specifically in the detergent-insoluble
fraction of lysates from geldanamycin plus Velcade – treated
cells indicates a catastrophic amount of protein misfolding,
aggregation, and precipitation had occurred. Third, inducing
protein misfolding uniquely within the ER compartment with
the protein glycosylation inhibitor, tunicamycin, exactly
reproduced the vacuolated phenotype induced by geldanamycin plus Velcade but only when proteasomal proteolysis
was inhibited by Velcade. Collectively, these observations
point to a massive buildup of misfolded and ubiquitinated
proteins within the ER lumen as the common factor in ER
vacuolization resulting from both geldanamycin plus Velcade
and tunicamycin plus Velcade treatments. It seems likely that
accumulated misfolded proteins trapped within the ER would
exert an osmotic force, inducing an influx of water from
the cytoplasm and distending the ER lumenal space into
vacuoles.
Additional evidence specifically implicates interference with
the ERAD function of VCP as the crucial biochemical event
responsible for initiating geldanamycin and Velcade – promoted
ER vacuolization. As reported previously (59, 65), we observed
that transient transfection of vectors overexpressing either
dnVCP or the VCP-inhibiting SVIP protein, treatments that
specifically interfere with VCP function, precisely recapitulated
the vacuolated phenotype induced by Hsp90 and proteasome
inhibition. The demonstrated redistribution of VCP into the
detergent-insoluble fraction of cell lysates and its coactivation
into aggresomes in geldanamycin plus Velcade – treated cells
indicates that the bulk of the cellular VCP would be unavailable
to facilitate the extraction of misfolded proteins from the ER, to
deliver misfolded proteins to proteasomes, or to participate in
its other multiple functions. Perhaps most convincingly,
overexpression of the ATPase-active, wild-type VCP ameliorated the ER vacuolization induced by geldanamycin plus
Velcade treatment. Cells expressing a high level of VCP protein
were refractory to vacuolization, whereas cells containing an
impoverished level of exogenous VCP remained susceptible to
extensive vacuolation when challenged by geldanamycin plus
Velcade exposure. This outcome most likely resulted from the
enhanced ability of supplemental VCP to extract misfolded
proteins from the ER lumen, although they could not be
degraded by Velcade-inhibited proteasomes. In this context, by
remaining bound to extracted polypeptides, the high level of
exogenously supplemented VCP would function as a misfolded
ubiquitinated protein chaperone as has been suggested
previously in other circumstances by others (43, 66, 80).
Notwithstanding the robust induction of ER vacuolization
following transient transfections of mutated dnVCP, we
observed that knockdown of VCP by siRNA interference
induced vacuolization in only a small percentage of COS-7
cells. Although immunoblotting indicated that siRNA knockdown depleted VCP protein levels by f90%, it is possible
that the small quantity of residual VCP was nevertheless
sufficient to participate in ERAD at a level that, in the absence
of unusual protein misfolding stress, was sufficient to prevent
vacuolization. Upsetting this balance by treating VCP
knockdown cells with Velcade to stabilize ubiquitinated
proteins synergistically increased the incidence of cells
generating vacuoles. These observations are consistent with
a scenario where ubiquitinated protein accumulation in
proteasome-inhibited cells overwhelms the diminished ability
of siRNA-depleted VCP to export misfolded polypeptides
from the ER.
At first glance, one might conclude that the geldanamycin
plus Velcade – induced ER vacuolization is simply a toxic
manifestation—a phenotypic consequence of a serious biochemical malfunction. Alternatively, expansion of the ER
compartment in the face of massive protein misfolding within
the ER lumen might be considered to be a stopgap
mechanism of sequestering misfolded, potentially toxic
proteins, thereby enabling the ER secretory pathway to
remain at least partially operational. In this scenario, ER
vacuolization could provide temporary survival advantage in
circumstances where the ERAD machinery of cells becomes
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
Protein Misfolding Induced ER Vacuolization
impaired. We know that drug-induced ER vacuolization is a
reversible process; if geldanamycin and Velcade are removed
from the medium bathing the cells before 24 hours,
proteasomes become reactivated within 16 to 18 hours and
ER vacuolization diminishes, presumably because ERAD
function is regained and misfolded proteins can be cleared.
On the other hand, continuous exposure of cells to the drug
combination for 48 hours is extremely cytotoxic and
essentially all cells, including those with vacuoles, rapidly
undergo apoptosis (81, 82). Although additional molecular
details of ER vacuolization are necessary to fully understand
the genesis of this dramatic phenotypic, we propose that ER
vacuolization, like aggresome formation, may very well be a
defensive cellular response to an overwhelming quantity of
aberrant misfolded proteins.
