The IgA/IgM Receptor Expressed on a
Murine B Cell Lymphoma Is Poly-Ig
Receptor
This information is current as
of June 17, 2017.
Julia M. Phillips-Quagliata, Samir Patel, Jing-Kang Han,
Sergei Arakelov, T. Dharma Rao, Marc J. Shulman, Shafie
Fazel, Ronald B. Corley, Margaret Everett, Michel H. Klein,
Brian J. Underdown and Blaise Corthésy
References
Subscription
Permissions
Email Alerts
This article cites 67 articles, 37 of which you can access for free at:
http://www.jimmunol.org/content/165/5/2544.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2000 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
J Immunol 2000; 165:2544-2555; ;
doi: 10.4049/jimmunol.165.5.2544
http://www.jimmunol.org/content/165/5/2544
The IgA/IgM Receptor Expressed on a Murine B Cell
Lymphoma Is Poly-Ig Receptor1
Julia M. Phillips-Quagliata,2* Samir Patel,* Jing-Kang Han,* Sergei Arakelov,*
T. Dharma Rao,* Marc J. Shulman,† Shafie Fazel,† Ronald B. Corley,‡ Margaret Everett,§
Michel H. Klein,§ Brian J. Underdown,¶ and Blaise Corthésy储
I
g Fc receptors are of interest because of their ability to transduce signals between bound, cross-linked Igs and the cell
interior, leading either to activation or down-regulation of
cellular function (1). Because the predominant Ig in the gut-associated lymphoid tissue (GALT)3 is IgA, it is likely that specific
receptors for IgA (Fc␣R) may participate in the regulation of
GALT B cell behavior, but this is difficult to study because few
lymphocytes express them (2– 8). Several years ago we discovered
a GALT-derived murine B lymphoma, T560, that expressed an
IgA receptor (9). Thinking that it might regulate GALT B cell
behavior, we studied its properties only to find that it differed from
the classical Fc␣R in that its binding of IgA immune complex (IC)
was inhibitable not only by IgA but also by IgM, implying that it
was, in reality, an IgA/IgM receptor. IgA/IgM receptors were al*Department of Pathology, New York University School of Medicine and Kaplan
Cancer Center, New York, NY 10016; †Department of Immunology and Medical
Genetics, University of Toronto, Toronto, Ontario, Canada; ‡Boston University Medical Center, Boston, MA 02118; §Department of Immunology, University of Toronto,
Toronto, Ontario, Canada; ¶Department of Pathology, McMaster University, Hamilton, Ontario, Canada; and 储Division of Immunology and Allergy, University Hospital,
Lausanne, Switzerland
Received for publication February 7, 2000. Accepted for publication June 15, 2000.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by American Cancer Society Grant IM-684, U.S. Public
Health Service Grants AI-29682 and AI-31209, the Medical Research Council of
Canada, and by Grant 3200 – 057088 from the Swiss National Science Foundation.
2
Address correspondence and reprint requests to Dr. Julia M. Phillips-Quagliata,
Department of Pathology, New York University School of Medicine, MSB 536, 550
First Avenue, New York, NY 10016. E-mail address: [email protected]
Abbreviations used in this paper: GALT, gut-associated lymphoid tissue; Fc␣R, IgA
receptor; Fc␮R, IgM receptor; IC, immune complex; MF, mean fluorescence; pIgR,
poly-Ig receptor; pIg, polymeric Ig; pIgA, polymeric IgA; PI-PLC, phosphatidylinositol-specific phospholipase C; SC, secretory component; S-IgA, secretory IgA; TNP,
2,4,6 trinitrophenyl; TNP-ORBC, TNP-ox RBC; wt, wild type; PKC, protein kinase
C; CDR, complementarity determining region; RFC, rosette-forming cells; DPBS,
Dulbecco’s PBS.
ready well known as poly-Ig receptors (pIgR), responsible for
transporting both dimeric and polymeric IgA (pIgA) and IgM (collectively referred to as pIgs) through secretory epithelial cells into
secretions (10 –13). pIgR are not thought to be importantly expressed on lymphoid cells, but they have been detected on a T cell
hybridoma that also expresses Fc␣R (14), and the ability of Abs to
secretory component (SC), the portion of pIgR bound to IgA in
secretory IgA (S-IgA), to block binding of IgA to Fc␣R on GALT
lymphoid cells of mice has been attributed to cross-reactivity between the Fc␣R and the pIgR (15).
In this paper, we show that the T560 IgA/IgM receptor is pIgR
based on the following evidence: its binding of IgM is inhibited by
pIgA but not by S-IgA and is J chain dependent as is binding of pIg
by human (16, 17) and mouse (18) pIgRs; it binds IgM through a
different structure from the distinct IgM receptor (Fc␮R) of mouse
T cells (19); it is precipitable with either IgA or IgM; its Mr (116
kDa) is consistent with its being pIgR; and it is recognized by Abs
to mouse pIgR on immunoblots. Furthermore, complete mRNA for
pIgR is contained in T560 cells. Studies of the binding properties
of mutant mouse IgAs also presented in this paper indicate that the
C␣2 domain probably does not mediate interaction between
dimeric IgA and the mouse pIgR. Because a small proportion of
T560 cells coexpress IgA with IgG2a (20, 21) and the cell supernatant contains low concentrations of IgA, we considered the possibility that binding and uptake of autochthonous IgA might enable
T560 to produce S-IgA. However, all of the IgA in both lysates
and secretions of T560 cells proved to be monomeric; none of it
had a high molecular mass consistent with that of S-IgA. T560
evidently does not convert endogenous IgA into S-IgA.
3
Copyright © 2000 by The American Association of Immunologists
Materials and Methods
Cell lines
The T560.2.F7 and CH12.LX B lymphoma and the J774 macrophage cell
lines were maintained as previously described (9, 22).
0022-1767/00/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
T560, a mouse B lymphoma that originated in gut-associated lymphoid tissue, expresses receptors that bind dimeric IgA and IgM
in a mutually inhibitory manner but have little affinity for monomeric IgA. Evidence presented in this paper indicates that the
receptor is poly-Ig receptor (pIgR) known in humans and domestic cattle to bind both IgA and IgM. The evidence includes the
demonstration that binding of IgM is J chain dependent, and that pIg-precipitated receptor has an appropriate Mr of 116 –120 kDa
and can be detected on immunoblots with specific rabbit anti-mouse pIgR. Overlapping RT-PCR performed using template
mRNA from T560 cells and oligonucleotide primer pairs designed from the published sequence of mouse liver pIgR indicate that
T560 cells express mRNA virtually identical with that of the epithelial cell pIgR throughout its external, transmembrane, and
intracytoplasmic coding regions. Studies using mutant IgAs suggest that the C␣2 domain of dimeric IgA is not involved in
high-affinity binding to the T560 pIgR. Inasmuch as this mouse B cell pIgR binds IgM better than IgA, it is similar to human pIgR
and differs from rat, mouse, and rabbit epithelial cell pIgRs that bind IgA but not IgM. Possible explanations for this difference
are discussed. All clones of T560 contain some cells that spontaneously secrete both IgG2a and IgA, but all of the IgA recoverable
from the medium and from cell lysates is monomeric; it cannot be converted to secretory IgA by T560 cells. The Journal of
Immunology, 2000, 165: 2544 –2555.
The Journal of Immunology
Antibodies
All goat Abs and Ab conjugates were obtained from Southern Biotechnology Associates (Birmingham, AL). Rat mAbs to the following four mouse
C␮ domains, R33-24, rat IgG2a anti-C␮1; b7/6, rat IgG1 anti-C␮2; IM41,
rat IgG1 anti-C␮3; and C2-23, rat IgG2a anti-C␮4 (19), were kindly provided by Dr. Richard Lynch (Department of Pathology, University of Iowa
College of Medicine, Iowa City, IA). Rabbit anti-recombinant mouse pIgR
reactive with denatured pIgR and SC in Western blots has been described
previously (23). The mouse anti-rat ␬-chain mAb RG7.9.1 (24) was purified from culture supernatants on protein A beads.
Detection of IgA and IgM binding by flow cytometry
supernatants by binding to DNP-Sepharose followed by elution with 8 mM
DNP-glycine. The eluates were dialyzed against PBS to remove the hapten
and concentrated by ultrafiltration. A total of 200 ␮l of the concentrated
SP-6, J⫺/IgM-S414, and J⫺/IgM-S575 protein solutions were ultracentrifuged on sucrose density gradients, essentially as described (27). Fractions
(0.5 ml) collected from the top down were serially diluted and examined by
ELISA, and the concentrations of IgM were plotted (Fig. 1). Pools of
“monomer” (fractions 4–8) and “polymer” (fractions 12–20) were concentrated by ultrafiltration and dialyzed against DPBS to remove sucrose, and
their IgM concentrations were determined in ELISA. Insufficient SP-6
monomer was obtained for experiments so only the polymer was used. The
J⫹/IgM-S414 was concentrated but not subjected to sucrose gradient fractionation. Mouse IgM was also isolated from supernatants of WEHI-231,
which lacks J chain and makes mainly hexameric IgM, and from two
WEHI lines that were transfected with the J chain gene as previously described (30). Of these two cell lines, one, 3-H1, remains J chain negative;
the other, 3-C10, is J chain positive. The IgMs were isolated by binding to
Con A beads in the presence of 1 mM CaCl2, MgCl2, and MnCl2, and, after
washing the beads, eluting the IgM with 0.2 M methyl-␣-D-mannopyranoside (Sigma-Aldrich). The eluates were concentrated by ultrafiltration, dialyzed against DPBS, and the IgM concentrations were determined by
ELISA (see below) and adjusted to working concentrations by dilution
in DPBS.
Other Igs
Mouse IgG2a␬ (UPC-10), IgG2b␬ (MOPC-141; Sigma-Aldrich), and rat
IgM (Rockland, Gilbertsville, PA) were taken to have the concentrations
specified by the manufacturer. Normal Sprague Dawley rat-IgG was prepared by binding to and elution from protein G beads (Pierce, Rockford,
IL). Its concentration was determined from its OD280.
