Endoplasmic Reticulum Vacuolization and ValosinContaining Protein Relocalization Result from Simultaneous Hsp90 Inhibition by Geldanamycin and Proteasome Inhibition by Velcade Edward G. Mimnaugh, Wanping Xu, Michele Vos, Xitong Yuan, and Len Neckers Urologic Oncology Branch, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland Abstract Geldanamycin and Velcade, new anticancer drugs with novel mechanisms of action, are currently undergoing extensive clinical trials. Geldanamycin interrupts Hsp90 chaperone activity and causes down-regulation of its many client proteins by the ubiquitin-proteasome pathway; Velcade is a specific proteasome inhibitor. Misfolded Hsp90 clients within the endoplasmic reticulum (ER) lumen are cleared by ER-associated protein degradation, a sequential process requiring valosin-containing protein (VCP) – dependent retrotranslocation followed by ubiquitination and proteasomal proteolysis. Cotreatment of cells with geldanamycin and Velcade prevents destruction of destabilized, ubiquitinated Hsp90 client proteins, causing them to accumulate. Here, we report that misfolded protein accumulation within the ER resulting from geldanamycin and Velcade exposure overwhelms the ability of the VCP-centered machine to maintain the ER secretory pathway, causing the ER to distend into conspicuous vacuoles. Overexpression of dominantnegative VCP or the ‘‘small VCP-interacting protein’’ exactly recapitulated the vacuolated phenotype provoked by the drugs, associating loss of VCP function with ER vacuolization. In cells transfected with a VCP-enhanced yellow fluorescent protein fluorescent construct, geldanamycin plus Velcade treatment redistributed VCP-enhanced yellow fluorescent protein from the cytoplasm and ER into perinuclear aggresomes. In further support of the view that compromise of VCP function is responsible for ER vacuolization, small interfering RNA interference of VCP Received 1/19/06; revised 6/19/06; accepted 6/29/06. Grant support: Intramural Research Program of the Center for Cancer Research, NIH, National Cancer Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Note: Present address for M. Vos: Division of Extramural Activities, National Institute of Allergy and Infectious Disease, NIH, Bethesda, MD 20892. Present address for X. Yuan: Beijing Institute of Disease Control and Prevention, Beijing 100039, China. Requests for reprints: Len Neckers, Urologic Oncology Branch, Center for Cancer Research, National Cancer Institute, NIH, 9000 Rockville Pike, Building 10, Room 1-5940, Bethesda, MD 20892-1107. Phone: 301-496-5899. E-mail: [email protected] Copyright D 2006 American Association for Cancer Research. doi:10.1158/1541-7786.MCR-06-0019 expression induced ER vacuolization that was markedly increased by Velcade. VCP knockdown by small interfering RNA eventually deconstructed both the ER and Golgi and interdicted protein trafficking through the secretory pathway to the plasma membrane. Thus, simultaneous geldanamycin and Velcade treatment has far-reaching secondary cytotoxic consequences that likely contribute to the cytotoxic activity of this anticancer drug combination. (Mol Cancer Res 2006;4(9):667 – 81) Introduction All organisms have evolved complex mechanisms to protect themselves from the deleterious consequences of mutated, oxidized, or otherwise improperly folded proteins. In particular, the heat shock proteins Hsp90 and Hsp70, also called chaperones or stress proteins, critically assist newly synthesized polypeptides (clients) in achieving their functional conformation, localization, activation, and even oligomerization (1, 2). Currently, >100 Hsp90 client proteins have been described (see website maintained by Dr. D. Picard),1 including a myriad of transcription factors, signal-transducing receptor kinases, cell cycle regulators, and steroid hormone receptors, most of which are essential for cell proliferation and survival (3-5). Unfortunately, Hsp90 may be a double-edged sword because it also stabilizes mutated tumor suppressors and inappropriately activated oncoproteins that contribute to the initiation, growth, and metastasis of human cancers (6-11). Geldanamycin and its clinically active analogue, 17allylamino-17-demethoxygeldanamycin (17-AAG), specifically bind to and profoundly inhibit the protein chaperone function of Hsp90 (12-14), inducing ubiquitination and proteasomal destruction of its numerous client proteins (15-17). When cells are simultaneously exposed to geldanamycin and a proteasome inhibitor, the degradation of geldanamycin-destabilized Hsp90 clients is unproductive; consequently, ubiquitinated misfolded proteins accumulate and usually coalesce into highly insoluble, perinuclear inclusion bodies known as aggresomes (18, 19). In preclinical experiments, the combination of geldanamycin and the proteasome inhibitor, Velcade, exhibits selectivity for transformed cells, inhibits proliferation, and is more cytocidal to tumor cells than either drug alone (20, 21). These observations prompted us to hypothesize that a buildup of 1 http://www.picard.ch/downloads/Hsp90interactors.pdf. Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. 667 668 Mimnaugh et al. misfolded, nondegradable Hsp90 client proteins might be responsible for the enhanced cytotoxicity of this drug combination (20). Both 17-AAG (5, 10) and Velcade (22-25) show promising clinical activity against various human cancers, and these drugs are currently in multiple advanced combinatory trials with standard first-line anticancer drugs (9, 26). Recently, a phase I clinical trial of 17-AAG combined with Velcade was initiated at several cancer research centers. When protein misfolding occurs within the endoplasmic reticulum (ER)-Golgi secretory pathway, the stress-recognizing proteins, Ire1p, PERK, and ATF6, signal for augmented synthesis of ER residing chaperones to facilitate correction of protein misfolding and also initiate transcriptional repression of essentially all other proteins (27, 28). This signaling cascade specifically responding to protein misfolding in the ER is called the unfolded protein response (29), and both geldanamycin (30) and Velcade (31) stimulate powerful unfolded protein responses. When protein misfolding in the ER fails to be corrected by the unfolded protein response, cells activate a secondary defensive mechanism called ER-associated protein degradation (ERAD; refs. 32, 33). ERAD unblocks the ERGolgi secretory pathway of misfolded polypeptides by retrotransporting them from the ER into the cytoplasm, where they undergo ubiquitination and proteasomal degradation (34, 35). This complex yet seamless mechanism of moving misfolded polypeptides across the ER membrane to undergo destruction requires the participation of the p97 ATPase, valosin-containing protein (VCP; Cdc48 in yeast; ref. 36). The hexameric, VCPcentered molecular machine, complemented with Ufd1p and Npl4p adapter proteins, mechanically ratchets misfolded polypeptides across the ER membrane at the expense of ATP (37-39). ERAD-specific ubiquitin ligases recruited to the extraction complex quickly ubiquitinate the emerging polypeptides (40-42) that are then escorted by ubiquitin-binding proteins to nearby cytosolic proteasomes for disassembly (37, 38, 43). Consequently, when geldanamycin or 17-AAG binds to Hsp90, destabilized clients, such as ErbB2 tyrosine kinase (15, 44), the cystic fibrosis transmembrane conductance regulator (16), or the mutated epidermal growth factor receptor (45), which normally pass through the secretory pathway to the plasma membrane (46), are instead rapidly down-regulated by ERAD. In addition to initiating profound ER stress, activating the unfolded protein response and ERAD, and promoting massive protein ubiquitination, we have noted that simultaneous geldanamycin and Velcade treatment causes distension of ER cisternae into numerous conspicuous vacuoles (20). Newly acquired data now indicate that geldanamycin plus Velcade – initiated ER vacuolization occurs as a consequence of overwhelming the ability of the VCP-centered molecular machine to extract misfolded proteins from the ER. We report here that VCP overexpression significantly mitigates geldanamycin plus Velcade – induced ER vacuolization. Conversely, transient transfections of dominant-negative VCP (dnVCP) or the interfering ‘‘small VCP-interacting protein’’ (SVIP) recapitulates the drug-induced vacuole phenotype. Knockdown of VCP by small interfering RNA (siRNA) interference induces ER vacuolization that is exacerbated by Velcade cotreatment and demolishes ER and Golgi architectures, derailing ErbB2 trafficking to the plasma membrane. Compro- mising the ERAD function of VCP by a massive accumulation of ubiquitinated and misfolded proteins is a heretofore unforeseen secondary consequence of combining geldanamycin with Velcade. Results Geldanamycin plus Velcade Cotreatment Initiates Cytosolic and ER Stress Responses and Greatly Enhances Protein Ubiquitination The binding of geldanamycin to Hsp90 indirectly activates heat shock factor-1 (47, 48) and Ire1a (49) stress sensor proteins, which then enter the nucleus and activate multiple stress response genes. Similarly, intracellular accumulation of misfolded proteins resulting from proteasome inhibition by Velcade is known to activate cytosolic and ER stress responses (50, 51). When COS-7 cells were simultaneously exposed to geldanamycin and Velcade, the cytosolic heat shock proteins Hsp70 and Hsp90 and the ER protein chaperone, BiP/GRP78 (30, 52), were elevated as much as 40-fold (Fig. 1A). Geldanamycin or Velcade alone induced only more modest cytosolic and ER stress responses (data not shown). Excessive protein misfolding in the ER initiates compensatory activation of the ERAD pathway, which depends on the mechanical action of the VCP-centered heterocomplex molecular machine to extract denatured polypeptides from the ER lumen (53-56). The crucial participation of VCP in this