It should be pointed out that our interpretation of the
experiments using VCP siRNA to modulate VCP gene
expression are confounded by the fact that VCP performs
multiple, hierarchical cellular functions in addition to partici-
pating in ERAD (66, 74). VCP is required for the disassembly
of the mitotic spindle proteins preceding cell division (83), and
VCP function is crucial during homotypic fusion of transient
vesicles into membranes that reassemble into the ER and Golgi
apparatus following cell division (73, 78, 84, 85). VCP also
participates in cell cycle (86) and transcription factor regulation
(87), and it even plays a role in apoptosis (69) and DNA repair
(88, 89). Consequently, in situations of extreme cellular stress,
such as occurs during Hsp90 and proteasome inhibition, when
VCP becomes relocalized from its constitutive sites of action
into insoluble aggresomes, all of the functions of VCP would be
compromised. Thus, a loss of VCP-dependent ERAD function
at the ER brought about by siRNA may be relatively
unimportant to cells in which the entire structure of the ER
and Golgi has been disassembled. On the other hand, it is
possible that loss of ERAD function actually contributes to the
severe morphologic alterations brought about by siRNA
knockdown of VCP, and future experimentation will address
this possibility in greater detail.
FIGURE 10. RNA interference of
VCP restructures the architecture of
the ER and Golgi apparatus. To more
thoroughly study the participation of
VCP in misfolded protein-induced cell
vacuolization, we used siRNA interference to deplete VCP to an inconspicuous level. We then transfected
siRNA-treated cells with vectors
expressing either the calreticulinderived ER fluorescent marker or a
Golgi apparatus fluorescent marker to
visualize those membranous structures. A. Top and bottom, ER architecture in control cells was completely
normal; however, in cells treated with
siRNA-VCP alone, the reticulated ER
structure was completely destroyed
and the remaining very faint fluorescence originating from the ER marker
was localized in small, perinuclear,
punctate structures (B, left and right,
top and bottom ). Visualization of the
punctate bodies required 10- to 15fold longer camera exposure time,
indicating how little of the ER was left
(note the extent of VCP knockdown by
siRNA in COS-7 cells shown in the
immunoblot in Fig. 8C). Additionally,
the normal structure of the Golgi
apparatus (C, top and bottom ) was
similarly disassembled by VCP knockdown, and the fluorescent Golgi marker visualized small, punctate
structures similar to those visualized
by the ER marker (D, left and right,
top and bottom ).
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
677
678 Mimnaugh et al.
FIGURE 11. RNA interference of VCP expression depletes ErbB2 from
the plasma membrane and causes the remaining ErbB2 to concentrate in
small perinuclear bodies. To verify that siRNA knockdown of VCP
interferes with the protein secretory pathway, COS-7 cells were treated
with siRNA-VCP for 24 hours and then transfected with a plasmid vector
expressing the ErbB2-EYFP fusion protein. Other siRNA-VCP-treated,
ErbB2-EYFP-transfected cells were also exposed to 25 nmol/L Velcade
and 100 nmol/L geldanamycin for an additional 24 hours. A. ErbB2-EYFP
fluorescence in control cells was localized on the plasma membrane.
Strikingly, siRNA-VCP nearly completely depleted ErbB2-EYFP from the
cell surface and redistributed the fusion protein into numerous, perinuclear, punctate bodies (B) reminiscent of the distribution pattern of the
fluorescent ER marker in VCP knockdown cells (shown in Fig. 9B). It
should be noted that the cytofluorescence photomicrographs of the siRNAVCP-treated cells required at least a 10-fold longer exposure time and
computer enhancement because of the extremely low level of ErbB2EYFP fusion protein in the VCP knockdown cells (B and C). Knockdown of
VCP before geldanamycin + Velcade treatment dramatically altered the
ER structure in most cells and actually diminished the proportion of cells
with drug-induced vacuoles. Although the VCP level in cells exposed to an
irrelevant siRNA were unchanged from untreated control cells, VCP
targeted with siRNA was diminished by f90% (C, top ) when evaluated by
immunoblotting. Geldanamycin + Velcade treatment in either the absence
or presence of siRNA-VCP did not further alter the VCP status of cells.
The near elimination of constitutive ErbB2 by siRNA-VCP observed in
the cytofluorescence photographs was verified by immunoblotting
(C, bottom ). Although ErbB2 protein is stabilized in cells treated with
Velcade and geldanamycin (C, bottom, lanes 2 and 4 ), in VCP knockdown
cells, Velcade did not stabilize ErbB2 protein (lane 6 ), suggesting that
perhaps its synthesis was inhibited by the devastating effects of VCP
depletion on the ER architecture.
We also suspect that VCP knockdown probably interferes
with protein synthesis from ribosomes attached to the rough
ER membranes. Indeed, even in the presence of Velcade to
inhibit proteasomal degradation, the level of ErbB2 in cells
exposed to siRNA-VCP was nearly undetectable by both
cytofluorescence and direct immunoblotting of the ErbB2
protein. These observations are consistent with the possibility
that protein synthesis at ER membranes was inhibited after
VCP depletion most likely because of the deconstruction of the
normal ER architecture. Thus, VCP knockdown would be
expected to have a significant effect on both protein synthesis
at the ER membrane and protein trafficking through the ER to
the cell surface through the secretory pathway.
