This information is current as
of June 17, 2017.
Lessons from Thymic Epithelial
Heterogeneity: FoxN1 and Tissue-Restricted
Gene Expression by Extrathymic,
Endodermally Derived Epithelium
James Dooley, Matthew Erickson and Andrew G. Farr
J Immunol 2009; 183:5042-5049; Prepublished online 28
September 2009;
doi: 10.4049/jimmunol.0901371
http://www.jimmunol.org/content/183/8/5042
Subscription
Permissions
Email Alerts
This article cites 53 articles, 25 of which you can access for free at:
http://www.jimmunol.org/content/183/8/5042.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2009 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
References
The Journal of Immunology
Lessons from Thymic Epithelial Heterogeneity: FoxN1 and
Tissue-Restricted Gene Expression by Extrathymic,
Endodermally Derived Epithelium1
James Dooley,* Matthew Erickson,* and Andrew G. Farr2*†‡
T
he spectrum of self-Ags expressed by medullary thymic
epithelial cells (MTEC)3 plays an important role in maintaining self-tolerance and is remarkably diverse, with a
marked skewing toward molecules that have been associated with
ectodermal, endodermal, and neuroectodermal derivatives (1, 2).
The finding that mutations of the AIRE gene are associated with an
autoimmune syndrome in humans (3) led to the finding that MTEC
from mice lacking functional Aire have a reduced spectrum of
tissue-restricted Ag (TRA) expression and also display features of
autoimmunity (4, 5). Although it is clear that MTEC expression
of some TRAs is strictly Aire-dependent, there are a large number
of TRAs that are expressed via an Aire-independent mechanism
(2). By one estimate, some 90% of the TRAs expressed by MTEC
are Aire-independent (H. Petrie, unpublished observation). Although it is not clear how the expression of Aire-independent
TRAs is regulated, it is widely held that the expression of many
Aire-independent TRAs by MTECs also reflects derepressed tran-
*Department of Biological Structure, †Department of Immunology, and ‡Institute
for Stem Cell and Regenerative Medicine, University of Washington, Seattle, WA
98195
Received for publication April 30, 2009. Accepted for publication August 7, 2009.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by Grant AI09575 from the National Institute of Allergy
and Infectious Diseases, National Institutes of Health. The content is solely the responsibility of the authors and does not necessarily represent the official views of the
National Institute of Allergy and Infectious Diseases.
2
Address correspondence and reprint requests to Dr. Andrew G. Farr, Department of
Biological Structure, Box 357420, School of Medicine, University of Washington,
Seattle, WA 98195-7420. E-mail address: [email protected]
3
Abbreviations used in this paper: MTEC, medullary thymic epithelial cell; TRA,
tissue-restricted Ag; Pth, parathyroid hormone; YFP, yellow fluorescent protein.
Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901371
scription that occurs in terminally differentiated MTEC, similar to
Aire-dependent TRAs (2).
Gaps in our understanding of the differentiation of thymic epithelium have hampered better understanding of TRA expression
by thymic epithelium and the mechanisms that regulate this activity. The thymus is derived from endoderm of the third pharyngeal
pouch, where domains of endoderm that give rise to thymus and
parathyroid are demarcated by the expression of FoxN1 and Gcm2,
respectively (6, 7), and do not receive a contribution of pharyngeal
ectoderm (8). It is clear that the activity of FoxN1 is required for
productive thymic epithelial differentiation, as evidenced by the
nonfunctional thymic rudiment of nude mice (9), but the nature of
contribution of FoxN1 to this process is not clear. Based on the
thymus-appropriate mediastinal location of an epithelial structure
in the nude mouse, it is thought that the initial specification of
pharyngeal endoderm to a thymic fate is FoxN1-independent, and
that FoxN1 is required for the subsequent differentiation of thymus-restricted cells to proceed (10, 11). However, the striking respiratory character of the nude thymic rudiment and the lack of any
molecular features of this rudiment indicative of thymic lineage
specification (12) would be consistent with a role for FoxN1 in the
specification of endoderm to the thymic lineage.
Cortical and medullary epithelial compartments have been commonly defined on the basis of reciprocal patterns of keratin expression, where cortical thymic epithelium express the K8/K18
simple keratin pair and medullary thymic epithelium have been
defined by their expression of K5/K14, a keratin pair usually associated with basal progenitor or transit amplifying epithelial cells
within stratified and pseudostratified epithelia (13, 14). A subset of
thymic epithelium at the corticomedullary junction that coexpress
K5 and K8 have been proposed to represent the immediate precursors to the K8⫹K5/14⫺ cortical thymic epithelium and the
K8⫺K5/K14⫹ MTEC (15–17). Although it is clear that single
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Modeling of thymic epithelial differentiation has been guided by several important underlying assumptions. One is that within
epithelial tissues derived from pharyngeal endoderm, FoxN1 expression is signature for the thymic epithelial lineage. Another is
that expression of tissue-restricted Ag (TRA) is a unique feature of thymic epithelium. In this murine study, we evaluate the thymic
expression of a subset of TRA, parathyroid hormone, calcitonin, and thyroglobulin, as part of an effort to better define the
heterogeneity of medullary thymic epithelial cells. In this study, we demonstrate that both conventional and cystic epithelial cells
display a history of FoxN1 expression using a cre-lox approach. We also document that extrathymic epithelial tissues that originate
from pharyngeal endoderm also have a history of FoxN1 expression, indicating that FoxN1 expression per se is not a signature
for the thymic lineage and suggesting that FoxN1 expression, whereas necessary for thymic epithelium, development, is not
sufficient for this process to occur. Both cystic and conventional medullary thymic epithelial cells express these TRAs, as do
extrathymic epithelial tissues that are not usually considered to be sources of these molecules. This finding supports the proposition
that promiscuous gene expression is not unique to the thymus. Furthermore, the pattern of promiscuous gene expression in these
extrathymic epithelia is consistent with developmental regulation processes and suggests that it is premature to discard the
possibility that some promiscuous gene expression in the thymus reflects normal differentiation programs of epithelia. The
Journal of Immunology, 2009, 183: 5042–5049.
The Journal of Immunology
thymic lineage specification among epithelial tissues derived from
pharyngeal endoderm. We also demonstrate instances in which
extrathymic tissue express Pth and calcitonin, which suggests that
mechanisms that lead to TRA expression are not unique to thymic
epithelium. Finally, in the course of these studies, we document
multiple instances in which parathyroid tissue is ectopically associated with the thymus. Features of the ectopic parathyroid tissue
are consistent with aberrant segregation of pharyngeal endoderm
during thymic organogenesis and suggest one possible mechanism
for the formation of some thymic cysts.
Materials and Methods
Mice
C57BL/6 mice were obtained from Charles River Breeding Laboratories,
FoxN1-cre mice (30) were provided by Dr. N. Manley (University of Georgia, Athens, GA), and the ROSA-stopflox-yellow fluorescent protein (YFP)
mice (31) were obtained from Dr. A. Y. Rudensky (Memorial Sloan-Kettering Cancer Center, New York, NY), now available from The Jackson
Laboratory (http://jaxmice.jax.org/index.html). All mice were maintained
in the University of Washington Specific Pathogen Free facility and used
in accordance with protocols approved by the University of Washington
Institutional Animal Care and Use Committee.
