The influence of opioids on gastric function:
experimental and clinical studies
Örebro Studies in Medicine 14
Jakob Walldén
The influence of opioids on gastric function:
experimental and clinical studies
© Jakob Walldén, 2008
Title: The influence of opioids on gastric function:
experimental and clinical studies
Publisher: Örebro University 2008
www.oru.se
Editor: Maria Alsbjer
[email protected]
Printer: Intellecta DocuSys, V Frölunda 02/2008
issn 1652-4063
isbn 978-91-7668-583-9
+,*,
(;EI< 5;FF>kH 2B? CH@FO?H=? I@ IJCIC>M IH A;MNLC= @OH=NCIH ?RJ?LCG?HN;F ;H>
=FCHC=;FMNO>C?MhL?<LI1NO>C?MCH+?>C=CH?
14. 66 JJ.
@N?L ;H?MNB?MC; ;H>IL MOLAC=;F JLI=?>OL?M
A;MNLICHN?MNCH;F GINCFCNS CM =IGGIHFS
CGJ;CL?> 2B? =;OM?M ;L? GOFNC@;=NILC;F
QCNB MOLAC=;F NL;OG;
J;CH ;H> J?LCIJ?L;NCP?
>LOAM JF;SCHA ; G;DIL LIF? 2BCM NB?MCM ?RJFIL?M IJCIC> ?@@?=NM IH A;MNLC= GINCFCNS CH
B?;FNBSPIFOHN??LM;H>J;NC?HNMOH>?LAICHAMOLA?LS
%;MNLC= ?GJNSCHA Q;M MNO>C?> <S ;H ;<MILJNCIH N?MN J;L;=?N;GIF G?NBI>
;H> CH
B?;FNBS PIFOHN??LM ; L?GC@?HN;HCF CH@OMCIH >?F;S?> A;MNLC= ?GJNSCHA I>S JIMCNCIH
;FN?L?>?GJNSCHA>OLCHANB?=IHNLIFMCNO;NCIHM
<ONHIN>OLCHANB?L?GC@?HN;HCFCH@OMCIH
$OLNB?L
NQI ;H?MNB?NC= G?NBI>M Q?L? =IGJ;L?> ;H> HI >C@@?L?H=?M Q?L? @IOH> CH
CGG?>C;N? JIMNIJ?L;NCP? A;MNLC= ?GJNSCHA <?NQ??H ; L?GC@?HN;HCFJLIJI@IF <;M?>
CHNL;P?HIOM ;H?MNB?MC; ;H> ;H IJCIC> @L?? CHB;F;NCIH;F ;H?MNB?MC;
;FNBIOAB NB?
CHN?LCH>CPC>O;F P;LC;<CFCNS Q;M BCAB .LIRCG;F A;MNLC= NIH? Q;M MNO>C?> OMCHA ; A;MNLC=
<;LIMN;N H CH@OMCIH I@ L?GC@?HN;HCF =;OM?> NQI J;NN?LHM I@ L?;=NCIH L?A;L>CHA A;MNLC=
NIH?
QCNB B;F@ I@ NB? MO<D?=NM CH=L?;MCHA ;H> B;F@ >?=L?;MCHA CH A;MNLC= NIH? %;MNLC=
GSI?F?=NLC=;F;=NCPCNSQ;M?P;FO;N?>QCNB?F?=NLIA;MNLIAL;JBS#%%
;H>;<IFOM>IM?I@
@?HN;HSF =;OM?> ; >?=L?;M? CH @L?KO?H=S I@ NB? A;MNLC= MFIQ Q;P?M IL >CMLOJN?> NBCM
;=NCPCNS &IQ?P?L
NB? ;=NCPCNS Q;M OH;@@?=N?> CH B;F@ I@ NB? CHP?MNCA;N?> MO<D?=NM
H;FSMCM I@ JIFSGILJBCMGM % ;H> %! CH NB? bIJCIC> L?=?JNIL A?H? Q;M
J?L@ILG?> NI @CH> ;H ?RJF;H;NCIH @IL NB? AL?;N CHN?LCH>CPC>O;F P;LC;NCIHM M??H CH NB?
<;LIMN;N;H>#%%MNO>C?M
<ONHI;MMI=C;NCIH=IOF><?@IOH>
2B?M? MNO>C?M B;P? MBIQH NB;N IJCIC>M B;P? JLIHIOH=?> ?@@?=NM IH A;MNLC= GINCFCNS
QCNBP;LC;<F?CH>CPC>O;FL?MJIHM?MNB;N;L?>C@@C=OFNNIJL?>C=N.IFSGILJBCMGMCHNB?b
IJCIC> L?=?JNIL A?H? =IOF> HIN ?RJF;CH NB? P;LC;NCIHM .IMNIJ?L;NCP?FS
INB?L @;=NILM
GCABN=IHNLC<ON?GIL?NB;HIJCIC>MNINB?CGJ;CLG?HNCHA;MNLC=GINCFCNS
)<:35(6 A;MNLICHN?MNCH;F GINCFCNS
A;MNLC= ?GJNSCHA
A;MNLC= NIH?
?F?=NLIA;MNLIAL;JBS
;H;FA?MC=M
IJCIC>M
bIJCIC>L?=?JNIL
JIFSGILJBCMG (;EI<5;FF>kH
"?JNI@H?MNB?MC;
1OH>MP;FF&IMJCN;F
1OH>MP;FF
1Q?>?H
?G;CFD;EI<Q;FF>?HFPHM?
&&',,'"' #@N?L IJ?L;NCIH I=B ;H?MN?MC @jL J;NC?HN?L I@N; ?H H?A;NCP JjP?LE;H Jj G;AMi=E
I=BN;LG;L'FF;Gj?H>?I=BELiEHCHA;LiL?NNMNILNJLI<F?GI=BGjHA;B;LMPjLN
;NNEIGG;CAjHAG?>CHN;A;P@l>;I=BHILG;FN;LG@OHENCIH>jG;AMi=E?HI=B
N;LG;LH;^MNjLMNCFF;^$F?L;@;ENIL?L<C>L;L<F;MGiLN;H
>?NECLOLACME;NL;OG;N
I=B>?FiE?G?>?FPCA?LCM;G<;H>G?>;H?MN?MCHP>?M?H;L?iLIJCIC>?L
>PM
GIL@CH I=B GIL@CHFCEH;H>? FiE?G?>?F
MN;LEN <C>L;A;H>? ' >?NN; ;PB;H>FCHAM
;L<?N?B;LIJCIC>?LM?@@?EN?LJjG;AMi=E?HMGINCFCN?NMNO>?L;NM
+?> ?NN ;<MILJNCIHMN?MN J;L;=?N;GIFG?NI>?H MNO>?L;>?M BIM @LCPCFFCA; BOL
IJCIC>?H L?GC@?HN;HCF JjP?LE;L G;AMi=EMNlGHCHA I=B IG ELIJJMJIMCNCIH?H B;L
<?NS>?FM?@lLNlGHCHAMB;MNCAB?N?HONCN;LG?H0?GC@?HN;HCF@lL>LlD>?G;AMi=EM
NlGHCHA?H I=B OH>?L JjAj?H>? IJCIC> <?B;H>FCHA B;>? ELIJJMJIMCNCIH?H CHA?H
MNlLL? <?NS>?FM?
PCFE?N >?N >iL?GIN B;>? OH>?L EIHNLIFF@lLMlE?H +?> M;GG;
G?NI> DiG@lL>? PC BIM J;NC?HN?L NPj ;H?MN?MCG?NI>?L I=B MNO>?L;>? G;AMi=EM
NlGHCHA >CL?EN ?@N?L ?H IJ?L;NCIH 'HA?H MECFFH;> EOH>? JjPCM;M G?FF;H ?H
IJCIC><;M?L;> I=B ?H IJCIC>@LC ;H?MN?MC
G?H CHIG L?MJ?ENCP? ALOJJ P;L >?N ?H
MNILP;LC;NCIHCG;AMi=EMNlGHCHAG?FF;HCH>CPC>?LH;
+?>?H<;LIMN;NMNO>?L;>?MNIHOMClPL?>?F?H;PG;AMi=E?H&IMBiF@N?H;P>?
@LCPCFFCA;ILM;E;>?L?GC@?HN;HCF?HlEHCHA;PNIHOMI=BBIM>?H;H>L;BiF@N?H?H
GCHMEHCHA ;P NIHOM 4C>;L? OH>?LMlEN?M BIM ?H ALOJJ J;NC?HN?L IJCIC>?H
@?HN;HSFM JjP?LE;H Jj >?H ?F?ENLCME; ;ENCPCN?N?H C G;AMi=E?H +?> ?H ?F?ELIA;
MNLIAL;@ #%% L?ACMNL?L;>?M >? FjHAM;GG; ?F?ENLCME; PjAIL MIG EIIL>CH?L;L
GOME?FLlL?FM?LH; C G;AMi=E?H &IM BiF@N?H ;P >? OH>?LMlEN; JjP?LE;>?M
;ENCPCN?N?H ;P @?HN;HSF G?> ?H MiHEN PjA@L?EP?HM ?FF?L OJJBlL;H>? ;P PjAIL
G?>;H ;ENCPCN?N?H P;L IJjP?LE;> BIM >?H lPLCA; BiF@N?H $lL ;NN @CHH; ?H
@lLEF;LCHANCFFP;LC;NCIH?HADIL>?MA?H?NCME;;H;FSM?L;PA?H?H@lLIJCIC>L?=?JNILH
BIM >? OH>?LMlEN; C <;LIMN;N I=B #%% MNO>C?LH; 4;LC;NCIH?L C A?HIG?N
ME
JIFSGIL@CMG
P;LCHN?;MMI=C?L;>NCFFON@;FF?HCMNO>C?LH;
1NO>C?LH;B;LPCM;NJj;NNIJCIC>?LB;L?HONN;F;>?@@?ENJjG;AMi=E?HMGINCFCN?N
I=B ;NN >?H P;LC?L;L EL;@NCAN G?FF;H CH>CPC>?L .IFSGIL@CMG C A?H?H @lL IJCIC>
L?=?JNILH @lLEF;L;>? CHN? MECFFH;>?H G?FF;H CH>CPC>?L "CL?EN ?@N?L IJ?L;NCIH
<C>L;L M;HHIFCEN ;H>L; @;ENIL?L iH ;H?MN?MCG?NI> NCFF >?N P;LC;<F; ON@;FF?N C
G;AMi=EMNlGHCHA
"$% &&%%%%! &!!) ""$%))$$$&!*
&$! '$%
0$ &&)
-*!%&$"&* '*$ & % !&
' *"!%&'$-
"#""
$
0$ 0(#(%&/&&)&&)
-&! %&&& #'! $*"!%&!"$&(%&$
"&* !"$%! !"$!"!!$ & !"!$
%(!'$ %&%-
$!"#"
0$ $
&&)
-&%!$ & ! %&$&! -
$##
$
0$ &&)
+&%! & *! %&$*!&$&(&*,"!%%
%%!&! &!"!*!$"%%!&.!"!$"&!$ -
#! $##"#"%
"$ &%)$)&"$%%! %$!&"'%$%!'$ %
&'*$"$ &)& "$%%! !"" !&&% %
&'*$"$ &)& "$%%! !"$ $ '% %%
*.","('+
1=F;MM
G?LC=;H 1I=C?NS I@ H?MNB?MCIFIACMNM .BSMC=;F 1N;NOM
!F;MMC@C=;NCIHMSMN?G
3!
L?;OH>?LNB?=OLP?
!,1
!?HNL;FH?LPIOMMSMN?G
!-
!;L<IH>CIRC>?
#%%
#,1
#F?=NLIA;MNLIAL;JBS
#HN?LC=H?LPIOMMSMN?G
%#
%;MNLC=?GJNSCHA
%'
%;MNLICHN?MNCH;F
'!!
'HN?LMNCNC;F=?FFMI@!;D;F
'!3
'HN?HMCP?=;L?OHCN
'4
'HNL;P?HIOM
*&"
*?@NF;N?L;FB?;>>IQHJIMCNCIH
++!
+CAL;NCHAGINIL=IGJF?R
+,26
+?NBSFH;FNL?RIH?
+-0
bIJCIC>L?=?JNIL
,,!
HIH;>L?H?LAC=HIH=BIFCH?LAC=
-.0+
bIJCIC>L?=?JNIL
.-'
.IMNIJ?L;NCP?CF?OM
.-,4
.IMNIJ?L;NCP?H;OM?;;H>PIGCNCHA
0&3
0CABNF;N?L;FB?;>OJJIMCNCIH
2!'
2;LA?N=IHNLIFF?>CH@OMCIH
2'4
2IN;FCHNL;P?HIOM;H?MNB?MC;
41
4CMO;F;H;FIAO?M=;F?
88@B-0A04->36;>@K>?7N:@5>K@@-?@A:01:-:8L@1>9K::5?7;>A>?7586-1@@
?-99-:4-:391:-80>537-:012-@@-A0?B1>72>L:.N>6-:@588?8A@
.L?>CE;L?H
(;"->5--:0:0>1-?
+-)(#./-%)+/%(%/2 %" "$"% # " !" " !" "% !/$+ ."+-)!.0-%*##./-%)+/%(%/2 ,%+% -0#. "% " ""!/+"+,%+% .+*#./-+%*/!./%*()+/%(%/2 #!"! *!./$!/% -0#.* #./-%)+/%(%/2 "!$""!!" "!"""% " !" "!"""% -+'%*!/% -0#. & " "!"! ./-+%*/!./%*()+/%(%/2 0-%*#/$!,!-%+,!-/%1!,!-%+ * %*/!*.%1!-! "$!" % " !" "$#! !" "$#!$" "!$ !*!/%1-%%(%/2 /0 2 /0 2 /0 2 /0 2 ./-%!),/2%*# ./-%/+*! (!/-+#./-+#-,$2 !*!/%*(2.%. "# " "% -+! 0-! "#% "#% "#% "#% //%./%. ./-%!),/2%*# 0-%*#*%*"0.%+*+"-!)%"!*/*%(* /$!%*"(0!*!+",+./0-! ))! %/!,+./+,!-/%1!#./-%!),/2%*#"/!-
/+/(%*/-1!*+0.-!)%"!*/*%(,-+,+"+(.! *!./$!.% ./-%/+*!"/!-%*&!/%+*+"#(0#+* ./-%/+*! 0-%*#*%*"0.%+*+"-!)%"!*/*%( (!/-+#./-+#-,$2 !*!/%./0 2 +/$!-.% !!""!/.* ,+./+,!-/%1!,%* $!-!/)+()!/$+ ./-%-+.// (!/-+#./-+#-,$2 !*!/%/!./%*# ./-%!),/2%*# 0-%*#-!)%"!*/*%(%*"0.%+** %*"(0!*!+",+./0-! ./-%!),/2%*#"/!-+,%+% .! 1.+,%+% "-!!*!./$!.% ""!/.+"-!)%"!*/*%(+*#./-%/+*! ""!/.+""!*/*2(+*#./-%)2+!(!/-%(/%1%/2 ..+%/%+*./+#!*!/%"/+-. % !!""!/.+"+,%+% . 0/0-!,!-.,!/%1!. Introduction
Why, as an anesthesiologist, am I writing a thesis about the gastrointestinal tract?
Shouldn’t I be more interested in the brain and the nerves? As a matter of fact,
the stomach and the intestines play a major role during the perioperative period.
The aim of preoperative fasting is an empty stomach at the start of anesthesia in
order to reduce the risk of pulmonary aspiration. Postoperative nausea and
vomiting (PONV), often termed “the big little problem”, is a major concern.
Postoperative ileus (POI) due to impairments in gastrointestinal motility is
common, and it delays the start of oral feeding and the passage of stool. Patients
sometimes rate gastrointestinal symptoms as more severe than postoperative pain,
and impairment of gastrointestinal function often delays discharge from the
hospital. To answer the initial question, the gastrointestinal tract is of central
importance for both perioperative care and the anesthesiologist. Many factors
contribute to the impairment of perioperative gastrointestinal function (1-4), and
the opioid analgesics are one of the major contributors (5, 6).
The overall objective of this work was to acquire more knowledge about the
mechanism and physiology behind opioid effects on the gastrointestinal system.
The current understanding in the field is limited and much more research is
needed (7). In this thesis I have explored the effects of two opioid drugs, fentanyl
and remifentanil, on gastric motility.
Normal gastric motility
The physiological functions of the stomach are to receive ingested food, mix it
with secretions, mechanically break down the contents and finally pass the
contents to the duodenum (2). The proximal stomach, the fundus, functions as a
reservoir and with volume loads, muscles are adapted for maintaining a
continuous contractile tone (8). The distal antral region exhibits phasic and
peristaltic contractile activity and functions both as a pump and a grinding mill
(9). The tone of the pyloric sphincter regulates the outflow to the duodenum (10).
Two patterns of gastric motility can be distinguished – fasting and postprandial
motility. Fasting motility has a housekeeping function and consists of recurrent
contractile activity, sweeping contents distally in the bowel (11). This pattern is
described by the expression “migrating motor complex” (MMC), which is
characterized by three different phases. MMC phase I starts approximately 2-3
hours after a meal, lasts for 1 hour, and during this phase there are only a few
15
contractions every 5 minutes. In MMC phase II, the frequency of contractions
increases, but they are irregular. Phase III starts after a further 30 minutes, lasts
for about 10 minutes, and the coordinated contraction is maximal with clear
propagation of intraluminal contents. The interdigestive pattern terminates
abruptly after ingestion of food. After a meal, the motility pattern is dependent
on the physical state and nutrient content. The stomach exhibits submaximal and
phasic contractile activity, similar to MMC phase II. The contents are mixed,
digested and portioned out to the duodenum through the pylorus.
Myoelectric activity
Gastric smooth muscles display a rhythmic electrical activity, slow waves, with a
frequency of approximately 3 cycles per minute. These slow waves originate from
a gastric pacemaker region in the corpus region of the stomach and propagate
towards the pylorus. With influence of the enteric nervous system and other
regulatory mechanisms, the slow waves trigger the onset of spike potentials,
which in turn initiate coordinated contractions of the gastric smooth muscles
(12). Gastric motility and emptying depend on these slow waves.
Neuronal control
Neural networks for control of gastric motility are present both on the enteric
and the central levels. The enteric nervous system (ENS) is a separate division of
the autonomic nervous system and has local circuits for integrative functions
independent of extrinsic nervous control. Many of the reflexes, “programs” and
information processing for motility are located within the ENS. However, the
functional physiology of the stomach is dependent on higher levels of control.
(13)
The parasympathetic vagus nerve is a mixed sensory and motor nerve with 90%
afferent fibers, transmitting sensory information to the brainstem, and 10%
efferent fibers with motor functions (14). In the brainstem, the sensory neurons
are located in the nucleus tractus solitarius (NTS) and the motor neurons are
located in the dorsal motor nucleus of vagus (DMV). The two nucleuses are in
proximity to one another and there are dense networks of interneurons between
them, providing sensory information for the motor output, and completing the
vago-vagal reflex loop. The whole complex is also under the influence of higher
centers and circulating hormones (15, 16). There are two subgroups of the
efferent motor nerves, and the neurons are organized separately within the DMV
16
(16). Cholinergic fibers mediate excitations and non-adrenergic non-cholinergic
(NANC) inhibition to the stomach.
The sympathetic innervations to the stomach originate from the thoracic spinal
cord (T6 to T9). They consist of efferent adrenergic fibers and act mainly through
inhibition of the cholinergic transmission in the stomach (17). Together with
sympathetic afferent sensory fibers, the inhibiting gastro-gastric reflex is formed
(18).
The composition of the contents in the intestines also affects motility. Lipids,
carbohydrates, amino acids, low pH and hyperosmolarity in the duodenum
inhibit gastric motility. The “ileal break”, activated by caloric content in the
ileum, inhibits gastric motility and the glucagon-like peptide-1 (GLP-1) is the
proposed mediator (19). Colonic distension decreases gastric tone (20).
Several endogenous substances are involved in the integrative functions.
Cholecystokinin, released in the ileum in the presence of fatty contents, inhibits
gastric emptying mainly through activation of afferent vagal fibers (21). Ghrelin,
a relatively newly discovered gastric peptide, stimulates appetite, food intake and
gastric motility (22). Somatostatin, released from D-cells found throughout the
gastrointestinal tract, has complex actions on motility (21). Motilin, produced in
the duodenum, stimulates stomach motility through direct activation of motilin
receptors on enteric neurons, leading to activation of cholinergic neurons in the
antral region of the stomach (23).
Gastric tone
The proximal part of the stomach acts as a reservoir and exhibits a constant
dynamic tone. It adapts for volume loads, and volume waves portion contents to
the distal part of the stomach. The tone is mainly controlled by the autonomous
nervous system. (8, 18)
Tone is not equivalent to pressure. Gastric tone can be expressed as the length of
the muscle fibers in the proximal stomach. As there is an adaptive relaxant reflex,
a volume load might maintain the same intragastric pressure. Therefore, an
almost empty stomach and a full stomach are able to have the same intragastric
pressure, but different tone.