The redistribution of VCP away from the ER and
cytoplasm into aggresome-like bodies following geldanamycin
plus Velcade treatment is an unexpected and provocative
observation. VCP levels are reported to be elevated in a
variety of different human solid tumors (90, 91), and the
increased expression of VCP in these tumors seems to
correlate with disease progression (90, 92) and a poor
prognosis (93). Although the exact role VCP plays in human
cancers is currently unknown, it is possible that VCP is
elevated in solid tumors because it is needed to clear mutated
misfolded proteins that are abundantly expressed in tumor
cells (94). In this context, VCP should be considered as a
credible molecular target for anticancer chemotherapy, especially because either depletion or inactivation of VCP is
ultimately incompatible with cell viability (59, 69). We have
reported previously that the combination of geldanamycin and
Velcade potently inhibits MCF-7 tumor cell proliferation (20),
and most recently, 17-AAG, the clinically useful analogue of
geldanamycin, was shown by Mitsiades et al. (21) to sensitize
multiple myeloma cells to Velcade. In this regard, the
combination of 17-AAG and Velcade is currently undergoing
National Cancer Institute – sponsored clinical evaluation at
several cancer research centers.2 Based on results presented
here, at least part of the cytotoxicity produced by the
geldanamycin plus Velcade combination may result from the
redistribution of VCP into an insoluble subcellular compartment.
In conclusion, although further experimentation is called for
to fully elucidate the very complex interactions between protein
misfolding, ubiquitination, VCP localization and function, and
ER vacuolization in Hsp90- and proteasome-inhibited cells,
based on the observations reported herein, it seems plausible
that overwhelming the ERAD function of VCP may be the
proximal cause of ER vacuolization in response to geldanamycin plus Velcade.
Materials and Methods
Cell Culture and Drug Treatments
Mycoplasma-free, SV40-transformed COS-7 monkey kidney cells (American Type Culture Collection, Manassas, VA)
were maintained in DMEM supplemented with 10% heatinactivated fetal bovine serum, 2 mmol/L L-glutamine, and
10 mmol/L HEPES (pH 7.5) under standard tissue culture
conditions of 5% humidified CO2 and 37jC. COS-7 cells were
2
National Cancer Institute – sponsored clinical trials of 17-AAG (http://www.
cancer.gov/search/ResultsClinicalTrialsAdvanced.aspx?protocolsearchid=
1892780) and Velcade (bortezomib; http://www.cancer.gov/search/ResultsClinical
TrialsAdvanced.aspx?protocolsearchid=1892785).
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
Protein Misfolding Induced ER Vacuolization
selected for this investigation because we observed previously
they were especially sensitive to vacuolization induced by
Hsp90 and proteasome inhibition and because they are
efficiently transfected with plasmid DNA. Subconfluent,
exponentially growing cells were exposed to Velcade alone
(Millennium Pharmaceuticals, Boston, MA), geldanamycin
alone (Developmental Therapeutics Program, National Cancer
Institute, NIH, Bethesda, MD), or the combination of both
agents at several concentrations and times; control COS-7 cells
were exposed to equivalent amounts of DMSO solvent
(V0.05%, v/v) in complete medium.
Transfections of Cells with Expression Vectors
COS-7 cells were transiently transfected with plasmids
expressing either the Living Colors ER marker fused to HcRed
fluorescent protein or plasmids expressing a Golgi apparatus
marker fused to EYFP (Clontech, Palo Alto, CA) using
FuGene 6 (Roche Molecular Biochemicals, Indianapolis, IN)
precisely according to the manufacturer’s instructions. Control
cells were transfected with a plasmid vector expressing only
unmodified EYFP. In other experiments, cells were transfected
with plasmids expressing wild-type or mutated VCP-GFP
fusion proteins (Dr. Akira Kakizuka, Kyoto, Japan), Flagtagged SVIP (a gift from Dr. M. Tagaya, Tokyo, Japan), or
ErbB2-EYFP (constructed in our laboratory by fusing the
EYFP sequence to the COOH terminus of the full-length
ErbB2 sequence). Following transfections, multiple fields of
cells were examined with an IX50-FLA fluorescence microscope (Olympus, Melville, NY) equipped with a Spot Junior
digital camera and appropriate wavelength filters. Images
illustrating the organelle markers and phenotypic changes
(400 and 1,000) were captured and enhanced when
necessary using Adobe PhotoShop software on a Mackintosh
G4 computer.
Immunoreagents and Chemicals
The antibodies used in this study were rabbit polyclonal antiubiquitin (Sigma-Aldrich, St. Louis, MO), mouse monoclonal
anti-Hsp70 (StressGen BioReagents, Victoria, British Columbia, Canada), mouse anti-Hsp90 (StressGen BioReagents),
rabbit anti-BiP/GRP78 (Santa Cruz Biotechnology, Santa Cruz,
CA), mouse anti-VCP (Research Diagnostics, Concord, MA
and Affinity BioReagents, Golden, CO), mouse anti-ErbB2
(Oncogene Research, San Diego, CA), anti-FLAG M2 and
Cy3-conjugated secondary anti-mouse antibodies (SigmaAldrich), horseradish peroxidase – conjugated rabbit anti-mouse
IgG1 (Cappel, Durham, NC), horseradish peroxidase –
conjugated sheep anti-mouse, and horseradish peroxidase –
conjugated donkey anti-rabbit (Amersham Life Sciences,
Arlington Heights, IL). All other reagent chemicals and
biochemicals used in this study were purchased from NIH
stockroom or Sigma-Aldrich.