Immunoglobulins
Other proteins
Human IgA. Polymeric myeloma IgA␭ (IgA polymer 1) and monomeric
myeloma IgA␭ from a single individual (Steele) were purified in the laboratory of one of us (B.J.U.). Polymeric myeloma IgA␬ (IgA polymer 2)
and dimeric myeloma IgA␬ from two different individuals, McElhancy and
Latimer, respectively, as well as normal human S-IgA, were kindly given
to us by Dr. J. Mestecky (University of Alabama, Birmingham, AL).
Mouse IgA. BALB/c mouse myeloma IgAs, TEPC-15 (T15; IgA␬) and
MOPC-315 (M315; IgA␭) were prepared as previously described (9, 21) or
purchased from Sigma-Aldrich. Mutant M315 IgA myeloma proteins were
prepared by cassette mutagenesis, changing Cys301 to Ala, Tyr302 to Phe,
and Cys311 to Ala, and substituting the flexible human IgA1 hinge or the
very short human IgA2 hinge for the mouse hinge region. Briefly, the
pSV2-VH 315 plasmid was constructed by inserting an XbaI-NaeI fragment
of a cloned VH 315 segment together with an enhancer-containing NaeEcoRI fragment of a JH3-JH4 probe into the XbaI and EcoRI sites of the
multiple cloning site in pSV2NeoM (25). The wild-type (wt) pSV2-VH-C␣
plasmid was created by inserting a 1.5-kb XhoI-SalI fragment containing
the BALB/c germline C␣ gene derived from the C␣30 phage clone (26)
into the corresponding site of psV2-VH 315. pUC-C␣30 was made by
excising the 1.5 kb XhoI-SalI wt C␣30 DNA fragment from pSV2-VH-C␣
and cloning it into a modified pUC18 with no EcoRI and one XhoI site. IgA
mutant constructs were generated from pUC-C␣30. The region encompassing residues 297–314 of wt C␣30 is flanked by EcoRI and EcoR47III
restriction sites, which facilitated insertion of synthetic oligonucleotides
containing the desired mutations. The mutants were sequenced to ensure a
correct reading frame, and the mutant C␣ was excised from pUC with
XhoI-SalI and inserted into the pSV2-VH 315 plasmid. The wt and mutant
IgA constructs were electroporated into cells of the light-chain-expressing
recipient myeloma line M315.26. Mutant and wt IgAs in the supernatants
of the transfected cells were used to coat TNP-ox RBC (TNP-ORBC) for
rosette assays (9). ELISA and agglutination titers were used to adjust the
IgA concentrations to approximate those in our standard preparation of
M315 IgA myeloma protein.
Mouse IgM. MOPC-104E (IgM␭) and TEPC-183 (IgM␬) were obtained
from Sigma-Aldrich. TNP-specific normal and mutant IgMs were prepared
from the supernatants of transfected cell lines expressing a TNP-specific
␬-chain together with a normal or mutant TNP-specific ␮-chain as previously described (27–29). SP-6 IgM has a wt ␮-chain and consists mainly
of polymers with J chain; J⫺/IgM-S414 and J⫹/IgM-S414 both have
␮-chains with Ser substituted for Cys414, but J⫺/IgM-S414 consists mostly
of monomers with some pentamers and tetramers lacking J chain, whereas
J⫹/IgM-S414 (28) consists of polymers with J chain. J⫺/IgM-S575 has
␮-chains with Ser substituted for Cys575 and consists mainly of monomers
with some polymers lacking J chain. These IgMs were isolated from the
Mouse whey was kindly given to us by Dr. Michael Lamm (Department of
Pathology, Case Western Reserve University, Cleveland, OH).
Phosphatidylinositol-specific phospholipase C (PI-PLC)
treatment of T560.2.F7 cells
T560.2.F7 cells were incubated at 37°C with 50 ␮/ml PI-PLC from Bacillus cereus (Boehringer Mannheim, Indianapolis, IN) and from Bacillus
thuringiensis (ICN Pharmaceuticals, Costa Mesa, CA) in medium or in
medium alone for 45 min in the presence or absence of 0.2 ng/ml calphostin C (Calbiochem-Novabiochem, La Jolla, CA), washed three times in
medium containing FCS, and resuspended in DPBS for rosette assay as
previously described (9).
ELISA
ELISA were performed as described in Ref. 21 using plates sensitized with
goat anti-mouse ␮-chain or anti-mouse or -human ␣-chain in PBS (pH 7.0).
The concentrations of the various mouse IgM and IgA and human pIgA
preparations were determined by interpolation on standard curves. Because
polymeric IgM and IgA titrate in ELISAs with different slopes from their
monomeric counterparts, both the samples and the standards, MOPC-104E
for mouse IgM, M315 for mouse IgA (both from Sigma-Aldrich), were
reduced to monomers and alkylated before titration. Briefly, 0.1-ml volumes of IgM or IgA in PBS containing 1 mg/ml BSA were mixed with 0.3
FIGURE 1. Sucrose gradient separation of mutant IgMs J⫺/IgM S414,
J⫺/IgM-S575, and wt SP-6 IgM. IgM fractions 4 – 8 and 12–20 were pooled
as “monomer” and “polymer,” respectively.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Binding of IgA and IgM for detection by flow cytometry was done as
described in Ref.9 except that binding was at room temperature rather than
37°C. Various concentrations of IgA, IgM, or IgA-2,4,6 trinitrophenyl
(TNP)-BSA IC (see below) or, for inhibition assays, mixtures of IgA IC
and IgM, IgM and IgA, or IgM and anti-IgM mAb were used. Maximal
binding of IgA or IgM was observed on T560 cells passed 24 h previously
at 2 ⫻ 105 cells/ml, incubated at 37°C for 2 h in fresh medium, then
washed three times with Dulbecco’s PBS (DPBS) at room temperature
followed by buffer appropriate to the assay. Binding of mouse IgM was
detected with FITC-goat anti-mouse ␮-chain or, when only MOPC-104E
IgM was used, with FITC-goat anti-mouse ␭ light chain; that of rat IgM
was detected with FITC-goat anti-rat IgM, that of mouse IgA was detected
with FITC-goat anti-mouse ␣-chain, and that of human IgA was detected
with FITC-goat anti-human ␣-chain.
For inhibition studies, the percentage of inhibition was determined from
the mean fluorescence (MF) in the various samples using the following
formula: % inhibition ⫽ 100 (1 ⫺ (MF in inhibited sample ⫺ MF in low
control)/(MF in unihibited sample ⫺ MF in low control)).
2545
2546
B CELL POLY-Ig RECEPTOR
ml 0.1 M Tris-HCl buffer (pH 8.6). DTT (0.1 ml, 0.03 M in the same
buffer) was added, and the mixtures were incubated for 1 h at 37°C. After
reduction, iodoacetamide (0.1 ml, 0.07 M in buffer) was added, and the
mixtures were incubated for 20 min at 37°C. Sodium acetate buffer (0.4 ml,
0.1 M) was then added to bring the pH to ⬃7.0 and the volume to 1.0 ml.
Serial dilutions of the standards and samples were applied to the sensitized
ELISA wells. The human pIgAs had titration curves similar to that of the
standard (human colostral IgA from Sigma-Aldrich) and so were not reduced, but the monomeric human IgA preparation had a titration curve of
very different slope so its concentration was calculated simply from its OD.
The concentration of rat IgM (Rockland) was taken as that specified by the
manufacturer.
To check that the ability of the rat anti-mouse C␮ domain mAbs to bind
to mouse IgM was intact, ELISA wells coated with 10 ␮g/ml of MOPC104E IgM were blocked with BSA, and serial dilutions of the mAbs or of
normal rat IgG were added to the wells and incubated. After washing, rat
IgG bound to the wells was detected with HRP-goat anti-rat IgG Ab. All
of the mAbs bound strongly to the IgM-coated wells and binding was not
diminished at all by serial dilution down to 1.5 ␮g/ml. At this concentration, binding of normal rat IgG was at background levels.
Preparation of IgA IC in Ab excess
Periodate-treatment of IgA and IgM
Rat IgM and M315 IgA at 1 mg/ml were treated with an equal volume of
40 mM sodium metaperiodate in 0.6 M sodium acetate buffer (pH 4.0) or
with the acetate buffer alone for 2 h at 4°C in the dark (31), blocked with
1% glycine at pH 9.6, and then dialyzed vs DPBS.
Precipitation of 125I-labeled IgA/IgM receptor from the surface
of T560.2.F7 cells
To 4 ⫻ 107 washed T560.2.F7 or CH12.LX cells resuspended in 0.4 ml
DPBS were added 20 ␮l DPBS containing 4 U lactoperoxidase (SigmaAldrich) followed by 1.5–2 mCi carrier-free 125I as NaI (ICN Biomedicals,
Irvine, CA). Ten microliters 0.05% hydrogen peroxide in H2O were then
Immunoblotting
For immunoblotting, lysates or 10-fold concentrated supernatants of unlabeled cells were precleared with protein G beads precoated with goat antimouse ␥2a chain (T560 cells) or goat anti-mouse ␮-chain Ab (CH12 cells),
and the pIgR or IgA present were precipitated onto protein G beads coated
as above with RG7.9.1 anti-rat ␬-chain rat IgM IC, with goat anti-human
␭ light chain human IgA polymer (1) complex, with the Abs alone with
Table I. PCR primers used for sequencing the pIgR of T56O
Identifier
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
pIgR
S5
S2
S3
S9
S6
S10
S14
S11
S7
S8
S4
S12
AS3
AS2
AS5
AS10
AS6
AS4
AS11
AS12
Homology
Direction
⫺84 to ⫺62
110–132
365–386
591–614
693–715
901–923
1134–1154
1517–1539
1607–1630
1670–1693
1771–1793
2009–2031
154–176
424–447
719–740
1132–1153
1420–1442
1765–1787
2024–2047
2389–2409
Sense
Sense
Sense
Sense
Sense
Sense
Sense
Sense
Sense
Sense
Sense
Sense
Antisense
Antisense
Antisense
Antisense
Antisense
Antisense
Antisense
Antisense
Primer (5⬘ to 3⬘)
TCACCTGGAGAGAAGGAAGTAGC
TCCATCACGTGCTACTACCCAGA
ATGTCAGCCTGGAGGTCAGCCA
GACCGACCTAACTGTATTCTATGT
GAATGTTGACCTCCAGGTGCTAG
AAGGATGACAATGGCCGCTTCAG
CAGCCTCAAGTACTGGTGTCG
ACATCCTGCCAAGCCATGACGAA
TCAGTAAGGAAGATGAAGGCTGGT
CTACCGCCATCTATATAGCAGTTG
GTAGTGGACTCCTCCATCAGTGA
TCCGACATCGGAAGAATGTAGAC
TCCTTGTCGGCACCAGTATTTCC
GGTCACATTTCTGCCTATGTCCTT
TTATAAAGCAGCTCTGGCTCAG
AGCGACACCAGTACTTGAGGCT
GAAGGTCTCTCCTAGTACTGCTG
ATGGAGGAGTCCACTACCTCTTC
TGTCCTGTAGCTGCTGATTGACAT
AAGAGCGGAGGTGATGGGTGA
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
To assay the ability of IgM to inhibit binding of mouse IgA to the IgA/IgM
receptor by flow cytometry, the IgA signal was increased by using IgA IC
formed in Ab excess. Dilutions of TNP-BSA (27 TNP groups/mol) were
incubated with M315 IgA myeloma protein, and the mixtures were examined by ELISA to establish an amount of TNP-BSA that would barely
inhibit binding of 10 ␮g/ml M315 IgA to plates precoated with TNP-BSA.