Ab production
Primary Abs for immunohistochemistry included polyclonal goat or rabbit
Abs to Aire (M-300; SC-33189, D-17; SC-17986), Pth (N18, SC-9676),
thyroglobulin (M-20, SC-7837), and calcitonin (G-18, SC-7784) from
Santa Cruz Biotechnology. The rabbit anti-K5 and anti-K14 Abs were purchased from Covance; monoclonal anti-K8 (Troma-1) (32) was obtained
from the Developmental Studies Hybridoma Bank (http://dshb.biology.
uiowa.edu/). The Troma-1 hybridoma was exhaustively grown in medium
supplemented with 10 mM glucose to maximize Ab concentration in the
supernatant. Anti-claudin Abs were purchased from Zymed Laboratories
and anti-surfactant C Ab was purchased from Chemicon International. Abs
raised against GFP, which are highly cross-reactive with YFP, were purchased from Rockland Immunochemicals. Secondary reagents for immunofluorescence microscopy (donkey anti-goat IgG, donkey anti-rabbit IgG,
goat anti-rabbit IgG, goat anti-rat IgG, chicken anti-rat IgG and streptavidin-conjugated with Alexa Fluor 488, Alexa Fluor 546, or Alexa Fluor
647) were purchased from Molecular Probes.
Immunohistochemistry
Different tissue processing protocols were used to accommodate the requirements of the reagent Abs used. Wherever possible, aldehyde fixation
was used to minimize the diffusion artifacts introduced by acetone fixation.
Frozen sections collected on microscope slides were fixed in 0.1 M cacodylate buffer, pH (7.4), containing 4% paraformaldehyde and 5 mM CaCl2.
In some instances, thymus tissue was perfused via the heart with 10 ml of
1% paraformaldehyde fixative or immersed in this fixative for 4 –16 h at
4°C, then washed repeatedly in PBS before cryoprotection (30% sucrose in
PBS) and embedment in OCT (Sakura Finetech) for cryosectioning. This
latter approach without Ag retrieval was used for detection of YFP expression. Samples were mounted to harvest thymic sections in the coronal plane
to maximize thymic area. Ag retrieval was accomplished by incubating
paraformaldehyde-fixed sections in 20 mM Tris buffer (pH 9.0) for 25 min
in a steam device (HS2776; Black&Decker) and then allowing the sections
to cool for ⬃45 min before washing in PBS and subsequent processing.
Monoclonal Abs were used as undiluted hybridoma supernatants, whereas
polyclonal Abs were used at dilutions of 1/500-2000.
The anti-hormone and anti-Aire Abs worked best with aldehyde fixation
and Ag retrieval as described or with paraffin sections. For paraffin sections, tissue was fixed in modified Carnoy’s fixative (60% ethanol, 30%
formalin solution (37%), and 10% galacial acetic acid) overnight at 4°C,
then dehydrated through ascending concentrations of ethanol, followed by
standard paraffin embedment. Following removal of paraffin and rehydration, the sections were subjected to Ag retrieval as described.
After Ag retrieval, aldehyde-fixed sections were incubated in PBS containing 10% v/v of normal mouse serum for 1 h before application of
primary Abs (polyclonal Abs diluted in hybridoma supernatant or PBS
containing 1% (w/v) BSA and 10% normal mouse serum. After incubation
with primary Abs overnight, sections were washed repeatedly with PBS
and then incubated with appropriate secondary Abs diluted in PBS containing 1% BSA (w/v) and 10% (v/v) of normal sera matched to the secondary Abs used. After 1–1.5 h of incubation, sections were again washed
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
epithelial progenitor cells can contribute to both cortical and medullary epithelial compartments in fetal (18) and postnatal (19)
mice, the binary aspect of this thymic epithelium differentiation
model based on keratin expression has been recently called into
question by demonstrations that the bulk of the MTEC population
express both K8 and K5/K4 (20 –22).
The differentiation program of MTEC is of particular interest
because it is related to the ability of these cells to expression of
TRAs and to mediate self-tolerance. In addition to the patterns of
keratin expression described above, MTEC differentiation has also
been modeled on the phenotype of differentiating dendritic cells
for which the expression of CD80 and high levels of MHC class II
has been considered to represent terminally differentiated MTEC
(2). The preferential expression of Aire and Aire-dependent TRAs
by sorted MTEC bearing a CD80⫹MHCIIhigh phenotype (2, 23)
and the demonstration that MTEC with this phenotype display
low levels of DNA synthesis and are rapidly eliminated (21)
have contributed to a model in which Aire and Aire-dependent
TRA expression are features of end-stage terminally differentiated MTEC. This view of MTEC differentiation, in which the
spectrum of MTEC heterogeneity would be largely defined by
phenotypic changes and TRA expression, does not account for
organizational and morphological heterogeneity of MTEC.
There are a number of important unresolved issues regarding
the phenomenon of TRA expression as it relates to thymic epithelium differentiation. One concerns the relationship between
TRA expression and MTEC populations that are not accommodated by prevailing views of MTEC differentiation. Another
issue is whether TRA expression is unique to thymic epithelium
or whether it represents a more general property of epithelia
that has acquired functional significance in the thymus because
it occurs in a context in which TRA expression would have
important immunological consequences. We have previously
suggested that expression of some TRAs could represent transient transcription of “irrelevant” genes during epithelial differentiation (20, 22, 24). According to this view, TRA expression would not be restricted to thymic epithelium.
In this study we have begun to address some of these questions
by evaluating the expression of subset of TRAs in the thymus. The
TRAs examined, parathyroid hormone (Pth), calcitonin, and thyroglobulin are hormones that are considered to be signature for
parathyroid gland, parafollicular cells of the thyroid gland, and
follicular epithelial cells of the thyroid gland, respectively (25–27).
Thymic expression of Pth and calcitonin is considered to be Aireindependent (GDS2274, Gene Expression Omnibus; www.ncbi.
nlm.nih.gov/projects/geo/), whereas MTEC expression of thyroglobulin appears to be partially Aire-dependent (28, 29). These
TRAs were of particular interest because the tissues that express
them are derived from pharyngeal endoderm, and thus have a developmental origin similar to the thymus. To gain a better understanding of the basis for observed heterogeneity of MTEC, we
evaluated their history of FoxN1 expression using a cre-lox approach. We also evaluated extrathymic tissues for evidence of
“promiscuous” gene expression to test the hypothesis that this
property is unique to thymic epithelium. We report that there is
extensive heterogeneity in terms of the MTEC populations that
express these TRAs. In addition to conventional MTEC, epithelial
cells lining thymic cysts also expressed Pth, calcitonin, and thyroglobulin. Despite obvious morphological and organizational differences, conventional MTEC, and the cyst epithelium displayed
considerable phenotypic similarities and both displayed a history
of FoxN1 expression. However, parathyroid and follicular thyroid
epithelial cells also displayed a history of FoxN1 expression, indicating that FoxN1 expression per se is not a definitive marker for
5043
5044
MULTIPLE SOURCES OF TRA IN THE MURINE THYMUS
and then coverslips were applied with Fluoromount G (Southern Biotechnology Associates). For nuclear counterstaining with DAPI (4⬘,6-diamidino-2-phenylindole), it was included in the secondary Ab solution at
0.1 ␮g/ml. Images were captured with a fluorescence microscope equipped
with a monochrome digital CCD camera (Orca-ER) and assembled into
RGB images with Photoshop (Adobe).