Clarified Cell Lysate and Detergent-Insoluble Fractions
Exponentially growing COS-7 cells were washed twice
with ice-cold PBS and then lysed on ice for 20 minutes into
TNESV lysis buffer [50 mmol/L Tris-HCl (pH 7.5), 1% NP40
detergent, 2 mmol/L EDTA, 100 mmol/L NaCl, 10 mmol/L
orthovanadate] supplemented with Complete protease inhibitor
cocktail tablets (Roche Diagnostics, Penzberg, Germany).
Lysates were centrifuged at 14,000 g for 20 minutes at
4jC, the supernatant fraction was transferred to fresh tubes,
and the NP40 detergent-insoluble fraction was resuspended
in TNESV lysis buffer by brief sonication (10 seconds at
50 W) while immersed in ice. Protein concentrations of both
fractions were determined by the microtiter plate bicinchoninic
acid method using bovine serum albumin as the standard (95).
Samples were diluted with 5 reducing SDS loading buffer
[100 mmol/L DTT, 50 mmol/L Tris-HCl (pH 6.8), 10% (w/v)
SDS, 10% (v/v) glycerol, 0.01% (w/v) bromophenol blue
tracking dye; ref. 96] before loading identical known protein
quantities onto gels.
Immunoblot Analysis
After fractionating samples by 10% Tris-HCl SDS-PAGE
(Bio-Rad Laboratories, Inc., Hercules, CA), proteins were
electroeluted onto Protran nitrocellulose membranes (Schleicher
& Schuell, Keene, NH) by the wet transfer method. All
membranes to be probed by anti-ubiquitin immunoblotting were
first autoclaved while immersed in deionized water in a glass
tray for 40 minutes to denature the adherent ubiquitinated
proteins, which exposes latent ubiquitin epitopes and greatly
enhances sensitivity (17, 97, 98). After blocking nonspecific
binding sites on the membranes with 5% fat-free dry milk
dissolved in 10 mmol/L Tris (pH 7.5), 50 mmol/L NaCl,
2.5 mmol/L EDTA buffer, various antigens were immunodetected with appropriately diluted antibodies followed by
horseradish peroxidase – linked secondary antibodies. Visualization of protein bands was by enhanced chemiluminescence
(99) using a luminol-based commercial kit (Pierce, Rockford,
IL). Exposed XOMAT AR films (Kodak, Rochester, NY) were
developed and scanned (Microtek Scanmaker III, Carson, CA)
and the images were captured and processed with a Macintosh
G4 computer using Adobe PhotoShop 5.0 and Microsoft
PowerPoint software.
RNA Interference
COS-7 cells in 35-mm dishes were exposed to 100 nmol/L
siRNA targeted against wild-type VCP (a mixture of equal
amounts of two siRNA duplexes complementing the DNA
target sequences: ACCCTGATTGCTCGAGCTGTA and
AAGAACCGTCCCAATCGGTTA; Qiagen, Valencia, CA)
using si-Importer reagent (Upstate, Lake Placid, NY)
according to the manufacturer’s instructions. Following a
48-hour incubation, siRNA-treated cells were transiently
transfected with either ER or Golgi apparatus fluorescent
marker expression vectors or plasmids expressing an ErbB2EYFP fusion protein. Control cells were exposed to
irrelevant, nonmammalian siRNA (Qiagen). On the third
day of siRNA-VCP exposure, cells were cotreated with 50
nmol/L geldanamycin plus 25 nmol/L Velcade for an
additional 24 hours and then examined for morphologic
changes by phase-contrast and fluorescent microscopy.
Satellite plates of cells treated in exactly the same way with
siRNA and the two drugs were lysed, and after separation of
proteins by SDS-PAGE and transfer to nitrocellulose
membranes, VCP and ErbB2 protein levels were evaluated
by immunoblotting.
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
679
680 Mimnaugh et al.
Acknowledgments
We thank Jennifer Isaacs for facilitating our acquisition of the wild-type and
mutated VCP-GFP expression plasmids (a kind gift from Dr. Akira Kakizuka) and
Dr. M. Tagaya for the SVIP expression plasmid.
References
1. Welch WJ. Heat shock proteins functioning as molecular chaperones: their
roles in normal and stressed cells. Philos Trans R Soc Lond B Biol Sci 1993;339:
327 – 33.
2. Wegele H, Muller L, Buchner J. Hsp70 and Hsp90—a relay team for protein
folding. Rev Physiol Biochem Pharmacol 2004;151:1 – 44.
3. Whitesell L, Mimnaugh EG, DeCosta B, Myers CE, Neckers LM. Inhibition
of heat shock protein HSP90-60v-src heteroprotein complex formation by
benzoquinone ansamycins: essential role for stress proteins in oncogenic
transformation. Proc Natl Acad Sci U S A 1994;91:8324 – 8.
4. Neckers L, Schulte TW, Mimnaugh E. Geldanamycin as a potential anti-cancer
agent: its molecular target and biochemical activity. Invest New Drugs 1999;17:
361 – 73.
5. Neckers L, Neckers K. Heat-shock protein 90 inhibitors as novel cancer
chemotherapeutics—an update. Expert Opin Emerg Drugs 2005;10:137 – 49.