elegant mechanism prompted us to examine whether overexpression of VCP would mitigate the ER cellular stress response initiated by geldanamycin and Velcade. Surprisingly, we found that greatly elevated levels of VCP achieved by transient transfection diminished neither ER nor cytosolic cellular stress responses resulting from simultaneous Hsp90 and proteasome inhibition (Fig. 1A, lanes 3 and 4). The amount of endogenous soluble VCP in COS-7 lysates was essentially unaltered by geldanamycin, Velcade, or the combination of the two inhibitors. However, interestingly, a substantial portion of endogenous VCP was detected in the detergent-insoluble, pellet fraction (Fig. 1B) from cells treated with geldanamycin plus Velcade. Velcade alone only slightly elevated the quantity of detergent-insoluble VCP, and geldanamycin alone had no effect. In cells in which the level of VCP was augmented by transient transfections, more than half of the overexpressed VCP protein was found in the detergentinsoluble fraction of cell lysates following geldanamycin plus Velcade treatment, whereas only a minuscule quantity of VCP partitioned into the pellet fraction from VCP-transfected cells not exposed to the drugs (Fig. 1C, top). Protein ubiquitination in the soluble lysate fraction from COS-7 cells treated with geldanamycin plus Velcade was only slightly increased, but in the detergent-insoluble pellet fraction, protein ubiquitination was extensive (Fig. 1C). Transient transfection and overexpression of VCP neither attenuated nor augmented the extent of protein ubiquitination in either fraction derived from the drug-treated cells. Given that VCP itself, as well as its ERAD-specific adaptor proteins, Ufd1p and Npl4p, bind to polyubiquitin chains (57-59), it is probable that the large quantity of VCP in the detergent-insoluble pellet fraction from geldanamycin plus Velcade – treated cells cosedimented with aggregated insoluble ubiquitinated proteins. Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. Protein Misfolding Induced ER Vacuolization FIGURE 1. Geldanamycin + Velcade treatment induces a powerful stress response and causes ubiquitinated proteins and VCP to become detergent insoluble. COS-7 cells were treated with 50 nmol/L geldanamycin (GA ), 25 nmol/L Velcade (Vcd ), or both drugs simultaneously (Rx) for 24 hours before harvesting cells into NP40-containing lysis buffer. Lysates were centrifuged to separate the clarified lysate and detergent-insoluble fractions. A. Hsp70, Hsp90, and BiP/GRP78 were measured by immunoblotting 50 Ag lysates from control cells (lane 1), cells treated with geldanamycin + Velcade (lanes 2 and 4), and cells in which VCP was highly overexpressed by transient transfections (lanes 3 and 4). These three stress proteins were increased as much as 40-fold by the drug treatments, indicating a powerful stress response occurred in the both cytoplasm and ER in response to the drugs. B. Neither geldanamycin, Velcade, nor the combination of both drugs altered the endogenous level of VCP in cell lysates; however, geldanamycin + Velcade increased the amount of endogenous VCP redistributed into the detergent-insoluble fraction. C. Top, only overexpressed transfected VCP was visualized because the film exposure was sufficiently short to prevent detection of endogenous VCP. Note the tremendous increase in VCP in the detergent-insoluble fraction from geldanamycin + Velcade – treated cells. Bottom, anti-ubiquitin immunoblot shows a robust increase in ubiquitinated proteins in the lysate fraction and an even greater increase in ubiquitinated proteins in the detergent-insoluble pellet fraction from cells treated with the drug combination. Note that highly overexpressed VCP did not alter the quantity of protein ubiquitination in either fraction in either the presence or the absence of the two drugs. Destabilization of Hsp90 by Geldanamycin Augments Velcade-Caused Vacuolization of COS-7 Cells When used at 10 nmol/L, a concentration half-maximally inhibiting proteasome activity in intact cells within 1 hour (20), Velcade alone induced cytoplasmic vacuolization in only a small proportion of COS-7 cells (f2%) within 24 hours, but when cells were exposed to 200 nmol/L Velcade for 24 hours, vacuolization was extensive, occurring in as many as 75% of cells (Fig. 2A). When we examined the concentration dependency of Velcade-induced vacuolization in COS-7 cells, we found a linear relationship between Velcade concentration and cell vacuolization, up to f50 nmol/L Velcade (Fig. 2B, left). Previous experiments in our laboratory indicated that 50 nmol/L Velcade inhibited proteasome activity in MCF-7 cells by f90% (20), corresponding reasonably well with this outcome. Geldanamycin alone at 50 nmol/L (Fig. 2A) or even at 3 Amol/L (data not shown) was incapable of promoting vacuolization in COS-7 cells (Fig. 2A). However, the incidence of vacuolization in cells exposed to the low 10 nmol/L concentration of Velcade was enhanced f2-fold by including 50 nmol/L geldanamycin (Fig. 2A, top right and C). Longer incubations with both drugs at these concentrations (up to 48 hours) increased the proportion of vacuolated cells to as much as 75%. But by then, most cells rounded up, released from the plastic, and developed surface blebbing indicative of apoptosis (results not shown). Interestingly, pretreatment of cells with geldanamycin for 24 hours followed by washout and overnight exposure to 10 nmol/L Velcade also effectively increased the incidence of vacuolization. The ability of geldanamycin to synergize with Velcade to induce cell vacuolization, even when the drugs are used sequentially, illustrates the durability of Hsp90 inhibition and suggests that client protein destabilization persists well after the drug is removed from the medium. Geldanamycin plus Velcade – Induced Vacuolization of COS-7 Cells Results from ER Dilation Cytoplasmic vacuolization of various types of cells treated with proteasome inhibitors has been ascribed to result from extensive dilation of ER cisternae (20, 59, 60). To verify that vacuoles induced by Hsp90 and proteasome inhibition in COS-7 cells originated from the ER, we transfected those cells with a plasmid vector expressing a red fluorescent protein fused to the KDEL ER localization sequence of calreticulin 48 hours before exposing them to geldanamycin and Velcade. In control cells, the fluorescent ER marker visualized the typical membranous ER architecture, which was concentrated near the nucleus and dispersed net-like throughout the cytoplasm, extending outward to the plasma membrane (Fig. 3A). When COS-7 cells were treated with geldanamycin plus Velcade, the fluorescent ER marker was strongly localized exclusively within the lumen of the drug-induced vacuoles, and essentially none of the normal reticulated ER structure remained (Fig. 3B). Beginning Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. 669 670 Mimnaugh et al. FIGURE 2. Geldanamycin greatly increases the ability of Velcade to induce vacuolization of cells. A. Cells were treated with either Velcade alone at 10 and 200 nmol/L, geldanamycin alone at 50 nmol/L, or 10 nmol/L Velcade + 50 nmol/L geldanamycin simultaneously for 24 hours. The low concentration of Velcade induced vacuolization in f5% to 10% of COS-7 cells, whereas Velcade at 200 nmol/ L prompted f90% of cells to become heavily vacuolated. The extent of vacuolization caused by 10 nmol/L Velcade (a concentration that inhibits proteasome activity by f50%) was greatly enhanced by either the simultaneous or sequential inclusion of geldanamycin. B. Concentrationdependent induction of cell vacuolization caused by Velcade alone. Following Velcade exposure for 24 hours, cells were photographed and the numbers of cells having numerous vacuoles (arbitrarily set at eight or more per cell) were counted in four separate microscopic fields. Points, mean of four separate determinations. C. Percentage of vacuolated cells induced by Velcade at 10 nmol/L for 22 hours was more than doubled by the simultaneous inclusion of 50 nmol/L geldanamycin. Longer exposure times, up to 48 hours, increased the percentage of vacuolated cells, but beyond 48 hours, most of the cells rounded up and released from the plastic surface. at f16 hours, small vacuoles first originated at or near the nuclear envelope, then expanded outward, and became more numerous as they further distorted the normal ER architecture. In some cells, especially at later times, several vacuoles seem to have fused together. Most commonly, the distribution of cytoplasmic vacuoles appeared random, but occasionally in some cells they seemed to radiate outward linearly from the nucleus (Fig. 3B, top left). In nonresponding geldanamycin plus Velcade – treated cells that failed to form cytoplasmic vacuoles, the fluorescent ER marker visualized only the normal ER architecture (data not shown). Thus, we conclude that the geldanamycin and Velcade – induced vacuolization of COS-7 cells resulted from extensive dilation of the ER. Tunicamycin-Caused Protein Misfolding in the ER Induces Vacuolization in Proteasome-Inhibited COS-7 Cells We reasoned that if geldanamycin plus Velcade induced cell vacuolization by promoting protein misfolding and retention in the ER lumen, then exposing cells to tunicamycin, a protein glycosylation inhibitor known to induce substantial ER protein misfolding and the unfolded protein response (61), should recapitulate the geldanamycin plus Velcade –induced vacuolated phenotype. Whereas exposure to tunicamycin alone promoted no COS-7 cell vacuolization, when tunicamycin was combined with as little as 5 nmol/L Velcade, extensive vacuolization (>90% of cells) occurred within as little as 16 hours (Fig. 4A). Although the dynamics of vacuole development was more rapid, the overall appearance of the vacuoles induced by tunicamycin combined with Velcade was identical to the vacuolization induced by geldanamycin plus Velcade, including the initial perinuclear emergence, size distribution, and eventual congestion of the entire cytoplasm. These common traits reinforce the notion that geldanamycin plus Velcade –caused vacuoles are a predictable consequence of excessive protein misfolding within the ER. We have noted previously that incubating cells at 43jC in the presence of Velcade, but not heat shock alone, likewise caused cytoplasmic vacuolization (20), an outcome consistent with the accumulation of heat-denatured, misfolded proteins within the ER compartment (62, 63). Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. Protein Misfolding Induced ER Vacuolization dnVCP or SVIP Overexpression Promotes Cell Vacuolization A vacuolated cellular phenotype has been shown to occur when endogenous wild-type VCP is compromised by overexpression of mutated, ATPase-inactivated dnVCP (64). Consistent with this observation, transient transfections of COS-7 cells with a plasmid vector expressing mutated dnVCP induced a vacuolated phenotype that was morphologically identical to that induced by geldanamycin and Velcade (Fig. 4B). Importantly, this result shows that specific interdiction of VCP function alone is sufficient to promote ER-derived cellular vacuolization. Similarly, overexpression of SVIP protein interferes with VCP function and causes cells to become vacuolated (65). Within 48 hours after transfections with a plasmid expressing SVIP, COS-7 cells developed prominent vacuoles resembling those induced by geldanamycin plus Velcade treatment (Fig. 5A, top). When SVIP-transfected cells were cotreated with geldanamycin, twice to thrice as many cells became vacuolated (Fig. 5A, bottom ), consistent with protein misfolding as a consequence of geldanamycin inhibition of Hsp90 chaperone function. SVIP was expressed as a FLAG fusion protein and anti-FLAG immunocytofluorescence revealed that the SVIP fusion protein was strongly localized on the drug-induced vacuoles, where it may have bound to VCP (Fig. 5B, top and bottom). Collectively, these data support the concept that misfolded polypeptide accumulation within the ER of Hsp90- and proteasome-inhibited cells necessarily occurs when the polypeptide extraction function of VCP is compromised by overexpressed dnVCP or SVIP or when VCP is overwhelmed by misfolded nondegradable proteins. Overexpression of VCP Diminishes Geldanamycin plus Velcade – Induced ER Vacuolization VCP is a relatively abundant protein compromising as much as 1% of total cellular proteins (66). However, the much lower quantity of VCP localized on ER membranes that participates in ERAD might become saturated with ubiquitinated proteins after cells are treated with geldanamycin and Velcade. Alternatively, VCP might even be depleted from the ER, given that a substantial quantity of VCP is relocated to the detergentinsoluble pellet fraction of cells in response to these two drugs. If ER vacuolization resulting from geldanamycin and Velcade exposure results from interference with the ERAD function of VCP, then supplemental VCP would be expected to attenuate the vacuolated phenotype induced by these two drugs. To explore this possibility, we transfected COS-7 cells with a vector expressing wild-type VCP-green fluorescent protein (GFP) fusion protein, waited 48 hours to permit the overexpressed VCP protein to accumulate, and then exposed cells to geldanamycin plus Velcade for an additional 24 hours. In those cells expressing abundant VCP-GFP protein (green in the overlayered images), exposure to the drugs did not induce ER vacuolization (Fig. 6, left and right ). Although small percentage of drug-treated cells developed vacuoles, those cells uniformly failed to express detectable levels of the VCPGFP fusion protein (Fig. 6, left and right). There were no obvious phenotypic changes in cells transfected with the VCPexpressing plasmid but not exposed to the drugs (data not shown). These data showing protection against ER vacuolization by exogenous VCP, especially when juxtaposed with the contrasting dnVCP and SVIP results, argue strongly that the ERAD function of VCP was susceptible to inhibition by geldanamycin plus Velcade – dependent protein misfolding. FIGURE 3. Cytoplasmic vacuoles in COS-7 cells induced by geldanamycin + Velcade treatment are ER derived. COS-7 cells were transiently transfected with a plasmid vector expressing the KDEL sequence of the ER resident protein, calreticulin, fused to red fluorescent protein before being treated with 10 nmol/L Velcade + 50 nmol/L geldanamycin for 24 hours. A. Fluorescent ER marker visualized the normal ER architecture in control cells. B. Reticulated ER structure was dramatically altered in cells exposed to the two drugs. Note that the fluorescent calreticulin-KDEL sequence-derived ER marker was localized inside the vacuoles, suggesting dilation of the ER lumenal space as a consequence of the accumulation of misfolded proteins following Hsp90 and proteasome inhibition. At early times, vacuolization was predominantly perinuclear, but eventually the vacuoles fill the entire cytoplasmic space. Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. 671 672 Mimnaugh et al. Geldanamycin plus Velcade Redistributes VCP Away from the ER and Cytoplasm into Aggresomes Because Hsp90 and proteasome inhibition redistributed both endogenous and transfected VCP into the detergent-insoluble fraction of COS-7 cells (Fig. 1B and C), we visually examined the consequences of geldanamycin plus Velcade treatment on the disposition of a transiently transfected VCP-GFP fusion protein. In controls, VCP-GFP-derived fluorescence was predominantly cytoplasmic (Fig. 7A), although a few cells exhibited faint nuclear fluorescence (data not shown). VCP is known to associate with the ER and Golgi apparatus membranes (66, 67), but we were unable to observe VCP-GFP on membranous structures because of its overpowering cytoplasmic fluorescence. When VCP-GFP-transfected COS-7 cells were exposed to geldanamycin plus Velcade for 24 hours, we observed that VCP-GFP had been completely redistributed into highly condensed, perinuclear bodies resembling aggresomes (Fig. 7B; refs. 18, 19, 26). Longer image capture (exposure) revealed that essentially all of the VCP-GFP fusion protein had been depleted from the cytoplasm, and no residual VCP-GFP fluorescence remained on ER membranes or on drug-induced vacuoles (data not shown). A previous report described condensation of VCPGFP into perinuclear aggresomes after cells were treated with a proteasome inhibitor (59). VCP may have redistributed from the cytoplasm, ER, and Golgi, as a consequence of Hsp90 and proteasome inhibition, because the VCP-centered extraction complex remained bound to ubiquitinated proteins that could not undergo proteolysis by inactive proteasomes (57). When stabilized by proteasome inhibition, ubiquitinated ER transiting and cytosolic Hsp90 client proteins frequently aggregate and accumulate in large insoluble aggresomes (18, 68). Given that ubiquitinated proteins and VCP were both greatly increased in the detergent-insoluble fraction of geldanamycin plus Velcade – treated cells (Fig. 1C), we suggest that VCP-GFP fusion protein in the drug-treated cells was segregated into aggresomes. FIGURE 4. Tunicamycin-induced protein misfolding within the ER lumen and overexpression of mutated, ATPase-inactive dnVCP both cause vacuolization. As they traverse the ER pathway, plasma membrane – residing polypeptides become misfolded when they fail to undergo glycosylation in cells treated with tunicamycin. A. Although tunicamycin alone failed to induce vacuolization, when cells were exposed to the combination of tunicamycin + Velcade, essentially all of the cells became heavily vacuolated. B. Further evidence that protein misfolding in the ER is responsible for ER vacuolization, which show extensive vacuolization in cells transfected with a plasmid expressing a mutated, ATPase-inactivated, dominant-negative acting VCP. Displacement of wild-type VCP from ER membranes by the mutated, inactive VCP would be expected to promote the accumulation of misfolded proteins inside the ER lumen as observed previously (63). Targeting VCP with siRNA Greatly Increases Vacuolization of Velcade-Treated Cells COS-7 cells were exposed to VCP siRNA sequences for 72 hours, and separate dishes of cells were also exposed to the drugs for an additional 22 hours. Although siRNA decreased VCP protein by >90%, as estimated by anti-VCP immunoblotting (shown in Fig. 8C), VCP knockdown by siRNA induced vacuolization in only a few cells (Fig. 9, middle). In contrast, when cells treated with both VCP siRNA and Velcade (Fig. 9, right), ER vacuolization was increased as much as 10-fold when compared with cells treated with Velcade alone (Fig. 9, left). Neither irrelevant siRNA nor the si-Importer transfecting reagent induced any vacuoles in cells (data not shown). This observation of synergistic induction of cell vacuolization as a consequence of VCP knockdown and proteasome inhibition by Velcade recapitulates the observations of Wojcik et al. (69). Those authors reported that proteasome inhibition by MG-132 greatly enhanced HeLa cell vacuolization in cells pretreated with VCP siRNA. To our surprise, treating siRNA-VCP knockdown cells with geldanamycin did not further increase the proportion of cells displaying vacuoles, suggesting that sufficient residual VCP was capable of delivering misfolded ER Hsp90 clients to proteasomes (data not shown). Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. Protein Misfolding Induced ER Vacuolization FIGURE 5. SVIP causes vacuolization that is enhanced by Hsp90 inhibition. Recently discovered, a protein known as SVIP is thought to specifically regulate the ERAD function of VCP. SVIP binding to VCP interferes with its ability to extract polypeptides from the ER and promotes cell vacuolization (64). We therefore transfected COS-7 cells with a plasmid expressing SVIP and 24 hours later examined them for the appearance of vacuoles. SVIP overexpression caused vacuolization in a small percentage of cells (A), but interestingly, when SVIPoverexpressing cells were cotreated with 50 nmol/L geldanamycin, the incidence of vacuolization was enhanced f4-fold. Because SVIP was expressed as a FLAG fusion protein, it was visualized by antiFLAG/Cy3 immunofluorescence; (B) in SVIP-transfected, geldanamycin-treated cells, SVIP was localized in the cytoplasm and concentrated on the membranes surrounding vacuoles where presumably it was VCP bound. siRNA Knockdown of VCP Markedly Changes the Architecture of Both ER and Golgi Apparatus To more precisely determine how VCP participated in the ER morphologic alterations brought about by geldanamycin plus Velcade treatment, we treated COS-7 cells with siRNA directed against VCP and then transfected cells with vectors expressing either fluorescent ER or Golgi apparatus markers. The ER and Golgi in control cells were normal in appearance (70); however, in cells in which VCP had been depleted by siRNA, the structures of the ER and Golgi were dramatically changed (Fig. 10A-D). Instead of its normal interconnected, net-like ER structure, in VCP knockdown cells, the fluorescent ER marker instead revealed a punctate pattern of small irregular bodies (Fig. 10B). In addition to its role in ERAD, and in conjunction with its p47 and VCIP135 effectors, VCP regulates homotypic ER and Golgi membrane fusion, which reconstitutes the membranes of these organelles following their disassembly during cell division (71-73). In the absence of VCP following cell division, ER transition vesicles may have been unable to fuse to reconstruct normal ER architecture (74). Similarly, in cells exposed to siRNA-VCP, the fluorescent Golgi marker revealed dispersed small bodies instead of the normal condensed perinuclear Golgi architecture that was seen in the control cells (Fig. 9C and D). Finally, depletion of VCP by siRNA interference increased overall protein ubiquitination 3- to 4-fold (data not shown) as has been observed previously (69). Further experiments are required to determine whether there is a relationship between the greatly enhanced protein ubiquitination and the profound morphologic changes to the ER and Golgi structures in VCP knockdown cells. FIGURE 6. Overexpression of VCP diminishes geldanamycin + Velcade – induced vacuolization. We reasoned that overexpression of wildtype VCP might augment the ability of cells to remove misfolded proteins from the ER compartment. Therefore, cells were transiently transfected with a plasmid vector expressing a fluorescent VCP-GFP fusion protein and 24 hours later were exposed to 10 nmol/L Velcade + 50 nmol/L geldanamycin for an additional 24 hours. Fluorescent images layered over phase-contrast photographs revealed that cells expressing high levels of exogenous VCP-GFP failed to form vacuoles. Conversely, cells with drug-induced vacuoles expressed little or no VCPGFP-derived fluorescence. Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. 673 674 Mimnaugh et al. FIGURE 7. Geldanamycin + Velcade causes VCP to relocalize to aggresome-like bodies. Even in proteasome-inhibited cells, VCP might be able to ratchet misfolded polypeptides from the ER into the cytoplasm. To investigate the fate of VCP itself in Hsp90and proteasome-inhibited cells, we first transfected COS-7 cells to express a VCP-GFP fusion protein and then exposed them to 50 nmol/L geldanamycin + 10 nmol/L Velcade. In control cells (A, top and bottom ), VCP-GFP fluorescence was distributed throughout the cytoplasm. Following Velcade + geldanamycin treatment for 24 hours, essentially all of the VCP-GFP was relocalized into condensed, irregular, perinuclear structures resembling aggresomes. Geldanamycin and Velcade Treatment Depletes ErbB2 from the Plasma Membrane and Relocates the Bulk of ErbB2 into Aggresomes The ErbB2 plasma membrane – residing tyrosine kinase is a Hsp90 client protein known to be rapidly down-regulated by ubiquitin-dependent proteasomal degradation in cells treated with geldanamycin (15, 44, 75). As it is translated at ER membrane-bound ribosomes, immature ErbB2 protein is inserted directly into the ER membrane as a transmembrane polypeptide. Hsp90 binds to its cytoplasmic moiety and regulates the trafficking of nascent ErbB2 (76). The ER lumenal portion of ErbB2 becomes glycosylated and the molecule moves on to the Golgi apparatus where glycosylation trimming takes place. Finally, mature ErbB2 traffics to the plasma membrane, where it functions as a transmembrane signal transducer (76, 77). We reasoned that a fluorescent ErbB2-enhanced yellow fluorescent protein (EYFP) fusion protein would be useful to visualize changes in ER architecture promoted by geldanamycin plus Velcade treatment and to document consequences of the drug treatment on protein transit through the secretory pathway. In control cells, ErbB2-EYFP was localized predominantly on the plasma membrane, where it was frequently highly concentrated in membrane folds and projections (Fig. 8A). It was impossible to visualize ErbB2-EYFP on ER or Golgi apparatus membranes because the intense cell surface fluorescence of the fusion protein obscured these organelles. However, in cells treated with geldanamycin plus Velcade, where the quantity of ErbB2-EYFP residing on the plasma membrane was substantially diminished, residual ErbB2EYFP could be seen on the ER membranes, especially in cells containing prominent vacuoles (Fig. 8B). Whereas the fluorescent calreticulin-derived ER fusion protein marker shown in Fig. 3 filled the lumen of the geldanamycin plus Velcade – induced vacuoles, ErbB2-EYFP clearly was localized on the membranes outlining the vacuoles (Fig. 8B). Note the frequent and easily observed characteristic tripartite intersections of ER membranes in the drug-treated vacuolated cells. Visualization by the fluorescent ErbB2-EYFP fusion protein on intact and interconnected ER membranes surrounding the drug-induced vacuoles supports an interpretation that the drug-induced vacuoles were formed by dilation of ER, rather than from a swelling and pinching-off process, as we had hypothesized previously (20). In the majority of cells treated with geldanamycin plus Velcade, however, ErbB2-EYFP-derived fluorescence was nearly absent from both the plasma membrane and ER, and the bulk of ErbB2-EYFP was highly concentrated in what appear to be perinuclear aggresomes (Fig. 8C). It is noteworthy that although inhibition of proteasome activity by Velcade prevented ErbB2 down-regulation and stabilized the cellular content of ErbB2, the ability of ErbB2 to function as a plasma membrane signal-transducing partner in geldanamycin plus Velcade – treated cells would be prevented by its relocalization to perinuclear aggresomes. siRNA Knockdown of VCP Also Prevents ErbB2 from Trafficking to the Cell Surface Given that VCP provides the ATP-driven mechanical force to eliminate misfolded polypeptides from the ER by retrograde translocation, we wondered whether depletion of VCP would promote accumulation of proteins within the ER. To examine this possibility, we first depleted the cellular level of VCP by siRNA interference and then transiently transfected cells with Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. Protein Misfolding Induced ER Vacuolization ErbB2-EYFP. Control cells were treated with irrelevant siRNA (Fig. 11A). Instead of accumulating at the plasma membrane or within the ER or even the Golgi, VCP knockdown caused the fluorescent ErbB2-EYFP fusion protein to localize in numerous punctate, perinuclear structures (Fig. 11B). This abnormal and unexpected ErbB2-EYFP distribution may have resulted from the cells’ inability to perform homotypic membrane fusion because of depletion of VCP (72, 78). Notably, the profound ErbB2-EYFP relocalization brought about by VCP siRNA recapitulated the pattern shown by the ER fluorescent marker in VCP knockdown cells (Fig. 9). When siRNA-VCP knockdown cells were treated with geldanamycin plus Velcade for an additional 24 hours, the ErbB2-EYFP signal became extremely weak, and in most cells, residual ErbB2-EYPF was found only in punctate bodies surrounding the nucleus (data not shown). Estimated by immunoblotting, VCP siRNA decreased the VCP content of cells by >90% (Fig. 11C). VCP siRNA also greatly diminished the cellular content of ErbB2 (Fig. 11C) most likely because ErbB2 synthesis was inhibited by the deconstruction of the ER (Fig. 10). As a control, when cells were treated with an irrelevant siRNA, neither VCP nor ErbB2 levels were altered (Fig. 11C). Thus, knockdown of VCP not only disassembled the normal architecture of the ER and Golgi apparatus but also prevented ErbB2 trafficking through the ER secretory pathway to its normal residence on the plasma membrane. Discussion Why do cells form vacuoles in response to geldanamycin plus Velcade? The appearance of membrane-bound, ERderived cytoplasmic vacuoles and the relocalization of VCP from its normal cytoplasmic and ER membrane locations into dense, compact aggresomes are major consequences of abnormal protein misfolding and ubiquitination resulting from inhibition of Hsp90 and exacerbated by proteasome inhibition. Several lines of evidence reported here provide insights into and support for this concept. First, geldanamycin plus Velcade – dependent activation of the cellular stress response, signaled by the marked increase in Hsp70 and Hsp90 in the cytoplasm and BiP/GRP78 within the ER, indicates this drug combination triggered profound cytoplasmic and ER stress, consistent with an abnormal amount of protein misfolding (28, 29, 50, 61, 79). Second, the tremendous increase in FIGURE 8. Geldanamycin + Velcade treatment depletes ErbB2 from the plasma membrane and redirects ErbB2 into aggresomes. To monitor the disposition of a Hsp90 client protein that normally transits the ER secretory pathway to its plasma membrane residence following geldanamycin + Velcade treatment, we created an ErbB2-EYFP fluorescent construct and overexpressed this fusion protein in COS-7 cells before treating them with 25 nmol/L Velcade + 50 nmol/L geldanamycin for 24 hours. In control cells (A, top to bottom ), ErbB2-EYFP-derived fluorescence was predominantly localized homogeneously on the cell surface or concentrated in surface patches and membrane folds. In cells treated with geldanamycin + Velcade (B, top to bottom ), most of the ErbB2-EYFP fusion protein was depleted from the cell surface, although Velcade blocked its proteasomal degradation, and ErbB2-EYFP was observed on membranes surrounding the drug-induced vacuoles and in large perinuclear aggresomes. Finally, in geldanamycin + Velcade – treated cells devoid of vacuoles, ErbB2-EYFP fluorescence was strongly concentrated in perinuclear aggresomes (C, top to bottom ). We have reported previously that the ErbB2 kinase in cells treated with geldanamycin + Velcade becomes extensively ubiquitinated before it is degraded by proteasomes (15). It is interesting to compare the localization of VCP-GFP following geldanamycin + Velcade shown in Fig. 7 with the localization of ErbB2-EYFP in the drug-treated cells shown here. Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. 675 676 Mimnaugh et al. FIGURE 9. Knockdown of VCP with siRNA combined with Velcade induces extensive ER vacuolization. COS-7 cells were exposed to 100 nmol/L siRNA sequences targeting VCP for 3 days, 25 nmol/L Velcade alone for 22 hours, or the combination of siRNA with Velcade and then examined for vacuolization by phase-contrast microscopy. As expected, Velcade induced vacuolization in a small proportion of cells (left, arrows ) as did siRNA-VCP treatment (middle, arrows ). However, the incidence of ER vacuolization was markedly increased by the combination of VCP knockdown and proteasome inhibition by Velcade (right ), illustrating how the ERAD function of VCP is linked to proteasomal protein degradation. protein ubiquitination specifically in the detergent-insoluble fraction of lysates from geldanamycin plus Velcade – treated cells indicates a catastrophic amount of protein misfolding, aggregation, and precipitation had occurred. Third, inducing protein misfolding uniquely within the ER compartment with the protein glycosylation inhibitor, tunicamycin, exactly reproduced the vacuolated phenotype induced by geldanamycin plus Velcade but only when proteasomal proteolysis was inhibited by Velcade. Collectively, these observations point to a massive buildup of misfolded and ubiquitinated proteins within the ER lumen as the common factor in ER vacuolization resulting from both geldanamycin plus Velcade and tunicamycin plus Velcade treatments. It seems likely that accumulated misfolded proteins trapped within the ER would exert an osmotic force, inducing an influx of water from the cytoplasm and distending the ER lumenal space into vacuoles. Additional evidence specifically implicates interference with the ERAD function of VCP as the crucial biochemical event responsible for initiating geldanamycin and Velcade – promoted ER vacuolization. As reported previously (59, 65), we observed that transient transfection of vectors overexpressing either dnVCP or the VCP-inhibiting SVIP protein, treatments that specifically interfere with VCP function, precisely recapitulated the vacuolated phenotype induced by Hsp90 and proteasome inhibition. The demonstrated redistribution of VCP into the detergent-insoluble fraction of cell lysates and its coactivation into aggresomes in geldanamycin plus Velcade – treated cells indicates that the bulk of the cellular VCP would be unavailable to facilitate the extraction of misfolded proteins from the ER, to deliver misfolded proteins to proteasomes, or to participate in its other multiple functions. Perhaps most convincingly, overexpression of the ATPase-active, wild-type VCP ameliorated the ER vacuolization induced by geldanamycin plus Velcade treatment. Cells expressing a high level of VCP protein were refractory to vacuolization, whereas cells containing an impoverished level of exogenous VCP remained susceptible to extensive vacuolation when challenged by geldanamycin plus Velcade exposure. This outcome most likely resulted from the enhanced ability of supplemental VCP to extract misfolded proteins from the ER lumen, although they could not be degraded by Velcade-inhibited proteasomes. In this context, by remaining bound to extracted polypeptides, the high level of exogenously supplemented VCP would function as a misfolded ubiquitinated protein chaperone as has been suggested previously in other circumstances by others (43, 66, 80). Notwithstanding the robust induction of ER vacuolization following transient transfections of mutated dnVCP, we observed that knockdown of VCP by siRNA interference induced vacuolization in only a small percentage of COS-7 cells. Although immunoblotting indicated that siRNA knockdown depleted VCP protein levels by f90%, it is possible that the small quantity of residual VCP was nevertheless sufficient to participate in ERAD at a level that, in the absence of unusual protein misfolding stress, was sufficient to prevent vacuolization. Upsetting this balance by treating VCP knockdown cells with Velcade to stabilize ubiquitinated proteins synergistically increased the incidence of cells generating vacuoles. These observations are consistent with a scenario where ubiquitinated protein accumulation in proteasome-inhibited cells overwhelms the diminished ability of siRNA-depleted VCP to export misfolded polypeptides from the ER. At first glance, one might conclude that the geldanamycin plus Velcade – induced ER vacuolization is simply a toxic manifestation—a phenotypic consequence of a serious biochemical malfunction. Alternatively, expansion of the ER compartment in the face of massive protein misfolding within the ER lumen might be considered to be a stopgap mechanism of sequestering misfolded, potentially toxic proteins, thereby enabling the ER secretory pathway to remain at least partially operational. In this scenario, ER vacuolization could provide temporary survival advantage in circumstances where the ERAD machinery of cells becomes Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. Protein Misfolding Induced ER Vacuolization impaired. We know that drug-induced ER vacuolization is a reversible process; if geldanamycin and Velcade are removed from the medium bathing the cells before 24 hours, proteasomes become reactivated within 16 to 18 hours and ER vacuolization diminishes, presumably because ERAD function is regained and misfolded proteins can be cleared. On the other hand, continuous exposure of cells to the drug combination for 48 hours is extremely cytotoxic and essentially all cells, including those with vacuoles, rapidly undergo apoptosis (81, 82). Although additional molecular details of ER vacuolization are necessary to fully understand the genesis of this dramatic phenotypic, we propose that ER vacuolization, like aggresome formation, may very well be a defensive cellular response to an overwhelming quantity of aberrant misfolded proteins. It should be pointed out that our interpretation of the experiments using VCP siRNA to modulate VCP gene expression are confounded by the fact that VCP performs multiple, hierarchical cellular functions in addition to partici- pating in ERAD (66, 74). VCP is required for the disassembly of the mitotic spindle proteins preceding cell division (83), and VCP function is crucial during homotypic fusion of transient vesicles into membranes that reassemble into the ER and Golgi apparatus following cell division (73, 78, 84, 85). VCP also participates in cell cycle (86) and transcription factor regulation (87), and it even plays a role in apoptosis (69) and DNA repair (88, 89). Consequently, in situations of extreme cellular stress, such as occurs during Hsp90 and proteasome inhibition, when VCP becomes relocalized from its constitutive sites of action into insoluble aggresomes, all of the functions of VCP would be compromised. Thus, a loss of VCP-dependent ERAD function at the ER brought about by siRNA may be relatively unimportant to cells in which the entire structure of the ER and Golgi has been disassembled. On the other hand, it is possible that loss of ERAD function actually contributes to the severe morphologic alterations brought about by siRNA knockdown of VCP, and future experimentation will address this possibility in greater detail. FIGURE 10. RNA interference of VCP restructures the architecture of the ER and Golgi apparatus. To more thoroughly study the participation of VCP in misfolded protein-induced cell vacuolization, we used siRNA interference to deplete VCP to an inconspicuous level. We then transfected siRNA-treated cells with vectors expressing either the calreticulinderived ER fluorescent marker or a Golgi apparatus fluorescent marker to visualize those membranous structures. A. Top and bottom, ER architecture in control cells was completely normal; however, in cells treated with siRNA-VCP alone, the reticulated ER structure was completely destroyed and the remaining very faint fluorescence originating from the ER marker was localized in small, perinuclear, punctate structures (B, left and right, top and bottom ). Visualization of the punctate bodies required 10- to 15fold longer camera exposure time, indicating how little of the ER was left (note the extent of VCP knockdown by siRNA in COS-7 cells shown in the immunoblot in Fig. 8C). Additionally, the normal structure of the Golgi apparatus (C, top and bottom ) was similarly disassembled by VCP knockdown, and the fluorescent Golgi marker visualized small, punctate structures similar to those visualized by the ER marker (D, left and right, top and bottom ). Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. 