Half of this concentration was then used together with 10 times the concentration of M315 IgA to prepare IgA IC in such vast Ab excess that no
TNP groups could possibly be available to mediate binding of IC to the
surface Ig of T560 cells. In practice, equal volumes of BSA-DPBS containing 12.8 ␮g TNP-BSA/ml and 100 ␮g M315 IgA/ml were mixed and
incubated for 1 h at room temperature. The IC was then diluted 1:2 with
diluent or the IgM inhibitor, yielding a final concentration of 25 ␮g/ml IgA
in the mixture.
added five times over the next 30 min, and the mixture was allowed to
stand 10 min after the last addition. The volume was then brought to 10 ml
with DPBS, and the cells were spun down and washed four times with
DPBS. Aliquots of 2 ⫻ 107 125I-labeled cells in 0.2 ml DPBS were lysed
with 1 ml DPBS-based lysis buffer (pH 6.0) containing 0.5% Nonidet P-40,
0.01% soybean trypsin inhibitor, 10 ␮g/ml leupeptin, 1 ␮g/ml pepstatin A,
2 ␮g/ml chymostatin, 2 ␮g/ml antipain, 100 ␮g/ml PMSF, 10 mM benzamidine hydrochloride, 50 mM ⑀-amino-caproic acid, 20 mM iodoacetamide, and 0.02% sodium azide (32) at 4°C for 1 h. After centrifugation,
the supernatants were transferred to clean tubes and supplemented with
1/10 volume of 3.5 M NaCl containing 100 ␮g/ml PMSF and 3 mg/ml
protease-free BSA. The supernatants were precleared by rotating them at
4°C overnight with mixtures of 30 ␮l each of packed plain protein G beads,
protein G beads coated with goat anti-mouse IgM (for CH12 cells), IgA,
and IgG and protein G beads coated with the eventual Ab to be used to bind
IgM or IgA to the beads to precipitate the receptor (i.e., goat anti-mouse ␭
light chain for MOPC-104E or M315, and anti-rat ␬-chain mAb RG7.9.1
(24) for rat IgM). These beads were removed by centrifugation, and a
second preclearance was performed by transferring the supernatants into
fresh tubes containing 30 ␮l of packed MOPC-21 (mouse IgG1)-coated
beads, rotating the mixtures at 4°C for 2 h. Equal volumes of the supernatants were then placed into fresh microfuge tubes containing 30 ␮l
washed protein G beads precoated with either monoclonal anti-rat ␬-chain
followed by rat IgM or control, BSA-containing buffer, or goat anti-mouse
␭ light chain Ab followed by either M315 dimeric IgA, MOPC-104E IgM,
or control, BSA-containing buffer. The lysates were rotated with the beads
overnight at 4°C. The beads were recovered by centrifugation and washed
twice with 1 ml high-salt lysis buffer, five times with 0.5 ml of this same
buffer, and once with 1 ml low-salt lysis buffer. The protein was solubilized
from the beads by boiling with 50 ␮l fresh Laemmli sample buffer (33)
with or without 0.7 M 2-ME and electrophoresed on SDS-PAGE. In some
experiments, precipitation was done in ELISA plates instead of on beads
(32). For preclearance, the wells were coated with goat anti-mouse ␭ light
chain or TNP-BSA, washed with PBS, and blocked with BSA. The lysates
were precleared seven times by serial transfer to and incubation at 4°C in
such coated wells, then placed in wells coated with goat anti-mouse ␭ light
chain, followed by either MOPC-104E IgM, control BSA-containing
buffer, or with TNP-BSA followed by M315 dimeric IgA or BSA-containing buffer. After adsorption to the coated wells, the lysates were removed,
and the wells were washed seven times with PBS. Bound proteins were
removed from the wells with Laemmli sample buffer with or without 0.7 M
2-ME and boiled for 5 min before separation on SDS-PAGE.
The Journal of Immunology
2547
BSA (controls), or with goat anti-␣-chain Ab. For the pIgR, 10% SDSPAGE was used, and the proteins were electrophoretically transferred to
nitrocellulose membranes (Bio-Rad, Hercules, CA). For S-IgA, 5% SDSPAGE was used, and the proteins were transferred to ␨-probe (Bio-Rad).
The membranes were blocked with 10% BSA in PBS containing 0.05%
Tween 20 and 0.02% sodium azide, washed in PBS-Tween 20 without
azide, and stained with either rabbit anti-denatured recombinant pIgR (23)
or normal rabbit serum followed by HRP-conjugated goat anti-rabbit IgG
heavy and light chains (human/mouse adsorbed) or HRP-conjugated goat
anti-mouse ␣-chain, diluted in 5% normal goat serum/PBS-Tween 20. The
bands were developed with ECL Western blotting detection reagents (Amersham, Arlington Heights, IL).
PCR
FIGURE 3. Inhibition of binding of M315 IgA IC preformed in Ab
excess (equal volumes of 100 ␮g/ml M315 IgA plus 12.8 ␮g/ml TNP27BSA were mixed and incubated for 1 h at room temperature) to T560.2F7
cells by normal rat IgM. The IC were mixed with equal volumes of medium
alone or of medium containing different concentrations of IgM to achieve
the stated IgM concentration and 25 ␮g IgA/ml. Staining was done with
FITC-goat anti-mouse ␣-chain. Dark line, IgA; light line, control. The
numbers represent the MF with the percentage of inhibition in parentheses.
The control MF was 13.2.
Results
Cross-inhibition of binding of IgA and IgM to T560.2.F7 cells
Rosette assays were previously used to show that T560 cells bind
both mouse IgA- and IgM-coated erythrocytes and that these two
Igs are mutually inhibitory (9). Similar binding and inhibitory phenomena are here demonstrated by flow cytometry with both mouse
and human IgA and mouse and rat IgM. Binding of polymeric
M315 mouse IgA myeloma protein to T560.2.F7 cells in the presence or absence of TNP-BSA is shown in Fig. 2A. IgA binds to
T560.2.F7 cells, and the presence of TNP-BSA in Ab excess markedly enhances the signal from FITC anti-␣-chain Ab, presumably
because there is more IgA to take it up in the bound complex. Not
all of this IgA is necessarily in contact with receptors on the cell
surface, but multipoint attachment to the cell surface receptors
probably increases the avidity of binding of complexes over that of
pIgA alone. No binding to CH12.LX cells, which lack IgA/IgM
receptors, is seen (Fig. 2B).
Inhibition of binding of M315 IgA-TNP-BSA IC to T560.2.F7
cells by normal rat IgM is illustrated in Fig. 3. More than 50%
FIGURE 2. Binding of 50 ␮g M315 IgA myeloma protein/ml and of
M315 IgA IC preformed in Ab excess (equal volumes of 100 ␮g/ml M315
IgA plus 12.8 ␮g/ml TNP27-BSA mixed and incubated for 1 h at room
temperature) to T560.2.F7 (A) and CH12.LX (B) B lymphoma cells. Staining was done with FITC-goat anti-mouse ␣-chain. Dark line, IgA; light
line, control. The numbers represent the MF. The MF of the FITC-goat
anti-mouse ␣-chain control binding to T560.2.F7 cells was 15.0 and to
CH12.LX was 25.6.
inhibition of binding of IgA complex containing 25 ␮g/ml IgA is
achieved with as little as 9 ␮g/ml of rat IgM.
Binding of 40 ␮g/ml of MOPC-104E mouse IgM to T560.2.F7
cells is inhibited by human polymeric and dimeric IgA, but not at
all by S-IgA and very little by monomeric IgA. Fifty percent inhibition requires ⬃100 ␮g/ml of IgA polymer (1) and dimer,
but 350 ␮g/ml of IgA polymer (2) and ⬎1000 ␮g/ml IgA monomer (Fig. 4). Because the inhibition curves for polymer and
monomer have the same slope, it is possible that the inhibition
by monomer is due to minor contamination by polymer.
