V(D)J Recombination Frequencies Can Be
Profoundly Affected by Changes in the
Spacer Sequence
This information is current as
of June 17, 2017.
Alina Montalbano, Kisani M. Ogwaro, Alan Tang, Adam G.
W. Matthews, Mani Larijani, Marjorie A. Oettinger and Ann
J. Feeney
J Immunol 2003; 171:5296-5304; ;
doi: 10.4049/jimmunol.171.10.5296
http://www.jimmunol.org/content/171/10/5296
Subscription
Permissions
Email Alerts
This article cites 41 articles, 25 of which you can access for free at:
http://www.jimmunol.org/content/171/10/5296.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2003 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
References
The Journal of Immunology
V(D)J Recombination Frequencies Can Be Profoundly Affected
by Changes in the Spacer Sequence1
Alina Montalbano,2* Kisani M. Ogwaro,2* Alan Tang,2* Adam G. W. Matthews,†
Mani Larijani,† Marjorie A. Oettinger,† and Ann J. Feeney3*
T
he vast repertoire of Igs and TCRs is accomplished in part
by the combinatorial association of three gene segments
(V, D, and J) for one chain, and two gene segments (V
and J) for the second chain of these heterodimeric Ag receptors.
Each of the many V, D, and J gene segments is flanked by a
recombination signal sequence (RSS),4 which is recognized by
RAG1 and RAG2 (1, 2). These enzymes catalyze the joining of V,
D, and J gene segments into a continuous exon encoding a complete Ag-binding domain. The RSS is composed of a conserved
heptamer (CACAGTG) and nonamer (ACAAAAACC), separated
by a spacer of conserved length, either 12 or 23 bp (3–5). Genes
flanked by 12-bp spacer RSS join to gene segments flanked by
23-bp spacer RSS (5). The first 3 bp of the heptamer are essential
for RSS recognition, and changes in those positions preclude recombination (3, 4). The other four positions are 77–91% conserved. The nonamer is slightly less conserved, but a stretch of 5 As
*Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037;
and †Department of Molecular Biology, Massachusetts General Hospital, and Department of Genetics, Harvard Medical School, Boston, MA 02114
Received for publication April 3, 2003. Accepted for publication September 15, 2003.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by National Institutes of Health Grants R01 AI29672 and
AI37098 (to A.J.F.), and R01 GM48026 (to M.A.O.). A.M. and K.M.O. were supported by Training Grant T32 GM08303. A.G.W.M. is a Howard Hughes Medical
Institute Predoctoral Fellow. M.L. was supported by a Canadian Institutes of Health
research grant to G.W. The Scripps General Clinical Research Center, which provided
the human peripheral blood DNA for PCR, is supported by National Institutes of
Health Grant M01 RR00833. This is manuscript 15683-IMM from The Scripps Research Institute.
2
preceded by a C is highly conserved in 12-bp nonamers (6). The
23-bp spacers show similar consensus motifs, with the exception that
the fourth base pair of the nonamer is much more variable (6).
Although variations in the length of the spacer from the conserved 12 or 23 bp were shown early on to be deleterious, it was
initially thought that the sequence of the spacer did not affect recombination (3–5). However, subsequent analysis showed that
there was moderate conservation of some positions in the spacers,
and that variations in the spacer sequence could affect recombination frequency up to 6-fold (6 –10). In addition, we showed that
naturally occurring variation in spacer sequences could contribute
to the nonrandom use of human V␬ genes observed in vivo, and that
a randomly generated variant of a human V␬ spacer was significantly
worse in recombination efficiency (8, 11). In this study, we show that
single base pair changes in the spacer sequence can significantly affect
recombination efficacy. Furthermore, we made an RSS spacer composed of the most infrequently used nucleotides at each position according to the large database of spacers compiled by Ramsden et al.
(6). We show that this Infrequent spacer, positioned between a consensus heptamer and nonamer, leads to very poor V(D)J rearrangement in a recombination substrate. The Infrequent spacer RSS binds
RAG proteins 2-fold less well than an RSS with a spacer sequence
that is close to consensus, and cleavage of this Infrequent RSS in
cell-free assays is reduced 9-fold. Moreover, the VHS107 spacer sequence itself reduces recombination frequency in transient recombination substrate assays sufficiently to suggest that the spacer difference
is a major contributing factor to the different recombination frequencies of these two VH genes in bone marrow pro-B cells (12). Hence,
the spacer sequence plays a much more important role in recombination frequency than previously appreciated.
A.M., K.M.O., and A.T. contributed equally to this study.
Address correspondence and reprint requests to Dr. Ann Feeney, Department of
Immunology, IMM-22, The Scripps Research Institute, 10550 North Torrey Pines
Road, La Jolla, CA 92037. E-mail address: [email protected]
Materials and Methods
4
Abbreviations used in this paper: RSS, recombination signal sequence; SC, single
RSS complex.
The construction of the competition recombination substrates was previously described (8, 13). New RSS fragments were cloned into existing
3
Copyright © 2003 by The American Association of Immunologists, Inc.
Recombination substrates
0022-1767/03/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Each V, D, and J gene segment is flanked by a recombination signal sequence (RSS), composed of a conserved heptamer and
nonamer separated by a 12- or 23-bp spacer. Variations from consensus in the heptamer or nonamer at specific positions can
dramatically affect recombination frequency, but until recently, it had been generally held that only the length of the spacer, but
not its sequence, affects the efficacy of V(D)J recombination. In this study, we show several examples in which the spacer sequence
can significantly affect recombination frequencies. We show that the difference in spacer sequence alone of two VHS107 genes
affects recombination frequency in recombination substrates to a similar extent as the bias observed in vivo. We show that
individual positions in the spacer can affect recombination frequency, and those positions can often be predicted by their frequency
in a database of RSS. Importantly, we further show that a spacer sequence that has an infrequently observed nucleotide at each
position is essentially unable to support recombination in an extrachromosmal substrate assay, despite being flanked by a consensus heptamer and nonamer. This infrequent spacer sequence RSS shows only a 2-fold reduction of binding of RAG proteins,
but the in vitro cleavage of this RSS is ⬃9-fold reduced compared with a good RSS. These data demonstrate that the spacer
sequence should be considered to play an important role in the recombination efficacy of an RSS, and that the effect of the spacer
occurs primarily subsequent to RAG binding. The Journal of Immunology, 2003, 171: 5296 –5304.
The Journal of Immunology
substrates at the MluI/NotI sites for the external fragment, the NotI/SalI site
for the internal fragment, or the SpeI/SacII sites for the downstream fragment. V␬ fragments contained ⬃100 bp 5⬘ of the RSS, and 5–100 bp
downstream of the RSS. VH constructs contained ⬃200 bp 5⬘ of the RSS,
and ⬃3–30 bp 3⬘ of the RSS. Changes in the spacer or flanking DNA were
introduced by either by PCR overlap, or by the use of a reverse PCR primer
containing the desired mutation. The downstream 23-bp RSS was the same
J␬1 fragment previously used for all of the competition substrates containing two V␬ RSS (8). For the VH and V␤ competition substrates, the J␬1
fragment was replaced with a fragment containing the 12-bp RSS from
DSP2.2.