Analysis of gene expression
Results
Heterogeneity of MTEC expressing Pth, calcitonin, and
thyroglobulin
Imunohistochemisty was used to characterize the cellular
sources of these hormones within the thymus. The specificity of
the anti-Pth Ab is demonstrated in Fig. 1a, in which parathyroid
tissue was labeled and adjacent thyroid tissue was not. MTEC
that expressed Pth also expressed K8 and K14 (Fig. 1b) and/or
K8 and K5 (Fig. 1c). Cystic epithelial structures that were universally K8⫹ and variably expressed K14 or K5 also expressed
Pth (Figs. 1, d and e). Within individual cysts, the organization
of epithelium ranged from columnar/pseudostratified columnar
to squamous. Pth immunoreactivity was detected in many of
these cysts and with more uniformity among epithelial domains
that were columnar/pseudostratified, although scattered, more
squamous epithelial cells were also noted (Fig. 1, d and e). The
conventional Pth-positive MTEC were variably claudin3-positive (Fig. 1f), and variably expressed claudin4 (Fig. 1g).
The epithelium of the cysts, including Pth-positive cells, were
also uniformly claudin3-positive (Fig. 1h) and showed some heterogeneity in claudin4 expression-in some instances, Pth-positive
lining cells expressed little, if any, claudin4 (Fig. 1i). MTECs that
expressed Pth were very rarely Aire-positive (Fig. 1j). The overlapping claudin and Pth coexpression and lack of Aire and Pth
codistribution suggested that the pattern of Aire and claudin expression in postnatal MTEC was different from that of fetal
MTEC, in which a high degree of claudin and Aire coexpression
was reported (35). The extent of Aire coexpression with either
claudin3 (Fig. 1k) or claudin4 (Fig. 1l) was not particularly high in
the postnatal thymus. Although double positive MTEC were evident, MTEC expressing either Aire or claudins alone were also
present. In contrast to conventional MTEC, epithelial cells lining
the cysts did not express Aire (Fig. 1m).
Evaluation of calcitonin expression used an Ab that selectively
labeled the parafollicular cells of the thyroid gland (Fig. 2a). Calcitonin was expressed by MTEC that were K8⫹K14⫹ (Fig. 2b) or
FIGURE 1. Pth expression by thymic epithelium. a, Specificity of antiPth Ab. Ab labels parathyroid tissue (PT) but not adjacent thyroid tissue
(T) with Pth (red); K8 (blue). b, Expression of Pth (red) by K14⫹/K8⫹
(green/blue) MTEC. c, Expression of Pth (red) by K5⫹/K8⫹ (green/blue)
MTEC. d, Cyst epithelium expresses Pth (red) expression in regions of
columnar/pseudostratified epithelium (arrows); K14 (green) or K8 (blue).
e, Another cyst showing Pth-positive (red) cells with patchy distribution;
K5 (green) or K8 (blue). f, Expression of Pth by claudin3-positive MTEC.
Note Pth-positive cells display a range of claudin3 expression. g, Claudin4positive (green) MTEC expression with Pth (red). Note that Pth expression
(red) is not associated with MTEC expressing high levels of claudin4. h,
Cystic epithelium is uniformly claudin3-positive (green). K8 labeling omitted to demonstrate claudin3 labeling. i, Cystic epithelium is variably claudin4-positive. Although most cysts were claudin4-positive, there was considerable variability of claudin4 expression (green) within individual cysts.
Red ⫽ Pth; green ⫽ claudin4. j, Low coincidence of Pth (red) and Aire
(green). k, Variable overlap of claudin3 (green) and Aire (red) expression
by MTEC; K8 (blue). l, Variable overlap of claudin4 (green) and Aire (red)
expression by MTEC; K8 (blue). m, Epithelial cells lining thymic cysts do
not express Aire⫺ (red); K8 (blue). Scale bar represents 50 microns.
K8⫹K5⫹ (data not shown). There was also regional calcitonin labeling in the epithelium lining the cysts (Fig. 2c), although the
staining was less punctate than the labeling observed in conventional MTECs. The Ab used to detect thyroglobulin strongly labeled the contents of thyroid follicles, labeled the surrounding follicular epithelial cells less strongly, and failed to label the adjacent
parathyroid tissue (Fig. 2d). Simultaneous localization of Pth in
adjacent parathyroid tissue also demonstrated that the secondary
Abs used in these studies were species specific. MTECs expressing
thyroglobulin were often organized in multicellular clusters as previously described (36). There was considerable overlap among
MTEC expressing thyroglobulin and calcitonin (Fig. 2e) or thyroglobulin and Pth (Fig. 2f). For technical reasons involving two
primary Abs derived from the same species, we were not able to
simultaneously assess the expression of calcitonin and Pth. Many
of the epithelial lining cells of the cyst that were thyroglobulinpositive were also Pth-positive (Fig. 2g). The relationship between
thyroglobulin and Aire expression by individual MTEC was variable. In some instances, no coexpression was evident (Fig. 2h),
whereas there was coexpression of Aire and thyroglobulin in other
cells (Fig. 2i).
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Pieces of esophagus and trachea were carefully dissected to exclude cervical thymic tissue (33, 34) and also excluded a 1-mm interval of esophagus and trachea immediately caudal to the parathyroid/thyroid tissue to
avoid contamination of these samples with thyroid/parathyroid tissue. Parathyroid tissue and thyroid tissue was separated from larynx, but no attempt
was made to separate parathyroid from thyroid tissue. Parathyroid and
thyroid tissue was examined with a dissection microscope to remove any
tissue that might correspond to ectopic thymic tissue. The fetal mix sample
was whole E14 embryos. Total RNA from these tissues was isolated with
Absolute RNA RT-PCR kits (Stratagene) and used to generate cDNA.
Polymerase chain reactions were performed with the following primer
sets: Pth (forward) catcagctgtctggtttactcca (reverse) tcaaaaaaattcccaagt
ttcattac; thyroglobulin (forward) tggaagcaagtataccggttcct (reverse) tgca
gagcttcccataagcag; calcitonin (forward) tcctgaagttctcccctttcc (reverse)
gttgccaaaatgggattggt; HPRT (forward) gttggatacaggccagactttgttg (reverse) gagggtattctggcctatggct; E-cadherin (forward) aggaaatgcacccctc
caat (reverse) gcatcttagagaacggtttc; and FoxN1 (forward) ggactgacctgg
atgctatcaac (reverse) ggcaacatggaggatgacgt.