17
Gastric emptying
Gastric emptying (GE), the functional outcome of gastric emptying, is dependent
on the character of the stomach contents. The emptying of liquids starts
immediately and follows an exponential profile, meaning that a certain
proportion of the liquids is emptied during each time interval. Usually the time
for emptying half of the liquid contents is about 15-20 minutes. In contrast, any
caloric content or solids in the food causes a change from the liquid pattern of
emptying. For solid food, there is first a delay in emptying, a so-called lag-phase,
where no contents are passed to the duodenum. Contents are then mixed, grinded
and digested. This lag-phase lasts up to 1 hour and is followed by an emptying
that is characterized as linear, as a certain amount of contents is emptied during
each time interval (24). Posture influences gastric emptying, particularly with long
emptying when patients are in a left lateral position (25-27) .
Methods for measuring gastric motility
Gastric emptying rates can be estimated with various methods. The “gold
standard” is scintigraphic methods with radionucelotide labeled test meals (28).
With ultrasound techniques, transpyloric flow and gastric volumes can be
estimated (29-31). Absorption tests, i.e. the paracetamol method, (32-34), and
hydrogen breath tests (35) measure gastric emptying indirectly. Gastric pressures
are studied with manometry catheters and gastric myoelectric activity with
cutaneous electrogastrography (36). The gastric barostat measures proximal
gastric tone (37).
Opioid drugs
Morphine-like alkaloids have been used for centuries for analgesia and sedation.
Morphine was isolated from the opium flower in the beginning of the 19th
century, and some half century later, with introduction of the needle and syringe
in clinical practice, morphine could be administered in a controlled manner.
Opioid drugs are still fundamental in the treatment of severe pain, and morphine
is the reference substance to which other opioids are compared. Numerous
analogues with various pharmacological profiles have been developed. (38)
Opioids mediate their effect via opioid receptors on cell membranes. Currently,
five classes of receptors are identified, but research in humans has focused on the
role of μ-, κ-, and δ-opioid receptors (39). All three receptor classes are expressed
throughout the nervous systems, including the GI tract, and they partly overlap in
distribution and function. The receptors bind to both exogenous opioids, i.e.
morphine, and endogenous opioid peptides. (40, 41). The receptors differ in their
18
pharmacological profiles and have selectivity for the three classes of endogenous
opioid peptides. Analgesia, as well as many of the side effects, are mainly
mediated via activation of the μ-opioid receptor (MOR) (42, 43).
Morphine-analogue drugs exhibit their actions mainly through the MORs (44).
MORs are widely distributed on cell membranes in the body and are present in
the central nervous system (45-47) including at the spinal level (48), on peripheral
nerves (49), and in the gastrointestinal tract (41, 50-52).
On the cellular level, the MOR is coupled to transmembrane G-proteins. The
cellular effects involve hyperpolarizations of the cell membrane via K+ and Ca++
channels and changes in the second messenger systems (i.e. cAMP, IP3). The
physiological result of receptor activation depends on the site of action, but
synaptic transmission is usually inhibited, i.e. via inhibition of presynaptic
excitatory transmitter release or postsynaptic hyperpolarization (38).
Fentanyl
Fentanyl is the most common opioid used in daily anesthetic practice. It is a
MOR agonist with analgesic potency 100 times that of morphine. It is highly
lipophilic and has a high volume of distribution. It is usually given as repetitive
bolus injections during anesthesia. Clearance from the body can be long,
especially after repetitive doses. (53)
Remifentanil
Remifentanil is a MOR agonist with analgesic potency similar to that of fentanyl.
It has a rapid onset and recovery and is usually administered as a continuous
infusion. Remifentanil is metabolized by unspecific esterases in the body, has a
relatively small volume of distribution, and has a systemic half life of about 10
minutes. The context sensitive halftime (time to reduce the effect site concentration to 50%) is around 4 minutes and is independent of infusion time. This gives
remifentanil the unique property that after termination of a several hour long
infusion, such as during anesthesia, remifentanil is rapidly cleared and patients
recover within minutes. Remifentanil is used routinely today in anesthetic
management. (54)
Effect of opioids on gastrointestinal motility
In 1917, Trendelenburg was the first to demonstrate the inhibitory effects of
opioids on motility in an experimental setting using isolated animal intestines (55,
56). Since then, effects of opioids on gastrointestinal motility have been studied
19
extensively, but the mechanism is complex and still uncertain (7). Opioid
receptors are widely spread in the gastrointestinal tract and are located on
neurons in the ENS, on secretomotor neurons and on smooth muscles (57-60).
Opioid receptors mediate the action of both exogenous opioids and endogenous
opioid peptides, and generally speaking opioids suppress neural excitability
through the opening of potassium conductance channels, leading to hyperpolarizations of cell membranes. Opioids affect a variety of functions including motility
(41, 51, 52, 61-65) and secretion (57), and both μ- and κ-receptors are involved
(40).
Opioid effects on motility can be both excitatory and inhibitory. The stomach
and the intestines are under tonic inhibitory influence from neuronal networks
controlling the coordinated contraction and propulsions. When opioids inhibit
these inhibitory neurons, control from the neuronal network is released and an
uncoordinated non-propulsive contraction occurs (57). This is seen, for example,
when opioids induce a phase III-like activity in the antroduodenal region and
disturb gastric motility (66). The negative effect is seen even with low doses of an
opioid (67).
There is clear evidence that there is both a peripheral and a central mechanism in
the inhibition of gastrointestinal motility (57, 66, 68). Higher centers involved in
the regulation of gastrointestinal motility also express MORs (46, 69, 70). Opioid
receptors are also present on afferent vagal nerve endings projecting to the NTS
(47, 71, 72).
Role of endogenous opioid peptides
Endogenous opioid peptides (enkephalins, β-endorphins and dynorphines) are
located within the GI tract. The function of these peptides is poorly understood,
but they might play a role in the normal control of motility. The distribution of
enkephalinergic neurons is closely matched to neurons expressing MOR (73).
There is evidence that endogenous opioids are released during stress and trauma
and inhibit the normal patterns of motility. After binding to ligands, the MOR
receptor complex is usually internalized into the cell through endocytosis (41).
Using immunhistochemical methods to demonstrate internalized opioid receptors,
the release of endogenous peptides can be studied. In an animal model,
abdominal surgery with and without manipulation of the intestines was
associated with endogenous peptide release, while anesthesia alone was not. (74)
20
Inhibition of endogenous peptides, i.e. through blockage of opioid receptors,
might therefore act prokinetically under conditions of disrupted motility (75).
Anesthetic drugs and gastric motility
Effects of volatile agents on gastrointestinal motility
There are only a few published studies on volatile agents and gastrointestinal
motility and no studies regarding sevoflurane. Marshall et al showed (76) that
halothane depressed motility of the stomach, jejunum and colon in dogs and that
activity returned promptly after the agent was withdrawn. In rodents, halothane
and enflurane had profound but different effects on motility (77). Both agents
reduced the frequencies of the slow waves. Halothane reduced phase III activity in
duodenum, intestinal motor activity was slowed after anesthesia, and contractile
activity was affected. Enflurane increased the frequency of MMC during
anesthesia, the frequency slowed to a normal rate after anesthesia, and there were
no major effects on contractile activity. In humans, enflurane and halothane
depress antral motilty and reduce phase II activity (78). To summarize, volatile
anesthetics affect gastric motility, but the effect may cease quickly after
termination of the agents.
Effect of propofol on gastrointestinal motility
Propofol in low doses does not influence gastric motility (79), but there is
evidence that propofol may inhibit motility in higher doses. In a laboratory
setting, propofol inhibited spontaneous contractions in human gastric tissue (80).
Prokinetic drugs
Prokinetic drugs can be used to improve and restore gastrointestinal motility.
Available major drug classes with prokinetic properties include antidopaminergic
agents, serotonergic agents and motilin-receptor agonists. However, the drugs
show signs of moderate prokinetic effects with adverse effects, and research on
novel substances is currently intense. (81, 82)
Metoclopramide is a dopamine receptor antagonist that has been used for
decades. As dopamine inhibits gastric motility (83, 84), blockade of the
dopamine-2 receptor (D2) promotes motility. It is also suggested that metoclopramide has effects on serotonergic receptors. Metoclopramide is widely used in
clinical practice, but the prokinetic effects last for only a short time. Also, the side
effects are considerable, as all D2 receptor antagonists might induce extrapyramidal symptoms. Domperidone has properties that are similar to those of
21
metoclopramide, although the most common side effect is hyperprolactemia. The
substance is available in many European countries, but currently not in Sweden.
Tegaserode is a novel serotonergic agent undergoing clinical evaluation. It is a
partial 5-HT4 receptor agonist and 5-HT2b receptor antagonist (85) and
accelerates orocecal transit in volunteers. It has not been associated with serious
side effects. Cisapride is a 5-HT4 receptor agonist with prokinetic actions in
major parts of the gastrointestinal tract, including the stomach. It stimulates
antral and duodenal contraction and improves gastric emptying. However, the
substance was associated with severe cardiac arrhythmias and was withdrawn
from the market in 2001.
The macrolide antibiotic erythromycin is a motilin receptor agonist and it
initiates MMC phase III, and stimulates motility and gastric emptying through
direct effects in the stomach. Compared to other prokinetic drugs, erythromycin
is considered effective. Novel motilin receptor agonists with higher potency and
without antibacterial activity are under development (86, 87).
μ-Opioid receptor antagonists
The classical μ-opioidreceptor antagonist naloxone improves opioid induced
bowel dysfunction (88), but as the reversal also antagonizes the analgesic effect of
opioids, the use of naloxone is limited (89).
Research in recent decades has focused on the development of peripheral μreceptor antagonists that do not penetrate the blood-brain barrier. Hence,
analgesic effects of opioids are maintained while gastrointestinal effects are
antagonized. Alvimopan is a selective opioid antagonist with extremely limited
oral absorption, and when given orally it does not cross the blood-brain barrier
(39, 90, 91). Clinical phase III trials have showed that Alvimopan accelerates
gastrointestinal recovery after abdominal surgery without compromising opioid
based analgesia (92-96). Metylnaltrexone (MNTX), a derivate of naltrexone, is a
peripheral opioid receptor antagonist that does not cross the blood brain-barrier
and can be administered by both the oral and the intravenous route (97-99).
MNTX is still under investigation in late clinical trials focusing on opioid induced
obstipation (100). In patients treated with opioids, MNTX reduces orocecal
transit time, induces laxation and is well tolerated (100, 101).
22
Gastrointestinal motility during the perioperative period and intensive care
Preoperative fasting
One of the most important preparations for patients before anesthesia and
surgery is an empty stomach. Protective reflexes are abundant during anesthesia,
and if regurgitation or vomiting occurs, contents from the stomach might be
aspirated into the lungs, causing fatal aspiration pneumonitis (102). Previously,
NPO (nil per os) after midnight was a rule, but research during the past 20 years
has changed this dogma (103). Current guidelines state a two-hour fast for fluids
and a six-hour fast for solids in healthy patients undergoing elective procedures
(104-107). However, a spectrum of conditions like trauma, pain, emergency
procedures, diabetes and opioid medication are associated with impaired gastric
motility. If the stomach is not considered empty, special procedures are used
routinely for rapidly protecting the airway during the induction of anesthesia
(108).
Early oral intake
Today an early start of oral intake after anesthesia and surgery, sometimes within
hours, is common. However, while there is currently no evidence that early intake
diminishes the duration of postoperative ileus, the routine is not associated with
adverse effects, except an increased risk of nausea (109-112). As opioids given
perioperatively might have residual effects during recovery, this might delay the
start of oral intake. Optimizing opioid administration might therefore be
beneficial.
Postoperative ileus
Postoperative ileus (POI) is a transient bowel dysmotility that occurs following
abdominal surgery (1, 113). It encompasses delayed gastric and colonic emptying
and failure in the propulsion of the intestinal contents due to atonic bowel (2),
and generally lasts for several days. Inhibitory neural reflexes, neurotransmitters,
inflammatory mediator release and endogenous and exogenous opioids contribute
to the pathogenesis (5). Activation of nociceptive afferent nerves and sympathetic
inhibitory efferent nerves through the spinal reflex is believed to play a major role
(18, 114). Blockade of these nerves with an intra- and postoperative epidural with
local anesthetic reduces gastrointestinal paralysis and enhances recovery by up to
36 hours compared to analgesia with systemic opioids (115). Recent studies have
shown that the prolonged phase of POI is caused by an enteric molecular
inflammatory response in the segments of the intestines manipulated during
surgery (1). Opioid receptors are also up-regulated with the inflammatory
response (49) and might contribute to the impairment.
23
Postoperative nausea and vomiting (PONV)
PONV occurs commonly after anesthesia and is described as the “big little
problem”. Patients often recall PONV as their worst experience after undergoing
a surgical procedure. The etiology is multifactorial, and non-smokers, female
gender, history of PONV or motion sickness and the use of opioids are associated
with increased risks (116). The emetic center in the brainstem is in the proximity
of the NTS and DMV. Nausea and vomiting induce changes in gastric motility
through central mechanisms, but there is currently no evidence that motility
changes in the stomach per se induce PONV. However, factors that induce
motility changes also induce PONV. Therefore, it might be difficult to perform
studies in humans where the aim is to study if an intervention with isolated
gastric effects affects nausea and vomiting.
Intensive Care
In critical illness, impaired gastric motility is common and is associated with
serious consequences. The underlying mechanisms are tissue ischemia, disturbances in fluid-electrolyte balance, abdominal surgery, infections and medications
(i.e. opioids, catecholamines, anticholinergica) (117). The clinical picture includes
enteral feeding intolerance, gastric retention, and paralytic ileus, and about 50%
of intensive care unit (ICU) patients have delayed gastric emptying. As early
enteral administration of nutrition is considered the best practice, with improved
outcome in morbidity and mortality, efforts have been made to promote gastric
motility in the critically ill (118). Erythromycin and metoclopramide are the most
commonly used prokinetics in the ICU (119). With advantage to erythromycin,
(120) both drugs improve gastric emptying (121, 122). Gastric emptying is even
more improved if the two drugs are combined (123). However, rapid tachyphylaxia occurs frequently and limits the use of these two drugs (118). The use of
enteral naloxone has been popular in many ICUs, but at this time there is only
weak evidence in the literature. Meissner found that naloxone reduced gastric
residual volumes and the frequency of pneumonia (124), and Mixides showed
that enteral feeding was better tolerated with naloxone (125). Novel prokinetics
are under evaluation for the ICU setting (126).
Genetic variability
In recent years research regarding individual variability in opioid-mediated
analgesia and in side-effects has suggested an association with genetic disposition.
Genetic variations might alter drug effects through changes in metabolizing
enzymes, transport proteins and expression of cellular receptors. Recently, several
24
studies have focused on single nucleotide polymorphism (SNP) in the gene coding
for the μ-opioid receptor (127-131).
Polymorphisms and mutations are variations of the normal ”wildtype” genetic
expression. If the variant is common in the population (>1%), it is termed
polymorphism, and if it is rare (<1%) it is termed mutation. A single nucleotide
polymorphism (SNP) occurs when a position in the DNA strand has two
alternative nucleotides. As all chromosomes exist in pairs, a subject is heterozygote for a SNP if one of the genes carries the variant, and homocygote if both
genes are variants.
One of the most common SNPs in the MOR gene is a change in the nucleotide
base of A>G at position 118 (A118G). This results in an amino acid exchange
from aspargine > aspartate at position 40 (Asn40Asp) in the receptor (127, 131).
The expected frequencies in populations of heterozygous A118G and homozygous subjects are 20 and 2 %, respectively, and there are substantial variations
between ethnic groups (132, 133).
The A118G alteration results in a loss of a putative glycosylation site of the
receptor (134). Investigators report up to 3 times higher affinity to betaendorphins for the variant (132), altered signal transduction pathways, and lower
thresholds for morphine in neurone models (135). In contrast, others have
reported no differences in ligand-binding or dose in the cellular response with the
variant (136). The differences might be explained by the use of different cell lines.
Subjects carrying the A118G variant have a diminished pupillary response to the
morphine metabolite morphine-6-glukoronide (M6G) (137). Observations in
patients with renal failure (causes accumulation of M6G) indicate that the variant
decreases side effects and the potency of M6G. There have been speculations
about an M6G toxicity protection by the A118G variant (137). Others report
that analgesic response to M6G is diminished in variants, while respiratory
response (depression) is unchanged (138).
In experimental settings, A118G carriers have a higher threshold for pain (139).
Clinical studies reveal decreased postoperative sensitivity to morphine after knee
arthroplasty (140), carriers of A118G required more morphine for alleviation of
pain caused by malignant disease (141), while there were no differences in opioid
consumption after abdominal hysterectomy (142). After abdominal surgery there
25
was a tendency toward higher morphine consumption with the variant (143).
Interestingly, there is speculation about an association with opioid induced
nausea and vomiting, as carriers of the variant had less symptoms after after
exposure to M6G (144). Compared to a control group, patients switching to
alternative opioids from morphine due to intolerance did not differ in the MOR
gene (145).
The SNP A118G has also been explored in the context of substance addictions.
Regarding alcohol intake, carriers of the variant had a higher sensitivity to
alcohol, became more stimulated and sedated than normal “wildtypes” (146),
and also had a stronger urge to drink more (147). Naltrexone, an opioid receptor
antagonist, blunted the alcohol effect more in subjects with the variant (148).
Some investigators report an association between alcohol dependence and the
variant (146, 149, 150). However, a recent meta analysis concluded that there
was no evidence for such an association (151).
Opioid systems are also believed to inhibit the hypothalamic-pituitary-adrenal
axis (HPA-axis). A blockade of this opioidergic effect releases cortisol. In
response to the MOR antagonist naloxone, the cortisol response was higher
among carriers of the variant (152).
26
Aims of the thesis
- To study effects of the opioid remifentanil on gastric emptying and
evaluate if extreme postures affect gastric emptying.
- To compare postoperative gastric emptying between a remifentanilpropofol based total intravenous anesthesia and an opioid free sevoflurane inhalational anesthesia.
- To study effects of remifentanil on proximal gastric tone using a
gastric barostat.
- To study effects of fentanyl on gastric myoelectric activity using a
cutaneous multichannel electrogastrograph (EGG).
- To test the hypothesis that single nucleotide polymorphisms (SNP)
in the μ-opioid receptor gene are associated with the variable effects
on gastric motility caused by opioids.
27
Materials
All studies were approved by the Ethics Committee of Örebro County Council
(prior to 2004) and the Uppsala Regional Ethical Review Board (after 2004).
Study II was also approved by the Swedish Medical Product Agency. All studies
were performed at Örebro University Hospital, Örebro, Sweden, during the
period 2000-2005.
Study I
Ten healthy male volunteers (ASA-class I-II) with a mean age of 23.9 years
(range, 21-31) underwent four gastric emptying studies on four separate days.
Study II
Fifty patients (ASA-class I-II) undergoing day-case laparoscopic cholecystectomy
were randomly allocated to receive either total intravenous anesthesia with
propofol-remifentanil (TIVA, n=25) or opioid-free inhalational anesthesia with
sevoflurane (GAS, n=25). Five patients (TIVA, n=4, GAS, n=1) were excluded for
perioperative surgical reasons. Postoperative data were analyzed for 21 subjects
in the TIVA group (mean age 45 years, (range 29-64)), females, n= 20) and 24
patients in the GAS group (mean age 46 years, (range 19-69)), females, n= 20).
The gastric emptying study was successful in 18 patients in the TIVA group and
20 patients in the GAS group.
Study III
Ten healthy male volunteers (ASA-class I-II) with a mean age 24 years (range, 1931) underwent two gastric tone studies on two separate days. Later, analyses of
SNP in the MOR gene were performed. Two subjects did not complete the first
barostat study (glucagon) and 1 subject did not complete the second barostat
study (remifentanil). Genetic analyses were performed in all subjects (n=9) with
successful gastric tone measurements.
Study IV
Gastric myoelectric activity was studied with an electrogastrograph in 20 patients
scheduled for elective surgery (ASA-class I-II, mean age 45 years (range, 28-67),
females, n=16) and the effect of a bolus dose of fentanyl 1μg/kg was evaluated.
Later, genetic analyses of SNP in the MOR gene were performed in 18 of the
patients.
29
Methods
Gastric emptying (I-II)
Gastric emptying was studied with the paracetamol method. (Acetaminophen is
the name for paracetamol in North America and in the literature the method is
also called the acetaminophen method). Paracetamol is not absorbed from the
stomach, but is rapidly absorbed from the small intestine. Consequently, the rate
of gastric emptying determines the rate of absorption of paracetamol administered into the stomach (32).