The recombination assay is the same as previously described, except
that lower concentrations of caffeine and chloramphenicol were used (8).
Briefly, constructs were transiently transfected into 18.8 A-murine leukemia virus pre-B cell lines in the presence of 0.5–1 mM caffeine, and the
recovered plasmids were transformed and plated on plates containing 1–3
␮g/ml chloramphenicol. The colonies were screened by PCR, as previously
described (8). The structure of the recombination substrate and the screening assay are shown in Fig. 1. For each substrate, several independent
transfections were performed.
RAG-binding assay
containing a 12-bp RSS, compete for rearrangement to a downstream 23-bp RSS (19). The relative frequency of rearrangement of
the two competing RSS in the recombined plasmids is determined
by a PCR screening assay of individual colonies, as shown in Fig.
1A. We have previously shown that the relative position of the RSS
in the internal or external position does not bias the results (8, 19).
By having both competing RSS in the same plasmid, this system
provides a very sensitive assay for determining even small effects
of changes in the RSS.
Single nucleotide changes in the spacer can affect
recombination frequencies
The spacer sequence of the human V␬ gene A27 varies from the
V␬A2 spacer in 7 of 12 positions, and we previously showed that
the A27 spacer was ⬃2-fold less efficient in promoting recombination than the V␬A2 spacer (8). A randomly generated variant of
the A27 spacer, which differed in only two positions from A27,
was much worse, with only 14% of the rearrangement events occurring at this A27 mutant RSS as compared with the A2 spacer
RSS (8). To analyze the basis for the decreased efficiency in the
A27 mutant spacer, we compared the frequency of usage of G, A,
T, and C in various positions from the large database of 12-bp RSS
compiled by Ramsden et al. (6). We reasoned that positions in
which all four nucleotides are observed with approximately equal
frequency might not be very critical, while positions of skewed
Cleavage assay
Standard oligonucleotide cleavage assays were performed, as described
(16), except that 20 fmol of 32P-labeled duplex oligonucleotide substrate
and 2 pmol of unlabeled, duplex nonspecific oligonucleotide competitor
DNA were included in each reaction, and samples were incubated for 2 h
at 30°C.
Results
The RSS heptamer and nonamer consensus sequences were first
identified on the basis of the high degree of conservation of nucleotides flanking the coding sequence (17, 18). The absence of
such obvious conservation in the sequence separating the conserved heptamer and nonamer led to the early conclusion that the
length of the spacer, but not its nucleotide composition, was playing a role in RSS recognition (3). However, Ramsden et al. (6)
compiled and analyzed a large database of Ig and TCR RSS, and
showed that some positions in the 12- and 23-bp spacers did show
some conservation . For example, the first five positions in the
12-bp spacer nearest the heptamer are moderately conserved (50 –
67%), while several of the other positions show much less conservation. Furthermore, we and others have reported that the sequence of the spacer can affect recombination frequency, with up
to 6-fold reduction in recombination frequency apparently due to
differences in the spacer sequence (6 –10). In this study, we wished
to determine which part of the spacer influences recombination
most strongly by dissecting some of these examples, and also to
determine the extent to which a poor spacer sequence can reduce
recombination.
We assessed relative recombination efficiency in competition
recombination substrates, in which two V gene fragments, each
FIGURE 1. A spacer composed of infrequently observed nucleotides at
each position is extremely poor at rearrangement. A, Diagram of the recombination substrate, and of the PCR assay for screening the recombinants. B, The consensus 12-bp spacer sequence is shown, with the frequency of the indicated nucleotide in the database shown. For position 7,
A and C are present in equal frequency, and we used A in our experiment.
V␬A2 spacer is shown for comparison, and again the frequency of each
nucleotide that differs from the consensus is shown. The Infrequent spacer
used in the construct is shown. For two positions, 2 and 9, the frequency
with which the least frequent nucleotide was present in the database was
5% or below, so we used the next most infrequent nucleotide as indicated.
C, Competition recombination substrates were made with the indicated
spacers, and the percentage of colonies that rearranged to the external or
the internal RSS is shown. Consensus-G1 has a G in the first position, but
the remainder of the spacer is the consensus sequence.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Double-stranded oligonucleotides were made, as previously described (14).
A2, A27 mutant, and Infrequent have 14 bp of the coding end DNA found
in the V␬A2 gene. VDJ 100/101 has 16 bp of 5⬘ flanking DNA, which is
different from the other three (14). All four of these RSS have consensus
heptamers and nonamers. The top strand sequences of each are: A2, ATA
CAGCTTCCTCCCACAGTGGTACAGACCAATACAAAAACCTCCCT
GCTGGGGTGT; A27 mutant, ATACAGCTTCCTCCCACAGTGAGT
CAGCTTCAAACAAAAACCTCCCTGCTGGGGTGT; Infrequent, ATA
CAGCTTCCTCCCACAGTGGGGATCTAAGAGACAAAAACCTCCC
GCTGGGGTGT; VDJ 100, GCTGCAGGTCGACCTGCACAGTGCTA
CAGACTGGAACAAAAACCCAGGTCTC
EMSAs to detect single RSS complexes (SC1 and SC2) were performed, as described (15), except that reactions were conducted in 1 mM
CaCl2 with 20 fmol of 32P-labeled duplex oligonucleotide substrate included in each reaction. Reaction products were separated through 5%
polyacrylamide-TBE gels (19:1 acrylamide-bisacrylamide, 22.5 mM Tris,
22.5 mM boric acid, 0.5 mM EDTA) containing 6% glycerol. Gels were
visualized by autoradiography and quantified using a PhosphorImager
(Molecular Dynamics, Sunnyvale, CA) with ImageQuant software.
5297
5298
RSS SPACER CAN PROFOUNDLY AFFECT RECOMBINATION FREQUENCY
ripheral blood (8, 20, 21). RSS of L11 varies from the A18/A2
RSS (hereafter referred to as A2) in only five positions in the
spacer. To test whether the difference in recombination frequency observed in vivo could be due to the nucleotide variations in the spacer, we assessed the relative A2:L11 recombination frequencies in our competition assay. In this assay (Table
II, C38), A2 was used 3 times as often as L11, a bias similar to
that seen in vivo.
We further analyzed three of the positions in which the spacer
sequences of A2 and L11 differ: positions 6, 11, and 12. In the
sixth position, there is a G in the good A2 spacer (and in 38% of
the database sequences), while C is present in the L11 spacer (and
in 15% of the database sequences). Based on this skewed usage of
nucleotides, it seemed likely that the G3 C substitution alters recombination frequencies. However, there was no difference in recombination among the three sets of substrates with G or C in this
position (C50 series) (Table II).
We next analyzed the 11th and 12th positions of the spacer. RSS
with a G at position 11 rearranged only half as well as RSS containing an A at position 11 (C50D and C50F). Although this suggests that the A3 G substitution observed at the 11th position of
the L11 spacer may contribute to the decreased recombination efficiency, G is actually present slightly more often than A in the
database (26 vs 19%). Thus, this result was not predicted based on
the frequency of nucleotide usage in the database. RSS containing
As at the 11th and 12th positions of the spacer support 40% less
rearrangement than RSS containing an A at the 11th position and
a T at the 12th position (C50C and C50G). Although this suggests
that the T3 A substitution observed at the 12th position of the L11
spacer might also contribute to the decreased recombination efficiency of L11, it is interesting to note that A is present slightly
more often than T in the database (43 vs 27%).