The following conditions were used for all PCR: at 3-min start at 94°C,
with denaturation (94°C) and annealing (60°C) periods of 30 s each, followed by an extension period (72°C) of 45 s. Magnesium concentration
was 2.5 mM. Real-time PCR was performed with an ABI instrument, and
cycle threshold determinations were determined according to the manufacturer’s recommendations.
The Journal of Immunology
5045
FIGURE 3. Three examples of ectopic parathyroid tissue in the thymus
with close proximity to cystic structures. a and b, Ectopic parathyroid
tissue resides in invaginations of the capsule (arrows). Cysts expressing Pth
(red) are indicated by asterisks; K14 (green) and K8 (blue). c, Two small
pieces of ectopic parathyroid tissue (arrows) aligned along a cleft continuous with the capsule. One piece is immediately adjacent to a thymic cyst
(asterisk) and lining cells that simultaneously express Pth (red) and thyroglobulin (green) (arrowhead); K8 (blue). Scale bar represents 50 microns.
Epithelium of thymic cysts and extrathymic tissues derived from
pharyngeal endoderm have a history of FoxN1 expression
FIGURE 2. Thymic expression of calcitonin and thyroglobulin. a,
Specificity of anti-calcitonin Ab. Ab labels parafollicular cells, but not
follicular epithelial cells of thyroid tissue with calcitonin (red) and K8
(blue). b, K14⫹K8⫹ (green/blue) MTEC express calcitonin (red) with a
punctate distribution pattern. c, Cystic epithelium expresses calcitonin
(red) with K14 (green) K8 (blue). d, Specificity of anti-thyroglobulin Ab.
Ab labels the lumen and associated cells of thyroid follicles in thyroid
tissue (T), but not parafollicular thyroid cells or parathyroid tissue (PT).
There is no cross-reactivity of secondary Abs with Pth (red), thyroglobulin
(green), and K8 (blue). e, Simultaneous detection of calcitonin (green) and
Pth (red) reveals coexpression by MTEC K8 (blue). f, Expression of thyroglobulin (green) and Pth (red) by MTEC. The clustered distribution of
thyroglobulin-positive MTEC is evident with K8 (blue). g, An example of
thyroglobulin (green) and Pth (red) expression by cystic epithelium with
K8 (blue). h and i, Variable coexpression of Aire (red) and thyroglobulin
(green) with K8 (blue). j, An MTEC coexpressing surfactant C (green) and
Pth (red) with K8 (blue). k, Expression of Surfactant C by cyst lining cells.
Most of the lining cells in this of section coexpress surfactant C (green) and
Pth (red) with K8 (blue).
As we had previously described the expression of surfactant C
by MTEC and epithelium lining thymic cysts (37), we wanted
to determine whether the thymic epithelium expressing Pth and
surfactant C represented separate, nonoverlapping populations. As
shown in Fig. 2, j and k, both conventional and cyst-associated
thymic epithelium can coexpress surfactant C and Pth.
Ectopic parathyroid tissue frequently associated with thymic
cysts
During the course of evaluating Pth expression in the thymus, we
observed ectoptic parathyroid tissue located in clefts of the thymic
capsule that penetrated toward the thymic medulla. Examples from
three different thymic samples are depicted in Fig. 3. Quite often,
cysts were located at the base of the clefts as previously described
(37) and in close proximity to the ectopic parathyroid tissue. The
These thymic cysts may represent remnants of pharyngeal
endoderm that have not been incorporated during thymic organogenesis and hence have not undergone thymic lineage specification. Alternatively, they may contain epithelial cells that are progeny of pharyngeal endoderm that has previously undergone thymic
specification and hence would represent an alternative differentiation outcome of committed thymic epithelial progenitors. Based
on the prevalent view that FoxN1 expression is a hallmark of the
thymic lineage among tissues derived by pharyngeal endoderm,
evidence that the epithelium lining the cysts has a history of
FoxN1 expression would indicate that the cysts arose from epithelium previously committed to the thymic lineage. To address this
question, we examined thymic tissue from mice expressing
FoxN1-cre (30) and ROSA-stopflox-YFP (31). Consistent with previous flow cytometric analysis of enzymatically dissociated thymic
stroma from these mice, (38), immunohistochemical detection of
YFP with anti-GFP Abs showed widespread expression by thymic
epithelium and included the epithelium lining cysts (Fig. 4, a and
b). Association of claudin4 (Fig. 4a) and K14 (Fig. 4b) with the
labeled cysts indicated they had a medullary location. Although
this finding was consistent with the possibility that the cyst-lining
cells were derived from thymic lineage-specified epithelium, evaluation of other tissues from the same mice revealed other tissues
derived from pharyngeal endoderm also displayed anti-GFP reactivity. Labeling was seen in parathyroid (Fig. 4, c–f), thyroid (Fig.
4, g and h), and by scattered epithelial cells lining the trachea (data
not shown) in tissue samples from four individual mice. The area
of parathyroid tissue that shows a history of FoxN1 expression
displayed the same cellular organization of surrounding parathyroid tissue (Fig. 4, d and f) and clearly lacked the previously described organization of ectoptic thymic tissue (33, 34). Similarly,
epithelial cells in the thyroid with a history of FoxN1 expression
displayed the follicular epithelial organization characteristic of that
tissue (Fig. 4, g and h). Labeling was not observed when the
anti-GFP primary Ab was replaced with normal rabbit Ig (Fig. 4i)
or when anti-GFP primary Ab and appropriate secondary Abs were
applied to tissue of Rosafloxstop-YFP mice (Fig. 4j). The patchy
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
epithelial cells lining the cyst in the vicinity of the parathyroid
tissue were often found to express Pth and in one case, thyroglobulin as well (Fig. 2c). Although subcapsular PTH-producing cells
in the thymus have been previously described (25), the association
of these cells with cystic structures was not appreciated.
5046
pattern of FoxN1 expression randomly dispersed in these tissues
would be consistent with a clonal, transient, and perhaps stochastic
expression of FoxN1 by thyroid or parathyroid epithelial cells at
intermediate stages of differentiation. Comparison of cycle threshold (Ct) values from real-time PCR analysis of cDNA from thymus, a mixture of thyroid and parathyroid tissue, and salivary
gland indicated that there was modest transcription of FoxN1 in
thyroid/parathyroid tissue. Normalizing FoxN1 expression to Ecadherin within each tissue sample, the threshold value for parathyroid/thyroid tissue was ⬃12% of the value obtained for thymus,
whereas a FoxN1 signal was not detected in salivary gland at 40
cycles. Although we cannot exclude the possibility that ectopic
thymic tissue might contribute to this signal, microscopic examination of the thyroid/parathyroid complex did not reveal the small
whitish structures indicative of ectopic thymic tissue. As thyroid
and parathyroid tissue was pooled in these analyses, the relative
expression of FoxN1 in these two tissues was not determined.