Paracetamol 1.5 g dissolved in 200 mL of water (at room temperature) was given
orally (Study I) or through a nasogastric tube (Study II). Blood samples were
taken from an intravenous catheter prior to the administration of paracetamol, at
5, 10, and 15 minutes after administration, and then at 15-minute intervals
during a total period of 120 min. Serum paracetamol was determined by an
immunologic method including fluorescence polarization (TDx acetaminophen®;
Abbott Laboratories, Chicago, IL, USA). Paracetamol concentration curves were
produced and the maximal paracetamol concentration (Cmax), the time taken to
reach the maximal concentration (Tmax), and the area under the serum paracetamol concentration time curves from 0 to 60 minutes (AUC60) and from 0 to 120
minutes (AUC120) were calculated. Tmax was assumed to be 120 minutes if no
paracetamol was detected in any sample. The paracetamol method is a wellaccepted method for studying the liquid phase of gastric emptying, and AUC60
correlates well with measures of gastric emptying performed using isotope
techniques (32, 153)
Gastric tone (III)
Gastric tone was measured by an electronic barostat (SVS®; Synetics AB,
Stockholm, Sweden). The gastric barostat is an instrument with an electronic
control system that maintains a constant preset pressure within an air-filled
flaccid intragastric bag by momentary changing of the volume of air in the bag
(37, 154). When the stomach contracts, the barostat aspirates air to maintain the
constant pressure within the bag, and when the stomach relaxes, air is injected.
The pressure in the bag was set at 2 mmHg above the basal intragastric pressure.
The pressure change at which respiration is perceived on the pressure tracing,
without an increase or decrease in the average volume, is the basal intragastric
pressure.
31
The bag, made of ultrathin polyethylene, has a capacity of 900 ml and is
connected to the barostat by a double-lumen 16 Ch gastric tube. The barostat
measurements followed the recommendations presented in a review article by an
international working team and the barostat instrument fulfilled the criteria
determined by this group (37).
Before the gastric intubation, propofol 0.3 mg/kg was given for sedation. Previous
studies in volunteers have shown that this dose of propofol does not influence
gastric tone (155), and it was given at least 30 min before the study started. The
intragastric bag was folded carefully around the gastric tube and positioned in the
gastric fundus via oral intubation. Thereafter, the gastric bag was unfolded by
being slowly inflated with 300 ml of air under controlled pressure (<20mmHg),
and the correct position of the bag was verified by traction of the gastric tube.
During the measurements, the mean gastric volume during each five-minute
interval was calculated.
Electrogastrography (IV)
Electrogastrography (EGG) is the cutaneous recording of gastric myoelectrical
activity, and the activity is closely associated with gastric motility (156). Gastric
smooth muscles display a rhythmic electrical activity, slow waves, with a
frequency of approximately 3 cycles per minute. These slow waves originate from
a gastric pacemaker region in the corpus and propagate towards the pylorus.
With influence of the enteric nervous system and other regulatory mechanisms,
the slow waves trigger the onset of spike potentials, which in turn initiate
coordinated contractions of the gastric smooth muscles (12). Gastric motility and
emptying depend on these slow waves.
Figure 1.
Electrode placements in electrogastrographic study:
Electrode 3 was placed halfway between the
xyphoid process and the umbilicus. Electrode 4 was
placed 4 cm to the right of electrode 3. Electrodes 2
and 1 were placed 45 degrees to the upper left of
electrode 3, with an interval of 4 to 6 cm. The
ground electrode was placed on the left costal
margin horizontal to electrode 4. The reference
electrode (electrode 0) was placed at the cross point
of the horizontal line containing electrode 1 and the
vertical line containing electrode 3. (Walldén et al,
Acta Anest Scand 2008. In Press.)
32
Six EGG electrodes were placed on the abdomen after skin preparation. The
electrodes consisted of four active electrodes, one reference electrode and one
ground electrode, as illustrated in Figure 1. A motion sensor was also attached to
the abdomen. We used the Medtronic Polygram NET EGG system (Medtronic
A/S, Denmark) for the simultaneous recording of four EGG signals. Our EGG
system was configured to accept an electrode impedance of less than 11 kΩ after
skin preparation. The EGG signal was sampled at ~105 Hz, and this was
downsampled to 1 Hz as part of the acquisition process (157).
All EGG tracings were first examined manually by two of the investigators (JW,
GL). Prior to the analysis, motion artifacts in the EGG signal, indicated by the
motion sensor, were identified and removed manually. For each patient, the EGG
channel with the most typical slow-wave pattern during baseline recording
(before fentanyl) was selected for further analysis.
An overall spectrum analysis was performed on each of the two main 30-minute
segments (before and after fentanyl, respectively) of the selected channel using the
entire time-domain EGG signal (157). Sequential sets of measurement data for
256s with an overlap of 196s were analyzed using fast Fourier transforms and a
Hamming window for the calculation of running power spectra. When the entire
signal was processed, the power spectra for each segment were combined to
arrive at the overall dominant frequency (DF) and power of the dominant
frequency (DP).
The EGG segments and the spectral analysis after fentanyl were further classified
either as 1) Unaffected EGG (no change in DF after fentanyl), 2) Bradygastric
EGG (decrease in DF >=0.3 after fentanyl) or 3) Flatline-EGG (total visual
disappearance of a previously clear sinusoidal 3 cpm EGG-curve after fentanyl)
(see example in figure 3) without any quantifiable DF. When DF was not
quantifiable, DF was set to 0.
Data from the baseline EGG were compared to data from a previous multicenter
study in normal subjects (157) to test if the group in study IV was similar to a
normal population.
Genetic Analysis (III-IV)
Due to the large interindividual variations in the gastric tone response after
remifentanil, we investigated if this variation could be explained by genetic
33
variability, polymorphisms, in the μ-opioid receptor gene. After reviewing the
literature, we decided to analyze polymorphisms with relative high frequencies
and with reports of altered responses. Therefore, we focused on the μ-opioid
receptor gene polymorphisms A118G and G691C (128).
DNA collection and purification.
Venous blood (10 ml) was collected from the subjects in EDTA tubes and the
samples were stored frozen at –70°C. Genomic DNA was purified from
peripheral leukocytes in 1 ml of EDTA blood on a MagNA Pure LC DNA
extractor, using the MagNA Pure LC Total Nucleic Acid Isolation Kit – Large
Volume (Roche Diagnostics Corporation, Indianapolis, IN, USA).
Genotyping.
Genotyping was performed at CyberGene AB, Huddinge, Sweden. The A118G
SNP in Exon 1 and the IVS2 G691C SNP in Intron 2 were genotyped using
polymerase chain reaction amplification and sequencing. Oligonucleotide primers
(forward:
5'-GCGCTTGGAACCCGAAAAGTC;
reverse:
5'-CATTGAG
CCTTGGGAGTT) and (forward: 5'-CTAGCTCATGTTGAGAGGTTC; reverse:
5'-CCAGTACCAGGTTGGATGAG) were used for amplifying gene fragments
containing Exon 1 and Intron 2, respectively. PCR conditions comprised an initial
denaturing step at 95°C for 1 min followed by 30 cycles at 94°C for 1 min,
annealing at 47.2-53.4°C (depending on primer) for 1 min and extension at 68°C
for 3 min, and a final extension at 68°C for 3 min. The amplified fragments were
sequenced using the same primers with the addition of Rev 1-2 5'TTAAGCCGCTGAACCCTCCG and the BigDye Terminator v1.1Cycle Sequence
Kit (Applied Biosystems, Foster City, CA, USA). PCR amplification and sequence
reactions were done on ABI GeneAmp 2400 and 9700 (Applied Biosystems).
Sequence analysis was first done on MegaBACE 1000 (Amersham Biosciences,
CA, USA) and then confirmed with ABI 377XL (Applied Biosystems).
Procedure
Study I
In a randomized order, gastric emptying was studied on four occasions in each
subject, with at least 1 day between occasions. The subjects were given a
continuous infusion of remifentanil on two occasions while lying either on the
right lateral side with the bed in a 20º head-up position (RHU) or on the left
lateral side with the bed in a 20º head-down position (LHD). On the other two
occasions, no remifentanil infusion was given, and the subjects were studied lying
in the two positions.
34
All subjects fasted for at least 6 h before each study. For the two occasions with
remifentanil, remifentanil was given as a continuous intravenous infusion in a
dose of 0.2 μg· kg-1·min-1 and was started 10 minutes before the ingestion of
paracetamol. The infusion was terminated directly after the last blood sample
(120 min) was drawn.
Study II
All patients fasted according to clinical guidelines (107) and were premedicated
with midazolam 1-2 mg I.V. Before induction, all patients received ketorolac 30
mg I.V. In the TIVA group, anesthesia was induced with an infusion of
remifentanil 0.2 μg·kg-1·min
–1
, followed after 2 minutes by a target-controlled
infusion (TCI) of propofol at 4 μg·mL
–1
(induction time 60 seconds). In the GAS
group anesthesia was induced with 8 % sevoflurane via a facial mask. After
attaining an adequate level of anesthesia, muscular relaxation was obtained in
both groups with rocuronium 0.6 mg·kg-1 IV and the trachea was intubated after
90 seconds. In the TIVA group anesthesia was maintained with remifentanil 0.2
μg·kg-1·min
–1
and TCI propofol adjusted (2-4 μg·mL
–1
) to maintain a BIS-index
below 50. In the GAS group anesthesia was maintained with sevoflurane,
adjusted to maintain a BIS-below 50. No prophylactic antiemetics were given. A
nasogastric tube was placed in all patients during anesthesia. At the end of
surgery, 20 mL of 0.25% levobupivacaine was infiltrated at the insertion sites of
the laparoscopic instruments, muscular relaxation was reversed with neostigmine
2.5 mg/glycopyrrolate 0.5 mg, and anesthetic agent(s) were terminated. The
patients were extubated in the operating room after return of consciousness and
spontaneous breathing and transferred to the adjacent day-care unit for recovery.
Except for the continuous infusion of remifentanil in the TIVA group, no opioids
were given during anesthesia. The gastric emptying study measurement was
initiated immediately after arrival in the day-care unit.
Patients stayed in the day-care unit for at least 4 hours and PONV and pain
parameters were evaluated every hour. After discharge, patients received a
questionnaire regarding the postoperative 4-24 hour-period, and they rated their
maximal pain and maximal nausea and were questioned about vomiting. In
addition, a telephone interview was performed on the first postoperative day.
Combining the results, we received postoperative data on PONV, maximal VASscore for pain, and time to first postoperative opioid analgesic for the time
periods 0-2 hours and 2-24 hours postoperatively.
35
Study III
All subjects fasted for at least 6 h before each study. Each subject underwent two
study protocols on two separate days. Before the gastric intubation the subjects
received a bolus dose of propofol (0.3 mg/kg IV). In the first study, the effect of
glucagon on gastric tone was measured. In the second study, gastric tone was
measured during and after a remifentanil infusion and, after a washout-time of 30
minutes, during readministration of remifentanil in combination with glucagon.
The study protocol is illustrated in Figure 2.
During study situations, vital parameters, blood-glucose, nausea and any other
symptoms were recorded.
Later, subjects (n=9) were asked to participate in the genetic analysis of the MOR
gene and we obtained blood samples.
Figure 2
Schematic illustration of the study protocol in study III.
Glucagon Study
Glucagon
1 mg
Propofol
0.3 mg ·kg-1
-10 min
-40- -80 min
0 min
15 min
Glucagon
Measurement of Gastric Tone
Remifentanil Study
Propofol
0.3 mg ·kg-1
-40- -80 min
Remifentanil
Start Remifentanil
-10 min
0 min
15 min
-1
0.1g·kg ·min
-1
Stop Remifentanil
Start Remifentanil
Glucagon
1 mg Stop Remifentanil
45 min
75 min 85 min 95 min
30 min
-1
0.2 g·kg ·min
-1
-1
0.3 g·kg ·min
-1
Glucagon
Measurement of Gastric Tone
36
-1
0.3 g·kg ·min
-1
Study IV
The study was performed in a pre-anesthesia area before the induction of
anesthesia. Patients fasted for at least 6 hours from solid foods and 2 hours from
clear fluids. No premedication was given. While the patient was lying in a
comfortable bed rest position, an intravenous line was inserted and the EGG
recordings were initiated. After achieving a stable EGG signal, a 30-minute
baseline EGG recording was collected. Without discontinuation of the EGG
recording, 1 μgram•kg-1 of fentanyl was given as an intravenous bolus through
the intravenous line and the EGG recording continued for another 30 minutes.
Charts and notes from the recovery unit were reviewed and we collected data
regarding analgesic and antiemetic requirements.
Later, patients were asked to participate in the genetic analysis of the MOR gene
and we obtained blood samples.
Statistics
The significance level was set at 5% in all tests. Data are presented as means (SD)
or medians (ranges).
In study I, repeated-measures analysis of variance was used for overall differences
between the study situations. If the analysis of variance showed differences, a
paired Student’s t-test with Bonferroni Correction was performed between the
study situations.
In study II, the unpaired Student’s t-test was used for comparisons between the
groups of primary outcome variables. For the secondary outcome variables, the
unpaired Student’s t-test, the Mann Whitney U test or Fisher’s exact test were
used.
In study III, repeated-measures analysis of variance was used for overall changes
in gastric tone over time. For comparisons between time periods, Fisher’s PLSD
was used.
In study IV, Wilcoxon’s signed rank test and the 95% confidence interval for the
difference between the medians were used for analysis of the primary EGG
outcome variables. The unpaired t-test was used for the comparison of baseline
EGG data with the historical controls. Fisher’s exact test was used to test
associations between PONV parameters and EGG outcome.
37
Results
Gastric emptying during an infusion of remifentanil and the
influence of posture (I).
Infusion of remifentanil delayed gastric emptying. During the control situations
there were differences in gastric emptying variables between the two extreme
positions, but there were no differences during the infusion of remifentanil (Table
1 and Figure 3). In three subjects, the dose of remifentanil had to be reduced due
to side effects.
Immediate postoperative gastric emptying after total intravenous remifentanil-propofol based anesthesia (II).
There were no differences in postoperative gastric emptying between the TIVA
group and the GAS group. Both groups differed significantly from a pooled
historical control group. However, there was great variability within both study
groups (Table 1 and Figure 4).
Table 1.
Gastric emptying variables in study I and study II.
AUC60
Cmax
Tmax
min μmol mL-1
μmol mL-1
min
Control RHU
5092 (1125)
138 (45)
25 (14)
Control LHD
3793 (1307)
94 (30)
47 (22)
Remifentanil RHU
962 (902)
34 (24)
94 (33)
Remifentanil LHD
197 (128)
16 (14)
109 (10)
Study I (n=10)
Study II
TIVA (n=18)
2458 (2775)
71 (61)
53 (55)
GAS (n=20)
2059 (2633)
81 (37)
83 (41)
Historical controls (n=36)
5988 (1713)
155 (46)
29 (15)
AUC 60
Cmax
Tmax
Paired T-test with Bonferroni Correction
RHU-Remi
vs
RHU-Control
RHU-Remi
vs
LHD-Remi
RHU-Remi
vs
LHD-Control
RHU-Control
vs
LHD-Remi
RHU-Control
vs
LHD-Control
LHD-Remi
vs
LHD-Control
p<0.0001
NS
p<0.0001
p<0.0001
p<0.0083
p < 0.0001
p< 0.0001
NS
p < 0.0001
p < 0.0001
p <0.0083
p<0.0001
p<0.0001
NS
p<0.0001
p<0.0001
NS
p<0.0001
Unpaired t-test
TIVA
TIVA
GAS
NS
p<0.001
p<0.001
NS
p<0.001
p<0.001
NS
p<0.001
p<0.001
vs
vs
vs
GAS
Historical Controls
Historical Controls
39
Figure 3
Gastric emptying in study I. Mean (SD) concentrations of paracetamol over time.
200
Control- Right lateral side head up
180
Control- Left lateral side head down
Mean S-Paracetamol concentration (mol/L) (SD)
Remifentanil 0.2g/kg/min- Right lateral head up
160
Remifentanil 0.2g/kg/min- Left lateral head down
140
120
100
80
60
40
20
0
0
30
60
90
120
Time (minutes)
Figure 4
Gastric emptying in study II. Mean (SD) concentrations of paracetamol over time.
Group TIVA (n=18)
Mean (SD) S-Paracetamol concentration (mol /L)
200
Group GAS (n=20)
Historical Controls (n=36)
150
100
50
0
0
30
60
Minutes
40
90
120
Gastric tone after injection of glucagon (III)
Glucagon decreased gastric tone in all subjects during the glucagon study. During
the remifentanil study and the ongoing remifentanil infusion, only one subject
had a decrease in gastric tone after the injection of glucagon, while the others
were almost unaffected. (Figure 5).
Gastric tone during an infusion of remifentanil (III)
There were distinct responses in gastric tone during the remifentanil infusion.
However, the responses were variable. Four subjects responded to remifentanil
with a marked increase in gastric tone (decreased volume in bag) that returned to
baseline levels during washout. Four subjects responded to remifentanil with a
marked decrease in gastric tone (increased volume) and maintained a low gastric
tone during the washout period. In one subject (no. 5) gastric tone was almost
unaffected. The mean gastric tone was significantly lower during the washout
period than before starting the infusion. During the readministration of
remifentanil, there were increases in gastric tone among subjects who increased in
tone during the previous remifentanil infusion. The subject with unaffected
gastric tone during the previous infusion increased in gastric tone. The subjects
who maintained a low gastric tone during washout continued to maintain a low
gastric tone. (Figure 5)
Figure 5.
Individual gastric volumes in the barostat study (III).
Subj 1
Subj 2
Subj 3
Subj 4
1000
Subj 5
800
Subj 7
Subj 8
Subj 10
600
400
0 - 5 min
5 - 10 min
Washout
5 - 10 min
0 - 5 min
Glucagon
5 - 10 min
25 - 30 min
0 - 5 min
Remi 0.3
20 - 25 min
15 - 20 min
10 - 15 min
5 - 10 min
10 - 15 min
0 - 5 min
Washout
0 - 5 min
5 - 10 min
10 - 15 min
Remi 0.3
0 - 5 min
10 - 15 min
5 - 10 min
Remi 0.2
5 - 10 min
5 - 10 min
0 - 5 min
Remi 0.1
Baseline 0 - 5 min
10 - 15 min
5 - 10 min
0 - 5 min
Glucagon
0
5 - 10 min
200
Baseline 0 - 5 min
Intragastric Bag Volume (ml)
Subj 6
Remifentanil Study
n=9
Glucagon Study
n=8
Time
41
Electrogastrography (IV)
Compared to historical controls (157), there were no differences in the baseline
EGG variables.
After the administration of intravenous fentanyl, there was a significant reduction
in both the dominant frequency (DF) and the dominant power (DP) of the EGG
spectra (Figure 7).
Among patients with a flatline-EGG (n=6), the median (range) time from the
administration of intravenous fentanyl to the observed disappearance of the slow
waves was 5 (1-9) minutes. In 5 of these patients, there was reappearance of the 3
cpm slow-wave EGG pattern 30 (29-35) minutes after the administration of
fentanyl.
There was large variation between patients in the response to intravenous
fentanyl. EGG recordings were unaffected in 8 patients, 5 patients developed a
slower DF (bradygastria) and in 6 patients the slow-wave tracings disappeared
totally (flatline-EGG). For an illustration of the effect, see Figure 6.
Figure 6.
An individual electrogastrographic response to Fentanyl.
80
Fentanyl 1g/kg I.V.
80
60
Fentanyl 1g/kg I.V.
40
60
40
0
-20
20
-40
V
V
20
-60
-80
0:00:00
0:10:00
0:20:00
0:30:00
0:40:00
0:50:00
1:00:00
0
-20
Time (min)
-40
-60
-80
25:00
Disappearance of Slow-wave
Slow-waves
v s
Slow-waves
Slow-wave
v s 3cpm
30:00
35:00
Time (min)
42
40:00
Figure 7.
Changes in the dominant frequency (DF) and the dominant power (DP) of the electrogastrographic spectra after Fentanyl. (Walldén et al. Acta Anest Scand, 2008. In Press)
A
B
*
*
50
3
Dominant Power (dB)
Dominant Frequency (cpm)
3,5
55
2,5
2
1,5
1
45
40
35
30
0,5
0
25
Baseline
After Fentanyl 1g/kg
Baseline
After Fentanyl 1g/kg
Genetic study (III-IV)
We found no association between the variable outcome in studies III and IV and
the presence of SNP A118G or G691C in the MOR (Table 2).
Table 2.
Results from the determinations of SNPs in the MOR gene with correlations to outcome groups in
studies III and IV.
118 A>G genotype
Wild Type Hetero- Variant
zygous
(AA)
(AG) (GG)
Study III
Increased tone (n=4)
Unchanged tone (n=1)
Decreased tone (n=4)
n=7
4
Study IV
Unaffected EGG (n=6)
Bradygastria (n=5)
Flatline (n=6)
Excluded from the
EGG-analysis (n=1)
n=15
5
4
5
1
3
n=2
n=0
1
1
n=2
1
n=1
1
1
IVS2 + 691 G>C genotype
Wild Type Hetero- Variant
zygous
(GG)
(GC)
(CC)
n=5
3
1
1
n=2
1
n=1
2
1
n=0
n=14
6
2
5
1
n=4
3
1
No associations found between presence of polymorphism and gastric outcome (Chi-Square tests).