We previously noted (9) that high concentrations of both mouse
IgG2a (UPC-10) and IgG2b (MOPC-141) inhibited IgA rosette
formation. These two proteins were shown not to be appreciably
contaminated with IgA. In the present work, we tested the same
lots of protein for their ability to inhibit binding of MOPC-104E
IgM to T560.2.F7 cells as measured by flow cytometry. We found
that IgG2a inhibited IgM binding by 40% at 300 ␮g/ml and by
16% at 150 ␮g/ml whereas, at the same concentrations, IgG2b
enhanced it (data not shown). ELISA subsequently revealed that
the IgG2b preparation was contaminated by IgM, which would
FIGURE 4. Inhibition of binding of MOPC-104E IgM myeloma protein
at 40 ␮g/ml (final concentration) by human monomeric, dimeric, polymeric, and secretory IgA. This figure shows means of two to three experiments with each IgA, not all done at the same time. The concentrations
have been corrected to those determined by ELISA.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
PCR were performed using pIgR primers with cDNA templates prepared
from T560.2.F7 cells, from mouse and rat liver, and from control J774
macrophages and CH12.LX B lymphoma cells, and the PCR products were
TA-cloned and sequenced as previously described (21). Sequential, overlapping PCRs were done using one primer designed from the sequence
contained within the preceding amplified fragment and a second primer
designed from the mouse liver pIgR sequence (34) 5⬘ or 3⬘ of the existing
fragment. Combination of the sequences of all these fragments allowed
determination of the complete sequence of the T560 pIgR except for the 5⬘
and 3⬘ ends, which were given by the mouse liver primers. The names and
locations of the primer sequences are given in Table I.
2548
B CELL POLY-Ig RECEPTOR
explain why it inhibited IgA rosette formation in our earlier experiments. However, the inhibition of both IgA and IgM-binding
by IgG2a is still unexplained for it was not contaminated by either
IgA or IgM. Inhibition of IgM binding by IgG2a in the experiments discussed here is much less impressive than the 100% inhibition of IgA rosette formation seen with only 65 ␮g/ml IgG2a
in our earlier study (9).
Binding of IgA and IgM to the IgA/IgM receptor is not due to
recognition of a shared carbohydrate
Binding of murine IgM to the T560 IgA/IgM receptor does not
involve the same epitopes as binding to the IgM receptor on
murine T cells
Marked inhibition of binding of murine IgM to the T cell IgM
receptor was shown to occur when either of two different rat mAbs
(IM41 and 2911) to the C␮3 domain were complexed with the IgM
at ratios higher than 5:1 (Ab to IgM) before addition to the cells
(19). Borderline inhibition was seen with one of two mAbs to the
C␮2 domain and no inhibition was seen with anti-C␮1 or with
either of two mAbs to the C␮4 domain. We tested the ability of
some of these same Abs to inhibit binding of MOPC-104E to the
T560 IgA/IgM receptor at Ab:IgM ratios ranging from 8:1 down to
1:1. There was no inhibition of binding with any of the mAbs to
any of domains C␮1 through C␮4, most notably not with IM41,
which reacts with C␮3, indicating that the epitopes bound by the
mAbs are not involved in binding to the T560 IgA/IgM receptor
(data not shown). Marked potentiation of the signal provided by
FITC-goat anti-mouse ␭ light chain actually occurred with Abs to
C␮2 and C␮3 but not with Abs to C␮1 and C␮4, suggesting that
Role of J chain in the binding of IgM to the IgA/IgM receptor
The best described IgA/IgM receptor to date is the pIgR, normally
expressed on secretory epithelial cells. Expression of the structure
recognized by this receptor is dependent on the presence of J chain
in the IgA or IgM polymer (16 –18). To examine a possible relationship between the T560 IgA/IgM receptor and the pIgR, binding
of IgMs containing or lacking J chain was investigated. TNP-specific SP-6 mutant and wt IgMs were affinity purified from the
supernatants of transfected cells, separated into monomers and
polymers on sucrose gradients (J⫺/IgM-S414, J⫺/IgM-S575, and
wt SP-6) or left unseparated, (J⫹/IgM-S414), and their ability to
bind to T560.2.F7 cells was assessed by flow cytometry (Fig. 5, A
and B).
The data indicated that neither the polymers nor the monomers
from the J⫺ mutant IgMs could bind significantly to T560.2.F7
cells (there was a trace of binding of J⫺/IgM-S414 polymer) but
J⫹/IgM-S414 and wt SP-6 polymeric IgM as well as additional
control, unseparated IgMs, MOPC-104E, and TEPC-183 all bound
very well. They suggested that pIgM-lacking J chain does not bind
to the receptor. However, they were not conclusive because the
mutations in the ␮-chains of S414 and S575 might have affected
their ability to bind independently of affecting their J chain
content.
The role of J chain in binding to the T560.2.F7 IgA/IgM receptor was further examined by comparing the binding of WEHI-231
IgM with normal ␮-chains but lacking J chain (30) with that of
IgM from two transfected cell lines: one, 3-C10, expressing J
chain; the other, 3-H1, not expressing J chain. (Fig. 6). The results
were clear cut. 3-C10 IgM-containing J chain, bound well to
T560.2.F7 cells; WEHI-231 IgM and 3-HI IgM, both lacking J
chain, failed to bind. Because WEHI-231 IgM is substantially hexameric, the results support the conclusion that it is not sufficient for
IgM to be polymeric; it must contain J chain to bind to the receptor. The results are consistent with the idea that the T560 IgA/IgM
receptor is a form of pIgR, known to require J chain for binding of
polymeric Ig.
Precipitation with pIg identifies a 116-kDa receptor for IgA/IgM
on T560 cells
Radioiodinated IgA/IgM receptor was precipitated with pIg from
T560 cells under several sets of conditions. Both rat and mouse
IgM precipitated it more readily than pIgA. No similar molecule
Table II. Effect of periodate treatment of rat IgM and M315 mouse IgA on their ability to bind to
T560.2.F7 cells
Expt.
1
2
3
Protein
None
IgM
IgM
None
IgA
IgA
None
IgM
IgM
None
IgA
IgA
None
IgA
IgA
Staining Reagent
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
FITC-goat
anti-rat IgM
anti-rat IgM
anti-rat IgM
anti-mouse ␣-chain
anti-mouse ␣-chain
anti-mouse ␣-chain
anti-rat IgM
anti-rat IgM
anti-rat IgM
anti-mouse ␣-chain
anti-mouse ␣-chain
anti-mouse ␣-chain
anti-mouse ␣-chain
anti-mouse ␣-chain
anti-mouse ␣-chain
Periodate Treatment
⫺
⫹
⫺
⫹
⫺
⫹
⫺
⫹
⫺
⫹
MF
8.0
41.8
29.5
7.7
39.2
61.9
12.6
76.3
75.3
12.1
67.4
107.8
10.4
43.2
63.2
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
To examine the possibility that IgA and IgM bind to the IgA/IgM
receptor through a shared carbohydrate, the effect of periodate oxidation of the carbohydrate on binding of rat IgM and M315 IgA
was tested. The data (Table II) indicate that treatment with periodate has little or no effect on the ability of IgM to bind to the cells
(in the first experiment it reduced it, in the second it did not) but,
in three experiments, it increased the ability of IgA to do so. It is
not clear why it has this effect on IgA but not IgM. One possibility
is that cleavage of sugar rings in the carbohydrates on IgA renders
the IgA susceptible to aggregation, another is that it relieves a
partial blockade of binding of IgA to the pIgR normally mediated
by native carbohydrates. Whatever the explanation, there being no
major reduction in binding of either protein, it seems unlikely that
interaction with the T560 receptor is mediated through a carbohydrate shared between IgM and IgA.
the former promoted the build-up of MOPC-104E-Ab IC on the
cell surface.
The Journal of Immunology
2549
was precipitated from CH12 cells. In our earliest studies (20) using
the protease inhibitors described in Ref. 14, triethanolamine, iodoacetamide, chymostatin, leupeptin, pepstatin, antipain, and
PMSF, we precipitated small amounts of a molecule similar in size
(36 kDa) to that of the IgA-binding 38-kDa molecule precipitated
from murine T cells (35). However, when we added soybean trypsin inhibitor, aprotinin, diisopropylfluorophosphate, and sodium
azide to the inhibitors mentioned above (32), we brought down a
band of much higher Mr (116 kDa; Fig. 7), and the 36-kDa band
disappeared. It seems likely that the 36-kDa band represented an
IgM-binding product of proteolysis derived from the 116-kDa
band. The apparent Mr of the 116-kDa band increased to about 120
kDa on 7.5% polyacrylamide gels but was unaltered under reducing vs nonreducing conditions (not shown). The band was also
precipitated by IgA or IgM in PBS in the presence of EDTA indicating that its binding is not dependent on divalent cation (not
shown).
Immunodetection reveals the identity of the 116-kDa protein
as pIgR
FIGURE 6. FACScan of T560.2.F7 cells incubated with normal wt
MOPC-104E IgM (J chain⫹), wt WEHI-231 IgM (J chain⫺), and IgM from
two J chain-transfected clones of WEHI-231, clone 3-C10, which is J
chain⫹, and 3-H1, which is J chain⫺. The cells were incubated with IgMs
at 20 ␮g/ml, washed, then stained with FITC-anti ␮-chain Ab. Dark line, IgM;
light line, control. The numbers represent the MF; the control was 16.8.
FIGURE 7. Electrophoretic analysis of Nonidet P-40 lysates of 125Ilabeled T560.2.F7 and CH12.LX cells precipitated in wells of ELISA
plates sensitized with goat anti-mouse ␭ light chain Ab followed by
MOPC-104E IgM (M) or diluent alone (MC), or with TNP-BSA followed
by M315 IgA (A) or diluent alone (AC). The samples were reduced and run
on 10% SDS-PAGE. Arrows indicate the 116-kDa receptor band.
The receptor precipitated from Nonidet P-40 lysates of T560 cells
with either rat IgM or human pIgA was detectable as a band of
⬃116 kDa on immunoblots with rabbit Ab to denatured mouse
pIgR followed by HRP-goat Ab to rabbit IgG (Fig. 8). No such
band was precipitated from lysates of CH12 cells, which lack the
IgA/IgM receptor. Control lanes show both free SC (⬃90 –95 kDa)
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 5. FACScan of T560.2.F7 cells incubated
with normal and mutant IgMs at 40 ␮g/ml, washed,
and then stained with FITC-goat anti-mouse ␮-chain
Ab. Dark line, IgM; light line, control. A, Comparison
between the binding of unseparated wt MOPC-104E
and TEPC-183 IgM, the polymer fraction of wt SP-6
IgMs, and both monomer and polymer fractions of the
mutant proteins, J⫺/S414-IgM and J⫺/S575-IgM. The
numbers represent the MF for IgM binding; the control was 9.6. B, Comparison between the binding of
unseparated wt MOPC-104E IgM, the polymer fraction of wt SP-6 IgM, and the polymer fractions of the
mutant proteins, J⫹/S414-IgM, J⫺/S414-IgM, and J⫺/
S575-IgM (control). The numbers represent the MF
for IgM binding; the control was 12.0.