In conclusion, we clearly demonstrate that individual nucleotide
variations in the spacer can affect recombination frequency. As
previously seen for multiple variations in heptamer and nonamer
sequence (19), the combined effects of nucleotide changes in the
spacer might be interdependent and/or synergistic, and therefore the
rearrangement potential of RSS may require functional assessment.
Table I. Single nucleotide changes in the spacer can affect recombination frequency
External Spacera
n⫽
b
Ext:Intc
(%)
Frequency in
Databased (%)
:
Internal Spacer
A2
A27
A27mut
GTACAGACCAAT
A-T---CTTG-A
AGT---CTTC-A
117
114
62:38
89:11
C40 series—varying position 2 in A27 spacer
C40G
AGT---CTTG-A
C40A
AAT---CTTG-A
C40T
ATT---CTTG-A
C40C
ACT---CTTG-A
---------------------------------------------
223
128
140
189
20:80
13:87
36:64
20:80
13
5
56
26
C44 series—varying position 10 in A27 spacer
C44G
A-T---CTTG-A
C44A
A-T---CTTA-A
C44T
A-T---CTTT-A
C44C
A-T---CTTC-A
---------------------------------------------
179
199
230
126
26:74
28:72
29:71
30:70
16
20
36
28
C24
C31
A2
A2
A2
GTACAGACCAAT
-----------------------
a
All RSS have V␬A2 flanking DNA and consensus heptamers and nonamers. C24 has the A2 spacer vs the A27 spacer in external and internal position, respectively. C31
is the same construct, but with the two underlined changes in the A27 spacer. Those two changes are analyzed in the C40 and C44 series of competition substrates.
b
Number of individual colonies that were screened by PCR.
c
Values are presented as the percentage of competition substrates that rearranged to the external segment:percentage that rearranged to the internal segment.
d
Frequency of the varied nucleotide, spacer position 2 in C40 series, and spacer position 10 in the C44 series, in the database of Ramsden et al. (6).
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
nucleotide usage might affect recombination frequency. We previously used this approach to accurately predict that a single base
pair change in the heptamer might be deleterious to efficient recombination, and we use it in this study to analyze the effect of
single nucleotide changes in the spacer sequence (19).
The A27 and A27 mutant RSS spacers differ in sequence at only
two positions: the second position (T in A27; G in A27 mutant)
and the tenth position (G in A27; C in A27 mutant). Because G is
observed at position 2 in only 10% of the 12-bp spacers in the RSS
database, while T is present in 56% (see Table I), we predicted that
a T3 G substitution at position 2 in the spacer would be likely to
contribute to the inefficient rearrangement of the A27 mutant RSS.
By the same reasoning, because C is observed at position 10 only
slightly more frequently than G (28 vs 16%), a G3 C substitution at
spacer position 10 would be less likely to decrease recombination.
To test these hypotheses, we made competition substrates in
which the second or the tenth position of the spacer was changed
to a G, A, T, or C (Table I, C40 series). All RSS in this series of
constructs had consensus heptamers and nonamers. In agreement
with our prediction, a T in the second position of the spacer creates
the most recombinogenic spacer (Table I, C40T). Conversely, an A
in the second position (present in only 5% of the database sequences) supports the lowest frequency of rearrangement (C40A).
The variant RSS with a G in the second position of the spacer is
used in only 20% of the rearrangement events (C40G). Hence, the
T3 G substitution at the second position of the spacer contributes
significantly to the poor rearrangement of the A27 mutant RSS. In
contrast, changing only the tenth position of the spacer to G, A, T,
or C had minimal effect on recombination frequency, consistent
with the unbiased usage of all four nucleotides in the database of
natural RSS at this position. Thus, a single nucleotide substitution
at the second position of the spacer is primarily responsible for the
ineffectiveness of the A27 mutant RSS.
To determine whether there are other examples in which the
spacer sequence might affect recombination frequency in vivo, we
compared the relative recombination potential of V␬ genes A18
and L11. The RSS of A18 is identical with that of A2, and it has
the best natural spacer that we have observed to date. In vivo, A18
has an intrinsically higher rearrangement frequency than L11, as
assessed in nonproductive sequences from bone marrow and pe-
The Journal of Immunology
5299
Table II. Effect of varying the spacer sequence
External RSS
Plasmid
C38
C50B
C50A
C50C
C50G
C50D
C50F
Internal RSS
Coding
enda
Heptamer
Spacer
Nonamer
Coding
end
Heptamer
Spacer
A2
A2
A2
A2
A2
A2
A2
CACAGTG
-------------------------------------------
GTACAGACCAAT
----------------G----AT
-----C----AT
-----G----AA
-----C----AA
-----G----GT
-----C----GT
ACAAAAACC
--G------------------------------------------------------
L11
A2
A2
A2
A2
A2
A2
CACAGTG
-------------------------------------------
GTACAGACCAAT
T----C---CGA
-------------------------------------------------------------------
% Colonies
Nonamer
ACAAAAACC
---G-----------------------------------------------------
n⫽
Ext:Int
182
165
184
183
116
202
107
74:26
47:53
50:50
29:71
28:72
38:62
31:69
Frequency of nucleotide usage at positionb
6
11
12
G
A
T
C
b
26
19
35
20
13
43
27
16
The coding end refers to the ⬃100 bp of coding DNA that is included in the construct.
Frequency according to the database of Ramsden et al. (6). The positions that vary between the V␬II A2 spacer and the V␬I L11 spacer are in bold.
A poor spacer sequence can dramatically reduce V(D)J
recombination
We wished to determine how much of a negative influence a poor
spacer sequence could have on recombination. Using the Ramsden
et al. database (6), we created an RSS spacer with the least used
nucleotide in each position, with the exception of two positions in
which the most infrequent nucleotide was used in 5% or less of the
sequences. In these two positions, we used the second-most infrequent nucleotide (Fig. 1B). We reasoned that this should be among
the least favorable spacer sequences, and thus should reveal how
much of a deleterious effect on recombination efficiency variation
in the spacer might have.
We constructed competition recombination substrates containing the V␬A2 spacer in competition with either the consensus or
the Infrequent spacer (Fig. 1C). All spacers were flanked by consensus heptamers and nonamers and V␬A2 coding and 3⬘ flanking
DNA. As can be seen in Fig. 1C, the A2 spacer is as efficient as the
consensus spacer in promoting recombination. Because the A
present in the first position of the consensus spacer is used in 50%
of the sequences in the database, while the G used in the first
position of A2 is used least frequently, we wondered whether the
consensus spacer would be less good with an A3 G substitution at
the first position. We therefore constructed another substrate containing the A2 spacer in competition with a variant consensus
spacer containing an A3 G substitution at position 1; however,
this change from A to G did not affect recombination levels at all
(Fig. 1C). Thus, the naturally occurring V␬A2 spacer is as effective as the consensus 12-bp spacer, despite having four changes at
the 5⬘ and 3⬘ ends.