PONV (I-IV), other side effects (I-IV) and postoperative pain (II).
In study I, six subjects experienced nausea, three subjects vomited and six subjects
had pruritus during infusion of remifentanil. Seven subjects experienced
43
dysphagia during remifentanil and five subjects complained of headache during
and/or after the infusion of remifentanil.
In study II, the postoperative incidence of nausea and vomiting was high. During
the 0-24 h postoperative period, 16 patients (76%) in the TIVA group and 20
(83%) patients in the GAS group experienced PONV symptoms. However, there
were no significant differences between the groups. There were shorter times to
rescue analgesics in the TIVA group (median 17 minutes) compared to the GAS
group (median 44 minutes).
In study III, 62% (n=5) of the subjects experienced nausea during the glucagon
experiment. During remifentanil, 33% (n=3) experienced nausea and 66% (n=6)
had nausea with the combination of remifentanil and glucagon. Further, during
remifentanil, 77% (n=7) had pruritus, 33% (n=3) had headache and 22% (n=2)
reported dysphagia.
In study IV, the incidence of PONV in the recovery unit was 53% (n=10) and
there was a need for rescue antiemetics in 47% (n=9) of the patients. We found
an association between flatline/bradygastric EGG and the requirement for rescue
analgesics (P=0.02).
44
Discussion
In this thesis I have studied the physiologic effects of opioid drugs on gastric
motility using both standard and novel methods. With the genetic analyses of the
μ-opioid receptor gene, I have introduced new aspects in the field of opioid
induced gastrointestinal motility disturbances.
As expected, opioids had a pronounced effect on gastric motility. Gastric
emptying was delayed, gastric tone altered and there were changes in the EGG
recordings. However, there was great interindividual variability and the
variability could not be explained by genetic variations in the μ-opioid receptor.
Further, we found no difference in postoperative gastric emptying between an
opioid based and opioid free anesthesia, and we suggest that other factors than
opioids contribute to affecting gastric motility.
The Paracetamol method
In studies I-II we used the paracetamol method to study the liquid phase of gastric
emptying. Paracetamol is absorbed in the proximal part of the small intestine,
and as gastric emptying is considered the rate limiting step in the absorption
profile, variables calculated from the paracetamol plasma concentration curve can
be used to describe the emptying rate from the stomach (33). Nimmo et al
showed in 1975 that the area under the concentration curve during the first 60
minutes (AUC60) correlated well with “gold standard” scintigraphic methods
(32). A recent systematic review concluded that the paracetamol method is well
correlated to scintigraphic assessments of gastric emptying (153), and in our
studies we used the validated variables AUC60, AUC120, Tmax and Cmax to
describe gastric emptying. However, it has been suggested that other variables
might be even more accurate, i.e. the ratio between concentrations at two time
points, C(2t)/C(t) or the ratio between two AUC at two time points. Then only
absorption and elimination constants influence the results, and differences
between individuals in volume of distribution, dose and first-passage metabolism
are eliminated (153, 158). It might be valuable to add these variables in future
studies. Also, the use of a salivary instead of a venous sample for the measurement of paracetamol has been proposed, but the method still needs validation
(159). There are also suggestions that studies with the paracetamol method
should be done with crossover designs to reduce the influence of variability
between individuals in pharmacokinetic parameters (158). This might be taken
45
into account in experimental studies, but it would be difficult in clinical
postoperative studies as the surgical procedure cannot be repeated.
The paracetamol method is a simple and cheap bedside method for the evaluation
of gastric emptying, but it is important to remember that it is an indirect
quantification of gastric emptying with limitations regarding interpretation.
Gastric barostat
In study III we used the gastric barostat for the measurement of proximal gastric
tone. It could be difficult to understand the concept of gastric tone, and it is
therefore important to distinguish it from gastric pressure. The smooth muscles in
the proximal stomach have the ability to generate a constant contraction (also
called a tonic contraction) and with that contraction the gastric wall applies a
certain pressure to the intraluminal contents. As the stomach adapts for volume
loads, the smooth muscles are elongated through diminished contraction and the
intraluminal pressure is maintained. This regulation with sustained muscular
activity is referred to as gastric tone (8), and to simplify, changes in gastric tone
are changes in the length of the smooth muscles.
The gastric barostat is the standard method for the evaluation of gastric tone, and
there are currently no other good methods available. The technique is invasive
and involves the introduction of a bag into the stomach (160), and this might
interfere with the response. However, the bag resembles a load of food and we
can consider it as partly physiological. The gastric barostat method is most
commonly used in research regarding the accommodation response, i.e. in the
field of dyspepsia, and usually subjective discomfort and compliance are
evaluated while the bag in the proximal stomach is distended (37, 160). It is
important to point out that we did not perform any distension tests and that we
did not study the accommodation response. We maintained a fixed, relatively low
pressure in the bag and studied effects of an opioid on gastric tone at a specific
pressure level. It might be interesting to perform distension tests with opioids, but
we consider this difficult with remifentanil and other potent opioids as their
analgesic effects blunt the perceptions and might harm the stomach if pressure is
elevated too high.
We found great variability in gastric tone during the remifentanil infusion. We do
not believe this was due to a methodological problem with the gastric barostat.
During the glucagon part of the study all subjects responded with a clear decrease
46
in tone (increased volume). This validates that the gastric barostat was working
properly, since an expected relaxant stimulus, glucagon, decreased the tone in all
subjects. Also, the same barostat equipment and setup were used in previous
studies by our group (84, 155) and we did not observe this kind of variation.
Electrogastrography (EGG)
In study IV we used cutaneous electrogastrography to study gastric myoelectric
activity. This activity is characterized as a constant ongoing fluctuation of the
membrane potential in the syncytium of the gastric smooth muscle cells.
Specialized smooth muscle cells without contractile properties, interstitial cells of
Cajal (ICC), are responsible for the distribution and propagation of the electric
activity. The pace of the fluctuations is normally determined by ICCs in the
corpus region, and the electric potential is propagated distally. These electrical
fluctuations are called gastric slow waves and they usually have a frequency of
about 3 cycles per minute. (156, 157, 161-163) The fluctuations per se do not
initiate muscular contraction, as the electrical potential is below the contraction
threshold. Excitatory stimuli from the controlling enteric network must be
present to initiate spike potentials and contractions (12). With the slow waves,
the pulse and propagation of the propulsive contractions are controlled.
Cutaneous EGG is the summation of electrical potentials from the gastric muscle
in a specific axis. This must be distinguished from electromyographic tracings
with electrodes inserted into the gastric wall; in that case the electrical potential at
a fixed point is measured. After our intervention, we found a lower frequency in
the slow waves and also a disappearance of the waves. The physiological
explanation for the bradygastria might either be a reduction in the frequency of
the pacesetter cells in the corpus or that normal pacesetter ICCs are “knockedout” and the slow waves are controlled by more distal ICCs with slower intrinsic
frequency (156). Further, the disappearance of the slow waves might reflect a
disappearance of the oscillations in membrane potential or a total disorganization
of the spontaneous activity. The latter might be more likely, as antral tachygastria, leading to a functional uncoupling of the slow waves, has been observed
after opioid administration (66), and gastric arrhythmias are generally caused by
disruptions of the slow waves(164). Our study is one of the first to use the EGG
in the perioperative setting. We suggest that the method should be used more
frequently, as it measures changes in gastric myoelectric activity, and this might
help us to understand the pathology behind the opioid induced impairments of
gastric myoelectric activity.
47
Genetic testing
Genetic evaluation of the μ-opioid receptor gene was done in studies III and IV.
The findings included major interindividual variability in motility variables in
subjects receiving opioids. Recent reports have suggested that SNPs in the MOR
gene can alter the effects of opioids (129, 165), and to our knowledge there is no
previous work where the issue is explored in the context of gastrointestinal
motility. Therefore, we collected blood samples from subjects who participated in
the studies. Genetic analysis was done by a contracted laboratory using routine
molecular biological techniques. Hence, we are the first to evaluate a possible
association between opioid effects on gastrointestinal motility and genetic
variations in the MOR.
Gastric emptying during a remifentanil infusion and influence of posture (I)
In Study I we evaluated the effect of posture on gastric emptying and the
objectives were in part to evaluate pyloric function. If gastric contents are
passively directed towards the pylorus, gastric emptying would be facilitated in
states of normal motility or when the pyloric sphincter is abnormally relaxed. We
used two extreme body positions in our study protocol – the RHU-position where
contents theoretically are directed towards the pylorus, and the LHD-position
where contents are directed from the pylorus. During the control situations,
gastric emptying was better in the RHU-position. This is in agreement with other
studies where body positions that direct stomach contents towards the pylorus
facilitate gastric emptying (25-27, 166). During the remifentanil infusion, gastric
emptying was delayed in both positions compared to the control situations. This
confirms that remifentanil has the same ability as other MOR agonists to affect
gastric motility and delay gastric emptying (32, 67, 68, 88, 167). However, we
found no significant differences between the positions. This indicates that
remifentanil increases pyloric tone and thereby impairs the flow out to the
duodenum.
Gastric emptying after opioid based vs opioid free anesthesia (II)
In study II we compared gastric emptying in two anesthetic protocols, one with
the opioid remifentanil and the other without opioids. We hypothesized that if
perioperative opioids play a major role in the postoperative inhibition of gastric
motility, there would be differences between the groups. ´The results showed that
gastric emptying was delayed in both groups compared to pooled data from
historical controls. However, we could not find any significant differences
between the groups. This indicates that the use of remifentanil during anesthesia
48
impairs postoperative gastric emptying in the same way as a solely inhalational
anesthesia.
Interestingly, if the figures are compared to the gastric emptying rates during the
remifentanil infusion in Study I, gastric emptying was better in Study II. A
reasonable assumption is that gastric motility during anesthesia with remifentanil
would be affected at least in the same way as during the remifentanil experiments.
As the measure of gastric emptying in study II was done after the cessation of
anesthesia, the results indicate that the inhibitory effect of remifentanil on gastric
emptying was reduced quickly. At the time when we measured gastric emptying
in Study II, the opioid effect might no longer have been present and other factors
might have contributed to the delay. The surgical trauma per se delays gastric
motility (1, 2, 4, 168), and if this factor plays the major role, then there would be
no differences between the groups.
There is limited knowledge about the effect on gastric motility of the other
anesthetics used in our protocols. Propofol in higher doses might inhibit motility
(80), and volatile agents inhibit motility with an effect that ceases quickly after
termination of the agents (76-78). Remifentanil and volatile agents might
therefore be considered similar regarding the time course of the gastric inhibition,
and that might also explain the finding of no difference. Future studies must
compare remifentanil with other potent opioids and evaluate if postoperative
gastric emptying is enhanced with remifentanil. As an early oral intake is
preferred today, the choice of a perioperative opioid with minimal impact on
postoperative gastric motility could be of importance.
Furthermore, there was great variability in the gastric emptying rates within the
groups, and both groups had patients with normal gastric emptying and patients
with no gastric emptying at all. As patients received IV opioids for severe pain
during recovery, we tested whether there was any association between opioid
analgesia during recovery and gastric emptying rates, but we found no association. The variability must be related to other factors.
Effects of remifentanil on gastric tone (III)
In study III we evaluated changes in gastric tone during an IV infusion of
remifentanil. We found that remifentanil had a marked effect on gastric tone, but
there were two distinctly different patterns of reactions, with about half of the
subjects increasing in gastric tone (decreased volume) and about half of the
49
subjects decreasing in gastric tone (increased volume). Due to this variability, we
were not able to statistically prove the response during remifentanil. However,
the gastric tone was statistically lower (higher volume) after the infusion of
remifentanil compared to the baseline period. We believe these are important
findings, as they show that opioid effects on human gastric motility are variable
and complex.
Proximal gastric tone is an important part of gastric motility and it is mainly
controlled by the autonomous nerve system. Vagal cholinergic nerves mediate
excitation (contraction) while vagal non-cholinergic non-adrenergic (NANC)
nerves mediate inhibition (relaxation) (169). Recent studies have identified
nitrous oxide as one of the main transmitters in the NANC pathway. In humans,
the NANC pathway is believed to be silent during fasting conditions and
activated on volume load by the adaptive reflex (170). In addition, there are
sympathetic adrenerigic spinal nerves that inhibit motility mainly through
cholinergic inhibition (17).
Several animal studies have tried to identify targets for the opioid induced
inhibition of gastric motility. It is widely believed that μ-opioid receptor (MOR)
agonists inhibit the release of Ach in the stomach (61), and there is also evidence
that MOR agonists reduce the relaxation induced by the NANC pathway (171).
Opioids might also have direct excitatory effects on gastric smooth muscles (51).
Opioids also act in the central nervous system (CNS). There is evidence that
MORs are present on and inhibit excitatory neurons projecting to gastrointestinal
motor neurons in the dorsal motor complex (DMV) of the medulla (69). In this
way activation of central MORs inhibits the excitatory vagal output, leading to
inhibition of intestinal transit and induction of gastric relaxation in animal
models. In humans, there is evidence that opioids inhibit gastric motility through
a central mechanism (66).
Hence, depending on the current state of autonomous and enteric nerve systems
and the main effect site, opioids have the potential to both increase and decrease
gastric tone.
There are diverging results in the literature regarding the effects of opioids on
gastric tone in humans. Penagini found that morphine increased gastric tone
(172), while Hammas reported a decrease in gastric tone (155). Both studies used
the same dose of intravenous morphine (0.1 mg/kg) and both used a gastric
50
barostat. However, there were important differences between the studies. In the
first study, baseline gastric tone was set to resemble a gastric load of a meal, and
in the second study baseline was set to fasting conditions. The stomach wall was
probably more distended (higher volumes in the intragastric bag) before
morphine in Penagani’s study compared to Hammas’ study, resulting in an
activated adaptive reflex. This leads to completely different baseline conditions.
In Penagini’s subjects there were probably low cholinergic and high NANC vagal
inputs to the stomach, and the reverse baseline conditions were probably present
in Hammas’ subjects. This might explain why a MOR antagonist contracted the
stomach (through NANC inhibition) in one study and relaxed the stomach
(through cholinergic inhibition) in the other study.
An interesting finding in Hammas’ study was that the concurrent administration
of propofol altered the effect of morphine on gastric tone. Propofol per se had no
effect on gastric tone, but after the subsequent administration of morphine,
gastric tone increased (volume decreased), contrary to the response to morphine
alone. We cannot explain the mechanism behind this modulation, but there is
evidence for central interactions and modulations between GABAergic and opioid
pathways (47). Other types of modulations of gastric tone have also been
described; in animals with an intact vagus nerve, noradrenaline relaxed the
proximal stomach while vagotomy reversed this response (169).
Can we explain the variable responses seen in our study within this context?
Remifentanil is a potent MOR agonist and the effect sites are probably both at
the stomach level and in the CNS. We speculate that the “normal” opioid
response during fasting conditions, as seen in Hammas’ study, is a decreased
cholinergic activity resulting in a decrease in gastric tone. However, due to the
high potency of remifentanil, direct smooth muscle effects might predominate in
some subjects, resulting in an increase in tone. Like propofol, remifentanil might
also have properties that modulate the opioid response. The focus of these
speculations is that opioid effects on gastric tone are variable and depend on
factors like the state of the subject and the current status of the neural pathways
and smooth muscles that are involved. This might be an explanation for the
variable results in study III.
Effects of fentanyl on gastric myoelectrical activity (IV)
In study IV we evaluated how fentanyl affected gastric myoelectrical activity.
Before the intervention, all subjects had a 3 cpm slow wave activity, which did
51
not differ from a recent multicenter electrogastrography study in normal subjects
(157). After fentanyl, gastric myoelectrical activity was inhibited, with a decrease
in both the dominant frequency and the dominant power of the electrogastrographic spectra. The electrical activity was disrupted after the administration of
fentanyl, and we observed both bradygastria and disappearance of the slow wave
activity. However, the EGG was unaffected in about half of the subjects.
There are only a few reports in the literature regarding the effects of opioids on
gastric electrical activity. Invasive recordings of gastric myoelectrical activity have
shown that morphine transiently distorts the slow-wave activity and initiates
migrating myoelectric complexes (65, 173). Cutaneous recordings with EGG have
shown that morphine induces tachygastria (66). The shift in the basal EGG
frequency towards bradygastria that we observed in some of the subjects indicates
that opioids inhibit the ICC-network. Bradygastria is believed to be a decrease in
the frequency of the normal pacemaker cells, while other dysrhythmias like
tachygastria have ectopic origins in the stomach (174).
We tried to explain the variability seen in responders and non-responders. One
hypothesis may be a difference between the individuals in the plasma concentration of fentanyl. Unfortunately, blood samples were not collected during the EGG
study. By using a pharmacokinetic model (53, 175), we calculated the predicted
plasma concentrations of fentanyl for each subject. We were not able to find any
differences in the predicted concentrations between the outcome groups.
However, there is a notable wide variability in the model that may conceal
relevant differences. Further, as body composition affects the pharmacokinetic
profiles of a drug, we tested for differences in body weight and body mass index
between the groups, but found no differences. Also, it cannot be ruled out that
differences between the subjects in pharmacokinetic factors, i.e. distribution
volume, metabolism and clearance, alter the effect-site concentration of fentanyl
and thus the effect on gastric motility.
With the knowledge we have today, we cannot determine the exact mechanism of
the inhibition of myoelectrical activity. Possible locations of opioid receptors are
the interstitial cells of Cajal, interneurons in the enteric nervous system, and nerve
terminals from ascending pathways. There might also be a direct effect on gastric
smooth muscles, but such an effect would probably not affect the slow waves.
52
Our findings confirm that opioids inhibit the electrical activity, but we cannot
explain the variable outcome.
Associations to genetic factors (III, IV).
We hypothesized that genetic variability in the MOR gene was responsible for the
variations seen in the barostat and EGG studies (III and IV), but we did not find
such an association.
There are data indicating that genetic differences are able to alter the gastrointestinal response to opioids. The variable analgesic effect of codeine is related to
genetic variations, leading to different expressions of the enzyme (CYP2D6) that
metabolizes codeine to morphine. Among extensive metabolizers, orocecal transit
time is prolonged compared to poor metabolizers and correlates to higher
morphine concentrations in plasma (176). To our knowledge, there are no studies
regarding the relation of SNP in the μ-opioid receptor to the effect of opioids on
gastrointestinal motility. After reviewing the literature, we decided to analyze two
common SNPs in the μ-opioid receptor gene - A118G and IVS2 G691C (128).
The frequencies of SNP A118G in our material were similar to the frequencies
reported in the literature, and the distributions were in Hardy-Weinberg
equilibrium. There were discrepancies in the distributions of SNP G691C between
studies III and IV. In study III, the distribution was in equilibrium. In study IV, all
investigated subjects were either heterozygote or homozygote to G691C and there
were no normal “wild types” of G691C, and the distribution was not consistent
with the expected distributions in Hardy-Weinberg equilibrium. Our study group
may not represent a normal population, as the majority of subjects were woman
and almost all of them had gallbladder disease. This may introduce a selection
bias. However, with the small sample size it is difficult to draw any conclusions
regarding the distribution.
Our results indicate that pharmacogenetic differences in the opioid receptor gene
may not be a major factor regarding the variable gastric outcome caused by an
opioid. However, due to the small sample size we want to emphasis that our
results are preliminary observations and they must be interpreted with caution.
Genetic variations can still be one co-factor, but not the factor that determined
the outcome in our studies.
53
Side effects of opioids
Nausea and vomiting are known side effects of opioid treatment (177) and we
had a high incidence in our studies. In the studies with volunteers (I and III), one
third to one half of the subjects experienced nausea during the remifentanil
infusion. The incidences of PONV in study II were 48% and 62% (TIVA and
GAS), respectively, and in study II the incidence was around 50%.
Those in Study I who experienced nausea did so during both occasions with
remifentanil. This indicates that there are individual factors that do not change
over time that determine if opioids induce nausea. In study IV we found an
association between opioid induced EGG changes and PONV. We speculate that
in subjects who are sensitive to opioids, both gastric motility changes and nausea
are easily induced. The emetic center and the motor nuclei are located close to
each other in the medulla and neurons influenced by opioids might affect both
systems.
In studies I and III, subjects experienced difficulties swallowing during the
remifentanil infusion. There are reports in the literature showing that potent
opioids can cause dysphagia (178). This side effect provides evidence that potent
opioids inhibit motility patterns through central mechanisms, as swallowing is a
process controlled by neuronal networks in the medulla (179).
Future perspectives
As we still have only small islands of knowledge about the actions of opioids in
the gastrointestinal system and the underlying mechanisms (7), more research is
needed to find out how we can diminish the side effects of the opioids. Novel,
peripheral-acting opioid antagonists are promising and need more evaluation.
However, as opioids also act through central mechanisms in the brain (66), it
might be impossible to antagonize all side effects in the gastrointestinal tract.