2550
B CELL POLY-Ig RECEPTOR
FIGURE 8. Immunoblot showing precipitation of 116-kDa band from T560 cells by rat IgM or human pIgA on protein G beads. The beads were
preincubated with RG7.9.1 anti-rat ␬-chain, washed, and then incubated with rat IgM (M), diluent alone (MC), goat anti-human ␭ light chain followed by
human IgA polymer (1) (A), or diluent alone (AC). Reduced samples were run on 10% SDS-PAGE, blotted onto nitrocellulose, and developed by anti-pIgR
Ab. Negative controls were done with CH12.LX cells stained with anti-pIgR (shown), as well as with T560 cells stained with normal rabbit serum followed
by HRP goat anti-rabbit IgG (not shown). Nonreduced (NR) and reduced mouse whey provided positive controls for staining of intact S-IgA (the high Mr
bands above 208 kDa) and free SC (the bands above 84 kDa) by the anti-pIgR Ab.
T560 cells express mRNA-encoding pIgR
The binding characteristics of the IgA/IgM receptor, especially its
requirement for J chain, its high molecular mass, and its ability to
bind anti-murine pIgR Ab suggest that it is pIgR. The possibility
that it might represent some new B cell form of the pIgR, perhaps
with GPI linkage to the cell membrane, as suggested by the sensitivity of the T560 IgA receptor to PI-PLC (9, 36), was next
explored by RT-PCR. First we demonstrated (Fig. 9) that T560
cells contain message for the pIgR using primers encompassing
⬃80% of domain I and a small portion of domain II of the mouse
liver pIgR sequence. Identically sized fragments (337 bp) were
amplified from rat and mouse liver and from both of two separately
prepared T560.2.F7 mRNAs but not from mRNA of either
CH12.LX, the B cell line used as control above, or J774, a receptor-negative macrophage line (9), and not from a control containing no template. The fragments were TA-cloned and sequenced;
fragments amplified from rat mRNA contained rat sequence while
those amplified from mouse liver and from T560 contained mouse
sequence.
Multiple, serial RT-PCRs were then performed using T560
mRNA as template and overlapping sets of primers. The fragments
were TA-cloned and sequenced. The whole T560 pIgR sequence is
shown in Fig. 10. T560 cells clearly contain mRNA coding for a
FIGURE 9. Photograph of agarose gel electrophoretic analysis of the
products of PCRs done with sense and antisense primers derived from the
first and second domain of mouse pIgR and with sense and antisense primers for ␤2-microglobulin as a control. Lane 1, Ladder (1-kb); lane 2, mouse
liver cDNA; lane 3, rat liver cDNA; lane 4, J774 macrophage cell line
cDNA; lane 5, T560.2.F7 cDNA; lane 6, CH12.LX B lymphoma cell line
cDNA; lane 7, T560.2.F7 cDNA (different preparation from that shown in
lane 5); lane 8, no template control.
protein identical with epithelial cell pIgR throughout its external,
transmembrane, and intracytoplasmic regions except for a single T
to C base change at position 476 that results in a Val3 Ala change
in domain II. This change, which could well be allelic, was verified
by sequencing the product of an independent RT-PCR. Two C to
T changes, one conservative in domain 4, the other in the 3⬘ untranslated region, have not been so verified. The sequence provided no grounds for supposing that the form of pIgR on T560 was
different from that on epithelial cells.
The sensitivity of the pIgR on T560 cells to PI-PLC is due to
activation of protein kinase C (PKC)
We previously noted (9) that treatment of T560 cells with PI-PLC
destroyed their ability to bind IgA-coated erythrocytes, suggesting
that the IgA receptor might be GPI-linked to the cell membrane.
We also found that activation of protein kinase C (PKC) by PMA
caused down-regulation of IgA receptor activity. Subsequently, we
discovered (36) that the effect of PI-PLC was partially reversed by
staurosporine, a protein kinase inhibitor. We now show that it is
completely reversed by calphostin C, which is PKC-specific. As
shown in Table III, treating T560 cells with PI-PLC reduces their
ability to form IgA rosettes by ⬃85%. Addition of calphostin C
diminishes the reduction due to PI-PLC to only 3%. These results
suggest that PI-PLC causes loss of IgA receptor activity (by inference pIgR receptor activity) from T560 cells indirectly, by activating PKC. PKC activation may follow cleavage by PI-PLC of
a bona fide GPI-linked molecule from the cell surface or (much
less likely) by PI-PLC itself crossing the cell membrane and cleaving phosphatidylinositol bisphosphate. Whatever the mechanism
of PI-PLC-induced activation of PKC, it is clear that the T560
pIgR is not GPI-linked to the cell membrane but has conventional
type I transmembrane and cytoplasmic regions consistent with the
sequence data presented above.
Lack of effect of mutation in the C␣2 domain or hinge regions
on binding of IgA to the pIgR
Motifs in the C␣2 domain have been postulated to mediate binding
between pIgA and the pIgR. To explore the roles of C␣2 domain
Cys residues in the binding of IgA to the pIgR, rosette assays were
performed comparing normal and mutant IgA proteins. The residues targeted were Cys301, its adjacent Tyr302, and Cys311. Both
Cys301 and Cys311 are responsible for inter-␣-chain bonding
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
and covalently bound SC in the unreduced S-IgA molecule contained in whey and of SC alone in reduced whey.
The Journal of Immunology
2551
within the IgA monomer. In addition, Cys311 of one ␣-chain in an
IgA dimer undergoes a disulfide exchange reaction and binds to a
highly conserved Cys in pIgR domain 5 (Cys467 in human pIgR)
during the formation of S-IgA. At similar concentrations and agglutination titers, there was no significant difference between mutant and nonmutant IgAs in their ability to mediate rosette formation (Table IV). Discrepancies between the concentrations and
agglutination titers probably reflect the ratios of monomer to polymer in the different supernatants. Because either of two Cys and a
Tyr in the C␣2 domain can undergo change without impairing the
ability of the dimeric IgA molecule to bind to the pIgR, the C␣2
domain is probably not directly involved in high-affinity binding to
the pIgR. It also makes no difference to rosette formation whether
the extended, flexible human IgA1 or the very short human IgA2
hinge is substituted for the mouse hinge region.
The IgA secreted by T56O cells upon switching from IgG2a to
IgA is all monomeric and is not taken up and resecreted as
S-IgA
Because T560 cells can produce IgA and contain mRNA for J
chain as determined by RT-PCR (not shown), we explored the
possibility that T560 might make dimeric IgA that could bind to
the pIgR and then be internalized, processed in endosomes, and
released as S-IgA. In immunoblots (Fig. 11), the lanes containing
the supernatants and lysates of T560.2.F7 lanes contain ␣-chain
bands with an Mr of ⬃100 kDa, consistent with ␣-chain dimers
(the light chains of mouse IgA are not covalently bound to heavy
chains). No tetrameric or higher molecular mass ␣-chain bands,
such as are seen in the lanes containing T15 IgA, M315 IgA, and
S-IgA (in mouse whey), are detectable.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 10. Comparison of the sequences of pIgR mRNA from mouse liver and from the T560 B lymphoma. Dashes indicate identity between the T560
and mouse liver sequences; horizontal arrows underline the sequences used to make the forward and reverse primers for RT-PCR; vertical lines define the
domain borders; asterisks indicate the initiation and termination codons; and the CDR1, CDR2, and CDR3 homology regions of domain I are italicized.
2552
B CELL POLY-Ig RECEPTOR
Table III. Effect of calphostin C on PI-PLC-induced reduction in IgA
rosette formation by T560.2.F7 cells incubated with M315 IgA-coated
TNP-ORBC
PI-PLC-1a
(50 mU/ml)
PI-PLC-2
(50 mU/ml)
Calphostin C
(0.2 ng/ml)
⫺
⫹
⫺
⫺
⫹
⫺
⫺
⫺
⫹
⫺
⫺
⫹
⫺
⫺
⫺
⫹
⫹
⫹
% IgA RFCb
35.3
4.3 (87.8)
6.1 (82.7)
32.7 (7.4)
34.2 (3.1)
34.2 (3.1)
a
PI-PLC-1 was from B. cereus; PI-PLC-2 was from B. thuringiensis.
A minimum of 200 cells per sample was counted in either the RFC or non-RFC
category. Figures in parentheses represent the percentage decrement in RFC resulting
from treatment. No RFC were found when T560 cells were incubated with control
TNP-ORBC without M315 IgA.
b
Discussion
Table IV. Rosette formation on T560.2.F7 cells incubated with TNP-ORBC precoated with wt and mutant
M315 IgA derived from supernatants of transfected M315.26 myeloma cells
Supernatant Used to Coat
TNP-ORBC (dilution)
M315 standard (1/12)
FCS control
C␣30 (wt IgA) (1/2)
1905 (1/2)
2077 (1/2)
1920 (1/2)
IgA1 (1/2)
IgA2 (1/2)
a
Mutation
Initial IgA Conc.
(␮g/ml)
Aggl. Titer
% IgA RFCa
None
—
None; wt
Cys3013Ala
Tyr3023Phe
Cys3113Ala
Human IgA1 hinge
Human IgA2 hinge
123
0
15
35
32
126
14
272
1⬊32
0
1⬊4
1⬊32
1⬊8
1⬊64
1⬊4
1⬊64
45.4
2.4
31.3
47.1
31.3
47.1
36.9
51.3
Means of duplicate samples. A minimum of 200 cells per sample was counted in either the RFC or non-RFC category.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
The IgA/IgM receptor expressed on the murine B lymphoma,
T560, is clearly conventional pIgR, well known to function in the
transport of dimeric or pIgA and IgM across epithelial cells into
secretions. Binding to the T560 receptor by both IgA and IgM is
independent of any hypothetical shared carbohydrate on these Igs,
because periodate oxidation of the carbohydrates on the Igs does
not prevent binding. This excludes the possibility that the T560
IgA/IgM receptor might be related to the lectin-like IgD receptor
(37) or to the monocyte Fc␣R which may (38) or may not (39)
need the C␣2 of human IgA1 to be N-glycosylated for binding.