Most importantly, we made a construct in which we analyzed
the Infrequent spacer. Strikingly, an RSS with the Infrequent
spacer is hardly ever used when placed in competition with the A2
spacer (only 2% of the rearrangements). Hence, the 12-bp spacer
sequence has the potential to dramatically affect recombination.
The 23-bp spacer sequences from VH genes also affect
recombination frequency
The work above concerns 12-bp spacers. To test whether the same
influence of spacer sequence would hold for 23-bp spacers, and to
further study naturally occurring VH RSS and their influence on
repertoire formation, we analyzed the rearrangement of additional
murine VH genes. We previously showed that the three functional
genes of the VHS107 family, V1, V11, and V13, have very different intrinsic rearrangement frequencies in vivo despite being
flanked by RSS with identical heptamers and nonamers (12). V11
and V13 have identical spacers, but the V1 spacer differs at five
positions (Fig. 2B). In bone marrow pro-B cells of ␮MT mice, V1
rearranges 5 times more often than V11, and 40 times more often
than V13 (12). We therefore made a series of constructs to ask
whether the nucleotide variations of the V1 spacer influenced its
high rearrangement frequency in vivo.
All competition recombination substrates in this series had 200
bp 5⬘ of the VH RSS, and 3–20 bp 3⬘ of the RSS, and all constructs
had a DSP2.2 12-bp RSS fragment in place of the J␬ RSS. First,
we made a construct with identical V1-competing segments (C88).
This construct had a slight bias for the external fragment, which we
never observed in our V␬-containing competition constructs (Fig.
2A). The reason for this is unclear, but we made reciprocal constructs for many of the variants to control for any slight position
effects.
In a competition between V1 and V11 (C56), rearrangement
occurred to V1 in 80% of the recombinants assayed. The reciprocal
competition construct (C108) demonstrated rearrangement to V1
in 75% of the recombinants (Fig. 2A). Because V1 rearranges 5
times more than V11 in vivo, these data from the recombination
substrates indicate that the intrinsic potency of the V1 RSS and/or
any of the V1-flanking DNA must be a major contributor to its
higher rearrangement frequency. To dissect the parts of the V1
segment that are responsible for the increased recombination, we
made a variety of recombinant constructs (Fig. 2A). As seen in C70
compared with C56, most of the difference in rearrangement frequency between V1 and V11 is due to the spacer and/or the 3⬘
flanking DNA, but there is some deleterious effect of having the
V11 coding region. To directly determine whether it is in fact the
spacer that controls the differential rearrangement frequency of V1
and V11, we replaced the V1 spacer with that of V11, while retaining all the V1 flanking sequence on both sides of the RSS. For
C129, which has the V11 spacer in the internal RSS, rearrangement occurs to the external V1 RSS 82% of the time, comparable
to the 80% recombination to V1 in C56. In the reciprocal construct
(C102), in which the V11 spacer was in the internal RSS, rearrangement occurred with the V1 spacer 64% of the time, which is
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
a
38
25
21
15
5300
RSS SPACER CAN PROFOUNDLY AFFECT RECOMBINATION FREQUENCY
Unequal rearrangement of the two V␤3 alleles in vivo is not
due to intrinsic RSS differences
The human V␤3 gene has two alleles that recombine at very different frequencies in vivo. Individuals homozygous for V␤3.2
have 8.1% V␤3⫹ cells in their peripheral blood, while those homozygous for V␤3.1 have only 1.2% V␤3⫹ cells (7). The two
alleles were sequenced, and the only difference in over 1 kb of
DNA was the substitution of a T (in V␤3.2) for a C (in V␤3.1) in
the spacer sequence (7). To see whether the change in the spacer
affected the recombination frequency, we made a competition recombination substrate in which V␤3.1 was in competition with
V␤3.2. Thus, the only change in this construct was the one nucleotide change in the spacer. As can be seen in Fig. 3, the spacer
difference did not account for the difference in recombination observed in vivo.
RSS identification and scoring by computer modeling
Poor spacer RSS display modestly decreased RAG binding
slightly lower than the 75% present in C108. Together, these two
constructs, in which the internal and external fragments differ only
by the spacer sequence, indicate that the quality of the 23-bp
spacer in V1 vs V11 is, in fact, primarily responsible for the biased
rearrangement that we observed in vivo.
Another region that has been reported to affect recombination
frequency is the coding end immediately flanking the heptamer of
the RSS (14, 22–25), and the results of C56 vs C70 indicated that
there was some effect of the V11 coding region. To address this
issue, we tested constructs with swapped coding ends. The coding
ends of V1 and V11 are identical, except for the three nucleotides
closest to the heptamer (Fig. 2B). Comparison of the results with
C98 vs C88 and C108, and C128 vs C56, show that the coding end
does have an effect upon recombination, but not nearly as much an
influence as the spacer. We also analyzed V11 and V13, which
share the identical RSS, yet rearrange at 7-fold different frequencies in vivo (12). They differ in coding sequence including the
coding end, yet show similar recombination frequencies in our
assay (Fig. 2, C57). Thus, for V13, other factors must contribute to
its very low frequency of rearrangement in vivo.
We conclude that the spacer is primarily responsible for the
differential recombination efficacy of the V1 and V11 gene segments, while the coding end also makes a small contribution to the
favored rearrangement of V1. Together, these differences account
for much of the differential rearrangement frequency of the V1 vs
V11 gene segments in vivo.
One hypothesis to explain why the spacer sequence affects the
recombination efficiency is that the RAG proteins may bind an
RSS containing a near-consensus spacer with higher affinity than
an RSS that has a spacer that varies in several positions from the
consensus. To test this hypothesis that RAG proteins may not bind
well to RSS with poor spacers, we compared the binding of purified RAG1 and RAG2 proteins with the three labeled RSS (A2,
A27 mutant, and Infrequent, all with consensus heptamers and
nonamers) by EMSA. We used an additional duplex 12-bp RSS
FIGURE 3. Unequal rearrangement of the two V␤3 alleles in vivo is not
due to intrinsic RSS differences. A, The sequence of the spacer of the two
V␤3 alleles is shown, along with the percentage of peripheral blood T cells
that express V␤3 in V␤3.1 or V␤3.2 homozygotes, respectively. The data
in A are from Ref. 7. B, Recombination substrate with V␤3.2 in competition with V␤3.1.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 2. A, Competition recombination substrates with fragments of
V1 and V11 show the effect of the spacer sequence on recombination. The
substrates have the indicated portions of the construct composed of V1
(open bars), V11 (striped bars), or V13 (dotted bar). All of these VHS107
genes had the same consensus heptamer and same nonconsensus nonamer,
which are indicated by filled boxes. The coding region of the V genes is on
the left of the RSS, and the 3⬘ flank is on the right of the RSS. B, The three
spacer sequences are shown in comparison with the consensus 12-bp
spacer sequence from Ramsden et al. (6). C, For the five positions that
differ between V1 and V11/V13, the frequency in the database of the nucleotide present in V1 and in V11/V13 is indicated. Position 5 shows the
biggest variation in frequency.