Using the results from out studies as a base, we might be able to further explore
the efficiency of the new antagonists. Can we improve gastric emptying during
opioid treatment? How is the dual response we achieved in gastric tone altered,
and can we reveal peripheral and central actions of opioids?
The finding that EGG changes predicted PONV might be useful in helping us
identify subjects at high risk for PONV. Properly designed studies must be
conducted with this issue as the primary hypothesis.
54
Conclusions
-
Remifentanil delayed gastric emptying.
-
Posture did not influence gastric emptying rates during a remifentanil
infusion.
-
There were no differences in postoperative gastric emptying rates between
a remifentanil-propofol based total intravenous anesthesia and an opioid
free sevoflurane inhalational anesthesia.
-
Remifentanil both increased and decreased proximal gastric tone and the
responses were individual.
-
Fentanyl inhibited gastric myoelectrical activity, although half of the
subjects were “non-responders.”
-
“Responders” to fentanyl (EGG changes) had higher incidences of PONV.
-
No associations were found between common SNPs in the μopioidreceptor gene and the variable outcomes in the gastric barostat studies and the EGG studies.
55
Acknowledgments
I wish to express my warm and sincere gratitude to:
All the volunteers and patients who contributed to this thesis.
My friend and tutor Magnus Wattwil, for initiating and guiding me in the field of
research, for patiently believing in me despite my remote location and the other
projects in my life, and for his incredible knowledge about how-to-get-to-andsurvive-a-congress.
My friend and co-tutor Sven-Egron Thörn, for head-hunting me into anesthesia,
for invaluable collaboration in my studies, for being a computer-mate, for
enthusiasm about everything, and for sharing important things in life.
Greger Lindberg, for collaboration with the electrogastrograph, for the genetic
hypothesis, and for constructive and valuable criticism.
Lisbeth Wattwil and Åsa Löfqvist, for all the blood samples and for your
unfailing practical support in my projects.
Mathias Sandin, for assistance in the electrogastrography study.
All my fellow colleagues and members of the staff at the Department of
Anesthesia, Sundsvall Hospital, for supporting me and being great colleagues and
friends.
My boss, Thomas Bohlin, for giving me time for my research.
My former colleagues and members of the staff at ANIVA-kliniken, Örebro, for
creating an inspiring research environment.
Hans Malker and FoU-centrum, Landstinget Västernorrland, for believing in my
projects and for providing the possibility for me to carry them out.
Margaretha Jurstrand, for deep-freezing my blood samples for the genetic
analysis.
The Medical Library at Sundsvall Hospital, for excellent bibliographic service.
Jane Wigertz, for linguistic revision of the text.
My friends and family, hopefully all of you now understand a little of what I have
been doing.
Those I have forgotten to mention… many thanks!
Maria, my beloved wife and best friend, for your love and support. If we hadn’t
had so much fun together, this thesis would have been defended ages ago…
Andreas, our best gift ever.
The work in this thesis was supported by fundings from Research and Development
Center (FoU-Centrum), Västernorrland County Council and Research Committee of
Örebro County Council.
56
References
1.
Bauer AJ, Boeckxstaens GE. Mechanisms of postoperative ileus. Neurogastroenterol Motil
2004:16 Suppl 2:54-60.
2.
Resnick J, Greenwald DA, Brandt LJ. Delayed gastric emptying and postoperative ileus
after nongastric abdominal surgery: part I. Am J Gastroenterol 1997:92(5):751-62.
3.
Luckey A, Livingston E, Tache Y. Mechanisms and treatment of postoperative ileus. Arch
Surg 2003:138(2):206-14.
4.
Baig MK, Wexner SD. Postoperative ileus: a review. Dis Colon Rectum 2004:47(4):516-26.
5.
Delaney CP. Clinical perspective on postoperative ileus and the effect of opiates.
Neurogastroenterol Motil 2004:16 Suppl 2:61-6.
6.
Kurz A, Sessler DI. Opioid-induced bowel dysfunction: pathophysiology and potential new
therapies. Drugs 2003:63(7):649-71.
7.
Hicks GA, DeHaven-Hudkins DL, Camilleri M. Opiates in the control of gastrointestinal
tract function: current knowledge and new avenues for research. Neurogastroenterol Motil
2004:16 Suppl 2:67-70.
8.
Azpiroz F. Control of gastric emptying by gastric tone. Dig Dis Sci 1994:39(12 Suppl):18S19S.
9.
Read NW, Houghton LA. Physiology of gastric emptying and pathophysiology of
gastroparesis. Gastroenterol Clin North Am 1989:18(2):359-73.
10.
Ramkumar D, Schulze KS. The pylorus. Neurogastroenterol Motil 2005:17 Suppl 1:22-30.
11.
Burks TF, Galligan JJ, Porreca F, Barber WD. Regulation of gastric emptying. Fed Proc
1985:44(14):2897-901.
12.
Chang FY. Electrogastrography: Basic knowledge, recording, processing and its clinical
applications. J Gastroenterol Hepatol 2005:20(4):502-16.
13.
Wood JD, Alpers DH, Andrews PL. Fundamentals of neurogastroenterology. Gut 1999:45
Suppl 2:II6-II16.
14.
Chang HY, Mashimo H, Goyal RK. Musings on the wanderer: what's new in our
understanding of vago-vagal reflex? IV. Current concepts of vagal efferent projections to
the gut. Am J Physiol Gastrointest Liver Physiol 2003:284(3):G357-66.
15.
Brookes SJH, Costa M. Functional Histoanatomy of the Enteric Nervous System. In:
Johnsson LR, editor. Physiology of the Gastrointestinal Tract. 4th ed: Elsevier Academic
Press; 2006. p. 577-602.
16.
Travagli RA, Hermann GE, Browning KN, Rogers RC. Brainstem circuits regulating gastric
function. Annu Rev Physiol 2006:68:279-305.
17.
Abrahamsson H, Glise H. Sympathetic nervous control of gastric motility and interaction
with vagal activity. Scand J Gastroenterol Suppl 1984:89:83-7.
18.
Glise H, Abrahamsson H. Reflex inhibition of gastric motility pathophysiological aspects.
Scand J Gastroenterol Suppl 1984:89:77-82.
19.
Naslund E, Bogefors J, Skogar S, Gryback P, Jacobsson H, Holst JJ, Hellstrom PM. GLP-1
slows solid gastric emptying and inhibits insulin, glucagon, and PYY release in humans. Am
J Physiol 1999:277(3 Pt 2):R910-6.
20.
Bojo L, Cassuto J. Gastric reflex relaxation by colonic distension. J Auton Nerv Syst
1992:38(1):57-64.
57
21.
Dockray JD. Gastrointestinal Hormones: Gastrin, Cholecystokinin, Somatostatin, and
Ghrelin. In: Johnsson LR, editor. Physiology of the Gastrointestinal Tract. 4th ed: Elsevier
Academic Press; 2006. p. 91-120.
22.
Masuda Y, Tanaka T, Inomata N, Ohnuma N, Tanaka S, Itoh Z, Hosoda H, Kojima M,
Kangawa K. Ghrelin stimulates gastric acid secretion and motility in rats. Biochem Biophys
Res Commun 2000:276(3):905-8.
23.
Englander EW, Greeley GH. Postpyloric Gastrointetsinal Peptides. In: Johnsson LR, editor.
Physiology of the Gastrointestinal Tract. 4th ed: Elsevier Academic Press; 2006. p. 121-159.
24.
Hellstrom PM, Gryback P, Jacobsson H. The physiology of gastric emptying. Best Pract Res
Clin Anaesthesiol 2006:20(3):397-407.
25.
Spiegel TA, Fried H, Hubert CD, Peikin SR, Siegel JA, Zeiger LS. Effects of posture on
gastric emptying and satiety ratings after a nutritive liquid and solid meal. Am J Physiol
Regul Integr Comp Physiol 2000:279(2):R684-94.
26.
Horowitz M, Jones K, Edelbroek MA, Smout AJ, Read NW. The effect of posture on
gastric emptying and intragastric distribution of oil and aqueous meal components and
appetite. Gastroenterology 1993:105(2):382-90.
27.
Burn-Murdoch R, Fisher MA, Hunt JN. Does lying on the right side increase the rate of
gastric emptying? J Physiol 1980:302:395-8.
28.
Maurer AH, Parkman HP. Update on gastrointestinal scintigraphy. Semin Nucl Med
2006:36(2):110-8.
29.
Gentilcore D, Hausken T, Horowitz M, Jones KL. Measurements of gastric emptying of
low- and high-nutrient liquids using 3D ultrasonography and scintigraphy in healthy subjects. Neurogastroenterol Motil 2006:18(12):1062-8.
30.
Hausken T, Mundt M, Samsom M. Low antroduodenal pressure gradients are responsible
for gastric emptying of a low-caloric liquid meal in humans. Neurogastroenterol Motil
2002:14(1):97-105.
31.
Soreide E, Hausken T, Soreide JA, Steen PA. Gastric emptying of a light hospital breakfast.
A study using real time ultrasonography. Acta Anaesthesiol Scand 1996:40(5):549-53.
32.
Nimmo WS, Heading RC, Wilson J, Tothill P, Prescott LF. Inhibition of gastric emptying
and drug absorption by narcotic analgesics. Br J Clin Pharmacol 1975:2(6):509-13.
33.
Clements JA, Heading RC, Nimmo WS, Prescott LF. Kinetics of acetaminophen absorption
and gastric emptying in man. Clin Pharmacol Ther 1978:24(4):420-31.
34.
Tarling MM, Toner CC, Withington PS, Baxter MK, Whelpton R, Goldhill DR. A model of
gastric emptying using paracetamol absorption in intensive care patients [see comments].
Intensive Care Med 1997:23(3):256-60.
35.
Jackson SJ, Bluck LJ. Measurement of gastric emptying by octanoate metabolism. Curr
Opin Clin Nutr Metab Care 2005:8(5):538-44.
36.
Camilleri M, Hasler WL, Parkman HP, Quigley EM, Soffer E. Measurement of
gastrointestinal motility in the GI laboratory. Gastroenterology 1998:115(3):747-62.
37.
Whitehead WE, Delvaux M. Standardization of barostat procedures for testing smooth
muscle tone and sensory thresholds in the gastrointestinal tract. The Working Team of
Glaxo-Wellcome Research, UK. Dig Dis Sci 1997:42(2):223-41.
38.
Bailey PL, Egan TD, Stanley TH. Intravenous Opioid Anesthestics. In: Miller RD, editor.
Anesthesia. 5th ed: Churchill Livingstone; 2000. p. 273-376.
39.
Camilleri M. Alvimopan, a selective peripherally acting mu-opioid antagonist. Neurogastroenterol Motil 2005:17(2):157-65.
40.
Greenwood-Van Meerveld B, Gardner CJ, Little PJ, Hicks GA, Dehaven-Hudkins DL.
Preclinical studies of opioids and opioid antagonists on gastrointestinal function. Neurogastroenterol Motil 2004:16 Suppl 2:46-53.
58
41.
Sternini C, Patierno S, Selmer IS, Kirchgessner A. The opioid system in the gastrointestinal
tract. Neurogastroenterol Motil 2004:16 Suppl 2:3-16.
42.
Ferrante FM. Principles of opioid pharmacotherapy: practical implications of basic
mechanisms. J Pain Symptom Manage 1996:11(5):265-73.
43.
Ganesh A, Maxwell LG. Pathophysiology and Management of Opioid-Induced Pruritus.
Drugs 2007:67(16):2323-2333.
44.
Sora I, Takahashi N, Funada M, Ujike H, Revay RS, Donovan DM, Miner LL, Uhl GR.
Opiate receptor knockout mice define mu receptor roles in endogenous nociceptive responses and morphine-induced analgesia. Proc Natl Acad Sci U S A 1997:94(4):1544-9.
45.
Aicher SA, Goldberg A, Sharma S, Pickel VM. mu-opioid receptors are present in vagal
afferents and their dendritic targets in the medial nucleus tractus solitarius. J Comp Neurol
2000:422(2):181-90.
46.
Tsuchida D, Fukuda H, Koda K, Miyazaki M, Pappas TN, Takahashi T. Central effect of
mu-opioid agonists on antral motility in conscious rats. Brain Res 2004:1024(1-2):244-50.
47.
Browning KN, Zheng Z, Gettys TW, Travagli RA. Vagal afferent control of opioidergic
effects in rat brainstem circuits. J Physiol 2006:575(Pt 3):761-76.
48.
Tejwani GA, Rattan AK, McDonald JS. Role of spinal opioid receptors in the antinociceptive interactions between intrathecal morphine and bupivacaine. Anesth Analg
1992:74(5):726-34.
49.
Pol O, Puig MM. Expression of opioid receptors during peripheral inflammation. Curr Top
Med Chem 2004:4(1):51-61.
50.
Shahbazian A, Heinemann A, Schmidhammer H, Beubler E, Holzer-Petsche U, Holzer P.
Involvement of mu- and kappa-, but not delta-, opioid receptors in the peristaltic motor
depression caused by endogenous and exogenous opioids in the guinea-pig intestine. Br J
Pharmacol 2002:135(3):741-50.
51.
Grider JR, Makhlouf GM. Identification of opioid receptors on gastric muscle cells by
selective receptor protection. Am J Physiol 1991:260(1 Pt 1):G103-7.
52.
Allescher HD, Ahmad S, Daniel EE, Dent J, Kostolanska F, Fox JE. Inhibitory opioid
receptors in canine pylorus. Am J Physiol 1988:255(3 Pt 1):G352-60.
53.
Shafer SL, Varvel JR, Aziz N, Scott JC. Pharmacokinetics of fentanyl administered by
computer-controlled infusion pump. Anesthesiology 1990:73(6):1091-102.
54.
Burkle H, Dunbar S, Van Aken H. Remifentanil: a novel, short-acting, mu-opioid. Anesth
Analg 1996:83(3):646-51.
55.
Trendelenburg P. Physiological and pharmacological investigations of small intestinal
peristalsis. Translation of the article "Physiologische und pharmakologische Versuche uber
die Dunndarmperistaltik", Arch. Exp. Pathol. Pharmakol. 81, 55-129, 1917. Naunyn
Schmiedebergs Arch Pharmacol 2006:373(2):101-33.
56.
Trendelenburg P. Physiologische und pharmakologische Versuche uber die Dunndarmperistaltik´. Arch Exp Pathol Pharmakol 1917(81):55-129.
57.
Wood JD, Galligan JJ. Function of opioids in the enteric nervous system. Neurogastroenterol Motil 2004:16 Suppl 2:17-28.
58.
Kromer W. Endogenous and exogenous opioids in the control of gastrointestinal motility
and secretion. Pharmacol Rev 1988:40(2):121-62.
59.
Burks TF, Hruby VJ, Galligan JJ, Porreca F. Opioids and CNS control of the gut. Nippon
Heikatsukin Gakkai Zasshi 1985:21 Suppl:101-2.
60.
Bagnol D, Mansour A, Akil H, Watson SJ. Cellular localization and distribution of the
cloned mu and kappa opioid receptors in rat gastrointestinal tract. Neuroscience
1997:81(2):579-91.
59
61.
Yokotani K, Osumi Y. Involvement of mu-receptor in endogenous opioid peptide-mediated
inhibition of acetylcholine release from the rat stomach. Jpn J Pharmacol 1998:78(1):93-5.
62.
Soldani G, Del Tacca M, Bernardini MC, Bardon T, Ruckebusch Y. Peripheral opioid
receptors mediate gastrointestinal secretory and motor effects of dermorphin N-terminal
tetrapeptide (NTT) in the dog. Neuropeptides 1987:10(1):67-76.
63.
Zhang L, Gu ZF, Pradhan T, Jensen RT, Maton PN. Characterization of opioid receptors
on smooth muscle cells from guinea pig stomach. Am J Physiol 1992:262(3 Pt 1):G461-9.
64.
Bitar KN, Makhlouf GM. Specific opiate receptors on isolated mammalian gastric smooth
muscle cells. Nature 1982:297(5861):72-4.
65.
Telford GL, Hoshmonai M, Moses AJ, Szurszewski JH. Morphine initiates migrating
myoelectric complexes by acting on peripheral opioid receptors. Am J Physiol 1985:249(5
Pt 1):G557-62.
66.
Thorn SE, Wattwil M, Lindberg G, Sawe J. Systemic and central effects of morphine on
gastroduodenal motility. Acta Anaesthesiol Scand 1996:40(2):177-86.
67.
Yuan CS, Foss JF, O'Connor M, Roizen MF, Moss J. Effects of low-dose morphine on
gastric emptying in healthy volunteers. J Clin Pharmacol 1998:38(11):1017-20.
68.
Murphy DB, Sutton JA, Prescott LF, Murphy MB. Opioid-induced delay in gastric
emptying: a peripheral mechanism in humans. Anesthesiology 1997:87(4):765-70.
69.
Browning KN, Kalyuzhny AE, Travagli RA. Opioid peptides inhibit excitatory but not
inhibitory synaptic transmission in the rat dorsal motor nucleus of the vagus. J Neurosci
2002:22(8):2998-3004.
70.
Aicher SA, Mitchell JL, Mendelowitz D. Distribution of mu-opioid receptors in rat visceral
premotor neurons. Neuroscience 2002:115(3):851-60.
71.
Silverman MB, Hermes SM, Zadina JE, Aicher SA. Mu-opioid receptor is present in
dendritic targets of Endomorphin-2 axon terminals in the nuclei of the solitary tract. Neuroscience 2005:135(3):887-96.
72.
Grundy D, Booth CE, Winchester W, Hicks GA. Peripheral opiate action on afferent fibres
supplying the rat intestine. Neurogastroenterol Motil 2004:16 Suppl 2:29-37.
73.
Patierno S, Zellalem W, Ho A, Parsons CG, Lloyd KC, Tonini M, Sternini C. N-methyl-Daspartate receptors mediate endogenous opioid release in enteric neurons after abdominal
surgery. Gastroenterology 2005:128(7):2009-19.
74.
Patierno S, Raybould HE, Sternini C. Abdominal surgery induces mu opioid receptor
endocytosis in enteric neurons of the guinea-pig ileum. Neuroscience 2004:123(1):101-9.
75.
Sanger GJ, Tuladhar BR. The role of endogenous opioids in the control of gastrointestinal
motility: predictions from in vitro modelling. Neurogastroenterol Motil 2004:16 Suppl
2:38-45.
76.
Marshall FN, Pittinger CB, Long JP. Effects of halothane on gastrointestinal motility.
Anesthesiology 1961:22:363-6.
77.
Wright JW, Healy TE, Balfour TW, Hardcastle JD. Effects of inhalation anaesthetic agents
on the electrical and mechanical activity of the rat duodenum. Br J Anaesth
1982:54(11):1223-30.
78.
Schurizek BA. The effects of general anaesthesia on antroduodenal motility, gastric pH and
gastric emptying in man. Dan Med Bull 1991:38(4):347-65.
79.
Hammas B, Hvarfner A, Thorn SE, Wattwil M. Propofol sedation and gastric emptying in
volunteers. Acta Anaesthesiol Scand 1998:42(1):102-5.
80.
Lee TL, Ang SB, Dambisya YM, Adaikan GP, Lau LC. The effect of propofol on human
gastric and colonic muscle contractions. Anesth Analg 1999:89(5):1246-9.
81.
Karamanolis G, Tack J. Promotility medications--now and in the future. Dig Dis
2006:24(3-4):297-307.
60
82.
Galligan JJ, Vanner S. Basic and clinical pharmacology of new motility promoting agents.
Neurogastroenterol Motil 2005:17(5):643-53.
83.
Levein NG, Thorn SE, Wattwil M. Dopamine delays gastric emptying and prolongs
orocaecal transit time in volunteers. Eur J Anaesthesiol 1999:16(4):246-50.
84.
Levein NG, Thorn SE, Lindberg G, Wattwill M. Dopamine reduces gastric tone in a doserelated manner. Acta Anaesthesiol Scand 1999:43(7):722-5.
85.
Beattie DT, Smith JA, Marquess D, Vickery RG, Armstrong SR, Pulido-Rios T,
McCullough JL, Sandlund C, Richardson C, Mai N, Humphrey PP. The 5-HT4 receptor
agonist, tegaserod, is a potent 5-HT2B receptor antagonist in vitro and in vivo. Br J Pharmacol 2004:143(5):549-60.
86.
Park MI, Ferber I, Camilleri M, Allenby K, Trillo R, Burton D, Zinsmeister AR. Effect of
atilmotin on gastrointestinal transit in healthy subjects: a randomized, placebo-controlled
study. Neurogastroenterol Motil 2006:18(1):28-36.
87.
Cowles VE, Nellans HN, Seifert TR, Besecke LM, Segreti JA, Mohning KM, Faghih R,
Verlinden MH, Wegner CD. Effect of novel motilide ABT-229 versus erythromycin and
cisapride on gastric emptying in dogs. J Pharmacol Exp Ther 2000:293(3):1106-11.
88.
Lewis TD. Morphine and gastroduodenal motility. Dig Dis Sci 1999:44(11):2178-86.
89.
Foss JF. A review of the potential role of methylnaltrexone in opioid bowel dysfunction.