6. Whitesell L, Sutphin P, An WG, Schulte T, Blagosklonny MV, Neckers L.
Geldanamycin-stimulated destabilization of mutated p53 is mediated by the
proteasome in vivo . Oncogene 1997;14:2809 – 16.
7. An WG, Schulte TW, Neckers LM. The heat shock protein 90 antagonist
geldanamycin alters chaperone association with p210bcr-abl and v-src proteins
before their degradation by the proteasome. Cell Growth Differ 2000;11:355 – 60.
8. Workman P. Overview: translating Hsp90 biology into Hsp90 drugs. Curr
Cancer Drug Targets 2003;3:297 – 300.
9. Bagatell R, Whitesell L. Altered Hsp90 function in cancer: a unique
therapeutic opportunity. Mol Cancer Ther 2004;3:1021 – 30.
10. Whitesell L, Lindquist SL. HSP90 and the chaperoning of cancer. Nat Rev
Cancer 2005;5:761 – 72.
11. Miyata Y. Hsp90 inhibitor geldanamycin and its derivatives as novel cancer
chemotherapeutic agents. Curr Pharm Des 2005;11:1131 – 8.
12. Stebbins CE, Russo AA, Schneider C, Rosen N, Hartl FU, Pavletich NP.
Crystal structure of an Hsp90-geldanamycin complex: targeting of a protein
chaperone by an antitumor agent. Cell 1997;89:239 – 50.
13. Prodromou C, Roe SM, O’Brien R, Ladbury JE, Piper PW, Pearl LH.
Identification and structural characterization of the ATP/ADP-binding site in the
Hsp90 molecular chaperone. Cell 1997;90:65 – 75.
14. Grenert JP, Sullivan WP, Fadden P, et al. The amino-terminal domain of heat
shock protein 90 (hsp90) that binds geldanamycin is an ATP/ADP switch domain
that regulates hsp90 conformation. J Biol Chem 1997;272:23843 – 50.
26. Corboy MJ, Thomas PJ, Wigley WC. Aggresome formation. Methods Mol
Biol 2005;301:305 – 27.
27. Brewer JW, Diehl JA. PERK mediates cell-cycle exit during the mammalian
unfolded protein response. Proc Natl Acad Sci U S A 2000;97:12625 – 30.
28. Schroder M, Kaufman RJ. ER stress and the unfolded protein response.
Mutat Res 2005;569:29 – 63.
29. Hampton RY. ER stress response: getting the UPR hand on misfolded
proteins. Curr Biol 2000;10:R518 – 21.
30. Lawson B, Brewer JW, Hendershot LM. Geldanamycin, an hsp90/GRP94binding drug, induces increased transcription of endoplasmic reticulum (ER)
chaperones via the ER stress pathway. J Cell Physiol 1998;174:170 – 8.
31. Bush KT, Goldberg AL, Nigam SK. Proteasome inhibition leads to a heatshock response, induction of endoplasmic reticulum chaperones and thermotolerance. J Biol Chem 1997;272:9086 – 92.
32. Friedlander R, Jarosch E, Urban J, Volkwein C, Sommer T. A regulatory link
between ER-associated protein degradation and the unfolded-protein response.
Nat Cell Biol 2000;2:379 – 84.
33. Romisch K. Endoplasmic reticulum-associated degradation. Annu Rev Cell
Dev Biol 2005;21:435 – 56.
34. Hiller MM, Finger A, Schweiger M, Wolf DH. ER degradation of a
misfolded luminal protein by the cytosolic ubiquitin-proteasome pathway. Science
1996;273:1725 – 8.
35. McCracken AA, Brodsky JL. Evolving questions and paradigm shifts in
endoplasmic-reticulum-associated degradation (ERAD). BioEssays 2003;25:
868 – 77.
36. Ye Y, Shibata Y, Yun C, Ron D, Rapoport TA. A membrane protein complex
mediates retro-translocation from the ER lumen into the cytosol. Nature 2004;
429:841 – 7.
37. Bays NW, Hampton RY. Cdc48-1-Npl4: stuck in the middle with Ub. Curr
Biol 2002;12:R366 – 71.
38. Jarosch E, Geiss-Friedlander R, Meusser B, Walter J, Sommer T. Protein
dislocation from the endoplasmic reticulum—pulling out the suspect. Traffic
2002;3:530 – 6.
39. Ye Y, Meyer HH, Rapoport TA. Function of the p97-1-Npl4 complex in
retrotranslocation from the ER to the cytosol: dual recognition of nonubiquitinated
polypeptide segments and polyubiquitin chains. J Cell Biol 2003;162:71 – 84.
40. Zhong X, Shen Y, Ballar P, Apostolou A, Agami R, Fang S. AAA ATPase
p97/valosin-containing protein interacts with gp78, a ubiquitin ligase
for endoplasmic reticulum-associated degradation. J Biol Chem 2004;279:
45676 – 84.
41. Richly H, Rape M, Braun S, Rumpf S, Hoege C, Jentsch S. A series of
ubiquitin binding factors connects CDC48/p97 to substrate multiubiquitylation
and proteasomal targeting. Cell 2005;120:73 – 84.