Cowell et al. (26) have developed a computer program to identify
potential RSS sequences, and to score them, with scores ranging
from -⬁ (worst RSS) to 0 (best RSS). Of 201 Ig or TCR 12-bp RSS
analyzed in their study, only 2 had scores less than ⫺38.8, and the
mean score for the Ig and TCR RSS was ⫺18.5. We used this
program to calculate the scores of the spacers studied in this investigation, all in the context of consensus heptamers and nonamers. The consensus spacer sequence based on the database of
Ramsden et al. gave the best score (⫺7.7), and Infrequent gave a
very poor score of ⫺36.4, despite having a consensus heptamer
and nonamer. However, RSS with spacers A2, A27, and A27 mutant all gave average scores (⫺15.2, ⫺13.8, and ⫺17.4, respectively), despite the fact that our recombination substrate assays
showed that A2 was essentially as good as the consensus, A27 was
2-fold worse in recombination, and A27 mutant was 6 times less
recombinogenic. Thus, this computational program to rate RSS did
not give very precise predictive value as to the relative efficiency
of recombination supported by these three spacers.
The Journal of Immunology
5301
oligonucleotide, VDJ 100/101, as an unlabeled competitor. The
spacer of VDJ 100/101 is very close to the consensus, as is the
V␬A2 spacer (Fig. 4A). Fig. 4B shows that RAG1 and RAG2
bound the A2 RSS ⬃2-fold better than either A27 mutant or Infrequent RSS (compare lane 1 with lanes 7 and 13). It can be seen
that SC1 formation is more dramatically affected than is SC2 formation, but the reason for this is unclear.
We also assessed binding by comparing the ability of unlabeled
A2, A27 mutant, or Infrequent RSS to compete for binding with
the labeled and highly efficient RSS VDJ100/101. Binding was
inhibited 50% with a 2-fold excess of cold A2, while 50% inhibition of binding to VDJ100/101 required ⬃7-fold excess of cold
A27 mutant RSS or Infrequent RSS (Fig. 5). Thus, both of these
approaches demonstrate that while RSS with poor spacers (A27
mutant and Infrequent) still bind the RAG proteins, they do so less
efficiently than RSS with good spacers (A2). This 2- to 3-fold
decrease in RAG binding to an individual RSS does not seem
sufficient to explain the greatly reduced recombination efficiency
of RSS containing these spacers.
Cleavage of RSS is more dramatically affected by the spacer
sequence
FIGURE 4. RSS with spacers that do not support efficient recombination show slightly reduced binding by RAG1 and RAG2. A, Sequence of
the spacers used in RAG-binding assay. B, Binding to A2ⴱ/A2C, A27mutⴱ/
A27mutC, Infrequentⴱ/InfrequentC, competed with 100/101. ⴱ, Indicates
the labeled oligo, and C indicates complementary oligo used to create the
dsRSS. Lanes 2– 6, 8 –12, and 14 –18, Contain 2-, 5-, 10-, 50-, and 100-fold
excess of unlabeled 100/101 competitor RSS. SC1 and SC2 both contain
RAG1 and RAG2, and the different mobility is due to different numbers of
RAG2 molecules bound (15). A film autoradiogram is shown in the figure.
The percentage of the substrate bound is indicated below the gel. Quantitation was performed by PhosphorImager analysis.
To determine whether the different spacer sequences affected the
subsequent cleavage step more than they affected the initial
RAG1/2 protein binding, single-site cleavage of various RSS was
assessed in vitro in the presence of Mn2⫹. The same four RSS
oligonucleotides were 32P labeled and incubated with RAG1 and
RAG2 proteins. It can be seen that the Infrequent RSS substrate is
cleaved ⬃9-fold less efficiently than the A2 RSS (Fig. 6, compare
lanes 4 and 2), and A27 mutant is cleaved ⬃3-fold less well than
A2 (compare lanes 3 and 2). Despite the differences in their spacer
sequences, A2, A27 mutant, and Infrequent all exhibit an increased
nick:hairpin ratio as compared with VDJ100/101. However, because the flanking coding DNA present in A2, A27 mutant, and
Infrequent differs from the coding DNA present in VDJ100/101,
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 5. Poor spacer RSS compete less well than the good spacer
RSS for RAG binding. A, Binding to 100ⴱ/101, competed with increasing
amounts of A2/A2C, A27mut/A27mutC, Infrequent/InfrequentC oligos.
Lanes 2– 6, 8 –12, and 14 –18, Contain 2-, 5-, 10-, 50-, and 100-fold excess
of the indicated unlabeled competitor RSS. A film autoradiogram is shown
in the figure. The percent inhibition of binding resulting from the presence
of competitor DNA is indicated below the gel, and is graphed in B. Quantitation was performed by PhosphorImager analysis.
5302
RSS SPACER CAN PROFOUNDLY AFFECT RECOMBINATION FREQUENCY
and because coding end DNA is known to affect the efficiency of
hairpin formation (14, 25), it seems likely that the altered nick:
hairpin ratio observed for A2, A27 mutant, and Infrequent vs
VDJ100/101 is attributable to the coding DNA sequence immediately flanking the RSS.
Thus, there is a more dramatic effect of the spacer on cleavage
than on binding of the RAG1/2 proteins to the RSS, although even
this decrease may not completely account for the level of decreased efficiency of rearrangement seen in the competition
substrates.
Discussion
RSS spacer sequence differences can dramatically affect
recombination frequency
Individual V, D, and J gene segments rearrange at different frequencies, and one of the reasons for this unequal rearrangement
frequency in vivo is the naturally occurring variation in the sequences of the RSS flanking these gene segments (11). Few RSS
have both consensus heptamers and nonamers, and we have previously used competition recombination substrates to show that
several examples of nonrandom rearrangement in vivo can be explained by these differences (8, 13, 19). However, there is a large
variation in the frequency of rearrangement for genes within a VH
or V␬ family, and very often all family members share heptamers
and nonamers, but diverge in the spacer sequence (12, 13, 20, 21,
27–29). Hence, our previous demonstration that the recombination
frequency of naturally occurring RSS is affected, albeit mildly, by
the sequence of the spacer had biologically significant implications
for lymphocyte repertoire composition (8).
In this study, we investigate the extent of the influence of the
spacer on recombination in vivo, and we present in vitro studies
Spacer region sequences affect RAG binding and RSS cleavage
Our analysis of the infrequent RSS spacer substrate shows clearly
that the spacer sequence can have a major impact upon recombination. This infrequent spacer RSS was essentially unable to support V(D)J recombination in transient assays with extrachromosomal substrates. How does the spacer influence the recombination
efficacy of an RSS? Previously published studies have demonstrated that RAG1 protein as well as the RAG1/2 protein complex
directly interact with the spacer (30, 31). Therefore, we first tested
the hypothesis that RAG binding may be impaired by a poor spacer
sequence.