Both polymeric and dimeric human IgA inhibit binding of IgM to
the T560 IgA/IgM receptor, but human S-IgA does not, suggesting
that SC already present in the S-IgA prevents its interaction with
the receptor. Binding of IgM to the T560 IgA/IgM receptor is J
chain dependent as are binding of IgM and pIgA to the epithelial
pIgR (16 –18). Binding of IgM to the T560 IgA/IgM receptor does
not involve the C␮3 epitope used in binding to the mouse T cell
Fc␮R (19). IgA/IgM receptor precipitated from the T560 cell surface has an appropriately high Mr (116 kDa), much higher than that
of Fc␣R on either murine T cells (38 kDa; Refs. 14 and 35), human
myeloid cells (30 kDa; Ref. 32), or human B cells (58 kDa; Ref.
40), or of the Fc␮R on human B cells (58 – 60 kDa; Refs. 41 and
42) or T cells (60 kDa; Ref. 42), and can be detected on immunoblots with rabbit Ab to murine pIgR. mRNA-encoding pIgR is
expressed within T560 cells, and its sequence indicates that the
molecule has external and transmembrane regions as well as a
cytoplasmic tail identical with that of the molecule expressed on
epithelial cells (34). Of course, because the sequence was determined from cloned RT-PCR-amplified products, it is possible that
mRNA for a distinct, hypothetical B cell GPI-linked pIgR was also
present, but not detected. This hypothesis is rendered unlikely by
the following two findings: first, the loss of IgA receptor activity
from the cell surface following PI-PLC treatment was shown to be
due not to cleavage of a GPI-linked pIgR from the cell surface but
rather to down-regulation of cell surface pIgR activity following
activation of PKC; second, only one receptor band was detectable
on immunoblots.
The ease with which wt rat or mouse IgM, as compared with
dimeric or pIgA, binds to the pIgR on T560 cells is striking. Only
9 ␮g/ml rat IgM are needed for 50% inhibition of binding of
MOPC-315 IgA IC containing 25 ␮g IgA/ml to T560 cells,
whereas 100 ␮g/ml of polymeric or dimeric human IgA are needed
for 50% inhibition of binding of IgM at 40 ␮g/ml. The affinity of
the T560 pIgR for IgM vs IgA is difficult to compare with that
measured in different laboratories because it depends on what species is under consideration and whether the pIgR is free (as SC in
solution) or cell bound. For instance, human IgM has a Ka 2–12.5
times that of dimeric IgA in binding to human SC in solution (43,
44) but binds to human pIgR on the surface of transfected MadinDarby canine kidney epithelial cells with much lower and more
nearly equal affinity, though the amount of IgM bound per cell is
3-fold higher (45). The affinity of binding also depends on the
source of the pIg; for example, one of us (R.B.C.) has found that
while mouse pIgA, like human pIgA and IgM, binds to human SC
in an ELISA, mouse IgM does not, implying that differences between human and mouse IgM affect their interaction with human
SC; in addition, human pIgA has a lower affinity for human than
for rabbit pIgR (46).
Although human pIgR and the T560 mouse pIgR bind both
pIgA and IgM, rabbit (44) and rat (47) hepatocyte pIgR bind only
pIgA well and do not translocate IgM into bile. Because mouse
liver similarly translocates pIgA but not IgM into bile (48, 49), it
is generally assumed that mouse hepatocyte pIgR resembles rat
and rabbit pIgR and binds IgM poorly or not at all. If this is true,
then the difference between the mouse hepatocyte and the T560
pIgR that makes the latter behave more like human pIgR must be
explained. Given that the amino acid sequences of the mouse hepatocyte and T560 B cell pIgRs are the same except for the Val to
Ala change in domain 2, the difference most likely reflects differential folding or glycosylation of the pIgR, probably the latter. It is
easy to imagine that a bulky carbohydrate on hepatocyte-derived
pIgR could interfere with IgM but not with IgA binding. Furthermore, it has already been shown that deglycosylation of human SC
allows it to inhibit binding of biotinylated native SC to pIgA with
10 times greater efficiency than native SC itself (50), suggesting
that some of the carbohydrate moieties on human pIgR may actually impede binding even of pIgA.
Initial, high-affinity, noncovalent binding of pIgA or IgM to
the epithelial cell pIgR involves interaction with its first domain
(50 –54). This first domain of the pIgR contains three Ig-related
The Journal of Immunology
FIGURE 11. Immunoblot showing IgA from the T15 and M315 IgA
myelomas from mouse whey and from lysates and supernatants of
T560.2.F7 cells. The cells were grown for 3 days to a density of 1.6 ⫻
106/ml. The cells contained in 35 ml culture fluid were centrifuged out and
lysed with 0.5% Nonidet P-40. The supernatants were concentrated 10-fold
by ultrafiltration. Both the lysates and supernatants were then adsorbed to
protein G beads coated with goat anti-mouse ␣-chain Ab. After washing,
bound IgA was eluted from the beads with Laemli sample buffer without
reducing agent, run on 5% SDS-PAGE, and blotted onto ␨-probe membranes.
The membranes were stained with HRP-goat anti-mouse ␣-chain Ab. High
molecular mass bands in the mouse whey lane represent murine S-IgA.
binding to T560 cells only when they contained J chain. However,
it is still not known what function J chain performs in binding to
pIgR, and the requirement for it may not be absolute (16 –18)
because some pIgAs lacking J chain do bind to pIgR (60, 61). J
chain may merely hold the IgA and IgM subunits with their loops
in a configuration necessary for their interaction with the pIgR or
may itself interact with pIgR. Isolated J chain dimers bind only
marginally to SC (16), but Abs to certain J chain epitopes can
block binding of intact pIg to SC (62) and prevent pIgR-mediated
biliary and epithelial transport of human pIgA (63), suggesting that
J chain may participate in binding to pIgR. Only one J chain is
present in any given IgA polymer or IgM pentamer (64). Differences in the sizes of the IgA polymers or ratios of IgM pentamer with J chain to hexamer without J chain in the proteins we
used might account for the differences in binding observed in
our experiments with human polymeric vs dimeric IgA and with
MOPC-104E vs TEPC-183 vs the separated polymeric fraction
of SP-6 IgM.
The ability of murine IgG2a (UPC-10) to inhibit binding of both
pIgA and IgM to the murine pIgR is unexplained. T560 exhibits
low-level direct binding of a second mouse IgG2a myeloma protein (UN2S1) in rosette assays (9) so the inhibitory effect may not
be restricted to the UPC-10 IgG2a myeloma protein. Inhibition
might depend on sharing of one or more binding structures between IgM, IgA, J chain or pIgR, and murine IgG2a. Alternatively,
it might depend on some interaction between IgG2a and another
molecule on the T560 cell surface that down-regulates the pIgR by,
for example, activating PKC (9). Optimal expression of the pIgR
on T560 cells is seen when the cells have been cultured in fresh
medium before being washed and used in the assay. This thorough
washing procedure may allow the pIgR on T560 cells to recover
from down-regulation or inhibition by the IgG2a the cells themselves secrete. It was originally instituted because we thought that
IgA secreted by T560 (20) might block the IgA/IgM receptor.
However, this is unlikely to be the case because all of the IgA
contained in both T560 cell lysates and supernatants (no more than
10 ng IgA/ml of supernatant at the end of a 3-day culture) is monomeric. Perhaps T560 cells do not make J chain due to some
unknown defect in J chain mRNA (detectable in T560 by RTPCR). None of the T560 IgA is converted to S-IgA, which is
consistent with the fact that monomeric IgA does not bind to the
pIgR. We conclude that endogenously produced IgA is not capable
of autocrine stimulation of T560 cells through the pIgR.
Activation of PKC down-regulates T560 IgA binding activity
(9, 35), which we now know represents pIgR activity. The mechanism of down-regulation is not clear. We previously showed (9)
that, after down-regulation by PMA, receptor activity recovered
slowly (over several hours) even in the presence of cycloheximide,
suggesting that the receptor had not been shed or degraded and that
a recycling mechanism might be involved. In Madin-Darby canine
kidney cells, activation of PKC by PMA causes transcytosis and
apical recycling of transfected pIgR but does not stimulate endocytosis at the basolateral surface; i.e., in these polarized cells, pIgR
is transcytosed from the basolateral surface to the apical recycling
compartment and then delivered to the apical surface more rapidly
in the presence than in the absence of PMA (65). T560 B cells are
nonpolar, and nothing is known about the membrane compartment
with which their pIgR is associated. Perhaps activation of PKC in
T560 cells promotes endocytosis of pIgR rather than an increase in
its surface expression.
That T560, a B lymphoma, expresses pIgR at all is a novelty. It
raises the question whether pIgR expression occurs naturally on a
small cohort of normal B cells, of which T560 is a transformed
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
complementarity determining region (CDR)1-, CDR2-, and
CDR3-like loops (see Fig. 10) that may form a binding surface,
much as they would in a conventional Ig (52). The CDR1-like loop
of human pIgR is essential for binding human pIgA (50, 53, 54),
but a distinct binding site containing the CDR2-like loop is critical
for binding IgM (55). The amino acid sequences of mouse and rat
pIgR CDR-2 loops are identical but have Asn in place of the human Glu and rabbit Thr at position 53. However, the amino acid
sequence following this Asn is incompatible with its being a potential glycosylation site that could be variably glycosylated in
mouse hepatocytes vs B cells (34). If differential glycosylation is,
as suggested above, involved in rendering the pIgR of mouse B
cells more capable of binding IgM than mouse hepatocytes, it must
be at some other site.