Am J Surg 2001:182(5A Suppl):19S-26S.
90.
Taguchi A, Sharma N, Saleem RM, Sessler DI, Carpenter RL, Seyedsadr M, Kurz A.
Selective postoperative inhibition of gastrointestinal opioid receptors. N Engl J Med
2001:345(13):935-40.
91.
Liu SS, Hodgson PS, Carpenter RL, Fricke JR, Jr. ADL 8-2698, a trans-3,4-dimethyl-4-(3hydroxyphenyl) piperidine, prevents gastrointestinal effects of intravenous morphine without affecting analgesia. Clin Pharmacol Ther 2001:69(1):66-71.
92.
Wolff BG, Weese JL, Ludwig KA, Delaney CP, Stamos MJ, Michelassi F, Du W, Techner L.
Postoperative ileus-related morbidity profile in patients treated with alvimopan after bowel
resection. J Am Coll Surg 2007:204(4):609-16.
93.
Herzog TJ, Coleman RL, Guerrieri JP, Jr., Gabriel K, Du W, Techner L, Fort JG, Wallin B.
A double-blind, randomized, placebo-controlled phase III study of the safety of alvimopan
in patients who undergo simple total abdominal hysterectomy. Am J Obstet Gynecol
2006:195(2):445-53.
94.
Tan EK, Cornish J, Darzi AW, Tekkis PP. Meta-analysis: Alvimopan vs. placebo in the
treatment of post-operative ileus. Aliment Pharmacol Ther 2007:25(1):47-57.
95.
Wolff BG, Michelassi F, Gerkin TM, Techner L, Gabriel K, Du W, Wallin BA. Alvimopan,
a novel, peripherally acting mu opioid antagonist: results of a multicenter, randomized,
double-blind, placebo-controlled, phase III trial of major abdominal surgery and postoperative ileus. Ann Surg 2004:240(4):728-34; discussion 734-5.
96.
Senagore AJ, Bauer JJ, Du W, Techner L. Alvimopan accelerates gastrointestinal recovery
after bowel resection regardless of age, gender, race, or concomitant medication use. Surgery 2007:142(4):478-86.
97.
Yuan CS, Foss JF, Moss J. Effects of methylnaltrexone on morphine-induced inhibition of
contraction in isolated guinea-pig ileum and human intestine. Eur J Pharmacol 1995:276(12):107-11.
98.
Foss JF, O'Connor MF, Yuan CS, Murphy M, Moss J, Roizen MF. Safety and tolerance of
methylnaltrexone in healthy humans: a randomized, placebo-controlled, intravenous,
ascending-dose, pharmacokinetic study. J Clin Pharmacol 1997:37(1):25-30.
99.
Yuan CS, Foss JF. Gastric effects of methylnaltrexone on mu, kappa, and delta opioid
agonists induced brainstem unitary responses. Neuropharmacology 1999:38(3):425-32.
61
100. Yuan CS. Methylnaltrexone mechanisms of action and effects on opioid bowel dysfunction
and other opioid adverse effects. Ann Pharmacother 2007:41(6):984-93.
101. Shaiova L, Rim F, Friedman D, Jahdi M. A review of methylnaltrexone, a peripheral opioid
receptor antagonist, and its role in opioid-induced constipation. Palliat Support Care
2007:5(2):161-6.
102. Janda M, Scheeren TW, Noldge-Schomburg GF. Management of pulmonary aspiration.
Best Pract Res Clin Anaesthesiol 2006:20(3):409-27.
103. Maltby JR. Fasting from midnight--the history behind the dogma. Best Pract Res Clin
Anaesthesiol 2006:20(3):363-78.
104. Ljungqvist O, Soreide E. Preoperative fasting. Br J Surg 2003:90(4):400-6.
105. Stuart PC. The evidence base behind modern fasting guidelines. Best Pract Res Clin
Anaesthesiol 2006:20(3):457-69.
106. Soreide E, Eriksson LI, Hirlekar G, Eriksson H, Henneberg SW, Sandin R, Raeder J. Preoperative fasting guidelines: an update. Acta Anaesthesiol Scand 2005:49(8):1041-7.
107. Soreide E, Ljungqvist O. Modern preoperative fasting guidelines: a summary of the present
recommendations and remaining questions. Best Pract Res Clin Anaesthesiol
2006:20(3):483-91.
108. Morris J, Cook TM. Rapid sequence induction: a national survey of practice. Anaesthesia
2001:56(11):1090-7.
109. Andersen HK, Lewis SJ, Thomas S. Early enteral nutrition within 24h of colorectal surgery
versus later commencement of feeding for postoperative complications. Cochrane Database
Syst Rev 2006(4):CD004080.
110. Han-Geurts IJ, Hop WC, Kok NF, Lim A, Brouwer KJ, Jeekel J. Randomized clinical trial
of the impact of early enteral feeding on postoperative ileus and recovery. Br J Surg
2007:94(5):555-61.
111. Charoenkwan K, Phillipson G, Vutyavanich T. Early versus delayed (traditional) oral fluids
and food for reducing complications after major abdominal gynaecologic surgery. Cochrane
Database Syst Rev 2007(4):CD004508.
112. Mangesi L, Hofmeyr GJ. Early compared with delayed oral fluids and food after caesarean
section. Cochrane Database Syst Rev 2002(3):CD003516.
113. Fukuda H, Tsuchida D, Koda K, Miyazaki M, Pappas TN, Takahashi T. Impaired gastric
motor activity after abdominal surgery in rats. Neurogastroenterol Motil 2005:17(2):24550.
114. Liu SS, Carpenter RL, Mackey DC, Thirlby RC, Rupp SM, Shine TS, Feinglass NG,
Metzger PP, Fulmer JT, Smith SL. Effects of perioperative analgesic technique on rate of
recovery after colon surgery. Anesthesiology 1995:83(4):757-65.
115. Jorgensen H, Wetterslev J, Moiniche S, Dahl JB. Epidural local anaesthetics versus opioidbased analgesic regimens on postoperative gastrointestinal paralysis, PONV and pain after
abdominal surgery. Cochrane Database Syst Rev 2001(1):CD001893.
116. Apfel CC, Laara E, Koivuranta M, Greim CA, Roewer N. A simplified risk score for
predicting postoperative nausea and vomiting: conclusions from cross-validations between
two centers. Anesthesiology 1999:91(3):693-700.
117. Martin B. Prevention of gastrointestinal complications in the critically ill patient. AACN
Adv Crit Care 2007:18(2):158-66.
118. Chapman MJ, Nguyen NQ, Fraser RJ. Gastrointestinal motility and prokinetics in the
critically ill. Curr Opin Crit Care 2007:13(2):187-94.
119. Rohm KD, Schollhorn T, Boldt J, Wolf M, Papsdorf M, Piper SN. Nutrition support and
treatment of motility disorders in critically ill patients - Results of a survey on German
intensive care units. Eur J Anaesthesiol 2007:1-9.
62
120. Nguyen NQ, Chapman MJ, Fraser RJ, Bryant LK, Holloway RH. Erythromycin is more
effective than metoclopramide in the treatment of feed intolerance in critical illness. Crit
Care Med 2007:35(2):483-9.
121. Berne JD, Norwood SH, McAuley CE, Vallina VL, Villareal D, Weston J, McClarty J.
Erythromycin reduces delayed gastric emptying in critically ill trauma patients: a randomized, controlled trial. J Trauma 2002:53(3):422-5.
122. Jooste CA, Mustoe J, Collee G. Metoclopramide improves gastric motility in critically ill
patients. Intensive Care Med 1999:25(5):464-8.
123. Nguyen NQ, Chapman M, Fraser RJ, Bryant LK, Burgstad C, Holloway RH. Prokinetic
therapy for feed intolerance in critical illness: One drug or two? Crit Care Med 2007.
124. Meissner W, Dohrn B, Reinhart K. Enteral naloxone reduces gastric tube reflux and
frequency of pneumonia in critical care patients during opioid analgesia. Crit Care Med
2003:31(3):776-80.
125. Mixides G, Liebl MG, Bloom K. Enteral administration of naloxone for treatment of
opioid-associated intragastric feeding intolerance. Pharmacotherapy 2004:24(2):291-4.
126. Roberts DJ, Banh HL, Hall RI. Use of novel prokinetic agents to facilitate return of
gastrointestinal motility in adult critically ill patients. Curr Opin Crit Care 2006:12(4):295302.
127. Mayer P, Hollt V. Pharmacogenetics of opioid receptors and addiction. Pharmacogenet
Genomics 2006:16(1):1-7.
128. Ikeda K, Ide S, Han W, Hayashida M, Uhl GR, Sora I. How individual sensitivity to opiates
can be predicted by gene analyses. Trends Pharmacol Sci 2005:26(6):311-7.
129. Klepstad P, Dale O, Skorpen F, Borchgrevink PC, Kaasa S. Genetic variability and clinical
efficacy of morphine. Acta Anaesthesiol Scand 2005:49(7):902-8.
130. Lotsch J, Geisslinger G. Are mu-opioid receptor polymorphisms important for clinical
opioid therapy? Trends Mol Med 2005:11(2):82-9.
131. Palmer SN, Giesecke NM, Body SC, Shernan SK, Fox AA, Collard CD. Pharmacogenetics
of anesthetic and analgesic agents. Anesthesiology 2005:102(3):663-71.
132. Bond C, LaForge KS, Tian M, Melia D, Zhang S, Borg L, Gong J, Schluger J, Strong JA,
Leal SM, Tischfield JA, Kreek MJ, Yu L. Single-nucleotide polymorphism in the human mu
opioid receptor gene alters beta-endorphin binding and activity: possible implications for
opiate addiction. Proc Natl Acad Sci U S A 1998:95(16):9608-13.
133. Landau R, Cahana A, Smiley RM, Antonarakis SE, Blouin JL. Genetic variability of muopioid receptor in an obstetric population. Anesthesiology 2004:100(4):1030-3.
134. Hollt V. A polymorphism (A118G) in the mu-opioid receptor gene affects the response to
morphine-6-glucuronide in humans. Pharmacogenetics 2002:12(1):1-2.
135. Margas W, Zubkoff I, Schuler HG, Janicki PK, Ruiz-Velasco V. Modulation of Ca2+
channels by heterologously expressed wild-type and mutant human micro-opioid receptors
(hMORs) containing the A118G single-nucleotide polymorphism. J Neurophysiol
2007:97(2):1058-67.
136. Beyer A, Koch T, Schroder H, Schulz S, Hollt V. Effect of the A118G polymorphism on
binding affinity, potency and agonist-mediated endocytosis, desensitization, and resensitization of the human mu-opioid receptor. J Neurochem 2004:89(3):553-60.
137. Lotsch J, Skarke C, Grosch S, Darimont J, Schmidt H, Geisslinger G. The polymorphism
A118G of the human mu-opioid receptor gene decreases the pupil constrictory effect of
morphine-6-glucuronide but not that of morphine. Pharmacogenetics 2002:12(1):3-9.
138. Romberg R, Olofsen E, Bijl H. Polymorphism of μ-Opiodreceptor Gene (OPRM1:c.118>G)
Does Not Protect Against Opioidinduced Respiratory Depression despite Reduced Analgetic
Response? Anesthesiology 2005:102(3):522-30.
63
139. Fillingim RB, Kaplan L, Staud R, Ness TJ, Glover TL, Campbell CM, Mogil JS, Wallace
MR. The A118G single nucleotide polymorphism of the mu-opioid receptor gene (OPRM1)
is associated with pressure pain sensitivity in humans. J Pain 2005:6(3):159-67.
140. Chou WY, Yang LC, Lu HF, Ko JY, Wang CH, Lin SH, Lee TH, Concejero A, Hsu CJ.
Association of mu-opioid receptor gene polymorphism (A118G) with variations in morphine consumption for analgesia after total knee arthroplasty. Acta Anaesthesiol Scand
2006:50(7):787-92.
141. Klepstad P, Rakvag TT, Kaasa S, Holthe M, Dale O, Borchgrevink PC, Baar C, Vikan T,
Krokan HE, Skorpen F. The 118 A > G polymorphism in the human micro-opioid receptor
gene may increase morphine requirements in patients with pain caused by malignant disease. Acta Anaesthesiol Scand 2004:48(10):1232-9.
142. Chou WY, Wang CH, Liu PH, Liu CC, Tseng CC, Jawan B. Human opioid receptor
A118G polymorphism affects intravenous patient-controlled analgesia morphine consumption after total abdominal hysterectomy. Anesthesiology 2006:105(2):334-7.
143. Coulbault L, Beaussier M, Verstuyft C, Weickmans H, Dubert L, Tregouet D, Descot C,
Parc Y, Lienhart A, Jaillon P, Becquemont L. Environmental and genetic factors associated
with morphine response in the postoperative period. Clin Pharmacol Ther 2006:79(4):316324.
144. Skarke C, Darimont J, Schmidt H, Geisslinger G, Lotsch J. Analgesic effects of morphine
and morphine-6-glucuronide in a transcutaneous electrical pain model in healthy volunteers. Clin Pharmacol Ther 2003:73(1):107-21.
145. Ross JR, Rutter D, Welsh K, Joel SP, Goller K, Wells AU, Du Bois R, Riley J. Clinical
response to morphine in cancer patients and genetic variation in candidate genes. Pharmacogenomics J 2005:5(5):324-36.
146. Ray LA, Hutchison KE. A polymorphism of the mu-opioid receptor gene (OPRM1) and
sensitivity to the effects of alcohol in humans. Alcohol Clin Exp Res 2004:28(12):1789-95.
147. van den Wildenberg E, Wiers RW, Dessers J, Janssen RG, Lambrichs EH, Smeets HJ, van
Breukelen GJ. A functional polymorphism of the mu-opioid receptor gene (OPRM1) influences cue-induced craving for alcohol in male heavy drinkers. Alcohol Clin Exp Res
2007:31(1):1-10.
148. Ray LA, Hutchison KE. Effects of naltrexone on alcohol sensitivity and genetic moderators
of medication response: a double-blind placebo-controlled study. Arch Gen Psychiatry
2007:64(9):1069-77.
149. Nishizawa D, Han W, Hasegawa J, Ishida T, Numata Y, Sato T, Kawai A, Ikeda K.
Association of micro-opioid receptor gene polymorphism A118G with alcohol dependence
in a Japanese population. Neuropsychobiology 2006:53(3):137-41.
150. Bart G, Kreek MJ, Ott J, LaForge KS, Proudnikov D, Pollak L, Heilig M. Increased
attributable risk related to a functional mu-opioid receptor gene polymorphism in association with alcohol dependence in central Sweden. Neuropsychopharmacology
2005:30(2):417-22.
151. Arias A, Feinn R, Kranzler HR. Association of an Asn40Asp (A118G) polymorphism in the
mu-opioid receptor gene with substance dependence: a meta-analysis. Drug Alcohol Depend 2006:83(3):262-8.
152. Chong RY, Oswald L, Yang X, Uhart M, Lin PI, Wand GS. The Mu-Opioid Receptor
Polymorphism A118G Predicts Cortisol Responses to Naloxone and Stress. Neuropsychopharmacology 2006:31(1):204-11.
153. Willems M, Quartero AO, Numans ME. How useful is paracetamol absorption as a marker
of gastric emptying? A systematic literature study. Dig Dis Sci 2001:46(10):2256-62.
154. Azpiroz F, Malagelada JR. Gastric tone measured by an electronic barostat in health and
postsurgical gastroparesis. Gastroenterology 1987:92(4):934-43.
64
155. Hammas B, Thorn SE, Wattwil M. Propofol and gastric effects of morphine. Acta
Anaesthesiol Scand 2001:45(8):1023-7.
156. Sanders KM, Ördög T, Koh SD, Ward SM. Properties of Electrical Rhytmicity in the
Stomach. In: Koch KL, Stern RM, editors. Handbook of Electrogastrography. New York:
Oxford University Press; 2004. p. 13-36.
157. Simonian HP, Panganamamula K, Parkman HP, Xu X, Chen JZ, Lindberg G, Xu H, Shao
C, Ke MY, Lykke M, Hansen P, Barner B, Buhl H. Multichannel electrogastrography
(EGG) in normal subjects: a multicenter study. Dig Dis Sci 2004:49(4):594-601.
158. Sanaka M, Kuyama Y, Yamanaka M. Guide for judicious use of the paracetamol
absorption technique in a study of gastric emptying rate of liquids. J Gastroenterol
1998:33(6):785-91.
159. Sanaka M, Kuyama Y, Nishinakagawa S, Mineshita S. Use of salivary acetaminophen
concentration to assess gastric emptying rate of liquids. J Gastroenterol 2000:35(6):429-33.
160. Schwizer W, Steingotter A, Fox M, Zur T, Thumshirn M, Bosiger P, Fried M. Non-invasive
measurement of gastric accommodation in humans. Gut 2002:51 Suppl 1:i59-62.
161. Parkman HP, Hasler WL, Barnett JL, Eaker EY. Electrogastrography: a document prepared
by the gastric section of the American Motility Society Clinical GI Motility Testing Task
Force. Neurogastroenterol Motil 2003:15(2):89-102.
162. Simonian HP, Panganamamula K, Chen JZ, Fisher RS, Parkman HP. Multichannel
electrogastrography (EGG) in symptomatic patients: a single center study. Am J Gastroenterol 2004:99(3):478-85.
163. Sanders KM, Koh SD, Ward SM. Interstitial cells of cajal as pacemakers in the gastrointestinal tract. Annu Rev Physiol 2006:68:307-43.
164. Wang ZS, Elsenbruch S, Orr WC, Chen JD. Detection of gastric slow wave uncoupling
from multi-channel electrogastrogram: validations and applications. Neurogastroenterol
Motil 2003:15(5):457-65.
165. Lotsch J, Geisslinger G. Current evidence for a genetic modulation of the response to
analgesics. Pain 2006:121(1-2):1-5.
166. Anvari M, Horowitz M, Fraser R, Maddox A, Myers J, Dent J, Jamieson GG. Effects of
posture on gastric emptying of nonnutrient liquids and antropyloroduodenal motility. Am J
Physiol 1995:268(5 Pt 1):G868-71.
167. Bueno L, Fioramonti J. Action of opiates on gastrointestinal function. Baillieres Clin
Gastroenterol 1988:2(1):123-39.
168. Behm B, Stollman N. Postoperative ileus: etiologies and interventions. Clin Gastroenterol
Hepatol 2003:1(2):71-80.
169. Jahnberg T. Gastric adaptive relaxation. Effects of vagal activation and vagotomy. An
experimental study in dogs and in man. Scand J Gastroenterol Suppl 1977:46:1-32.
170. Tack J, Demedts I, Meulemans A, Schuurkes J, Janssens J. Role of nitric oxide in the gastric
accommodation reflex and in meal induced satiety in humans. Gut 2002:51(2):219-24.
171. Storr M, Gaffal E, Schusdziarra V, Allescher HD. Endomorphins 1 and 2 reduce relaxant
non-adrenergic, non-cholinergic neurotransmission in rat gastric fundus. Life Sci
2002:71(4):383-9.
172. Penagini R, Allocca M, Cantu P, Mangano M, Savojardo D, Carmagnola S, Bianchi PA.
Relationship between motor function of the proximal stomach and transient lower oesophageal sphincter relaxation after morphine. Gut 2004:53(9):1227-31.
173. Thorn SE, Wickbom G, Philipson L, Leissner P, Wattwil M. Myoelectric activity in the
stomach and duodenum after epidural administration of morphine or bupivacaine. Acta
Anaesthesiol Scand 1996:40(7):773-8.
65
174. Qian LW, Pasricha PJ, Chen JD. Origins and patterns of spontaneous and drug-induced
canine gastric myoelectrical dysrhythmia. Dig Dis Sci 2003:48(3):508-15.
175. Shibutani K, Inchiosa MA, Jr., Sawada K, Bairamian M. Accuracy of pharmacokinetic
models for predicting plasma fentanyl concentrations in lean and obese surgical patients:
derivation of dosing weight ("pharmacokinetic mass"). Anesthesiology 2004:101(3):60313.
176. Mikus G, Trausch B, Rodewald C, Hofmann U, Richter K, Gramatte T, Eichelbaum M.
Effect of codeine on gastrointestinal motility in relation to CYP2D6 phenotype. Clin Pharmacol Ther 1997:61(4):459-66.
177. Watcha MF, White PF. Postoperative nausea and vomiting. Its etiology, treatment, and
prevention. Anesthesiology 1992:77(1):162-84.
178. Currier DS, Levin KR, Campbell C. Dysphagia with intrathecal fentanyl. Anesthesiology
1997:87(6):1570-1.
179. Martino R, Terrault N, Ezerzer F, Mikulis D, Diamant NE. Dysphagia in a patient with
lateral medullary syndrome: insight into the central control of swallowing. Gastroenterology 2001:121(2):420-6.