These real-time PCR data provide qualitative corroborating support for the immunohistochemical approach described and indi-
FIGURE 5. Extrathymic epithelia express TRA. a, Suprabasal epithelial
cells (esophagus), defined by low levels of K5 expression (green), express
Pth (red). b, Claudin3 and Pth as markers of epithelial differentiation in the
esophagus. Claudin3 expression (green) defines suprabasal epithelial cells
that do not express Pth (red); Pth expression localizes to epithelial cells that
have down-regulated claudin3 expression. c, Tracheal epithelium demonstrating Pth expression (red) by K8⫹K5⫺ epithelium (blue/green) in this
pseudostratified columnar epithelium. d, Pth expression by claudin3-positive epithelium of the lumen and submucosal glands of the trachea. e,
Epithelium of tracheal submucosal glands express calcitonin with Pth (red),
K5 (green), or K8 (blue). Scale bar represents 50 microns.
cates that some of the GFP signal observed corresponds to epithelial cells actively transcribing FoxN1.
Thymus is not unique in expressing TRA ectopically
It has been widely assumed that TRA expression is a unique feature of thymic epithelium. Although this assumption seems reasonable for the subset of TRAs that are Aire-dependent because
Aire expression is restricted to thymic epithelium (22, 39 – 41),
there has been little assessment of the expression of TRAs by
extrathymic tissues. If, as we have suggested, expression of some
TRAs reflect a general property of transient transcriptional activity
of epithelial cells discrete stages of differentiation, other epithelial
tissues would be predicted to also express gene products that are
not associated with the primary function of that tissue. To begin
exploration of this question, we examined the expression of Pth,
calcitonin, and thyroglobulin in other epithelia, focusing attention
on epithelial tissues that have a pharyngeal/ventral foregut
endodermal derivation. As shown in Fig. 5a and b, stratified squamous epithelium of the esophagus expressed Pth. Using either patterns of K5 or K14 expression to delineate the basal progenitor and
transit amplifying epithelial compartment (Fig. 5a and data not
shown), Pth expression was clearly associated with suprabasal and
presumably postmitotic epithelial compartment in the stratified
squamous epithelium of the esophagus. The stratified nature of
esophageal epithelium facilitates staging epithelial cells at different
stages of differentiation and it was possible to relate patterns of
claudin3 expression to esophageal epithelial differentiation and Pth
expression. As shown in Fig. 5b, claudin3 was expressed by the
suprabasal epithelial cells that are more mature than the K5high
basal cells, but less mature than the adjacent, more luminal layer of
epithelial cells that that expressed Pth. It is noteworthy that stratified claudin and Pth and expression in the esophagus appears to
define discrete stages of differentiation of a single epithelial lineage, and by doing so, provides an alternative interpretation to the
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 4. History of FoxN1 expression demonstrated with FoxN1-cre
ROSA26floxstop YFP mice. a and b, Thymic tissue processed to demonstrate YFP expression immunohistochemically with highly cross-reactive
anti-GFP Abs. There is widespread YFP expression in both cortical and
medullary compartments, including epithelium lining cysts. a, Claudin4
expression (red) is associated with MTEC and with some cystic epithelial
cells; GFP (green). b, MTEC and some cystic epithelial cells express K14
(red) and GFP (green). c–f, Some cells of the parathyroid gland display a
history of FoxN1 expression. Parathyroid tissue from two individual mice
is representative of tissue from four mice. Samples have been counterstained with DAPI (red) to provide tissue detail. d and f, Duplicate of c and
e, except the anti-GFP labeling has been removed to demonstrate that areas
of YFP expression (green) have the same tissue organization as adjacent
parathyroid tissue and are not ectopic thymus tissue. g and h, Some cells of
the thyroid gland display a history of FoxN1 expression. Shown are samples from two mice that are representative of tissue from four mice. i,
Thyroid tissue from foxn1cre ROSA26floxstop YFP mice in which the primary anti-GFP Ab has been omitted. j, Representative thyroid tissue form
ROSA26floxstop YFP mice that has been processed for the immunohistochemical demonstration of GFP. Scale bar represents 50 microns.
MULTIPLE SOURCES OF TRA IN THE MURINE THYMUS
The Journal of Immunology
FIGURE 6. Demonstration of Pth and calcitonin message in trachea and
esophagus. cDNA was prepared from the indicated tissues as described in
Materials and Methods and then subjected to RT-PCR analyses. Fetal mix
represents RNA isolated from whole E14 embryos. In H2O lane, cDNA
template was omitted.
Discussion
This study raises a number of important issues regarding several
key aspects of thymic epithelium differentiation. One concerns the
manner in which FoxN1 regulates thymic epithelium differentiation. A two-stage model of thymic epithelium differentiation was
proposed in which initial specification of pharyngeal endoderm to
a thymic lineage was independent of FoxN1 and that FoxN1
played an obligate role in subsequent program in thymic epithelium differentiation (10). Based on this model, the mediastinal epithelial rudiment in nude mice has been considered to consist of
committed thymic epithelial progenitors that have been arrested in
their lineage-restricted differentiation program (11). Invoking
FoxN1 as thymic-restricted regulator of epithelial differentiation
has led to the conclusion that FoxN1 expression represents definitive proof that a thymic lineage specification has occurred
within the context of epithelial tissues derived from pharyngeal
endoderm. However, the demonstration here that FoxN1 expression is also associated with parathyroid and thyroid epithelium
argues that FoxN1 expression per se is not a definitive marker of
thymic epithelial lineage. It is likely that quantitative and temporal
features of FoxN1 expression or combinatorial signaling pathways
acting in concert with FoxN1 will be critical determinants in defining thymic lineage specification. For instance, a transient expression of FoxN1 in these extrathymic tissues may not be sufficient to specify thymic lineage commitment. In this context, it is
also worth noting that human thyroid and kidney exhibit low transcription levels of the human FoxN1 gene (42).
Because FoxN1 expression cannot be considered as a signature
marker for thymic epithelium, the expression of FoxN1 by epithe-
lium comprising the cystic structures within the thymus is not very
informative regarding their derivation. Two nonexclusive possibilities are suggested. The cysts may constitute a minor differentiation pathway of thymic epithelium within the medullary compartment that emerges after lineage specification has occurred or they
may be remnants of nonspecified pharyngeal endoderm that has
partitioned with the thymic anlage during development. A circumstantial case can be made for the latter possibility. The evagination
of the epithelial cells representing the thymic domain of the third
pharyngeal pouch retains continuity with the overlying pharyngeal
endoderm via a thymopharyngeal duct until this connection is lost
upon further differentiation (reviewed in Ref. 43). The presence of
cysts in E16 fetal thymi (37) and the regular, but minor contribution of cysts to the postnatal thymus (36, 37, 44) are both consistent with the possibility that some of the thymic cysts are remnants
of thymopharyngeal ducts that persist in the postnatal thymus. A
lack of precision during the partitioning of thymic and parathyroid
primordia from thymopharyngeal duct endoderm would provide an
explanation for the frequent occurrence of thymic tissue in the
neck or associated with thyroid/parathyroid tissue (33, 34, 45, 46),
the association of parathyroid hormone-producing cells with the
thymus (Ref. 25 and this report), and the close proximity of ectopic
parathyroid tissue and cystic epithelial structures in the thymus
(Ref. 47 and this study). In this last situation, parathyroid tissue
associated with the thymus may represent progeny of third pharyngeal pouch endoderm that was specified to a parathyroid fate,
but failed to partition from the pharyngeal endoderm forming the
thymopharyngeal duct, and thus remained associated with the developing thymus.