Blocking experiments using Fab of Ab to discrete epitopes in
human C␣2 and C␣3 suggest that both of these domains are involved in the interaction between human dimeric IgA and rabbit
SC (56), but recent studies with a panel of IgA1/IgG1 constant
region “domain swap” mutants implicate a peptide in C␣3 rather
than C␣2 in binding of human IgA to human pIgR (57). A tentative
model depicting the interaction of SC with dimeric IgA aligns
pIgR domain 1 with C␣2 of one IgA subunit and pIgR domain 5
with C␣2 of the second subunit (57). It has been suggested (50)
that initial binding of pIgA to pIgR domain 1 may be followed by
less avid interactions between the remaining pIgR domains and
pIgA that result in conformational changes and closer alignment of
pIgR with pIgA. Late in transcytosis of pIgA-pIgR complexes, a
covalent bond is formed between a highly conserved Cys residue
in pIgR domain 5 and Cys311 in the C␣2 domain in one of the pIgA
heavy chains (58, 59). Obviously, for this to happen these two
domains must somehow be brought close together. That they have
an affinity for one another that contributes to the overall affinity of
binding is not supported, at least for the mouse system, by our
data; it made no significant difference to IgA rosette formation
whether either of the two C␣2 Cys involved in interchain disulfide
bonding were mutated to Ala. Of particular relevance, mutation of
Cys311, which is actually used in disulfide bridging to SC, had no
effect. This does not, of course, argue against the idea that a linear
epitope of C␣2 independent of interchain S-S bonding might be
involved in initial binding of dimeric IgA to pIgR domain 1.
The requirement for J chain for binding of IgM to the pIgR has
been used in the present work as a criterion identifying our T560
IgA/IgM receptor as pIgR: two different IgMs proved capable of
2553
2554
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
References
28.
1. Daeron, M. C. 1997. Fc receptor biology. Annu. Rev. Immunol. 15:203.
2. Tsujimura, K., Y.-H. Park, M. Miyama-Inaba, T. Meguro, T. Ohno, M. Ueda, and
T. Masuda 1990. Comparative studies on FcR (FcRII, FcRIII, and Fc␣) functions
of murine B cells. J. Immunol. 144:4571.
3. Strober, W., N. E. Hague, L. G. Lum, and P. A. Henkart. 1978. IgA-Fc receptors
on mouse lymphoid cells. J. Immunol. 121:2440.
4. Hoover, R. G., and R. G. Lynch. 1980. Lymphocyte surface membrane Ig in
myeloma II: T cells with IgA-Fc receptors are markedly increased in mice with
IgA plasmacytomas. J. Immunol. 125:1280.
5. Hoover, R. G., B. K. Dickgraeffe, and R. G. Lynch 1981. T cells with Fc receptors
for IgA: induction of T␣ cells in vivo and in vitro by purified IgA. J. Immunol.
127:1560.
6. Yodoi, J., M. Adachi, and T. Masuda 1982. Induction of FcR␣ on murine lymphocytes by IgA in vitro. J. Immunol. 128:888.
7. Adachi, M., J. Yodoi, N. Noro, T. Masuda, and J. Uchino. 1984. Murine IgA
binding factors produced by Fc␣R⫹ T cells: role of Fc␥R⫹ cells for the induction
of Fc␣R and formation of IgA-binding factor in Con A-activated cells. J. Immunol. 133:65.
8. Yodoi, J., M. Adachi, and N. Noro. 1987. IgA binding factors and Fc receptors
for IgA: comparative studies between IgA and IgE Fc receptor systems. Int. Rev.
Immunol. 2:117.
9. Rao, T. D., A. A. Maghazachi, A. V. Gonzalez, and J. M. Phillips-Quagliata
1992. A novel IgA receptor expressed on a murine B cell lymphoma. J. Immunol.
149:143.
10. Mostov, K. E., M. Friedlander, and G. Blobel. 1984. The receptor for transepithelial transport of IgA and IgM contains multiple immunoglobulin-like domains.
Nature 308:37.
11. Mostov, K. E., J. P. Kraehenbuhl, and G. Blobel. 1980. Receptor-mediated transcellular transport of immunoglobulin: synthesis of secretory component as multiple and larger transmembrane forms. Proc. Natl. Acad. Sci. USA 77:7257.
12. Mostov, K. E., and G. Blobel, 1982. A transmembrane precursor of secretory
component. J. Biol. Chem. 257:11816.
13. Hoppe, C. A., T. P. Connolly, and A. L. Hubbard. 1985. Transcellular transport
of polymeric IgA in the rat hepatocyte: biochemical and morphological characterization of the transport pathway. J. Cell Biol. 101:2113.
14. Aicher, W. K., M. L. McGhee, J. R. McGhee, Z. Moldoveanu, V. J. Kidd,
M. Tomana, J. Mestecky, J. H. Eldridge, T. F. Meyer, and H. Kiyono. 1992.
Properties of IgA-binding receptors on murine T cells: relative importance of
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
Fc␣R, ␤-galactosyltransferase and anti-secretory component reactive proteins
(ASCP). Scand. J. Immunol. 35:469.
Crago, S. S., C. J. Word, and T. B. Tomasi. 1989. Antisera to the secretory
component recognize the murine Fc receptor for IgA. J. Immunol. 142:3909.
Brandtzaeg, P. 1985. Role of J chain and secretory component in receptor-mediated glandular and hepatic transport of immunoglobulins in man. Scand. J. Immunol. 22:111s.
Brandtzaeg, P., and H. Prydz. 1984. Direct evidence for an integrated function of
J chain and secretory component in epithelial transport of immunoglobulins. Nature 311:71.
Hendrickson, B. A., D. A. Conner, D. J. Ladd, D. Kendall, J. Casanova,
B. Corthesy, E. A. Max, M. Neutra, C. E. Seidman, and J. G. Seidman, 1995.
Altered hepatic transport of immunoglobulin A in mice lacking the J chain.
J. Exp. Med. 182:1905.
Mathur, A., R. G. Lynch, and G. Kohler. 1988. The contribution of constant
region domains to the binding of murine IgM to Fc␮ receptors on T cells. J. Immunol. 140:143.
Faria, A. M. C., T. D. Rao, and J. M. Phillips-Quagliata 1995. A new IgA receptor
expressed on a highly activated murine B cell lymphoma. In Advances in Mucosal Immunology, Vol. A. J. McGhee, J. Mestecky, M. W. Russell, S. Jackson,
S. M. Michalek, H. Tlaskalová-Hogenova, and J. Sterzl, eds. Plenum, New York,
p. 663.
Phillips-Quagliata, J. M., A. M. C. Faria, J. Han. D. H. Spencer, G. Haughton,
and P. Casali. 1999. The IgA produced by the murine T560 B lymphoma, that
arose during a graft-versus-host reaction, is polyreactive and somatically mutated.
Autoimmunity 29:215.
Rao T. D., A. A. Maghazachi, A. M. C. Faria, R. S. Basch, and
J. M. Phillips-Quagliata. 1992. T560: an (H-2b ⫻ H-2a) F1 hybrid, phosphorylcholine (PC)-binding, murine B cell lymphoma that bears receptors for IgA and
IgG, presents antigen and secretes IL-4. Int. Immunol. 3:107.
Hendrickson, B. A., L. Rindisbacher, B. Corthesy, D. Kendall, D. A. Waltz,
M. R. Neutra, and J. G. Seidman. 1996. Lack of association of secretory component with IgA in J chain-deficient mice. J. Immunol. 157:750.
Springer, T., J. T. Bhattacharya, J. T. Cardoza, and F. Saanchez-Madrid. 1982.
Monoclonal antibodies specific for rat IgG1, IgG2a, and IgG2b subclasses and
␬-chain monotypic and allotypic determinants: reagents for use with rat monoclonal antibodies. Hybridoma 1:257.
Rinfret, A., C. Horne, H. Boux, A. Marks, K. J. Dorrington, and M. Klein. 1990.
Isotype modulation of idiotypic expression in recombinant isotypic variants of
MOPC 315. J. Immunol. 145:925.
Tucker, P. W., J. L. Slightom, and F. R. Blattner. 1981. Mouse IgA heavy chain
gene sequence: implications for evolution of immunoglobulin hinge exons. Proc.
Natl. Acad. Sci. USA 78:7684.
Davis, A. C., K. H. Roux, J. Pursey, and M. J. Shulman. 1989. Intermolecular
disulfide bonding in IgM: effects of replacing cysteine residues in the ␮ heavy
chain. EMBO J. 8:2519.
Fazel, S, E. J. Wiersma, and M. J. Shulman. 1997. Interplay of J chain and
disulphide bonding in assembly of polymeric IgM. Int. Immunol. 9:1149.
Wiersma, E. J., C. Collins, S. Fazel, and M. J. Shulman. 1998. Structural and
functional analysis of J chain-deficient IgM. J. Immunol. 160:5979.
Randall, T. D., J. W. Brewer, and R. B. Corley. 1992. Direct evidence that J chain
regulates the polymeric structure of IgM in antibody-secreting B cells. J. Biol.
Chem. 267:18002.
Woodward, M. P., W. W. Young, and R. A. Bloodgood. 1985. Detection of
monoclonal antibodies specific for carbohydrate epitopes using periodate oxidation. J. Immunol. Methods 178:143.
Monteiro, R. C., H. Kubagawa, and M. D. Cooper. 1990. Cellular distribution,
regulation and biochemical nature of an Fc␣ receptor in humans. J. Exp. Med.
171:597.
Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227:680.
Piskurich, J. F., M. H. Blanchards, K. R. Youngman, J. A. France, and
C. S. Kaetzel. 1995. Molecular cloning of the mouse polymeric Ig receptor.
J. Immunol. 154:1735.
Aicher, W. K., M. L. McGhee, J. R. McGhee, J. H. Eldridge, K. W. Beagley,
T. F. Meyer, and H. Kiyono, 1990. Mouse IgA Fc receptor on CD3⫹ T cells.
Molecular forms of IgA that bind to a 38-kDa Fc␣R protein and development of
an anti-Fc␣R antisera. J. Immunol. 145:1745.
Phillips-Quagliata, J. M., T. D. Rao, A. A. Maghazachi, A. Gonzalez, and
M. C. Faria. 1991. Sensitivity of receptors for IgA on T560, a murine B lymphoma, to phorbol myristate acetate and to phosphatidylinositol-specific phospholipase C. Immunol. Res. 10:432.