15. Mimnaugh EG, Chavany C, Neckers L. Polyubiquitination and proteasomal
degradation of the p185c-erbB-2 receptor protein-tyrosine kinase induced by
geldanamycin. J Biol Chem 1996;271:22796 – 801.
42. Ye Y, Shibata Y, Kikkert M, van Voorden S, Wiertz E, Rapoport TA.
Inaugural Article: Recruitment of the p97 ATPase and ubiquitin ligases to the site
of retrotranslocation at the endoplasmic reticulum membrane. Proc Natl Acad Sci
U S A 2005;102:14132 – 8.
16. Loo MA, Jensen TJ, Cui L, Hou Y, Chang XB, Riordan JR. Perturbation of
Hsp90 interaction with nascent CFTR prevents its maturation and accelerates its
degradation by the proteasome. EMBO J 1998;17:6879 – 87.
43. Dai RM, Li CC. Valosin-containing protein is a multi-ubiquitin chaintargeting factor required in ubiquitin-proteasome degradation. Nat Cell Biol 2001;
3:740 – 4.
17. Mimnaugh EG, Neckers LM. Measuring ubiquitin conjugation in cells.
Methods Mol Biol 2005;301:223 – 41.
44. Miller P, DiOrio C, Moyer M, et al. Depletion of the erbB-2 gene product
p185 by benzoquinoid ansamycins. Cancer Res 1994;54:2724 – 30.
45. Shimamura T, Lowell AM, Engelman JA, Shapiro GI. Epidermal growth
factor receptors harboring kinase domain mutations associate with the heat shock
protein 90 chaperone and are destabilized following exposure to geldanamycins.
Cancer Res 2005;65:6401 – 8.
46. Xiong X, Chong E, Skach WR. Evidence that endoplasmic reticulum (ER)associated degradation of cystic fibrosis transmembrane conductance regulator is
linked to retrograde translocation from the ER membrane. J Biol Chem 1999;274:
2616 – 24.
18. Johnston JA, Ward CL, Kopito RR. Aggresomes: a cellular response to
misfolded proteins. J Cell Biol 1998;143:1883 – 98.
19. Kopito RR. Aggresomes, inclusion bodies and protein aggregation. Trends
Cell Biol 2000;10:524 – 30.
20. Mimnaugh EG, Xu W, Vos M, et al. Simultaneous inhibition of hsp 90 and
the proteasome promotes protein ubiquitination, causes endoplasmic reticulumderived cytosolic vacuolization, and enhances antitumor activity. Mol Cancer
Ther 2004;3:551 – 66.
21. Mitsiades CS, Mitsiades NS, McMullan CJ, et al. Anti-myeloma activity of
heat shock protein-90 inhibition. Blood 2006;107:1092 – 100.
22. Adams J, Palombella VJ, Sausville EA, et al. Proteasome inhibitors: a novel
class of potent and effective antitumor agents. Cancer Res 1999;59:2615 – 22.
23. Adams J. Preclinical and clinical evaluation of proteasome inhibitor PS-341
for the treatment of cancer. Curr Opin Chem Biol 2002;6:493 – 500.
47. Ali A, Bharadwaj S, O’Carroll R, Ovsenek N. HSP90 interacts with and
regulates the activity of heat shock factor 1 in Xenopus oocytes. Mol Cell Biol
1998;18:4949 – 60.
48. Bagatell R, Paine-Murrieta GD, Taylor CW, et al. Induction of a heat shock
factor 1-dependent stress response alters the cytotoxic activity of hsp90-binding
agents. Clin Cancer Res 2000;6:3312 – 8.
24. Cusack JC. Rationale for the treatment of solid tumors with the proteasome
inhibitor bortezomib. Cancer Treat Rev 2003;29 Suppl 1:21 – 31.
49. Marcu MG, Doyle M, Bertolotti A, Ron D, Hendershot L, Neckers L. Heat
shock protein 90 modulates the unfolded protein response by stabilizing IRE1a.
Mol Cell Biol 2002;22:8506 – 13.
25. Wright JJ, Zerivitz K, Schoenfeldt M. Clinical trials referral resource. Current
clinical trials of bortezomib. Oncology (Huntingt) 2003;17:677 – 80, 676 – 83,
672 – 91.
50. Kawazoe Y, Nakai A, Tanabe M, Nagata K. Proteasome inhibition leads to
the activation of all members of the heat-shock-factor family. Eur J Biochem
1998;255:356 – 62.
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
Protein Misfolding Induced ER Vacuolization
51. Mitsiades N, Mitsiades CS, Poulaki V, et al. Molecular sequelae of
proteasome inhibition in human multiple myeloma cells. Proc Natl Acad Sci
U S A 2002;99:14374 – 9.
52. Ma Y, Hendershot LM. The mammalian endoplasmic reticulum as a sensor
for cellular stress. Cell Stress Chaperones 2002;7:222 – 9.
53. Rabinovich E, Kerem A, Frohlich KU, Diamant N, Bar-Nun S. AAA-ATPase
p97/Cdc48p, a cytosolic chaperone required for endoplasmic reticulum-associated
protein degradation. Mol Cell Biol 2002;22:626 – 34.