We found that a nonconsensus spacer modestly decreases the
efficiency of RAG1/2 binding. The RSS with the poor spacers, A27
mutant and Infrequent, were both ⬃2-fold less efficient than the
near-consensus A2 RSS at inhibiting RAG binding to the nearconsensus VDJ 100/101. Direct binding of RAG1 and RAG2 to
Infrequent and A27 mutant RSS was also demonstrated, although
again the binding was ⬃2-fold less efficient than binding to A2
RSS. For both A27 mutant and Infrequent, we observed a greater
decrease in SC1 formation than SC2 formation. SC1 is the precursor of SC2, and SC2 is the precursor of the paired synaptic
complex (15). SC2 and SC1 differ only in that SC2 contains twice
as many RAG2 molecules as SC1 (15). Thus, it is possible that the
spacer region plays a more significant role in the initial RAG-RSS
interactions. The full complement of RAG proteins found in SC2
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 6. Infrequent spacer RSS is cleaved inefficiently by RAG proteins. Cleavage of A2ⴱ/A2C, A27mutⴱ/A27mutC, Infrequentⴱ/InfrequentC. Lane 1, Contains VDJ 100ⴱ/101. Lane 2, Contains A2ⴱ/A2C. Lane
3, Contains A27mutⴱ/A27mutC. Lane 4, Contains Infrequentⴱ/InfrequentC. The percentage of the substrate cleaved is indicated below the gel.
Quantitation was performed by PhosphorImager analysis. A film autoradiogram is shown in the figure, and some of the lanes of this gel have been
omitted for clarity. HP denotes the hairpin.
analyzing the mechanism of this influence. Much of this basis for
this study comes from the large database of RSS made by Ramsden et al. (6). They showed that several positions in the spacer,
particularly at the 5⬘ half portion near the heptamer, were moderately well conserved. Because we had previously shown that infrequently observed nucleotides within the heptamer can produce
less efficient RSS (19), we reasoned that conserved positions
within the spacer might also contribute to RSS efficacy. This hypothesis correctly predicted that the decrease in efficiency of A27
mutant spacer, which varied from A27 by only two positions, was
predominantly due to the change in the second position, while the
change at the tenth position did not affect recombination.
However, a more complex situation was observed when we dissected the spacer difference between the V␬ genes A2 and L11
(Table II). In position 6, the G found in the good A2 spacer is
present at over twice the frequency of the C found in the L11
spacer, but three pairs of recombination substrates showed that
there was no difference in recombination efficacy at all of a C vs
a G at that position. This is most likely due to the fact that this sixth
position in the middle of the 12-bp spacer would be on the opposite
side of the DNA helix from the surface to which the RAG proteins
are binding. In contrast, the last two positions that abut the
nonamer did have an effect. The worst option was having the
spacer terminate with AA, despite the fact that A is found in position 12 in 43% of the spacers in the database. However, this
deleterious effect may be because the last three nucleotides of the
newly created spacer are now AAA, making the spacer-nonamer
sequence . . . . ACAGACCAAA-ACAAAAACC, which inadvertently creates two partially overlapping nonamers. Binding of the
RAG proteins to the wrong nonamer could prevent proper contact
with the heptamer, disrupting overall binding and cleavage levels.
In general, from these studies on the L11 spacer sequence, we find
that although predictions of good vs bad RSS heptamer, spacer, or
nonamer sequences can be made by comparing an individual RSS
with the consensus database, there are certainly some exceptions,
no doubt based on synergistic interactions within the surrounding
sequence context when multiple deviations from consensus occur.
The Journal of Immunology
CpG methylation of the spacer may affect the recombination
efficiency of an RSS
The first description of a difference in a single nucleotide in the
spacer sequence being responsible for a 6-fold difference in frequency in vivo was that of the V␤3 alleles (7). However, in this
study, we show that the two RSS are identical in their ability to
undergo recombination as assessed in recombination substrates.
These data then strongly point to an epigenetic effect for this particular spacer difference in vivo. The T to C substitution in the
spacer of the infrequently rearranged V␤3.1 allele has created a
CpG sequence. Thus, as suggested previously, our data support the
proposal that in vivo methylation of this spacer could greatly reduce recombination frequency (7). It has been shown that methylation of a CpG sequence in the heptamer can preclude recombination (38), and our data are consistent with the hypothesis that
methylation of the spacer might also preclude recombination.
RSS spacer sequence differences may affect V gene usage in vivo
How much of an impact do spacer differences have on actual V
gene usage in vivo? Both V␬ genes A2 and L11 share the same
nonconsensus nonamer, and the same consensus heptamer. A2 rearranges more than L11 in vivo, and the A2 gene fragment supports 3 times more recombination that the L11 fragment in our
competition substrate. Thus, the difference in spacer sequence may
be responsible for the difference in recombination in vivo. However, these genes are also from different V␬ families, and so their
coding regions differ by ⬃30%, and even the coding ends are quite
different. Thus, because we did not make constructs that varied
only in the spacer, we cannot be certain that the difference in recombination frequency seen in C38 is due to the spacer alone.
However, we did make a detailed analysis of two murine VHS107
genes that are very similar in coding sequence, and are identical
with each other in heptamer and nonamer. In this case, we clearly
showed that the spacer alone was the predominant factor accounting for the 4-fold difference in recombination seen in the competition substrates, with a more modest effect of the coding end also.
Comparison of both of the spacer sequences to the database suggests that positions 5 and 21 of the V1 spacer are likely candidates
to be primarily responsible for the differential recombination potency, because the nucleotides present in V1 spacer are far more
frequent that the nucleotides that the V11 spacer has at those positions (Fig. 2C). Hence, we conclude that the spacer difference,
and to a lesser extent the coding end difference, between V1 and
V11 may well be responsible for the unequal rearrangement frequency of these two genes in vivo (12).
A potential caveat to our comparison of V␬ genes A2 vs L11
and VH genes V1 vs V11 is that for genes such as these, which are
not alleles as were the A2a/A2b genes we previously analyzed
(19), the chromosomal context of the genes may vary. Therefore,
we cannot rule out the possibility that we are fortuitously observing the same relative frequency of recombination in the competition substrates as that which occurs in vivo. Proof that the spacer
sequence was responsible for the difference in recombination frequency in vivo would require gene targeting of the spacer of one
of the genes to convert it to the other sequence. We know that other
factors do influence rearrangement frequency, as was shown in our
analysis of the large VH7183 family, in which genes with identical
RSS rearrange very differently (13). In this case, we showed that
recombination frequency in vivo was more highly correlated with
chromosomal location. Furthermore, within the VHS107 family,
V11 and V13 have identical RSS, very similar coding regions, and
are neighboring genes, yet they vary 7-fold in rearrangement frequency in vivo. Thus, the competition substrates clearly reveal the
extent to which the RSS and/or coding end differences could contribute to nonrandom gene use in vivo. However, these recombination substrate studies also show that some of the in vivo recombination frequencies must be affected by other factors to account
for the differences in rearrangement frequency in vivo for genes
with equal recombination efficiency in the transient assays with the
substrates.