677 678 Mimnaugh et al. FIGURE 11. RNA interference of VCP expression depletes ErbB2 from the plasma membrane and causes the remaining ErbB2 to concentrate in small perinuclear bodies. To verify that siRNA knockdown of VCP interferes with the protein secretory pathway, COS-7 cells were treated with siRNA-VCP for 24 hours and then transfected with a plasmid vector expressing the ErbB2-EYFP fusion protein. Other siRNA-VCP-treated, ErbB2-EYFP-transfected cells were also exposed to 25 nmol/L Velcade and 100 nmol/L geldanamycin for an additional 24 hours. A. ErbB2-EYFP fluorescence in control cells was localized on the plasma membrane. Strikingly, siRNA-VCP nearly completely depleted ErbB2-EYFP from the cell surface and redistributed the fusion protein into numerous, perinuclear, punctate bodies (B) reminiscent of the distribution pattern of the fluorescent ER marker in VCP knockdown cells (shown in Fig. 9B). It should be noted that the cytofluorescence photomicrographs of the siRNAVCP-treated cells required at least a 10-fold longer exposure time and computer enhancement because of the extremely low level of ErbB2EYFP fusion protein in the VCP knockdown cells (B and C). Knockdown of VCP before geldanamycin + Velcade treatment dramatically altered the ER structure in most cells and actually diminished the proportion of cells with drug-induced vacuoles. Although the VCP level in cells exposed to an irrelevant siRNA were unchanged from untreated control cells, VCP targeted with siRNA was diminished by f90% (C, top ) when evaluated by immunoblotting. Geldanamycin + Velcade treatment in either the absence or presence of siRNA-VCP did not further alter the VCP status of cells. The near elimination of constitutive ErbB2 by siRNA-VCP observed in the cytofluorescence photographs was verified by immunoblotting (C, bottom ). Although ErbB2 protein is stabilized in cells treated with Velcade and geldanamycin (C, bottom, lanes 2 and 4 ), in VCP knockdown cells, Velcade did not stabilize ErbB2 protein (lane 6 ), suggesting that perhaps its synthesis was inhibited by the devastating effects of VCP depletion on the ER architecture. We also suspect that VCP knockdown probably interferes with protein synthesis from ribosomes attached to the rough ER membranes. Indeed, even in the presence of Velcade to inhibit proteasomal degradation, the level of ErbB2 in cells exposed to siRNA-VCP was nearly undetectable by both cytofluorescence and direct immunoblotting of the ErbB2 protein. These observations are consistent with the possibility that protein synthesis at ER membranes was inhibited after VCP depletion most likely because of the deconstruction of the normal ER architecture. Thus, VCP knockdown would be expected to have a significant effect on both protein synthesis at the ER membrane and protein trafficking through the ER to the cell surface through the secretory pathway. The redistribution of VCP away from the ER and cytoplasm into aggresome-like bodies following geldanamycin plus Velcade treatment is an unexpected and provocative observation. VCP levels are reported to be elevated in a variety of different human solid tumors (90, 91), and the increased expression of VCP in these tumors seems to correlate with disease progression (90, 92) and a poor prognosis (93). Although the exact role VCP plays in human cancers is currently unknown, it is possible that VCP is elevated in solid tumors because it is needed to clear mutated misfolded proteins that are abundantly expressed in tumor cells (94). In this context, VCP should be considered as a credible molecular target for anticancer chemotherapy, especially because either depletion or inactivation of VCP is ultimately incompatible with cell viability (59, 69). We have reported previously that the combination of geldanamycin and Velcade potently inhibits MCF-7 tumor cell proliferation (20), and most recently, 17-AAG, the clinically useful analogue of geldanamycin, was shown by Mitsiades et al. (21) to sensitize multiple myeloma cells to Velcade. In this regard, the combination of 17-AAG and Velcade is currently undergoing National Cancer Institute – sponsored clinical evaluation at several cancer research centers.2 Based on results presented here, at least part of the cytotoxicity produced by the geldanamycin plus Velcade combination may result from the redistribution of VCP into an insoluble subcellular compartment. In conclusion, although further experimentation is called for to fully elucidate the very complex interactions between protein misfolding, ubiquitination, VCP localization and function, and ER vacuolization in Hsp90- and proteasome-inhibited cells, based on the observations reported herein, it seems plausible that overwhelming the ERAD function of VCP may be the proximal cause of ER vacuolization in response to geldanamycin plus Velcade. Materials and Methods Cell Culture and Drug Treatments Mycoplasma-free, SV40-transformed COS-7 monkey kidney cells (American Type Culture Collection, Manassas, VA) were maintained in DMEM supplemented with 10% heatinactivated fetal bovine serum, 2 mmol/L L-glutamine, and 10 mmol/L HEPES (pH 7.5) under standard tissue culture conditions of 5% humidified CO2 and 37jC. COS-7 cells were 2 National Cancer Institute – sponsored clinical trials of 17-AAG (http://www. cancer.gov/search/ResultsClinicalTrialsAdvanced.aspx?protocolsearchid= 1892780) and Velcade (bortezomib; http://www.cancer.gov/search/ResultsClinical TrialsAdvanced.aspx?protocolsearchid=1892785). Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. Protein Misfolding Induced ER Vacuolization selected for this investigation because we observed previously they were especially sensitive to vacuolization induced by Hsp90 and proteasome inhibition and because they are efficiently transfected with plasmid DNA. Subconfluent, exponentially growing cells were exposed to Velcade alone (Millennium Pharmaceuticals, Boston, MA), geldanamycin alone (Developmental Therapeutics Program, National Cancer Institute, NIH, Bethesda, MD), or the combination of both agents at several concentrations and times; control COS-7 cells were exposed to equivalent amounts of DMSO solvent (V0.05%, v/v) in complete medium. Transfections of Cells with Expression Vectors COS-7 cells were transiently transfected with plasmids expressing either the Living Colors ER marker fused to HcRed fluorescent protein or plasmids expressing a Golgi apparatus marker fused to EYFP (Clontech, Palo Alto, CA) using FuGene 6 (Roche Molecular Biochemicals, Indianapolis, IN) precisely according to the manufacturer’s instructions. Control cells were transfected with a plasmid vector expressing only unmodified EYFP. In other experiments, cells were transfected with plasmids expressing wild-type or mutated VCP-GFP fusion proteins (Dr. Akira Kakizuka, Kyoto, Japan), Flagtagged SVIP (a gift from Dr. M. Tagaya, Tokyo, Japan), or ErbB2-EYFP (constructed in our laboratory by fusing the EYFP sequence to the COOH terminus of the full-length ErbB2 sequence). Following transfections, multiple fields of cells were examined with an IX50-FLA fluorescence microscope (Olympus, Melville, NY) equipped with a Spot Junior digital camera and appropriate wavelength filters. Images illustrating the organelle markers and phenotypic changes (400 and 1,000) were captured and enhanced when necessary using Adobe PhotoShop software on a Mackintosh G4 computer. Immunoreagents and Chemicals The antibodies used in this study were rabbit polyclonal antiubiquitin (Sigma-Aldrich, St. Louis, MO), mouse monoclonal anti-Hsp70 (StressGen BioReagents, Victoria, British Columbia, Canada), mouse anti-Hsp90 (StressGen BioReagents), rabbit anti-BiP/GRP78 (Santa Cruz Biotechnology, Santa Cruz, CA), mouse anti-VCP (Research Diagnostics, Concord, MA and Affinity BioReagents, Golden, CO), mouse anti-ErbB2 (Oncogene Research, San Diego, CA), anti-FLAG M2 and Cy3-conjugated secondary anti-mouse antibodies (SigmaAldrich), horseradish peroxidase – conjugated rabbit anti-mouse IgG1 (Cappel, Durham, NC), horseradish peroxidase – conjugated sheep anti-mouse, and horseradish peroxidase – conjugated donkey anti-rabbit (Amersham Life Sciences, Arlington Heights, IL). All other reagent chemicals and biochemicals used in this study were purchased from NIH stockroom or Sigma-Aldrich. Clarified Cell Lysate and Detergent-Insoluble Fractions Exponentially growing COS-7 cells were washed twice with ice-cold PBS and then lysed on ice for 20 minutes into TNESV lysis buffer [50 mmol/L Tris-HCl (pH 7.5), 1% NP40 detergent, 2 mmol/L EDTA, 100 mmol/L NaCl, 10 mmol/L orthovanadate] supplemented with Complete protease inhibitor cocktail tablets (Roche Diagnostics, Penzberg, Germany). Lysates were centrifuged at 14,000 g for 20 minutes at 4jC, the supernatant fraction was transferred to fresh tubes, and the NP40 detergent-insoluble fraction was resuspended in TNESV lysis buffer by brief sonication (10 seconds at 50 W) while immersed in ice. Protein concentrations of both fractions were determined by the microtiter plate bicinchoninic acid method using bovine serum albumin as the standard (95). Samples were diluted with 5 reducing SDS loading buffer [100 mmol/L DTT, 50 mmol/L Tris-HCl (pH 6.8), 10% (w/v) SDS, 10% (v/v) glycerol, 0.01% (w/v) bromophenol blue tracking dye; ref. 96] before loading identical known protein quantities onto gels. Immunoblot Analysis After fractionating samples by 10% Tris-HCl SDS-PAGE (Bio-Rad Laboratories, Inc., Hercules, CA), proteins were electroeluted onto Protran nitrocellulose membranes (Schleicher & Schuell, Keene, NH) by the wet transfer method. All membranes to be probed by anti-ubiquitin immunoblotting were first autoclaved while immersed in deionized water in a glass tray for 40 minutes to denature the adherent ubiquitinated proteins, which exposes latent ubiquitin epitopes and greatly enhances sensitivity (17, 97, 98). After blocking nonspecific binding sites on the membranes with 5% fat-free dry milk dissolved