A second important issue raised in our study concerns the mechanism responsible for TRA expression by thymic epithelium. The
preferential association of Aire-dependent TRAs with Aire-positive MTEC and the demonstration that this population displays
BrdU labeling properties of cells that are postmitotic with rapid
turnover (21) support a model in which Aire-dependent TRA expression is a feature of terminally differentiated MTEC (1). Expression of some Aire-independent TRA expression is also thought
to reflect the activity of mature MTEC, whereas others appear to be
expressed by less mature MTEC (2). In either case, it has been
assumed that TRA expression is a unique feature of thymic epithelium. We have proposed that some TRAs expressed by MTEC
may reflect a general feature of epithelial differentiation in which
epithelial cells in the course of their differentiation program would
transiently transcribe genes that are normally signature features of
other epithelia (20, 22, 24). This latter view does not consider the
ability to express TRAs to be an intrinsic feature unique to thymic
epithelium. The proposal that TRA expression may be a general
feature of epithelial differentiation is consistent with the demonstration here that epithelium of the trachea and esophagus can also
express Pth and calcitonin. In the case of esophageal epithelium,
where the stratified organization reflects progressive differentiation, expression of Pth is clearly associated with a more luminal
and distal stage of epithelial differentiation. The expression of Pth
and calcitonin by tracheal epithelium and associated submucosal
glands represents another instance of extrathymic TRA expression.
This expression is intriguing because submucosal gland epithelium
is thought to contain relatively undifferentiated cells with progenitor activity (48).
The demonstration in this study that esophagus and trachea express Pth or calcitonin provides proof-of-principle that TRA expression is not unique to the thymus. Furthermore, the demonstration in this study that TRA expression may be restricted to specific
stages of differentiation in extrathymic epithelia raises the possibility that the apparent unique capacity of thymic epithelium to
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
model in which claudin expression in the thymus defines different
lineages of epithelium (35).
Pth was also detected in tracheal epithelium. Scattered luminal
K8⫹K14⫺ epithelial cells displayed strong apical anti-Pth labeling
(Fig. 5c) and there was also diffuse Pth staining associated with the
epithelium of the submucosal glands. Both the submucosal glands
and the luminal epithelium were uniformly claudin3-positive (Fig.
5d). Calcitonin was not detected in esophageal epithelium, but
similar to Pth, was expressed by the epithelium of the tracheal
submucosal glands (Fig. 5c). These immmunohistochemical demonstrations of ectopic hormone/TRA expression in esophagus and
trachea were confirmed by RT-PCR analysis in which trachea and
esophagus were found to express message for Pth and calcitonin
(Fig. 6).
5047
5048
regulated. This would parallel other instances in which a TRA
expressed by thymic epithelium is not regulated in the same manner as in the corresponding target tissue (23, 52, 53).
The data presented in this study indicate that FoxN1 expression
cannot serve as a definitive marker of thymic epithelial differentiation among derivatives of pharyngeal endoderm, thereby leaving
the field in search of molecular signatures unique for the thymic
lineage. These data also challenge the view that promiscuous gene
expression is a unique feature of thymic epithelium and indicate
that it may be premature to exclude a developmental basis for any
TRA expression by thymic epithelium.
Disclosures
The authors have no financial conflict of interest.
References
1. Derbinski, J., A. Schulte, B. Kyewski, and L. Klein. 2001. Promiscuous gene
expression in medullary thymic epithelial cells mirrors the peripheral self. Nat.
Immunol. 2: 1032–1039.
2. Derbinski, J., J. Gabler, B. Brors, S. Tierling, S. Jonnakuty, M. Hergenhahn,
L. Peltonen, J. Walter, and B. Kyewski. 2005. Promiscuous gene expression in
thymic epithelial cells is regulated at multiple levels. J. Exp. Med. 202: 33– 45.
3. Bjorses, P., J. Aaltonen, N. Horelli-Kuitunen, M. L. Yaspo, and L. Peltonen.
1998. Gene defect behind APECED: a new clue to autoimmunity. Human Mol.
Genetics 7: 1547–1553.
4. Anderson, M. S., E. S. Venanzi, L. Klein, Z. Chen, S. P. Berzins, S. J. Turley,
H. von Boehmer, R. Bronson, A. Dierich, C. Benoist, and D. Mathis. 2002.
Projection of an immunological self shadow within the thymus by the aire protein. Science 298: 1395–1401.
5. Ramsey, C., O. Winqvist, L. Puhakka, M. Halonen, A. Moro, O. Kampe,
P. Eskelin, M. Pelto-Huikko, and L. Peltonen. 2002. Aire deficient mice develop
multiple features of APECED phenotype and show altered immune response.
Human Mol. Genetics 11: 397– 409.
6. Gordon, J., A. R. Bennett, C. C. Blackburn, and N. R. Manley. 2001. Gcm2 and
Foxn1 mark early parathyroid- and thymus-specific domains in the developing
third pharyngeal pouch. Mech. Dev. 103: 141–143.
7. Griffith, A. V., K. Cardenas, C. Carter, J. Gordon, A. Iberg, K. Engleka,
J. A. Epstein, N. R. Manley, and E. R. Richie. 2009. Increased thymus- and
decreased parathyroid-fated organ domains in Splotch mutant embryos. Dev.
Biol. 327: 216 –227.
8. Gordon, J., V. A. Wilson, N. F. Blair, J. Sheridan, A. Farley, L. Wilson,
N. R. Manley, and C. C. Blackburn. 2004. Functional evidence for a single
endodermal origin for the thymic epithelium. Nat. Immunol. 5: 546 –553.
9. Kindred, B. 1971. Immunological unresponsiveness of genetically thymusless
(nude) mice. Eur. J. Immunol. 1: 59 – 61.
10. Nehls, M., B. Kyewski, M. Messerle, R. Waldschutz, K. Schuddekopf,
A. J. Smith, and T. Boehm. 1996. Two genetically separable steps in the differentiation of thymic epithelium. Science 272: 886 – 889.
11. Blackburn, C. C., C. L. Augustine, R. Li, R. P. Harvey, M. A. Malin, R. L. Boyd,
J. F. Miller, and G. Morahan. 1996. The nu gene acts cell-autonomously and is
required for differentiation of thymic epithelial progenitors. Proc. Natl. Acad. Sci.
USA 93: 5742–5746.
12. Dooley, J., M. Erickson, H. Roelink, and A. G. Farr. 2005. Nude thymic rudiment
lacking functional foxn1 resembles respiratory epithelium. Dev. Dyn. 233:
1605–1612.