66
STUDY I
115
Klunserna Study
115
05-10-25, 10.10
STUDY I
The Delay of Gastric Emptying Induced by Remifentanil Is
Not Influenced by Posture
Jakob Walldén,
MD*†,
Sven-Egron Thörn,
MD, PhD*,
and Magnus Wattwil,
MD, PhD*†
*Department of Anesthesia and Intensive Care, Örebro University Hospital, Örebro, Sweden; and †Department of
Medicine and Care, Faculty of Health Sciences, Linköping, Sweden
Posture has an effect on gastric emptying. In this study,
we investigated whether posture influences the delay in
gastric emptying induced by opioid analgesics. Ten
healthy male subjects underwent 4 gastric emptying studies with the acetaminophen method. On two occasions the
subjects were given a continuous infusion of remifentanil
(0.2 ␮g · kg⫺1 · min⫺1) while lying either on the right lateral side in a 20° head-up position or on the left lateral side
in a 20° head-down position. On two other occasions no
infusion was given, and the subjects were studied lying in
the two positions. When remifentanil was given, there
were no significant differences between the two postures
in maximal acetaminophen concentration (right side, 34
␮mol 䡠 L⫺1; versus left side, 16 ␮mol 䡠 L⫺1), time taken to
reach the maximal concentration (94 versus 109 min), or
T
he use of IV, epidural, and intrathecal opioids for
postoperative pain relief causes a delay in gastric
emptying (1–3). This may delay intake of fluids
and food and influence the absorption of drugs administered orally. Both systemic and spinal opioids
delay gastric emptying (2). This delay may be caused
by decreased gastric motility and gastric tone or increased pyloric tone. The pylorus has a rich enkephalinergic innervation, and opioids may therefore increase pyloric tone (4). Posture influences gastric
emptying, particularly with prolonged emptying
when patients are in a left lateral position (5–7). The
use of opioids also increases the risk for postoperative
nausea and vomiting (8).
The effects of posture on gastric emptying during
opioid administration have not been studied. If posture
The study was supported by grants from the Örebro County
Council Research Committee.
Accepted for publication January 20, 2004.
Address correspondence to Jakob Walldén, MD, Department of
Anesthesia and Intensive Care, Örebro University Hospital, 701 85
Örebro, Sweden. Address e-mail to [email protected]. Address reprint requests to Magnus Wattwil, MD, PhD, Department of
Anesthesia and Intensive Care, Örebro University Hospital, 701 85
Örebro, Sweden. Address e-mail to [email protected].
DOI: 10.1213/01.ANE.0000121345.58835.93
©2004 by the International Anesthesia Research Society
0003-2999/04
area under the serum acetaminophen concentration time
curve from 0 to 60 min (962 versus 197 min 䡠 ␮mol 䡠 L⫺1).
In the control situation, there were differences between
the postures in maximal acetaminophen concentration
(138 versus 94 ␮mol 䡠 L⫺1; P ⬍ 0.0001) and area under the
serum acetaminophen concentration time curves from 0
to 60 min (5092 versus 3793 min 䡠 ␮mol 䡠 L⫺1; P ⬍ 0.0001),
but there was no significant difference in time taken to
reach the maximal concentration (25 versus 47 min). Compared with the control situation, remifentanil delayed
gastric emptying in both postures. We conclude that
remifentanil delays gastric emptying and that this delay is
not influenced by posture.
(Anesth Analg 2004;99:429 –34)
has an effect, then an optimal position may be found that
facilitates gastric emptying and thereby reduces the negative effects. However, if opioids increase pyloric tone,
gastric emptying may not be influenced by posture.
Because postoperative opioids are used in most patients undergoing major surgery, the purpose of this
study was to evaluate whether posture can influence the
delayed gastric emptying induced by an opioid. We
compared the effects on gastric emptying of 2 extreme
postures in 10 healthy volunteers with and without the
administration of remifentanil. The objective for using
volunteers was to eliminate other factors (e.g., surgical
stress and pain) that influence gastric emptying and
study the pure effect of an opioid. As an opioid, an
infusion of the ultra-short-acting opioid remifentanil
was chosen because of its pharmacological profile
with which a predictable and constant effect could be
achieved. The acetaminophen method was used to
study gastric emptying.
Methods
After approval of the study protocol by the ethics
committee of the Örebro County Council, 10 healthy
male volunteers with a mean age of 23.9 yr (range,
21–31 yr), a mean weight of 80 kg (range, 71–98 kg),
Anesth Analg 2004;99:429–34
429
430
ANESTHETIC PHARMACOLOGY WALLDÉN ET AL.
REMIFENTANIL AND GASTRIC EMPTYING
and a mean height of 180 cm (range, 173–188 cm) were
recruited to the study. The subjects gave their informed consent to participate after receiving verbal
and written information. Only men were recruited,
because the menstrual cycle may alter gastric emptying (9). None of them was taking any medications, and
none had a history of gastrointestinal disturbances. In
a randomized order, each subject was studied on four
occasions, with at least 1 day between occasions. They
were given a continuous infusion of remifentanil on
two occasions while lying either on the right lateral
side with the bed in a 20° head-up position (RHU) or
on the left lateral side with the bed in a 20° head-down
position (LHD). On the other two occasions, no
remifentanil infusion was given, and the subjects were
studied lying in the two positions (RHU and LHD).
The subjects fasted (both liquids and solids) for at
least 6 h before each study. An indwelling IV catheter
was placed in one arm for the drawing of blood samples. On the occasions when remifentanil was given,
an IV line was established in the opposite arm.
Remifentanil was administered as a continuous infusion in a dose of 0.2 ␮g · kg⫺1 · min⫺1 and was started
10 min before the ingestion of acetaminophen. The
infusion was terminated directly after the last blood
sample (120 min) was drawn.
During the study, the usual monitors were used.
Heart rate, arterial blood pressure, oxygen saturation,
end-tidal carbon dioxide (CO2), respiratory rate, and
sedation level were recorded every fifth minute. At
the same intervals, the subjects were asked if they
were experiencing nausea or any other symptoms. The
sedation level was recorded as follows: no sedation ⫽
1, light sedation ⫽ 2, moderate sedation ⫽ 3, and deep
sedation ⫽ 4. The visual analog scale (VAS) 0 –10 was
used for nausea, where VAS 0 was no subjective
symptoms and VAS 10 was the worst nausea the
subjects could imagine.
If the subject showed signs of excessive sedation, respiratory depression, severe nausea, or vomiting or
showed signs of other severe symptoms related to the
infusion of remifentanil, the dose was reduced. During
the two control situations, heart rate, arterial blood pressure, and sedation level were recorded every 15 min, and
the subjects were questioned about nausea. Their level of
sedation was checked at the same intervals.
The acetaminophen absorption test was used for
measurement of gastric emptying. Acetaminophen
1.5 g dissolved in 200 mL of water was ingested orally,
and venous blood samples were taken at 5, 10, and
15 min and then at 15-min intervals for 120 min. When
remifentanil was given, acetaminophen was taken
orally 10 min after the start of the infusion. Acetaminophen is not absorbed from the stomach but is rapidly
absorbed from the small intestine. Consequently, the
rate of gastric emptying determines the rate of absorption of acetaminophen administered into the stomach.
ANESTH ANALG
2004;99:429 –34
Serum acetaminophen was determined by an immunologic method including fluorescence polarization
(TDx® acetaminophen; Abbott Laboratories; North
Chicago, IL). Acetaminophen concentration curves
were produced, and the maximal acetaminophen concentration (Cmax), the time taken to reach the maximal
concentration (Tmax), and the area under the serum
acetaminophen concentration time curves from 0 to
60 min (AUC60) were calculated. Tmax was assumed to
be 120 min if no acetaminophen was detected in any
sample. The acetaminophen method is a well accepted
method for studying the liquid phase of gastric emptying, and AUC60 correlates very well with measures
of gastric emptying performed with isotope techniques (10,11).
A prior power calculation was performed and designed to detect differences in AUC60 between the 2
postures when remifentanil was given. On the basis of
data from previous studies, the estimated sample size
was 10 volunteers with a power of 80% at the 5%
significance level.
The results are presented as means with standard
deviations. Repeated-measures analysis of variance
was used for overall differences between the study
situations. If the analysis of variance showed differences, a paired Student’s t-test with Bonferroni’s correction was used for comparisons between the situations. The significance level was set at 5% in all tests.
Results
The acetaminophen concentration curves are presented in Figure 1. There were significant differences
in AUC60 (P ⬍ 0.001), Cmax (P ⬍ 0.001), and Tmax (P ⬍
0.001) among the 4 study situations. During the
remifentanil infusion, AUC60 was lower, Cmax was
smaller, and Tmax was longer in both postures compared with the control situations. During the control
situations, there were statistically significant differences, with a higher AUC60 and a larger Cmax in the
RHU position. There were no statistically significant
differences in AUC60, Cmax, or Tmax between the 2
postures when remifentanil was given (Table 1).
In 3 subjects (30%), the dose of remifentanil had to
be reduced during the study because of side effects
(Table 2). Six subjects (60%) experienced nausea, three
subjects (30%) vomited, and six subjects (60%) had
pruritus during at least one of the remifentanil situations. There was no nausea, vomiting, or pruritus
during the control situations (Table 3).
Systolic blood pressure and heart rate were stable in
all situations during the study. Arterial blood pressure
decreased slightly compared with the initial pressure
in all situations, but no further changes were detected.
Heart rate decreased in the LHD position when no
infusion was given (Table 4).
ANESTH ANALG
2004;99:429 –34
Respiratory rate decreased in the RHU position, and
end-tidal CO2 increased in both positions during the
remifentanil infusion (Table 4). There was no change
in oxygen saturation. In 7 subjects (70%), the respiratory rate decreased during the remifentanil infusion to
⬍5 breaths/min. After verbally reminding the volunteers to breathe and, for one subject, reducing the
infusion of remifentanil, the respiratory rate immediately returned to an acceptable level.
Seven subjects experienced difficulty swallowing
during the remifentanil infusion, but the symptom
ceased within minutes after the infusion was terminated. Five subjects complained of headache during
and after the infusion of remifentanil, and in some
subjects the headache persisted for several hours.
Discussion
This study has demonstrated that body position influences gastric emptying of fluids, that remifentanil in
small doses delays gastric emptying of fluids, and that
a change in body position does not influence the delay
in gastric emptying induced by remifentanil. During
the control situation, the RHU position resulted in
faster gastric emptying than the LHD position.
Gastric emptying is influenced by at least three
mechanisms— gastric tone, gastric motility, and pyloric tone. The proximal fundus of the stomach functions as a reservoir, and the muscles are adapted for
maintaining a continuous contractile tone. The distal
antrum/pyloric area of the stomach exhibits phasic
and peristaltic contractile activity and functions both
as a pump and a grinding mill (12). The tone of the
pyloric sphincter regulates the outflow to the duodenum. Consequently, changes in any of these factors
will affect the rate of gastric emptying.
There are limited reports on the effects of posture on
gastric emptying. Anvari et al. (13) found that gastric
emptying of nonnutrient liquids was faster in the sitting position compared with the left lateral position
431
and that even after a delay in gastric emptying induced by atropine there were differences between the
positions. The faster emptying in the sitting position
before atropine was associated with increased antral
peristaltic activity and increased pyloric pressure, but
after atropine, no differences in antropyloroduodenal
motility could be observed. The mechanism for the
change in motility was thought to be due to effects of
gravity rather than primarily to changes in motility.
Other authors also report that the left lateral position
is associated with a delay in gastric emptying (5–7),
and our findings are in accordance with these results.
The effect of gravity on gastric emptying is dependent on pyloric tone. Even if posture moves the gastric
contents toward the pylorus and there is a high pyloric
tone, gastric emptying will be difficult. In the control
situation in this study, emptying time was fast in both
postures. This indicates that passage through the pyloric region was easy. Opioids decrease gastric tone
(14), but even if gastric tone was decreased, gastric
emptying would have been facilitated by the RHU
position. Because our study showed no significant
differences in gastric emptying between the RHU and
LHD positions during remifentanil infusion, these results indicate that remifentanil increases pyloric tone
and thereby impairs the flow into the duodenum. It
has been clearly shown that the pylorus has a rich
enkephalinergic innervation (4), which may explain
the effect of opioids on pyloric obstruction. No conclusions about gastric motility can be drawn on the
basis of the results of our study.
Several studies have demonstrated that both systemic
and spinal opioids delay gastric emptying (1,15,16), and
these effects are both peripherally and centrally mediated (2). Opioid receptors are present in the gastric tract,
and recently developed opioid antagonists such as methylnaltrexone and alvimopan, which do not pass the
blood-brain barrier, reverse the opioid-induced inhibition of gastrointestinal motility (17,18).
Opioids pass the blood-brain barrier and have the
potential to regulate motility through a central mechanism. The dorsal vagal complex, located in the medullar
brainstem, receives sensory information from the gastrointestinal tract through afferent vagal fibers and is also
the origin of efferent vagal fibers projecting to the gastrointestinal tract. ␮-Opioid receptors have been identified in the synaptic connections within this region, and
opioid agonists given locally inhibit gastric motility and
decrease gastric tone (19). The role of opioids in the
brainstem’s normal physiological control of gastrointestinal motility is controversial, because local injection of
the opioid antagonist naloxone has not been found to
influence motility per se (20). However, intrathecal morphine has been shown to inhibit motility and delay gastric emptying (2), so clinical studies consequently support the findings that opioids can inhibit motility
through a central mechanism.
STUDY I
Figure 1. Mean (sd) serum acetaminophen concentrations during
the four study situations.
ANESTHETIC PHARMACOLOGY
WALLDÉN ET AL.
REMIFENTANIL AND GASTRIC EMPTYING
432
ANESTHETIC PHARMACOLOGY WALLDÉN ET AL.
REMIFENTANIL AND GASTRIC EMPTYING
ANESTH ANALG
2004;99:429 –34
Table 1. Mean (sd) of AUC60, Tmax, and Cmax in Two Different Body Postures With and Without Infusion of
Remifentanil 0.2 ␮g 䡠 kg⫺1 䡠 min⫺1
Variable
Right lateral side head-up position
Left lateral side head-down position
Remifentanil
Control
Remifentanil
Control
962 (902)
34 (24)
94 (33)
5092 (1125)
138 (45)
25 (14)
197 (128)
16 (14)
109 (10)
3793 (1307)
94 (30)
47 (22)
⫺1
AUC60 (min 䡠 ␮mol 䡠 L
Cmax (␮mol 䡠 L⫺1)
Tmax (min)
)
AUC60
Cmax
Tmax
P ⬍ 0.0001
P ⬍ 0.0001
P ⬍ 0.0001
RHU-Remi
vs
RHU-Control
RHU-Remi
vs
LHD-Remi
NS
NS
NS
RHU-Remi
vs
LHD-Control
P ⬍ 0.0001
P ⬍ 0.0001
P ⬍ 0.0001
RHU-Control
vs
LHD-Remi
P ⬍ 0.0001
P ⬍ 0.0001
P ⬍ 0.0001
RHU-Control
vs
LHD-Control
P ⬍ 0.0083
P ⬍ 0.0083
NS
LHD-Remi
vs
LHD-Control
P ⬍ 0.0001
P ⬍ 0.0001
P ⬍ 0.0001
Paired Student’s t-tests with Bonferroni’s correction after the analysis of variance detected differences. The significance level was set at 5%, with P ⬍ 0.0083
considered significant.
AUC60 ⫽ area under the serum acetaminophen concentration curve from 0 to 60 min during the study; Cmax ⫽ maximum acetaminophen concentration;
Tmax ⫽ time taken to reach the maximum acetaminophen concentration.
Table 2. Adjustments of the Initial Dose of Remifentanil 0.2 ␮g 䡠 kg⫺1 䡠 min⫺1 in Three Subjects Because of Side
Effects
Subject
No.
Position
4
RHU
5
LHD
RHU
LHD
9
RHU
LHD
Time after start
of remifentanila
(min)
86
96
105
120
120
83
103
113
31
0
36
Side effect
Nausea (VAS ⫽ 9)
Nausea (VAS ⫽ 7)
Vomited
Vomited
Vomited
Nausea (VAS ⫽ 6)
Nausea (VAS ⫽ 6)
Headache
Respiratory rate 3 breaths/min
Dose reduced from start because of
respiratory depression during
RHU position
Respiratory rate 3 breaths/min
Adjusted dose of
remifentanil
(␮g 䡠 kg⫺1 䡠 min⫺1)
0.1
0.05
0
0
0
0.1
0.05
0.025
0.15
0.15
0.1
RHU ⫽ right lateral head-up position; LHD ⫽ left lateral head-down position; VAS ⫽ visual analog scale (scale 0 –10; no subjective symptom ⫽ 0, worst
subjective symptom ⫽ 10).
a
Infusion of remifentanil was started 10 min before the ingestion of acetaminophen. The infusion was normally terminated after 130 min, when the last blood
sample was taken.
The respiratory rate decreased and end-tidal CO2
increased during the infusion of remifentanil. CO2
induces relaxation of smooth muscle in vascular beds,
but we are not aware of any reports concerning the
effects of CO2 on gastrointestinal motility. However,
hypercapnia also induces sympathetic stimulation,
and the increased sympathetic activity may influence
gastric function, with delayed gastric emptying. Soon
after the infusion of remifentanil was terminated, the
respiratory rate and end-tidal CO2 were normalized.
Half of the volunteers experienced nausea during
the remifentanil infusion. Five subjects vomited, but
this was late in the study and therefore had no major
effect on the acetaminophen study. Opioids are
known to cause nausea and vomiting, but the mechanisms are complex. The action is believed to be mediated through activation of the chemoreceptor trigger
zone (located in the area postrema) (8).
Sixty percent of the subjects experienced pruritus.
Pruritus is often seen after the administration of opioids, particularly after spinal administration, in which
there are reports of incidences up to 50% (21).
Remifentanil induced difficulties in swallowing in
most volunteers. Swallowing is a complex motor behavior controlled by neuronal networks in the brainstem, and after the administration of intrathecal fentanyl, there are reports of dysphagia (22). This suggests
that the mechanism is mediated by a central action.
ANESTH ANALG
2004;99:429 –34
433
ANESTHETIC PHARMACOLOGY
WALLDÉN ET AL.
REMIFENTANIL AND GASTRIC EMPTYING
Right lateral side head-up position
Left lateral side head-down position
Variable
Remifentanil
Control
Remifentanil
Control
Nausea
Vomiting
Pruritus
5/10
3/10
4/10
0/10
0/10
0/10
6/10
2/10
4/10
0/10
0/10
0/10
Five subjects had nausea in both remifentanil situations. The maximal nausea VAS score for those subjects who experienced nausea was in the right lateral
head-up position (median, 6; range, 3–10) and in the left lateral head-down position (median, 4.5; range, 2–9).
Two subjects vomited in both remifentanil situations. There was prior nausea in all subjects who vomited.
Two subjects had pruritus in both remifentanil situations.
VAS ⫽ visual analog scale (Scale 0 –10; no subjective symptom ⫽ 0, worst subjective symptom ⫽ 10).
Table 4. Vital Variables During the Study
Variable
Mean systolic blood pressure (mm Hg)
RHU with remifentanil infusion
RHU with no infusion (control)
LHD with remifentanil infusion
LHD with no infusion (control)
Mean heart rate (bpm)
RHU with remifentanil infusion
RHU with no infusion (control)
LHD with remifentanil infusion
LHD with no infusion (control)
Mean respiratory rate (breaths/min)
RHU with remifentanil infusion
LHD with remifentanil infusion
Mean end-tidal CO2 (%)
RHU with remifentanil infusion
LHD with remifentanil infusion
Mean oxygen saturation (%)
RHU with remifentanil infusion
LHD with remifentanil infusion
Before
start
⫺10 to 0 min 0–30 min 31–60 min 61–90 min 91–120 min
P value
⬍0.0001a
⬍0.0001a
⬍0.0001a
⬍0.0001a
120 (10.8)
126 (15.8)
129 (12.2)
121 (12.8)
105 (9.2)
—
111 (10.5)
—
109 (10.9)
111 (12.7)
109 (14.7)
104 (11.4)
106 (10.2)
106 (9.6)
106 (10.8)
99 (6.9)
105 (7.3)
104 (8.3)
105 (9.5)
100 (8)
105 (8.8)
107 (10.6)
106 (11.1)
106 (7.7)
66 (12)
68 (11)
68 (10)
66 (12)
66 (15)
—
64 (10)
—
68 (18)
65 (12)
63 (10)
60 (9)
70 (14)
63 (10)
66 (10)
59 (6)
70 (13)
63 (7)
66 (10)
59 (5)
70 (14)
63 (7)
67 (12)
58 (6)
NS
NS
NS
0.0055a
13.4 (3.3)
10.9 (4.4)
9.6 (3.4)
8.5 (2.2)
8.8 (3)
9.2 (2.4)
8.5 (4)
9.6 (2.7)
8.7 (3.6)
9.2 (3.4)
9 (3.6)
9.9 (2.1)
⬍0.0001a
NS
5.3 (0.4)
5.5 (0.5)
6.0 (0.7)
6.0 (0.6)
6.8 (0.9)
7.0 (0.6)
6.9 (1.1)
6.9 (0.8)
6.8 (1.1)
6.9 (1)
6.8 (0.9)
6.5 (1.2)
⬍0.0001b
⬍0.0001b
98 (1)
98 (1)
98 (1)
99 (2)
98 (1)
98 (1)
98 (1)
98 (1)
98 (1)
98 (1)
98 (1)
98 (1)
NS
NS
Values are mean (sd).