Swenson, C. D., T. Patel, R. B. Parekh, S. M. Lakshmi Tamma, R. F. Coico,
G. J. Thorbecke, and A. R. Amin. 1998. Human T cell IgD receptors react with
O-glycans on both human IgD and IgA1. Eur. J. Immunol. 28:2366.
Carayannopoulos, L., J. M. Hexham, and J. D. Capra. 1996. Localization of the
binding site for the monocyte immunoglobulin (Ig) A-Fc receptor (CD89) to the
domain boundary between Ca2 and Ca3 in human IgA1. J. Exp. Med. 183:1579.
Mattu, T. S., R. J. Pleass, A. C. Willis, M. Kilian, M. R. Wormald, A. C. Lelouch,
P. M. Rudd, J. M. Woof, and R. A. Dwek. 1998. The glycosylation and structure
of human serum IgA1, Fab, and Fc regions and the role of N-glycosylation on
Fc␣ receptor interactions. J. Biol. Chem. 273:2260.
Maliszewski, C. R., C. J. March, M. A. Schoenborn, S. Gimpel, and L. Shen.
1990. Expression cloning of a human Fc receptor for IgA. J. Exp. Med. 172:1665.
Sanders, S. K., H. Kubagawa, T. Suzuki, J. L. Butler, and M. D. Cooper. 1987.
IgM-binding protein expressed by activated B cells. J. Immunol. 139:188.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
representative, or whether it is due to some aspect of the transformation process. Support for the notion that pIgR may be expressed
on normal or activated lymphocytes comes from work showing
that the splenocytes of mice carrying an IgA-secreting myeloma
express IgA receptors whose ability to bind IgA is blocked by
rabbit anti-rat SC (15). No other evidence indicating expression of
pIgR by normal lymphoid cells has appeared, although numerous
immunohistochemical studies have shown binding of anti-SC Abs
to human intestinal epithelial cells in health and disease (65). If
binding of anti-SC Abs to mucosal lymphocytes were common, it
should surely have been recorded. Perhaps expression of the pIgR
on the T560 lymphoma initially occurred as a response to cytokines available during malignant transformation. T560 is highly
activated (22) with heavily mutated Ig heavy and light chains (21)
and originated in the GALT of an F1 hybrid mouse that had been
injected with parental splenocytes. Although signs of an ongoing
graft-vs-host reaction were not apparent at the time of sacrifice, a
graft-vs-host reaction had probably been initiated and then abrogated. Graft-vs-host reactions involve release of many cytokines
that might up-regulate pIgR on an activated B cell (64) that was
subsequently transformed. In several human systems, synergy between IFN-␥ and IL-4 in up-regulating pIgR has been reported
(66). Whether these same cytokines would function in the same
way with respect to murine B cells is unknown, but it may be
significant that T560 secretes IL-4 (22). An alternative hypothesis,
suggested to us by Dr. Randy Goldblum (University of Texas
Medical Branch, Galveston, TX), is that the pIgR gene, normally
localized to chromosome 1 in both human (67, 68) and mouse (69),
has been switched on in T560 as a consequence of translocation
events that put it under the control of the promoter of some other
constitutively activated gene. We have not investigated the chromosomes of T560 and do not know the genetic mechanism of its
transformation.
B CELL POLY-Ig RECEPTOR
The Journal of Immunology
57. Hexham, J. M., K. D. White, L. N. Carayannopoulos, W. Mandecki, R. Brisette,
Y.-S. Yang, and J. D. Capra, 1999. A human immunoglobulin (Ig)A C␣3 domain
motif directs polymeric Ig receptor-mediated secretion. J. Exp. Med. 189:747.
58. Fallgreen-Gebauer, E., W. Gebauer, A. Bastian, H. D. Kratzin, H. Eiffert,
B. Zimmermann, M. Karas, and N. Hilschmann. 1993. The covalent linkage of
secretory component to IgA. Biol. Chem. Hoppe-Seyler 374:1023.
59. Chintalcharuvu, K. R., A. S. Tavill, L. N. Louis, J.-P. Vaerman, M. E. Lamm, and
C. S. Kaetzel. 1994. Disulphide bond formation between dimeric immunoglobulin A and the polymeric immunoglobulin receptor during hepatic transcytosis.
Hepatology 19:162.
60. Tomasi, T. B., and D. S. Czerwinski. 1976. Naturally occurring polymers of IgA
lacking J chain. Scand. J. Immunol. 5:647.
61. Crottet, P., S. Cottet, and B. Corthésy. 1999. Expression, purification and biochemical characterization of recombinant murine secretory component: a novel
tool in mucosal immunology. Biochem. J. 341:299.
62. Brandtzaeg, P. 1975. Blocking effect of J chain and J-chain antibody on the
binding of secretory component to human IgA and IgM. Scand. J. Immunol.
4:837.
63. Vaerman, J.-P., E. E. Langendries, D. A. Giffroy, C. S. Kaetzel,
C. M. Tamer Fiani, I. Moro, P. Brandtzaeg, and K. Kobayashi, 1998. Antibody
against the human J chain inhibits polymeric Ig receptor-mediated biliary and
epithelial transport of human polymeric IgA. Eur. J. Immunol. 28:171.
64. Koshland, M. E. 1975. Structure and function of the J chain. Adv. Immunol.
20:41.
65. Cardone M. H., B. L. Smith, W. Song, D. Mochly-Rosen, and K. Mostov. 1994.
Phorbol myristate acetate-mediated stimulation of transcytosis and apical recycling in MDCK cells. J. Cell Biol. 124:717.
66. Mostov, K., and C. S. Kaetzel. 1999. Immunoglobulin transport and the polymeric immunoglobulin receptor. In Mucosal Immunology, 2nd Ed. J. Mestecky,
J. Bienenstock, J. McGhee, M. Lamm, W. Strober., and P. Ogra, eds. Academic,
San Diego, p. 181.
67. Davidson, M. K., M. M. Le Beau, R. L. Eddy, T. B. Show, L. A. DiPietro,
M. Kingzette, and W. C. Hanly. 1988. Genetic mapping of the human polymeric
immunoglobulin receptor gene to chromosome region 1q31– q41. Cytogenet. Cell
Genet. 48:107.
68. Krajci, P., K. H. Grzeschik, A. H. M. Guerts van Kessel, B. Olaison and P.
Brandtzaeg. 1991. The human transmembrane secretory component (poly-Ig receptor) molecular cloning, restriction fragment length polymorphism and chromosomal sublocalization. Hum. Genet. 87:642.
69. Kushiro, A., and T. Sato. 1997. Polymeric immunoglobulin receptor gene of
mouse: sequence, structure and chromosomal location. Gene 204:277.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
42. Nakamura, T., H. Kubagawa, T. Ohno, and M. D. Cooper. 1993. Characterization
of an IgM Fc-binding receptor on human T cells. J. Immunol. 151:6933.
43. Brandtzaeg, P. 1977. Human secretory component VI: immunoglobulin-binding
properties. Immunochemistry 14:179.
44. Socken, D. J., and B. J. Underdown. 1978. Comparison of human, bovine and
rabbit secretory component-immunoglobulin interactions. Immunochemistry 15:
499.
45. Natvig, I. B., F.-E. Johansen, T. W. Nordeng, G. Haraldsen, and P. Brandtzaeg.
1997. Mechanism for enhanced external transfer of dimeric IgA over pentameric
IgM: studies of diffusion, binding to the human polymeric Ig receptor, and epithelial transcytosis. J. Immunol. 159:4330.
46. Natvig Norderhaug, I., F.-E. Johansen, P. Krajci, and P. Brandtzaeg. 1999. Domain deletions in the human polymeric Ig receptor disclose differences between
its dimeric IgA and pentameric IgM interaction. Eur. J. Immunol. 29:3401.
47. Underdown, B. J., I. Switzer, and G. D. F. Jackson. 1992. Rat secretory component binds poorly to rodent IgM. J. Immunol. 149:487.
48. Brown, T. A., M. W. Russell, R. Kulhavy, and J. Mestecky. 1983. IgA-mediated
elimination of antigens by the hepatobiliary route. Fed. Proc. 42:3218.
49. Phillips, J. O., M. W. Russell, T. A. Brown, and J. Mestecky. 1984. Selective
hepatobiliary transport of human polymeric IgA in mice. Mol. Immunol. 21:907.
50. Bakos, M.-A., A. Kurosky, and R. M. Goldblum. 1991. Characterization of a
critical binding site for human polymeric Ig on secretory component. J. Immunol.
147:3419.
51. Bakos, M. A., A. Kurosky, C. S. Woodard, R. M. Denney, and R. M. Goldblum,
1991. Probing the topography of free and polymeric Ig-bound human secretory
component with monoclonal antibodies. J. Immunol. 146:162.
52. Bakos, M.-A., A. Kurosky, E. W. Czerwinsky, and R. M. Goldblum. 1993. A
conserved binding site on the receptor for polymeric Ig is homologous to CDR1
of IgV␬ domains. J. Immunol. 151:1346.
53. Frutiger, S., G. J. Hughes, W. C. Hanly, M. Kingzette, and J. C. Jaton, 1986. The
amino-terminal domain of rabbit secretory component is responsible for noncovalent binding to immunoglobulin A dimers. J. Biol. Chem. 261:16673.
54. Coyne, R. S., M. Siebrecht, M. C. Peitsch, and J. E. Casanova, 1994. Mutational
analysis of polymeric immunoglobulin receptor/ligand interactions: evidence for
the involvement of multiple complementarity determining region (CDR)-like
loops in receptor domain 1. J. Biol. Chem. 269:31620.
55. Roe, M., I. N. Norderhaug, P. Brandtzaeg, and F.-E. Johansen. 1999. Fine specificity of ligand-binding domain 1 in the polymeric Ig receptor: importance of the
CDR2-containing region for IgM interaction. J. Immunol. 162:6046.
56. Geneste, C., S. Iscaki, R. Mangalo, and J. Pillot 1986. Both Fc␣ domains of
human IgA are involved in in vitro interaction between secretory component and
dimeric IgA. Immunol. Lett. 13:221.
2555