13. Moll, R., W. W. Franke, D. L. Schiller, B. Geiger, and R. Krepler. 1982. The
catalog of human cytokeratins: patterns of expression in normal epithelia, tumors
and cultured cells. Cell 31: 11–24.
14. Nelson, W. G., and T. T. Sun. 1983. The 50- and 58-kdalton keratin classes as
molecular markers for stratified squamous epithelia: cell culture studies. J. Cell
Biol. 97: 244 –251.
15. Klug, D. B., C. Carter, E. Crouch, D. Roop, C. J. Conti, and E. R. Richie. 1998.
Interdependence of cortical thymic epithelial cell differentiation and T-lineage
commitment. Proc. Natl. Acad. Sci. USA 95: 11822–11827.
16. Klug, D. B., E. Crouch, C. Carter, L. Coghlan, C. J. Conti, and E. R. Richie. 2000.
Transgenic expression of cyclin D1 in thymic epithelial precursors promotes
epithelial and T cell development. J. Immunol. 164: 1881–1888.
17. Klug, D. B., C. Carter, I. B. Gimenez-Conti, and E. R. Richie. 2002. Cutting
edge: thymocyte-independent and thymocyte-dependent phases of epithelial patterning in the fetal thymus. J. Immunol. 169: 2842–2845.
18. Rossi, S. W., W. E. Jenkinson, G. Anderson, and E. J. Jenkinson. 2006. Clonal
analysis reveals a common progenitor for thymic cortical and medullary epithelium. Nature 441: 988 –991.
19. Bleul, C. C., T. Corbeaux, A. Reuter, P. Fisch, J. S. Monting, and T. Boehm.
2006. Formation of a functional thymus initiated by a postnatal epithelial progenitor cell. Nature 441: 992–996.
20. Gillard, G. O., J. Dooley, M. Erickson, L. Peltonen, and A. G. Farr. 2007. Airedependent alterations in medullary thymic epithelium indicate a role for Aire in
thymic epithelial differentiation. J. Immunol. 178: 3007–3015.
21. Gray, D., J. Abramson, C. Benoist, and D. Mathis. 2007. Proliferative arrest and
rapid turnover of thymic epithelial cells expressing Aire. J. Exp. Med. 204:
2521–2528.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
express TRAs may reflect a bias in TRA analyses. This is because
the same rigor of analyses used to look at fractionated thymic
epithelium has never been applied to comparably fractionated extrathymic epithelia. This issue may be particularly important if the
pool sizes of epithelial cells at different stages of differentiation
vary among different epithelia. When transcriptional profiles of
thymic and extrathymic epithelial cells at comparable stages of
differentiation are evaluated, the differences of TRA expression
between these populations may be more quantitative than qualitative. As there may be multiple mechanisms effecting TRA expression by epithelium, it will be important to follow up these initial
findings with an evaluation of a broader panel of candidate TRAs
and their patterns of expression by other epithelia.
This study also fills in some of the gaps in our knowledge regarding MTEC heterogeneity and the relationship of this heterogeneity to the expression of TRAs. First, despite the striking morphological differences between conventional and cyst-associated
MTEC, they were phenotypically similar. This may reflect a common ancestry or indicate that these phenotypic criteria are common
to multiple epithelia. This phenotypic convergence between conventional MTEC and cyst epithelium extended to the panel of
TRAs that we examined. MTEC expressing Pth, calcitonin, or
thyroglobulin were readily detected and probably occur with a frequency consistent with previous estimates for abundantly expressed TRAs (1) and is in contrast to the rarity of MTEC that
express the Aire-dependent TRA, insulin (49).
Based on the model in which claudin-positive Aire⫺ cells give
rise to claudin-positive Aire-positive cells and other data referenced, indicating that Aire expression is a feature of terminally
differentiated MTEC, the rarity of MTECs coexpressing Aire and
Pth (and by virtue of their high degree of coexpression, calcitonin,
and thyroglobulin as well) would indicate that these TRAs are not
expressed at a terminal stage of differentiation. One could still
invoke the terminal differentiation model by proposing that Aire
expression does not define all terminally differentiated MTEC.
Parenthetically, the finding here that claudin3 expression is restricted to a layer of suprabasal epithelial cells in the esophagus,
and the demonstration that claudin3 expression is restricted to the
granular layer in human epidermis (50) show that claudin3 expression can define discrete stages of epithelial differentiation within a
single lineage of epithelium, and thus provides an alternative interpretation to the consideration of claudin3 as a marker of thymic
epithelium lineage heterogeneity (35).
The extent of Pth, calcitonin, and thyroglobulin coexpression by
individual MTEC was also noteworthy. The demonstrated specificity of the Abs used to detect these molecules, and the demonstration that these molecules are not always coexpressed by MTEC
indicate that the expression patterns reported in this study are accurate. However, immunohistochemistry could not confirm the
thyroglobulin expression by cortical thymic epithelium indicated
by PCR analyses of enzymatic-dissociated thymic epithelium (1).
This may reflect the sensitivity limits of immunohistochemical detection. The previous demonstration that genes promiscuously expressed in the thymus tend to be clustered in the genome and the
proposal that the thymic expression of both Aire-dependent and
Aire-independent TRAs reflects transcriptional “read-through” of
neighboring genes (2) could provide an explanation for the coexpression of Pth and calcitonin, which are closely positioned on
chromosome 7 in the mouse. This mechanism cannot account for
the coexpression of thyroglobulin and either Pth or calcitonin because the thyroglobulin gene is located on chromosome 15. That a
transgene driven by the Pth promoter showed strong expression in
the parathyroid gland but was not expressed in the thymus (51)
suggests that Pth expression in the thymus may not conventionally
MULTIPLE SOURCES OF TRA IN THE MURINE THYMUS
The Journal of Immunology
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
resembles the epithelial thymic rudiment of nude mice. J. Immunol. 175:
4331– 4337.
Liston, A., A. G. Farr, Z. Chen, C. Benoist, D. Mathis, N. R. Manley, and
A. Y. Rudensky. 2007. Lack of Foxp3 function and expression in the thymic
epithelium. J. Exp. Med. 204: 475– 480.
Heino, M., P. Peterson, N. Sillanpaa, S. Guerin, L. Wu, G. Anderson, H. S. Scott,
S. E. Antonarakis, J. Kudoh, N. Shimizu, et al. 2000. RNA and protein expression
of the murine autoimmune regulator gene (Aire) in normal, RelB-deficient and in
NOD mouse. Eur. J. Immunol. 30: 1884 –1893.
Zuklys, S., G. Balciunaite, A. Agarwal, E. Fasler-Kan, E. Palmer, and
G. A. Hollander. 2000. Normal thymic architecture and negative selection are
associated with Aire expression, the gene defective in the autoimmune-polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). J. Immunol. 165:
1976 –1983.
Hubert, F. X., S. A. Kinkel, K. E. Webster, P. Cannon, P. E. Crewther,
A. I. Proeitto, L. Wu, W. R. Heath, and H. S. Scott. 2008. A specific anti-Aire
antibody reveals aire expression is restricted to medullary thymic epithelial cells
and not expressed in periphery. J. Immunol. 180: 3824 –3832.