Recently, it has been shown that the RSS can impose rearrangement biases, in that V␤ genes do not rearrange to J␤ genes in vivo
despite the fact that they have 12- and 23-bp spacers, respectively,
and thus should be permitted to rearrange. Gene targeting showed
that the RSS was responsible for this bias, which was thus a preference beyond the 12–23 rule (39). This restriction could be due to
a specific affinity of the appropriate RSS (i.e., V␤ and 5⬘ D␤, or 3⬘
D␤ and J␤) to synapse and rearrange to each other. Analysis of
these RSS in competition recombination substrates recapitulated
the restrictions observed in vivo (40, 41), and one study showed
that for the V␤, it was the sequence of the spacer and the coding
end that imposed this rearrangement bias (40). In vitro cleavage
reactions showed that the RAG proteins are the only proteins required to enforce this bias (40). It is possible that our infrequent
spacer RSS does not compete well with the V␬A2 spacer to the
natural partner of A2 in vivo, the J␬ RSS, just as the V␤ RSS due
to its spacer does not rearrange to J␤ RSS, due to the mechanistically unknown basis of beyond 12–23 rule. However, it was
shown in another study that a V␤ RSS rearranged much better to
a 12-bp V␬ RSS, which is close to consensus, than to its in vivo
rearrangement partner, the 5⬘ D␤ RSS, and likewise substitution of
the V␤ RSS with the consensus J␬1 RSS still showed almost exclusive rearrangement to the 5⬘ D␤ rather than the J␤ RSS (41).
Hence, the basis for the inability of the V␤ and J␤ RSS to recombine together in vivo or in substrate assays may be greatly influenced by the fact that both of these nonconsensus RSS have efficiencies well below that of a consensus RSS, and thus may not rise
above some threshold affinity required for high frequency
rearrangement.
Spacer region sequences affect the postbinding steps of V(D)J
recombination, and influence T and B cell repertoire formation
Our data showing that RAGs do bind the infrequent spacer RSS,
albeit somewhat less efficiently, demonstrate that there are steps
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
may help stabilize binding to the poor spacer RSS, whereas the
SC1 complex might be more transient.
However, a more dramatic influence of the spacer sequence was
seen when RAG-mediated cleavage was analyzed. We observed
3-fold less cleavage of A27 mutant RSS and ⬃9-fold less cleavage
of infrequent RSS, as compared with cleavage of 100/101 or A2
RSS. However, even the observed decrease in single-site cleavage
(Fig. 6) is not sufficient to explain the near inability of the infrequent RSS to recombine in competition recombination substrate
assays. However, the RAG1/2 binding to the poor RSS may not be
stably maintained through pairing of the two RSS into the synaptic
complex, paired cleavage, processing of the hairpins, and joining
of the two coding ends. We suggest that in the context of the
recombination substrate, the weakened binding of RAG1 and
RAG2 to infrequent RSS may cause such inefficient or short-lived
synaptic complex formation and possibly also postcleavage complex formation that coding joint formation would be greatly impaired. Finding that rejoining of DNA is more strictly controlled
than RSS cleavage has precedent in studies of RAG1 and RAG2
mutants and RSS heptamer and nonamer mutants in postcleavage
joining events (32–37). Overall, it appears that a poor RSS spacer
region slightly impairs initial RAG binding, but more severely
affects subsequent RAG-catalyzed RSS cleavage.
5303
5304
RSS SPACER CAN PROFOUNDLY AFFECT RECOMBINATION FREQUENCY
subsequent to RAG binding that control rearrangement frequency
in vivo. Because the RSS spacer region affects RSS cleavage more
severely than it affects RAG binding, RSS cleavage appears to be
one of the postbinding steps that is affected by the spacer region.
Because RAG1 and RAG2 have been shown to play additional
roles subsequent to RSS cleavage (34 –37), and because RSS with
poor heptamers and nonamers can result in postcleavage defects in
joining (33), perhaps the spacer region not only affects initial RAG
binding and RSS cleavage, but also affects the postcleavage RSSRAG interactions necessary to maintain the integrity of the postcleavage complex during subsequent coding joint formation. Overall, these data clearly demonstrate that RSS spacer sequence
differences can potentially play a major role in determining the
rearrangement frequency of a given gene segment, and should be
considered to be one of the influences leading to nonrandom gene
segment use in the primary T and B cell repertoires.
Acknowledgments
References
1. Oettinger, M. A., D. G. Schatz, C. Gorka, and D. Baltimore. 1990. RAG-1 and
RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 248:1517.
2. McBlane, J. F., D. C. van Gent, D. A. Ramsden, C. Romeo, C. A. Cuomo,
M. Gellert, and M. A. Oettinger. 1995. Cleavage at a V(D)J recombination signal
requires only RAG1 and RAG2 proteins and occurs in two steps. Cell 83:387.
3. Hesse, J. E., M. R. Lieber, K. Mizuuchi, and M. Gellert. 1989. V(D)J recombination: a functional definition of the joining signals. Genes Dev. 3:1053.
4. Akamatsu, Y., N. Tsurushita, F. Nagawa, M. Matsuoka, K. Okazaki, M. Imai, and
H. Sakano. 1994. Essential residues in V(D)J recombination signals. J. Immunol.
153:4520.
5. Akira, S., K. Okazaki, and H. Sakano. 1987. Two pairs of recombination signals
are sufficient to cause immunoglobulin V-(D)-J joining. Science 238:1134.
6. Ramsden, D. A., K. Baetz, and G. E. Wu. 1994. Conservation of sequence in
recombination signal sequence spacers. Nucleic Acids Res. 22:1785.
7. Posnett, D. N., C. S. Vissinga, C. Pambuccian, S. Wei, M. A. Robinson,
D. Kostyu, and P. Cancannon. 1994. Level of human TCRBV3S1 (V␤3) expression correlates with allelic polymorphism in the spacer region of the recombination signal sequence. J. Exp. Med. 179:1707.
8. Nadel, B., A. Tang, G. Escuro, G. Lugo, and A. J. Feeney. 1998. Sequence of the
spacer in the recombination signal sequence affects V(D)J rearrangement frequency and correlates with non-random V␬ usage in vivo. J. Exp. Med. 187:1495.
9. Fanning, L., A. Connor, K. Baetz, D. Ramsden, and G. E. Wu. 1996. Mouse RSS
spacer sequences affect the rate of V(D)J recombination. Immunogenetics 44:146.
10. Larijani, M., C. C. K. Yu, R. Golub, Q. L. K. Lam, and G. E. Wu. 1999. The role
of components of recombination signal sequences in immunoglobulin gene segment usage: a V81x model. Nucleic Acids Res. 27:2304.
11. Feeney, A. J., A. Tang, and K. M. Ogwaro. 2000. B-cell repertoire formation: role
of the recombination signal sequence in non-random V segment utilization. Immunol. Rev. 175:59.
12. Love, V. A., G. Lugo, D. Merz, and A. J. Feeney. 2000. Individual promoters
vary in strength, but the frequency of rearrangement of those VH genes does not
correlate with promoter strength nor enhancer independence. Mol. Immunol.
37:29.
13. Williams, G. W., A. Martinez, A. Montalbano, A. Tang, A. Mauhar,
K. M. Ogwaro, D. Merz, C. Chevillard, R. Riblet, and A. J. Feeney. 2001. Unequal VH gene rearrangement frequency within the large VH7183 gene family is
not due to RSS variation, and mapping of the genes shows a bias of rearrangement based on chromosomal location. J. Immunol. 167:257.
14. Cuomo, C. A., C. L. Mundy, and M. A. Oettinger. 1996. DNA sequence and
structure requirements for cleavage of V(D)J recombination signal sequences.