54. Rouiller I, DeLaBarre B, May AP, et al. Conformational changes of the
multifunction p97 AAA ATPase during its ATPase cycle. Nat Struct Biol 2002;9:
950 – 7.
55. Song C, Wang Q, Li CC. ATPase activity of p97-valosin-containing protein
(VCP). D2 mediates the major enzyme activity, and D1 contributes to the heatinduced activity. J Biol Chem 2003;278:3648 – 55.
56. Jarosch E, Taxis C, Volkwein C, et al. Protein dislocation from the ER
requires polyubiquitination and the AAA-ATPase Cdc48. Nat Cell Biol 2002;4:
134 – 9.
57. Meyer HH, Wang Y, Warren G. Direct binding of ubiquitin conjugates by
the mammalian p97 adaptor complexes, p47 and Ufd1-4. EMBO J 2002;21:
5645 – 52.
58. Flierman D, Ye Y, Dai M, Chau V, Rapoport TA. Polyubiquitin serves as a
recognition signal, rather than a ratcheting molecule, during retrotranslocation of
proteins across the endoplasmic reticulum membrane. J Biol Chem 2003;278:
34774 – 82.
59. Hirabayashi M, Inoue K, Tanaka K, et al. VCP/p97 in abnormal protein
aggregates, cytoplasmic vacuoles, and cell death, phenotypes relevant to
neurodegeneration. Cell Death Differ 2001;8:977 – 84.
60. Wojcik C. An inhibitor of the chymotrypsin-like activity of the proteasome
(PSI) induces similar morphological changes in various cell lines. Folia
Histochem Cytobiol 1997;35:211 – 4.
61. Marquardt T, Helenius A. Misfolding and aggregation of newly synthesized
proteins in the endoplasmic reticulum. J Cell Biol 1992;117:505 – 13.
62. Casagrande R, Stern P, Diehn M, et al. Degradation of proteins from the ER
of S. cerevisiae requires an intact unfolded protein response pathway. Mol Cell
2000;5:729 – 35.
63. Jorgensen MM, Bross P, Gregersen N. Protein quality control in the
endoplasmic reticulum. APMIS 2003;Suppl:86 – 91.
64. Kobayashi T, Tanaka K, Inoue K, Kakizuka A. Functional ATPase activity of
p97/valosin-containing protein (VCP) is required for the quality control of
endoplasmic reticulum in neuronally differentiated mammalian PC12 cells. J Biol
Chem 2002;277:47358 – 65.
65. Nagahama M, Suzuki M, Hamada Y, et al. SVIP is a novel VCP/p97interacting protein whose expression causes cell vacuolation. Mol Biol Cell 2003;
14:262 – 73.
66. Wang Q, Song C, Li CC. Molecular perspectives on p97-VCP: progress in
understanding its structure and diverse biological functions. J Struct Biol 2004;
146:44 – 57.
67. Meyer HH. Golgi reassembly after mitosis: the AAA family meets the
ubiquitin family. Biochim Biophys Acta 2005;1744:108 – 19.
68. Fratta P, Engel WK, McFerrin J, Davies KJ, Lin SW, Askanas V. Proteasome
inhibition and aggresome formation in sporadic inclusion-body myositis and in
amyloid-h precursor protein-overexpressing cultured human muscle fibers. Am J
Pathol 2005;167:517 – 26.
69. Wojcik C, Yano M, DeMartino GN. RNA interference of valosin-containing
protein (VCP/p97) reveals multiple cellular roles linked to ubiquitin/proteasomedependent proteolysis. J Cell Sci 2004;117:281 – 92.
70. Lippincott-Schwartz J, Snapp E, Kenworthy A. Studying protein dynamics in
living cells. Nat Rev Mol Cell Biol 2001;2:444 – 56.
71. Wang Y, Satoh A, Warren G, Meyer HH. VCIP135 acts as a deubiquitinating
enzyme during p97-47-mediated reassembly of mitotic Golgi fragments. J Cell
Biol 2004;164:973 – 8.
75. Chavany C, Mimnaugh E, Miller P, et al. p185erbB2 binds to GRP94
in vivo. Dissociation of the p185erbB2/GRP94 heterocomplex by benzoquinone ansamycins precedes depletion of p185erbB2. J Biol Chem 1996;271:
4974 – 7.
76. Xu W, Mimnaugh EG, Kim JS, Trepel JB, Neckers LM. Hsp90, not Grp94,
regulates the intracellular trafficking and stability of nascent ErbB2. Cell Stress
Chaperones 2002;7:91 – 6.
77. Wiley HS. Trafficking of the ErbB receptors and its influence on signaling.
Exp Cell Res 2003;284:78 – 88.
78. Uchiyama K, Jokitalo E, Kano F, et al. VCIP135, a novel essential factor
for p97/p47-mediated membrane fusion, is required for Golgi and ER assembly
in vivo. J Cell Biol 2002;159:855 – 66.
79. Lee AH, Iwakoshi NN, Anderson KC, Glimcher LH. Proteasome inhibitors
disrupt the unfolded protein response in myeloma cells. Proc Natl Acad Sci U S A
2003;100:9946 – 51.