Gattenlohner, S., H. K. Muller-Hermelink, and A. Marx. 1999. Transcription of
the nude gene (WHN) in human normal organs and mediastinal and pulmonary
tumors. Pathol. Res. Prac. 195: 571–574.
Manley, N. R. 2000. Thymus organogenesis and molecular mechanisms of thymic epithelial cell differentiation. Semin. Immunol. 12: 421– 428.
Khosla, S., and W. K. Ovalle. 1986. Morphology and distribution of cystic cavities in the normal murine thymus. Cell Tissue Res. 246: 531–542.
Miller, J. F. A. P., A. H. E. Marshall, and R. G. White. 1962. The immunological
significance of the thymus. Adv. Immunol. 2: 111–162.
Law, L. W., T. B. Dunn, N. Trainin, and R. H. Levey. 1964. Studies of thymic
function. Wistar Inst. Symp. Monogr. 2: 105–120.
McCluggage, W. G., C. F. Russell, and P. G. Toner. 1995. Parathyroid cyst of the
thymus. Thorax 50: 913–914.
Liu, X., and J. F. Engelhardt. 2008. The glandular stem/progenitor cell niche in
airway development and repair. Proc. Am. Thorac. Soc. 5: 682– 688.
Smith, K. M., D. C. Olson, R. Hirose, and D. Hanahan. 1997. Pancreatic gene
expression in rare cells of thymic medulla: evidence for functional contribution
to T cell tolerance. Intl. Immunol. 9: 1355–1365.
Watson, R. E., R. Poddar, J. M. Walker, I. McGuill, L. M. Hoare, C. E. Griffiths,
and A. O’Neill, C. 2007. Altered claudin expression is a feature of chronic plaque
psoriasis. J. Pathol. 212: 450 – 458.
Imanishi, Y., Y. Hosokawa, K. Yoshimoto, E. Schipani, S. Mallya, A. Papanikolaou,
O. Kifor, T. Tokura, M. Sablosky, F. Ledgard, et al. 2001. Primary hyperparathyroidism caused by parathyroid-targeted overexpression of cyclin D1 in transgenic
mice. J. Clin. Invest. 107: 1093–1102.
Klein, L., M. Klugmann, K. A. Nave, V. K. Tuohy, and B. Kyewski. 2000.
Shaping of the autoreactive T-cell repertoire by a splice variant of self protein
expressed in thymic epithelial cells. Nat. Med. 6: 56 – 61.
Li, H. S., and G. Carayanniotis. 2005. Detection of thyroglobulin mRNA as
truncated isoform(s) in mouse thymus. Immunology 115: 85– 89.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
22. Dooley, J., M. Erickson, and A. G. Farr. 2008. Alterations of the medullary
epithelial compartment in the Aire-deficient thymus: implications for programs of
thymic epithelial differentiation. J. Immunol. 181: 5225–5232.
23. Villasenor, J., W. Besse, C. Benoist, and D. Mathis. 2008. Ectopic expression of
peripheral-tissue antigens in the thymic epithelium: probabilistic, monoallelic,
misinitiated. Proc. Natl. Acad. Sci. USA 105: 15854 –15859.
24. Gillard, G. O., and A. G. Farr. 2005. Contrasting models of promiscuous gene
expression by thymic epithelium. J. Exp. Med. 202: 15–19.
25. Gunther, T., Z. F. Chen, J. Kim, M. Priemel, J. M. Rueger, M. Amling,
J. M. Moseley, T. J. Martin, D. J. Anderson, and G. Karsenty. 2000. Genetic
ablation of parathyroid glands reveals another source of parathyroid hormone.
Nature 406: 199 –203.
26. Kameda, Y., T. Nishimaki, O. Chisaka, S. Iseki, and H. M. Sucov. 2007. Expression of the epithelial marker E-cadherin by thyroid C cells and their precursors during murine development. J. Histochem. Cytochem. 55: 1075–1088.
27. Fagman, H., L. Andersson, and M. Nilsson. 2006. The developing mouse thyroid:
embryonic vessel contacts and parenchymal growth pattern during specification,
budding, migration, and lobulation. Dev. Dyn. 235: 444 – 455.
28. Misharin, A. V., Y. Nagayama, H. A. Aliesky, B. Rapoport, and S. M. McLachlan.
2009. Studies in mice deficient for the autoimmune regulator (Aire) and transgenic
for the thyrotropin receptor reveal a role for Aire in tolerance for thyroid autoantigens. Endocrinology 150: 2948 –2956.
29. Ruan, Q. G., K. Tung, D. Eisenman, Y. Setiady, S. Eckenrode, B. Yi, S. Purohit,
W. P. Zheng, Y. Zhang, L. Peltonen, and J. X. She. 2007. The autoimmune
regulator directly controls the expression of genes critical for thymic epithelial
function. J. Immunol. 178: 7173–7180.
30. Gordon, J., S. Xiao, B. Hughes, III, D. M. Su, S. P. Navarre, B. G. Condie, and
N. R. Manley. 2007. Specific expression of lacZ and cre recombinase in fetal
thymic epithelial cells by multiplex gene targeting at the Foxn1 locus. BMC Dev.
Biol. 7: 69.
31. Srinivas, S., T. Watanabe, C. S. Lin, C. M. William, Y. Tanabe, T. M. Jessell, and
F. Costantini. 2001. Cre reporter strains produced by targeted insertion of EYFP
and ECFP into the ROSA26 locus. BMC Dev. Biol. 1: 4.
32. Brulet, P., C. Babinet, R. Kemler, and F. Jacob. 1980. Monoclonal antibodies
against trophectoderm-specific markers during mouse blastocyst formation. Proc.
Natl. Acad. Sci. USA 77: 4113– 4117.
33. Dooley, J., M. Erickson, G. O. Gillard, and A. G. Farr. 2006. Cervical thymus in
the mouse. J. Immunol. 176: 6484 – 6490.
34. Terszowski, G., S. M. Muller, C. C. Bleul, C. Blum, R. Schirmbeck, J. Reimann,
L. D. Pasquier, T. Amagai, T. Boehm, and H. R. Rodewald. 2006. Evidence for
a functional second thymus in mice. Science 312: 284 –287.
35. Hamazaki, Y., H. Fujita, T. Kobayashi, Y. Choi, H. S. Scott, M. Matsumoto, and
N. Minato. 2007. Medullary thymic epithelial cells expressing Aire represent a
unique lineage derived from cells expressing claudin. Nat. Immunol. 8: 304 –311.
36. Farr, A. G., J. L. Dooley, and M. Erickson. 2002. Organization of thymic medullary epithelial heterogeneity: implications for mechanisms of epithelial differentiation. Immunol. Rev. 189: 20 –27.
37. Dooley, J., M. Erickson, and A. G. Farr. 2005. An organized medullary epithelial
structure in the normal thymus expresses molecules of respiratory epithelium and
5049