in 10 mmol/L Tris (pH 7.5), 50 mmol/L NaCl, 2.5 mmol/L EDTA buffer, various antigens were immunodetected with appropriately diluted antibodies followed by horseradish peroxidase – linked secondary antibodies. Visualization of protein bands was by enhanced chemiluminescence (99) using a luminol-based commercial kit (Pierce, Rockford, IL). Exposed XOMAT AR films (Kodak, Rochester, NY) were developed and scanned (Microtek Scanmaker III, Carson, CA) and the images were captured and processed with a Macintosh G4 computer using Adobe PhotoShop 5.0 and Microsoft PowerPoint software. RNA Interference COS-7 cells in 35-mm dishes were exposed to 100 nmol/L siRNA targeted against wild-type VCP (a mixture of equal amounts of two siRNA duplexes complementing the DNA target sequences: ACCCTGATTGCTCGAGCTGTA and AAGAACCGTCCCAATCGGTTA; Qiagen, Valencia, CA) using si-Importer reagent (Upstate, Lake Placid, NY) according to the manufacturer’s instructions. Following a 48-hour incubation, siRNA-treated cells were transiently transfected with either ER or Golgi apparatus fluorescent marker expression vectors or plasmids expressing an ErbB2EYFP fusion protein. Control cells were exposed to irrelevant, nonmammalian siRNA (Qiagen). On the third day of siRNA-VCP exposure, cells were cotreated with 50 nmol/L geldanamycin plus 25 nmol/L Velcade for an additional 24 hours and then examined for morphologic changes by phase-contrast and fluorescent microscopy. Satellite plates of cells treated in exactly the same way with siRNA and the two drugs were lysed, and after separation of proteins by SDS-PAGE and transfer to nitrocellulose membranes, VCP and ErbB2 protein levels were evaluated by immunoblotting. Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. 679 680 Mimnaugh et al. Acknowledgments We thank Jennifer Isaacs for facilitating our acquisition of the wild-type and mutated VCP-GFP expression plasmids (a kind gift from Dr. Akira Kakizuka) and Dr. M. Tagaya for the SVIP expression plasmid. References 1. Welch WJ. Heat shock proteins functioning as molecular chaperones: their roles in normal and stressed cells. Philos Trans R Soc Lond B Biol Sci 1993;339: 327 – 33. 2. Wegele H, Muller L, Buchner J. Hsp70 and Hsp90—a relay team for protein folding. Rev Physiol Biochem Pharmacol 2004;151:1 – 44. 3. Whitesell L, Mimnaugh EG, DeCosta B, Myers CE, Neckers LM. Inhibition of heat shock protein HSP90-60v-src heteroprotein complex formation by benzoquinone ansamycins: essential role for stress proteins in oncogenic transformation. Proc Natl Acad Sci U S A 1994;91:8324 – 8. 4. Neckers L, Schulte TW, Mimnaugh E. Geldanamycin as a potential anti-cancer agent: its molecular target and biochemical activity. Invest New Drugs 1999;17: 361 – 73. 5. Neckers L, Neckers K. Heat-shock protein 90 inhibitors as novel cancer chemotherapeutics—an update. Expert Opin Emerg Drugs 2005;10:137 – 49. 6. Whitesell L, Sutphin P, An WG, Schulte T, Blagosklonny MV, Neckers L. Geldanamycin-stimulated destabilization of mutated p53 is mediated by the proteasome in vivo . Oncogene 1997;14:2809 – 16. 7. An WG, Schulte TW, Neckers LM. The heat shock protein 90 antagonist geldanamycin alters chaperone association with p210bcr-abl and v-src proteins before their degradation by the proteasome. Cell Growth Differ 2000;11:355 – 60. 8. Workman P. Overview: translating Hsp90 biology into Hsp90 drugs. Curr Cancer Drug Targets 2003;3:297 – 300. 9. Bagatell R, Whitesell L. Altered Hsp90 function in cancer: a unique therapeutic opportunity. Mol Cancer Ther 2004;3:1021 – 30. 10. Whitesell L, Lindquist SL. HSP90 and the chaperoning of cancer. Nat Rev Cancer 2005;5:761 – 72. 11. Miyata Y. Hsp90 inhibitor geldanamycin and its derivatives as novel cancer chemotherapeutic agents. Curr Pharm Des 2005;11:1131 – 8. 12. Stebbins CE, Russo AA, Schneider C, Rosen N, Hartl FU, Pavletich NP. Crystal structure of an Hsp90-geldanamycin complex: targeting of a protein chaperone by an antitumor agent. Cell 1997;89:239 – 50. 13. Prodromou C, Roe SM, O’Brien R, Ladbury JE, Piper PW, Pearl LH. Identification and structural characterization of the ATP/ADP-binding site in the Hsp90 molecular chaperone. Cell 1997;90:65 – 75. 14. Grenert JP, Sullivan WP, Fadden P, et al. The amino-terminal domain of heat shock protein 90 (hsp90) that binds geldanamycin is an ATP/ADP switch domain that regulates hsp90 conformation. J Biol Chem 1997;272:23843 – 50. 26. Corboy MJ, Thomas PJ, Wigley WC. Aggresome formation. Methods Mol Biol 2005;301:305 – 27. 27. Brewer JW, Diehl JA. PERK mediates cell-cycle exit during the mammalian unfolded protein response. Proc Natl Acad Sci U S A 2000;97:12625 – 30. 28. Schroder M, Kaufman RJ. ER stress and the unfolded protein response. Mutat Res 2005;569:29 – 63. 29. Hampton RY. ER stress response: getting the UPR hand on misfolded proteins. Curr Biol 2000;10:R518 – 21. 30. Lawson B, Brewer JW, Hendershot LM. Geldanamycin, an hsp90/GRP94binding drug, induces increased transcription of endoplasmic reticulum (ER) chaperones via the ER stress pathway. J Cell Physiol 1998;174:170 – 8. 31. Bush KT, Goldberg AL, Nigam SK. Proteasome inhibition leads to a heatshock response, induction of endoplasmic reticulum chaperones and thermotolerance. J Biol Chem 1997;272:9086 – 92. 32. Friedlander R, Jarosch E, Urban J, Volkwein C, Sommer T. A regulatory link between ER-associated protein degradation and the unfolded-protein response. Nat Cell Biol 2000;2:379 – 84. 33. Romisch K. Endoplasmic reticulum-associated degradation. Annu Rev Cell Dev Biol 2005;21:435 – 56. 34. Hiller MM, Finger A, Schweiger M, Wolf DH. ER degradation of a misfolded luminal protein by the cytosolic ubiquitin-proteasome pathway. Science 1996;273:1725 – 8. 35. McCracken AA, Brodsky JL. Evolving questions and paradigm shifts in endoplasmic-reticulum-associated degradation (ERAD). BioEssays 2003;25: 868 – 77. 36. Ye Y, Shibata Y, Yun C, Ron D, Rapoport TA. A membrane protein complex mediates retro-translocation from the ER lumen into the cytosol. Nature 2004; 429:841 – 7. 37. Bays NW, Hampton RY. Cdc48-1-Npl4: stuck in the middle with Ub. Curr Biol 2002;12:R366 – 71. 38. Jarosch E, Geiss-Friedlander R, Meusser B, Walter J, Sommer T. Protein dislocation from the endoplasmic reticulum—pulling out the suspect. Traffic 2002;3:530 – 6. 39. Ye Y, Meyer HH, Rapoport TA. Function of the p97-1-Npl4 complex in retrotranslocation from the ER to the cytosol: dual recognition of nonubiquitinated polypeptide segments and polyubiquitin chains. J Cell Biol 2003;162:71 – 84. 40. Zhong X, Shen Y, Ballar P, Apostolou A, Agami R, Fang S. AAA ATPase p97/valosin-containing protein interacts with gp78, a ubiquitin ligase for endoplasmic reticulum-associated degradation. J Biol Chem 2004;279: 45676 – 84. 41. Richly H, Rape M, Braun S, Rumpf S, Hoege C, Jentsch S. A series of ubiquitin binding factors connects CDC48/p97 to substrate multiubiquitylation and proteasomal targeting. Cell 2005;120:73 – 84. 15. Mimnaugh EG, Chavany C, Neckers L. Polyubiquitination and proteasomal degradation of the p185c-erbB-2 receptor protein-tyrosine kinase induced by geldanamycin. J Biol Chem 1996;271:22796 – 801. 42. Ye Y, Shibata Y, Kikkert M, van Voorden S, Wiertz E, Rapoport TA. Inaugural Article: Recruitment of the p97 ATPase and ubiquitin ligases to the site of retrotranslocation at the endoplasmic reticulum membrane. Proc Natl Acad Sci U S A 2005;102:14132 – 8. 16. Loo MA, Jensen TJ, Cui L, Hou Y, Chang XB, Riordan JR. Perturbation of Hsp90 interaction with nascent CFTR prevents its maturation and accelerates its degradation by the proteasome. EMBO J 1998;17:6879 – 87. 43. Dai RM, Li CC. Valosin-containing protein is a multi-ubiquitin chaintargeting factor required in ubiquitin-proteasome degradation. Nat Cell Biol 2001; 3:740 – 4. 17. Mimnaugh EG, Neckers LM. Measuring ubiquitin conjugation in cells. Methods Mol Biol 2005;301:223 – 41. 44. Miller P, DiOrio C, Moyer M, et al. Depletion of the erbB-2 gene product p185 by benzoquinoid ansamycins. Cancer Res 1994;54:2724 – 30. 45. Shimamura T, Lowell AM, Engelman JA, Shapiro GI. Epidermal growth factor receptors harboring kinase domain mutations associate with the heat shock protein 90 chaperone and are destabilized following exposure to geldanamycins. Cancer Res 2005;65:6401 – 8. 46. Xiong X, Chong E, Skach WR. Evidence that endoplasmic reticulum (ER)associated degradation of cystic fibrosis transmembrane conductance regulator is linked to retrograde translocation from the ER membrane. J Biol Chem 1999;274: 2616 – 24. 18. Johnston JA, Ward CL, Kopito RR. Aggresomes: a cellular response to misfolded proteins. J Cell Biol 1998;143:1883 – 98. 19. Kopito RR. Aggresomes, inclusion bodies and protein aggregation. Trends Cell Biol 2000;10:524 – 30. 20. Mimnaugh EG, Xu W, Vos M, et al. Simultaneous inhibition of hsp 90 and the proteasome promotes protein ubiquitination, causes endoplasmic reticulumderived cytosolic vacuolization, and enhances antitumor activity. Mol Cancer Ther 2004;3:551 – 66. 21. Mitsiades CS, Mitsiades NS, McMullan CJ, et al. Anti-myeloma activity of heat shock protein-90 inhibition. Blood 2006;107:1092 – 100. 22. Adams J, Palombella VJ, Sausville EA, et al. Proteasome inhibitors: a novel class of potent and effective antitumor agents. Cancer Res 1999;59:2615 – 22. 23. Adams J. Preclinical and clinical evaluation of proteasome inhibitor PS-341 for the treatment of cancer. Curr Opin Chem Biol 2002;6:493 – 500. 47. Ali A, Bharadwaj S, O’Carroll R, Ovsenek N. HSP90 interacts with and regulates the activity of heat shock factor 1 in Xenopus oocytes. Mol Cell Biol 1998;18:4949 – 60. 48. Bagatell R, Paine-Murrieta GD, Taylor CW, et al. Induction of a heat shock factor 1-dependent stress response alters the cytotoxic activity of hsp90-binding agents. Clin Cancer Res 2000;6:3312 – 8. 24. Cusack JC. Rationale for the treatment of solid tumors with the proteasome inhibitor bortezomib. Cancer Treat Rev 2003;29 Suppl 1:21 – 31. 