Mol. Cell. Biol. 16:5683.
15. Mundy, C. L., N. Patenge, A. G. W. Matthews, and M. A. Oettinger. 2002.
Assembly of the RAG1/RAG2 synaptic complex. Mol. Cell. Biol. 22:69.
16. Kim, D. R., and M. A. Oettinger. 1998. Functional analysis of coordinated cleavage in V(D)J recombination. Mol. Cell. Biol. 18:4679.
17. Sakano, H., Y. Kurosawa, M. Weigert, and S. Tonegawa. 1981. Identification and
nucleotide sequence of a diversity DNA segment (D) of immunoglobulin heavychain genes. Nature 290:562.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
We gratefully acknowledge valuable comments on this work by Dr. Bertrand Nadel and Dr. Norman Klinman. We also thank Drs. Christoph Weber and Lindsay Cowell for assistance in the computer analysis.
18. Sakano, H., R. Maki, Y. Kurosawa, W. Roeder, and S. Tonegawa. 1980. Two
types of somatic recombination are necessary for the generation of complete
immunoglobulin heavy chain genes. Nature 286:676.
19. Nadel, B., A. Tang, G. Lugo, V. Love, G. Escuro, and A. J. Feeney. 1998.
Decreased frequency of rearrangement due to the synergistic effect of nucleotide
changes in the heptamer and nonamer of the recombination signal sequence of the
V␬ gene A2b, which is associated with increased susceptibility of Navajos to
Haemophilus influenzae type B disease. J. Immunol. 161:6068.
20. Feeney, A. J., G. Lugo, and G. Escuro. 1997. Human cord blood ␬ repertoire.
J. Immunol. 158:3761.
21. Foster, S. F., H.-P. Brezinschek, R. I. Brezinschek, and P. E. Lipsky. 1997.
Molecular mechanisms and selective influences that shape the ␬ gene repertoire
of IgM⫹ cells. J. Clin. Invest. 99:1614.
22. Gerstein, R. M., and M. R. Lieber. 1993. Coding end sequence can markedly
affect the initiation of V(D)J recombination. Genes Dev. 7:1459.
23. Ezekiel, U. R., T. Sun, G. Bozek, and U. Storb. 1997. The composition of coding
joints formed in V(D)J recombination is strongly affected by the nucleotide sequence of the coding ends and their relationship to the recombination signal
sequences. Mol. Cell. Biol. 17:4191.
24. Boubnov, N. V., Z. P. Wills, and D. T. Weaver. 1993. V(D)J recombination
coding junction formation without DNA homology: processing of coding termini.
Mol. Cell. Biol. 13:6957.
25. Ramsden, D. A., J. F. McBlane, D. C. van Gent, and M. Gellert. 1996. Distinct
DNA sequence and structure requirements for the two steps of V(D)J recombination signal cleavage. EMBO J. 15:3197.
26. Cowell, L. G., M. Davila, T. B. Kepler, and G. Kelsoe. 2002. Identification and
utilization of arbitrary correlations in models of recombination signal sequences.
Genome Biol. 3:1.
27. Kraj, P., S. P. Rao, A. M. Glas, R. R. Hardy, E. C. B. Milner, and
L. E. Silberstein. 1997. The human heavy chain Ig V region gene repertoire is
biased at all stages of B cell ontogeny, including early pre-B cells. J. Immunol.
158:5824.
28. Yu, K., A. Taghva, and M. R. Lieber. 2002. The cleavage efficiency of the human
immunoglobulin heavy chain VH elements by the RAG complex: implications
for the immune repertoire. J. Biol. Chem. 15:5040.
29. Livak, F., D. B. Burtrum, L. Rowen, D. G. Schatz, and H. T. Petrie. 2000. Genetic
modulation of T cell receptor gene segment usage during somatic recombination.
J. Exp. Med. 192:1191.
30. Nagawa, F., K.-I. Ishiguro, A. Tsuboi, T. Yoshida, A. Ishikawa, T. Takemori,
A. J. Otsuka, and H. Sakano. 1998. Footprint analysis of the RAG protein recombination signal sequence complex for V(D)J recombination. Mol. Cell. Biol.
18:655.
31. Swanson, P. C., and S. Desiderio. 1998. V(D)J recombination signal recognition:
distinct, overlapping DNA-protein contacts in complexes containing RAG1 with
and without RAG2. Immunity 9:115.
32. Hempel, W. M., P. Stanhope-Baker, N. Mathieu, F. Huang, M. S. Schlissel, and
P. Ferrier. 1998. Enhancer control of V(D)J recombination at the TCR␤ locus:
differential effects on DNA cleavage and joining. Genes Dev. 12:2305.
33. Agard, E. A., and S. M. Lewis. 2000. Postcleavage sequence specificity in V(D)J
recombination. Mol. Cell. Biol. 20:5032.
34. Tsai, C.-L., A. H. Drejer, and D. G. Schatz. 2002. Evidence of a critical architectural function for the RAG proteins in end processing, protection, and joining
in V(D)J recombination. Genes Dev. 16:1934.
35. Yarnell Schultz, H., M. A. Landree, Y.-X. Qiu, S. B. Kale, and D. B. Roth. 2001.
Joining-deficient RAG1 mutants block V(D)J recombination in vivo and hairpin
opening in vitro. Mol. Cell 7:65.
36. Qiu, J.-X., S. B. Kale, H. Y. Schultz, and D. B. Roth. 2001. Separation-offunction mutants reveal critical roles for RAG2 in both the cleavage and joining
steps of V(D)J recombination. Mol. Cell 7:77.
37. Huye, L. E., M. M. Purugganan, M. M. Jiang, and D. B. Roth. 2002. Mutational
analysis of all conserved basic amino acids in RAG-1 reveals catalytic, step
arrest, and joining-deficient mutants in the V(D)J recombinase. Mol. Cell. Biol.
22:3460.
38. Whitehurst, C. E., M. S. Schlissel, and J. Chen. 2000. Deletion of germline
promoter PD ␤1 from the TCR ␤ locus causes hypermethylation that impairs D
␤1 recombination by multiple mechanisms. Immunity 13:703.
39. Bassing, C. H., F. W. Alt, M. M. Hughes, M. D’Auteull, T. D. Wehrfy,
B. B. Woodman, F. Gartner, J. M. White, L. Davidson, and B. P. Sleckman. 2000.
Recombination signal sequences restrict chromosomal V(D)J recombination beyond the 12/23 rule. Nature 405:583.
40. Jung, D., C. H. Bassing, S. D. Fugmann, H.-L. Cheng, D. G. Schatz, and
F. W. Alt. 2003. Extrachromosomal recombination substrates recapitulate beyond
12/23 restricted V(D)J recombination in nonlymphoid cells. Immunity 18:65.
41. Tillman, R. E., A. L. Wooley, B. Khor, T. D. Wehrly, C. A. Little, and
B. P. Sleckman. 2003. Cutting Edge: Targeting of V␤ to D␤ rearrangement by
RSSs can be mediated by the V(D)J recombinase in the absence of additional
lymphoid-specific factors. J. Immunol. 170:5.