80. Prince T, Shao J, Matts RL, Hartson SD. Evidence for chaperone
heterocomplexes containing both Hsp90 and VCP. Biochem Biophys Res
Commun 2005;331:1331 – 7.
81. Nomura M, Nomura N, Newcomb EW, Lukyanov Y, Tamasdan C, Zagzag D.
Geldanamycin induces mitotic catastrophe and subsequent apoptosis in human
glioma cells. J Cell Physiol 2004;201:374 – 84.
82. Drexler HC. Activation of the cell death program by inhibition of proteasome
function. Proc Natl Acad Sci U S A 1997;94:855 – 60.
83. Cao K, Nakajima R, Meyer HH, Zheng Y. The AAA-ATPase Cdc48/
p97 regulates spindle disassembly at the end of mitosis. Cell 2003;115:
355 – 67.
84. Nichols BJ, Pelham HR. SNAREs and membrane fusion in the Golgi
apparatus. Biochim Biophys Acta 1998;1404:9 – 31.
85. Cao K, Zheng Y. The Cdc48/p97-1-Npl4 complex: its potential role in
coordinating cellular morphogenesis during the M-G1 transition. Cell Cycle 2004;
3:422 – 4.
86. Mayr PS, Allan VJ, Woodman PG. Phosphorylation of p97(VCP) and p47
in vitro by p34cdc2 kinase. Eur J Cell Biol 1999;78:224 – 32.
87. Asai T, Tomita Y, Nakatsuka S, et al. VCP (p97) regulates NFnB signaling
pathway, which is important for metastasis of osteosarcoma cell line. Jpn J Cancer
Res 2002;93:296 – 304.
88. Partridge JJ, Lopreiato JO, Jr., Latterich M, Indig FE. DNA damage
modulates nucleolar interaction of the Werner protein with the AAA ATPase p97/
VCP. Mol Biol Cell 2003;14:4221 – 9.
89. Livingstone M, Ruan H, Weiner J, et al. Valosin-containing protein
phosphorylation at Ser784 in response to DNA damage. Cancer Res 2005;65:
7533 – 40.
90. Yamamoto S, Tomita Y, Nakamori S, et al. Elevated expression of valosincontaining protein (p97) in hepatocellular carcinoma is correlated with increased
incidence of tumor recurrence. J Clin Oncol 2003;21:447 – 52.
91. Yamamoto S, Tomita Y, Hoshida Y, et al. Expression of valosin-containing
protein in colorectal carcinomas as a predictor for disease recurrence and
prognosis. Clin Cancer Res 2004;10:651 – 7.
92. Yamamoto S, Tomita Y, Hoshida Y, et al. Expression level of valosincontaining protein (p97) is correlated with progression and prognosis of nonsmall-cell lung carcinoma. Ann Surg Oncol 2004;11:697 – 704.
93. Tsujimoto Y, Tomita Y, Hoshida Y, et al. Elevated expression of valosincontaining protein (p97) is associated with poor prognosis of prostate cancer. Clin
Cancer Res 2004;10:3007 – 12.
94. Jolly C, Morimoto RI. Role of the heat shock response and molecular
chaperones in oncogenesis and cell death. J Natl Cancer Inst 2000;92:1564 – 72.
95. Smith PK, Krohn RI, Hermanson GT, et al. BCA protein assay. Anal
Biochem 1985;150:76 – 85.
96. Laemmli UK. Cleavage of structural proteins during the assembly of the head
of bacteriophage T4. Nature (Lond) 1970;227:680 – 5.
72. Uchiyama K, Kondo H. p97/p47-mediated biogenesis of Golgi and ER.
J Biochem (Tokyo) 2005;137:115 – 9.
97. Swerdlow PS, Finley D, Varshavsky A. Enhancement of immunoblot
sensitivity by heating of hydrated filters. Anal Biochem 1986;156:147 – 53.
73. Kano F, Kondo H, Yamamoto A, et al. NSF/SNAPs and p97/p47/VCIP135
are sequentially required for cell cycle-dependent reformation of the ER network.
Genes Cells 2005;10:989 – 99.
98. Mimnaugh EG, Neckers LM. Immunoblotting methods for the study of
protein ubiquitination. Methods Mol Biol 2002;194:179 – 203.
74. Woodman PG. p97, a protein coping with multiple identities. J Cell Sci 2003;
116:4283 – 90.
99. Bobrow MN, Harris TD, Shaughnessy KJ, Litt GJ. Catalyzed reporter
disposition, a novel method of signal amplification. J Immunol Methods 1989;
125:279 – 85.
Mol Cancer Res 2006;4(9). September 2006
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
681
Endoplasmic Reticulum Vacuolization and
Valosin-Containing Protein Relocalization Result from
Simultaneous Hsp90 Inhibition by Geldanamycin and
Proteasome Inhibition by Velcade
Edward G. Mimnaugh, Wanping Xu, Michele Vos, et al.
Mol Cancer Res 2006;4:667-681.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://mcr.aacrjournals.org/content/4/9/667
This article cites 98 articles, 44 of which you can access for free at:
http://mcr.aacrjournals.org/content/4/9/667.full.html#ref-list-1
This article has been cited by 8 HighWire-hosted articles. Access the articles at:
/content/4/9/667.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.