49. Marcu MG, Doyle M, Bertolotti A, Ron D, Hendershot L, Neckers L. Heat shock protein 90 modulates the unfolded protein response by stabilizing IRE1a. Mol Cell Biol 2002;22:8506 – 13. 25. Wright JJ, Zerivitz K, Schoenfeldt M. Clinical trials referral resource. Current clinical trials of bortezomib. Oncology (Huntingt) 2003;17:677 – 80, 676 – 83, 672 – 91. 50. Kawazoe Y, Nakai A, Tanabe M, Nagata K. Proteasome inhibition leads to the activation of all members of the heat-shock-factor family. Eur J Biochem 1998;255:356 – 62. Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. Protein Misfolding Induced ER Vacuolization 51. Mitsiades N, Mitsiades CS, Poulaki V, et al. Molecular sequelae of proteasome inhibition in human multiple myeloma cells. Proc Natl Acad Sci U S A 2002;99:14374 – 9. 52. Ma Y, Hendershot LM. The mammalian endoplasmic reticulum as a sensor for cellular stress. Cell Stress Chaperones 2002;7:222 – 9. 53. Rabinovich E, Kerem A, Frohlich KU, Diamant N, Bar-Nun S. AAA-ATPase p97/Cdc48p, a cytosolic chaperone required for endoplasmic reticulum-associated protein degradation. Mol Cell Biol 2002;22:626 – 34. 54. Rouiller I, DeLaBarre B, May AP, et al. Conformational changes of the multifunction p97 AAA ATPase during its ATPase cycle. Nat Struct Biol 2002;9: 950 – 7. 55. Song C, Wang Q, Li CC. ATPase activity of p97-valosin-containing protein (VCP). D2 mediates the major enzyme activity, and D1 contributes to the heatinduced activity. J Biol Chem 2003;278:3648 – 55. 56. Jarosch E, Taxis C, Volkwein C, et al. Protein dislocation from the ER requires polyubiquitination and the AAA-ATPase Cdc48. Nat Cell Biol 2002;4: 134 – 9. 57. Meyer HH, Wang Y, Warren G. Direct binding of ubiquitin conjugates by the mammalian p97 adaptor complexes, p47 and Ufd1-4. EMBO J 2002;21: 5645 – 52. 58. Flierman D, Ye Y, Dai M, Chau V, Rapoport TA. Polyubiquitin serves as a recognition signal, rather than a ratcheting molecule, during retrotranslocation of proteins across the endoplasmic reticulum membrane. J Biol Chem 2003;278: 34774 – 82. 59. Hirabayashi M, Inoue K, Tanaka K, et al. VCP/p97 in abnormal protein aggregates, cytoplasmic vacuoles, and cell death, phenotypes relevant to neurodegeneration. Cell Death Differ 2001;8:977 – 84. 60. Wojcik C. An inhibitor of the chymotrypsin-like activity of the proteasome (PSI) induces similar morphological changes in various cell lines. Folia Histochem Cytobiol 1997;35:211 – 4. 61. Marquardt T, Helenius A. Misfolding and aggregation of newly synthesized proteins in the endoplasmic reticulum. J Cell Biol 1992;117:505 – 13. 62. Casagrande R, Stern P, Diehn M, et al. Degradation of proteins from the ER of S. cerevisiae requires an intact unfolded protein response pathway. Mol Cell 2000;5:729 – 35. 63. Jorgensen MM, Bross P, Gregersen N. Protein quality control in the endoplasmic reticulum. APMIS 2003;Suppl:86 – 91. 64. Kobayashi T, Tanaka K, Inoue K, Kakizuka A. Functional ATPase activity of p97/valosin-containing protein (VCP) is required for the quality control of endoplasmic reticulum in neuronally differentiated mammalian PC12 cells. J Biol Chem 2002;277:47358 – 65. 65. Nagahama M, Suzuki M, Hamada Y, et al. SVIP is a novel VCP/p97interacting protein whose expression causes cell vacuolation. Mol Biol Cell 2003; 14:262 – 73. 66. Wang Q, Song C, Li CC. Molecular perspectives on p97-VCP: progress in understanding its structure and diverse biological functions. J Struct Biol 2004; 146:44 – 57. 67. Meyer HH. Golgi reassembly after mitosis: the AAA family meets the ubiquitin family. Biochim Biophys Acta 2005;1744:108 – 19. 68. Fratta P, Engel WK, McFerrin J, Davies KJ, Lin SW, Askanas V. Proteasome inhibition and aggresome formation in sporadic inclusion-body myositis and in amyloid-h precursor protein-overexpressing cultured human muscle fibers. Am J Pathol 2005;167:517 – 26. 69. Wojcik C, Yano M, DeMartino GN. RNA interference of valosin-containing protein (VCP/p97) reveals multiple cellular roles linked to ubiquitin/proteasomedependent proteolysis. J Cell Sci 2004;117:281 – 92. 70. Lippincott-Schwartz J, Snapp E, Kenworthy A. Studying protein dynamics in living cells. Nat Rev Mol Cell Biol 2001;2:444 – 56. 71. Wang Y, Satoh A, Warren G, Meyer HH. VCIP135 acts as a deubiquitinating enzyme during p97-47-mediated reassembly of mitotic Golgi fragments. J Cell Biol 2004;164:973 – 8. 75. Chavany C, Mimnaugh E, Miller P, et al. p185erbB2 binds to GRP94 in vivo. Dissociation of the p185erbB2/GRP94 heterocomplex by benzoquinone ansamycins precedes depletion of p185erbB2. J Biol Chem 1996;271: 4974 – 7. 76. Xu W, Mimnaugh EG, Kim JS, Trepel JB, Neckers LM. Hsp90, not Grp94, regulates the intracellular trafficking and stability of nascent ErbB2. Cell Stress Chaperones 2002;7:91 – 6. 77. Wiley HS. Trafficking of the ErbB receptors and its influence on signaling. Exp Cell Res 2003;284:78 – 88. 78. Uchiyama K, Jokitalo E, Kano F, et al. VCIP135, a novel essential factor for p97/p47-mediated membrane fusion, is required for Golgi and ER assembly in vivo. J Cell Biol 2002;159:855 – 66. 79. Lee AH, Iwakoshi NN, Anderson KC, Glimcher LH. Proteasome inhibitors disrupt the unfolded protein response in myeloma cells. Proc Natl Acad Sci U S A 2003;100:9946 – 51. 80. Prince T, Shao J, Matts RL, Hartson SD. Evidence for chaperone heterocomplexes containing both Hsp90 and VCP. Biochem Biophys Res Commun 2005;331:1331 – 7. 81. Nomura M, Nomura N, Newcomb EW, Lukyanov Y, Tamasdan C, Zagzag D. Geldanamycin induces mitotic catastrophe and subsequent apoptosis in human glioma cells. J Cell Physiol 2004;201:374 – 84. 82. Drexler HC. Activation of the cell death program by inhibition of proteasome function. Proc Natl Acad Sci U S A 1997;94:855 – 60. 83. Cao K, Nakajima R, Meyer HH, Zheng Y. The AAA-ATPase Cdc48/ p97 regulates spindle disassembly at the end of mitosis. Cell 2003;115: 355 – 67. 84. Nichols BJ, Pelham HR. SNAREs and membrane fusion in the Golgi apparatus. Biochim Biophys Acta 1998;1404:9 – 31. 85. Cao K, Zheng Y. The Cdc48/p97-1-Npl4 complex: its potential role in coordinating cellular morphogenesis during the M-G1 transition. Cell Cycle 2004; 3:422 – 4. 86. Mayr PS, Allan VJ, Woodman PG. Phosphorylation of p97(VCP) and p47 in vitro by p34cdc2 kinase. Eur J Cell Biol 1999;78:224 – 32. 87. Asai T, Tomita Y, Nakatsuka S, et al. VCP (p97) regulates NFnB signaling pathway, which is important for metastasis of osteosarcoma cell line. Jpn J Cancer Res 2002;93:296 – 304. 88. Partridge JJ, Lopreiato JO, Jr., Latterich M, Indig FE. DNA damage modulates nucleolar interaction of the Werner protein with the AAA ATPase p97/ VCP. Mol Biol Cell 2003;14:4221 – 9. 89. Livingstone M, Ruan H, Weiner J, et al. Valosin-containing protein phosphorylation at Ser784 in response to DNA damage. Cancer Res 2005;65: 7533 – 40. 90. Yamamoto S, Tomita Y, Nakamori S, et al. Elevated expression of valosincontaining protein (p97) in hepatocellular carcinoma is correlated with increased incidence of tumor recurrence. J Clin Oncol 2003;21:447 – 52. 91. Yamamoto S, Tomita Y, Hoshida Y, et al. Expression of valosin-containing protein in colorectal carcinomas as a predictor for disease recurrence and prognosis. Clin Cancer Res 2004;10:651 – 7. 92. Yamamoto S, Tomita Y, Hoshida Y, et al. Expression level of valosincontaining protein (p97) is correlated with progression and prognosis of nonsmall-cell lung carcinoma. Ann Surg Oncol 2004;11:697 – 704. 93. Tsujimoto Y, Tomita Y, Hoshida Y, et al. Elevated expression of valosincontaining protein (p97) is associated with poor prognosis of prostate cancer. Clin Cancer Res 2004;10:3007 – 12. 94. Jolly C, Morimoto RI. Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J Natl Cancer Inst 2000;92:1564 – 72. 95. Smith PK, Krohn RI, Hermanson GT, et al. BCA protein assay. Anal Biochem 1985;150:76 – 85. 96. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (Lond) 1970;227:680 – 5. 72. Uchiyama K, Kondo H. p97/p47-mediated biogenesis of Golgi and ER. J Biochem (Tokyo) 2005;137:115 – 9. 97. Swerdlow PS, Finley D, Varshavsky A. Enhancement of immunoblot sensitivity by heating of hydrated filters. Anal Biochem 1986;156:147 – 53. 73. Kano F, Kondo H, Yamamoto A, et al. NSF/SNAPs and p97/p47/VCIP135 are sequentially required for cell cycle-dependent reformation of the ER network. Genes Cells 2005;10:989 – 99. 98. Mimnaugh EG, Neckers LM. Immunoblotting methods for the study of protein ubiquitination. Methods Mol Biol 2002;194:179 – 203. 74. Woodman PG. p97, a protein coping with multiple identities. J Cell Sci 2003; 116:4283 – 90. 99. Bobrow MN, Harris TD, Shaughnessy KJ, Litt GJ. Catalyzed reporter disposition, a novel method of signal amplification. J Immunol Methods 1989; 125:279 – 85. Mol Cancer Res 2006;4(9). September 2006 Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research. 681 Endoplasmic Reticulum Vacuolization and Valosin-Containing Protein Relocalization Result from Simultaneous Hsp90 Inhibition by Geldanamycin and Proteasome Inhibition by Velcade Edward G. Mimnaugh, Wanping Xu, Michele Vos, et al. Mol Cancer Res 2006;4:667-681. Updated version Cited articles Citing articles E-mail alerts Reprints and Subscriptions Permissions Access the most recent version of this article at: http://mcr.aacrjournals.org/content/4/9/667 This article cites 98 articles, 44 of which you can access for free at: http://mcr.aacrjournals.org/content/4/9/667.full.html#ref-list-1 This article has been cited by 8 HighWire-hosted articles. Access the articles at: /content/4/9/667.full.html#related-urls Sign up to receive free email-alerts related to this article or journal. To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at [email protected]. To request permission to re-use all or part of this article, contact the AACR Publications Department at [email protected]. Downloaded from mcr.aacrjournals.org on June 17, 2017. © 2006 American Association for Cancer Research.
© Copyright 2026 Paperzz