RHU ⫽ right lateral side head-up position; LHD ⫽ left lateral side head-down position; NS ⫽ not significant.
Repeated-measurement analysis of variance was used to evaluate differences over time in the monitored variables.
a
Significant changes in values between before start and during the infusion, but no detectable changes during the infusion of remifentanil.
b
Significant increase in end-tidal CO2 during the infusion of remifentanil.
Even though remifentanil is an ultra-short-acting
drug, the subjects complained of headache and late
nausea after the infusion was stopped. This is probably not a direct effect of remifentanil and may instead
be an effect of the increased CO2 level, with a possible
cerebral influence.
Because of the extensive side effects found in volunteers, we do not consider remifentanil a suitable
drug for postoperative analgesia. A multicenter evaluation of the use of remifentanil for early postoperative analgesia found an occurrence of adverse respiratory events in 29% of patients (23) and concluded that
the technique is probably not practical for routine
clinical use.
However, with adequate monitoring, remifentanil is
a valuable drug for studying the effects of opioids in
experimental setups with volunteers. With this drug,
it is possible to study the dose-response effects of
opioids.
In conclusion, remifentanil delays gastric emptying,
and this delay is not influenced by changes in body
posture. During the control situation, the RHU position facilitated gastric emptying.
References
1. Murphy DB, Sutton JA, Prescott LF, Murphy MB. Opioidinduced delay in gastric emptying: a peripheral mechanism in
humans. Anesthesiology 1997;87:765–70.
2. Thorn SE, Wattwil M, Lindberg G, Sawe J. Systemic and central
effects of morphine on gastroduodenal motility. Acta Anaesthesiol Scand 1996;40:177– 86.
3. Thoren T, Wattwil M. Effects on gastric emptying of thoracic
epidural analgesia with morphine or bupivacaine. Anesth
Analg 1988;67:687–94.
STUDY I
Table 3. Incidence of Nausea, Vomiting, and Pruritus for Each Posture With and Without Infusion of Remifentanil 0.2
␮g 䡠 kg⫺1 䡠 min⫺1 (n ⫽ 10)
434
ANESTHETIC PHARMACOLOGY WALLDÉN ET AL.
REMIFENTANIL AND GASTRIC EMPTYING
4. Edin R, Lundberg J, Terenius L, et al. Evidence for vagal enkephalinergic neural control of the feline pylorus and stomach.
Gastroenterology 1980;78:492–7.
5. Horowitz M, Jones K, Edelbroek MA, et al. The effect of posture
on gastric emptying and intragastric distribution of oil and
aqueous meal components and appetite. Gastroenterology 1993;
105:382–90.
6. Burn-Murdoch R, Fisher MA, Hunt JN. Does lying on the right
side increase the rate of gastric emptying? J Physiol 1980;302:
395– 8.
7. Spiegel TA, Fried H, Hubert CD, et al. Effects of posture on
gastric emptying and satiety ratings after a nutritive liquid and
solid meal. Am J Physiol Regul Integr Comp Physiol 2000;279:
R684 –94.
8. Apfel CC, Roewer N. Risk assessment of postoperative nausea
and vomiting. Int Anesthesiol Clin 2003;41:13–32.
9. Notivol R, Carrio I, Cano L, et al. Gastric emptying of solid and
liquid meals in healthy young subjects. Scand J Gastroenterol
1984;19:1107–13.
10. Nimmo WS, Heading RC, Wilson J, et al. Inhibition of gastric
emptying and drug absorption by narcotic analgesics. Br J Clin
Pharmacol 1975;2:509 –13.
11. Medhus AW, Lofthus CM, Bredesen J, Husebye E. Gastric
emptying: the validity of the paracetamol absorption test adjusted for individual pharmacokinetics. Neurogastroenterol
Motil 2001;13:179 – 85.
12. Read NW, Houghton LA. Physiology of gastric emptying and
pathophysiology of gastroparesis. Gastroenterol Clin North Am
1989;18:359 –73.
13. Anvari M, Horowitz M, Fraser R, et al. Effects of posture on
gastric emptying of nonnutrient liquids and antropyloroduodenal motility. Am J Physiol 1995;268:G868 –71.
ANESTH ANALG
2004;99:429 –34
14. Hammas B, Thorn SE, Wattwil M. Propofol and gastric effects of
morphine. Acta Anaesthesiol Scand 2001;45:1023–7.
15. Yuan CS, Foss JF, O’Connor M, et al. Effects of low-dose morphine on gastric emptying in healthy volunteers. J Clin Pharmacol 1998;38:1017–20.
16. Lydon AM, Cooke T, Duggan F, Shorten GD. Delayed postoperative gastric emptying following intrathecal morphine and
intrathecal bupivacaine. Can J Anaesth 1999;46:544 –9.
17. Yuan CS, Foss JF. Gastric effects of methylnaltrexone on mu,
kappa, and delta opioid agonists induced brainstem unitary
responses. Neuropharmacology 1999;38:425–32.
18. Taguchi A, Sharma N, Saleem RM, et al. Selective postoperative
inhibition of gastrointestinal opioid receptors. N Engl J Med
2001;345:935– 40.
19. Browning KN, Kalyuzhny AE, Travagli RA. Opioid peptides
inhibit excitatory but not inhibitory synaptic transmission in the
rat dorsal motor nucleus of the vagus. J Neurosci 2002;22:
2998 –3004.
20. Gue M, Junien JL, Bueno L. Central and peripheral opioid
modulation of gastric relaxation induced by feeding in dogs.
J Pharmacol Exp Ther 1989;250:1006 –10.
21. Rathmell JP, Pino CA, Taylor R, et al. Intrathecal morphine for
postoperative analgesia: a randomized, controlled, doseranging study after hip and knee arthroplasty. Anesth Analg
2003;97:1452–7.
22. Currier DS, Levin KR, Campbell C. Dysphagia with intrathecal
fentanyl. Anesthesiology 1997;87:1570 –1.
23. Bowdle TA, Camporesi EM, Maysick L, et al. A multicenter
evaluation of remifentanil for early postoperative analgesia.
Anesth Analg 1996;83:1292–7.
STUDY II
Klunserna Study
123
05-10-25, 10.12
J Anesth (2006) 20:261–267
DOI 10.1007/s00540-006-0436-3
Original articles
Jakob Walldén1, Sven-Egron Thörn2, Åsa Lövqvist2, Lisbeth Wattwil2, and Magnus Wattwil2
1
2
Department of Anesthesia, Sundsvall Hospital, 851 86 Sundsvall, Sweden
Departments of Anesthesia and Intensive Care, Örebro University Hospital, Örebro, Sweden
Abstract
Purpose. A postoperative decrease in the gastric emptying
(GE) rate may delay the early start of oral feeding and alter
the bioavailability of orally administered drugs. The aim of
this study was to compare the effect on early gastric emptying
between two anesthetic techniques.
Methods. Fifty patients (age, 19–69 years) undergoing
day-case laparascopic cholecystectomy were randomly
assigned to received either total intravenous anesthesia with
propofol/remifentanil/rocuronium (TIVA; n = 25) or inhalational opioid-free anesthesia with sevoflurane/rocuronium
(mask induction; GAS; n = 25). Postoperative gastric emptying was evaluated by the acetaminophen method. After
arrival in the recovery unit, acetaminophen (paracetamol)
1.5 g was given through a nasogastric tube, and blood samples
were drawn during a 2-h period. The area under the serumacetaminophen concentration curve from 0–60 min (AUC60),
the maximal concentration (Cmax), and the time to reach Cmax (Tmax) were calculated.
Results. Twelve patients were excluded due to surgical complications (e.g., conversion to open surgery) and difficulty in
drawing blood samples (TIVA, n = 7; GAS, n = 5). Gastric
emptying parameters were (mean ± SD): TIVA, AUC60,
2458 ± 2775 min·μmol·l−1; Cmax, 71 ± 61 μmol·l−1; and Tmax,
81 ± 37 min; and GAS, AUC60, 2059 ± 2633 min·μmol·l−1;
Cmax, 53 ± 53 μmol·l−1; and Tmax, 83 ± 41 min. There were no
significant differences between groups.
Conclusion. There was no major difference in early postoperative gastric emptying between inhalation anesthesia with
sevoflurane versus total intravenous anesthesia with propofolremifentanil. Both groups showed a pattern of delayed gastric
emptying, and the variability in gastric emptying was high.
Perioperative factors other than anesthetic technique may
have more influence on gastric emptying.
Key words Gastrointestinal motility · Gastric emptying ·
Anesthesia, inhalation · Anesthesia, intravenous · Analgesics,
opioid · Cholecystectomy, laparoscopic
Address correspondence to: J. Walldén
Received: March 20, 2006 / Accepted: July 28, 2006
Introduction
Gastric emptying is an essential part of gastrointestinal
motility, and a postoperative delay may postpone the
early start of oral feeding and alter the bioavailability of
orally given drugs [1]. Today a majority of our patients
undergo surgery on an ambulatory basis and an important part of the care is to have them tolerate oral nutrition and per-oral analgesics as soon as possible. A delay
in gastric emptying may therefore postpone a patient’s
discharge.
Activation of inhibitory neural pathways by the surgical trauma, a local inflammatory response in the gastrointestinal tract, and the drugs used perioperatively
contribute to the impairment of gastric motility [2], and,
of the drugs used, opioids are thought to constitute the
most important factor.
The extent to which anesthetic technique contributes
to the early postoperative inhibition of gastric motility
is uncertain. With an inhalation technique without
opioids, the effect of inhalation agents on gastric motility may cease quickly after discontinuation of the agent
[3]. An intravenous technique with an ultra-shortacting opioid, to minimize the negative opioid effect on
motility, combined with propofol, which has antiemetic
properties, and to some degree, antagonizes the opioid
effect on gastric motility [4], may favor motility.
Both methods are, theoretically, optimal for gastric
motility. However, when these anesthetic techniques
are used in major surgery there may be a need
for opioid analgesics in the early postoperative period,
as the residual analgesic properties of the anesthetics
cease quickly. If one of the techniques proves to have
a faster gastric emptying rate, this may have an
impact on the choice of anesthesia to optimize gastric
motility.
The aim of this study was to compare the effect on
early gastric emptying between two anesthetic methods,
an inhalation opioid-free sevoflurane-based anesthesia
STUDY II
The effect of anesthetic technique on early postoperative gastric
emptying: comparison of propofol-remifentanil and opioid-free
sevoflurane anesthesia
262
and an intravenous
anesthesia.
J. Walldén et al.: Anesthetic technique and gastric emptying
propofol-remifentanil
based
Patients, materials, and methods
Fifty patients (American Society of Anesthesiologists
[ASA] physical status I and II) undergoing day-case
laparoscopic cholecystectomy at Örebro University
Hospital, Sweden, were included in this study. The
study protocol was approved by the Ethics Committee
of the Örebro County Council and by the Swedish
Medical Product Agency. The patients entered the
study after giving verbal and written consent. Patients
were randomly allocated (by the use of sealed envelopes) to receive either total intravenous anesthesia
(TIVA group; n = 25) or total inhalation anesthesia
(GAS group; n = 25). An independent nurse prepared
all the sealed envelopes from of a computer-generated
table before the study started. Investigators (J.W.,
M.W., S.E.T.) enrolled patients to the study. The envelopes were opened by the investigators just before the
induction of anesthesia. There was no blinding in the
study.
Patients were excluded from the study if the procedure was converted to open cholecystectomy, or if the
duration of surgery exceeded 150 min.
The gastric emptying study was started immediately
after the patient’s arrival at the recovery unit. During
the first 24 h after surgery, the incidence of postoperative nausea and vomiting (PONV) and pain, and the
need for opioid analgesics were evaluated by means of
observations in the recovery unit, a telephone interview, and a questionnaire.
The primary endpoints in the study were the gastric
emptying parameters, and we tested the hypothesis that
there would be a difference in gastric emptying between
the study groups.
For the secondary outcome variables (PONV, pain,
opioid need) we were aware that the number of patients
might be too small to detect differences.
The patients fasted for 6 h but were allowed to drink
clear fluids up to 2 h before premedication. All patients
received premedication with midazolam 1–2 mg IV at
the day-care unit, 20–30 min before the induction of
anesthesia. In the operating room, patients underwent
routine monitoring, including continuous processed
electroencephalography (Bispectral index [BIS]monitor; Aspect Medical Systems, Newton, MA, USA).
Before induction, all patients received ketorolac 30 mg
IV. In the TIVA group, anesthesia was induced with an
infusion of remifentanil 0.2 μg·kg−1·min−1, followed, after
2 min, by a target-controlled infusion (TCI) of propofol
at 4 μg·ml−1 (induction time, 60 s). In the GAS group,
anesthesia was induced with 8% sevoflurane via a facial
mask. After an adequate level of anesthesia was attained, muscular relaxation was obtained in both groups
with rocuronium 0.6 mg·kg−1 IV, and the trachea was
intubated after 90 s. In the TIVA group, anesthesia was
maintained with remifentanil 0.2 μg·kg−1·min−1 and TCI
propofol, adjusted (2–4 μg·ml−1) to maintain a BIS
index below 50. In the GAS group, anesthesia was
maintained with sevoflurane, with concentrations adjusted to maintain a BIS index below 50. No prophylactic antiemetics were given. A nasogastric tube was
placed in all patients during anesthesia. At the end of
surgery, 20 ml of 0.25% levobupivacaine was infiltrated
at the insertion sites of the laparoscopic instruments,
muscular relaxation was reversed with neostigmine
2.5 mg/glycopyrrolate 0.5 mg, and anesthetic agent(s)
were terminated. The patients were extubated in the
operating room after return of consciousness and spontaneous breathing and transferred to the adjacent
day-care unit for recovery. Except for the continuous
infusion of remifentanil in the TIVA group, no opioids
were given during anesthesia.
Acetaminophen absorption was used as an indirect
measure of gastric emptying [5]. Acetaminophen is not
absorbed from the stomach, but is rapidly absorbed
from the small intestine. Consequently, the rate of gastric emptying determines the rate of absorption of
acetaminophen administered into the stomach.
Immediately after patients’ arrival at the day-care unit,
acetaminophen 1.5 g, dissolved in 200 ml of water (at
room temperature), was given through the nasogastric
tube. Prior to administration, correct placement of the
tube was verified by auscultation over the stomach area
during the injection of 20 ml of air into the tube. The
tube was removed after acetaminophen was given.
Blood samples were taken from an intravenous catheter
prior to the administration of acetaminophen and then
5, 10, and 15 min after the administration, and then at
15-min intervals during a period of 120 min. Serum
acetaminophen was determined by an immunologic
method, including fluorescence polarization (TDx acetaminophen; Abbott Laboratories, Chicago, IL, USA).
Acetaminophen concentration curves were produced,
and the maximal acetaminophen concentration (Cmax),
the time taken to reach the maximal concentration
(Tmax), and the area under the serum-acetaminophen
concentration time curves from 0 to 60 min (AUC60) and
0 to 120 min (AUC120) were calculated. Tmax was assumed to be 120 min if no acetaminophen was detected
in any sample. The acetaminophen method is a wellaccepted method for studying the liquid phase of gastric
emptying, and the AUC60 correlates well with measures
of gastric emptying performed using isotope techniques
[5].
The patients stayed in the day-care unit for at least
4 h. During this period, nausea, vomiting, and pain were
263
evaluated every hour. Nausea and pain were evaluated
with a visual analogue scale (VAS), and occurrences of
vomiting were recorded. Droperidol 0.5–1 mg IV was
given on request as the first rescue antiemetic according
to the routines of the department. If not sufficient,
ondansetron 2–4 mg IV was given as the second drug.
If patients scored more than 3 on the VAS for pain,
ketobemidone 1–2 mg IV was given. Ketobemidone
is an opioid analgesic with properties similar to those
of morphine and is widely used in the Scandinavian
countries.
After discharge from the day-care unit, the patients
themselves completed a questionnaire about PONV
and pain during the time period 4–24 h postoperatively.
The patients scored the maximal pain and maximal nausea on a VAS and were questioned as to whether they
had vomited or not. A nurse or doctor also performed a
telephone interview on the first postoperative day,
during which patients were questioned about events of
pain, nausea, or vomiting after discharge. Combining
the observations from the recovery unit, the questionnaire, and the telephone interview, we acquired variables regarding the incidence of PONV during 0–2 h
and 2–24 h, the need for antiemetics in the day-care unit,
the maximal VAS score for pain during the periods 0–
2 h and 2–24 h, the time to first dose of opioid analgesics,
and the total dose of opioids given. These variables
were regarded as secondary outcome variables in the
study.
Sample size was calculated based on the AUC60 as the
primary outcome variable. A difference of at least
one-third of AUC60 under normal conditions was
considered clinically significant. Based on previous
studies [6], we estimated the minimal difference to be
2000 min·μmol·l−1 and the within-group SD for the
AUC60 to be 2000 min·μmol·l−1. For a power of 0.8
and α = 0.05, a sample size of 17 patients in each group
was calculated to be appropriate. From previous studies
with the acetaminophen method, we had the experience
that, in some patients, it might be difficult to draw
venous blood samples due to a constricted venous system. For this reason, we increased the study population
to 25 patients in each group.
To be able to compare our gastric-emptying results
with a normal gastric-emptying profile (in our context
without any influence from anesthesia, surgery, pain,
drugs, etc) we used a pooled dataset of control
gastric-emptying measurements from three previous
studies by our group. In the first study [6] the controls
were taken 4–5 weeks after an open cholecystectomy (n
= 17; ASA, I–II; mean (±SD) age, 49 ± 15 years; male, n
= 4; female, n = 13); in the second study (unpublished
data), 4 weeks after abdominal surgery (n = 9; ASA,
I–II; mean age, 69 ± 10 years; male, n = 7; female, n = 2);
and in the third study, the controls were young healthy
male volunteers in an experimental setting [7] (n = 10;
ASA, I; mean age, 24 ± 3.4 years). In all control measurements, 1.5 g acetaminophen dissolved in 200 ml of
water was given orally after a period of fasting and
blood samples were taken every 15 min during 2 h. The
handling and laboratory analysis of the samples were
the same as in the current study, as described above.
The mean serum-acetaminophen concentration curve
of the pooled data is presented in Fig. 1, and the
gastric emptying parameters were (mean ± SD): AUC60,
5988 ± 1713 min·μmol·l−1; Cmax, 145 ± μmol·l−1; and Tmax,
29 ± 15 min.
The primary outcome variables AUC60, AUC120, Cmax,
and Tmax, are presented as means with SDs. The secondary outcome variables are presented as events, numbers, or medians with ranges. Unpaired Student’s t-test,
Mann-Whitney U-test, or Fisher’s exact test was used
Fig. 1. Mean (+SD) serum (S)acetaminophen concentrations during the
gastric emptying study after propofolremifentanil total intravenous anesthesia
(TIVA) or opioid-free sevoflurane (GAS)
anesthesia. As a reference for normal gastric emptying, a group of historical controls, pooled from control groups in three
previous studies (see the Methods section
for description), is included in the graph
STUDY II
J. Walldén et al.: Anesthetic technique and gastric emptying
264
J. Walldén et al.: Anesthetic technique and gastric emptying
Table 1. Patient characteristics and time variables before the start of the gastric
emptying study
Age (years)
Height (cm)
Weight (kg)
Females
Males
Smokers
ASA Class I
ASA Class II
Duration of surgery (min)
Duration from end of surgery
to tracheal extubation (min)
Duration from end of surgery
to arrival at recovery unit (min)
Duration from end of surgery
to start of GE study (min)
TIVA group
(n = 24)
GAS group
(n = 21)
45 (29–64)
168 (152–189)
80 (56–112)
20
4
4
19
5
74 (25–148)
8 (2–17)
46 (19–69)
169 (158–187)
75 (56–100)
16
5
4
17
4
70 (65–108)
9 (2–22)
P valuea
NS
NS
NS
NS
NS
NS
NS
NS
NS
19 (10–30)
22 (8–45)
NS
24 (13–35)
26 (17–45)
NS
Values are given as means with ranges or numbers
TIVA, total intravenous anesthesia with remifentanil and propofol; GAS, total inhalation
anesthesia with sevoflurane; GE, gastric emptying
a
Unpaired Student’s t-test or Fisher’s exact test
Table 2. Mean and SD of AUC60, AUC120, Cmax, and Tmax in the two study groups
Variable
TIVA group
(n = 18)
GAS group
(n = 20)
AUC60 (min·μmol−1·l−1)
AUC120 (min·μmol−1·l−1)
Cmax(μmol·l−1)
Tmax(min)
2458 ±
5889 ±
71 ±
81 ±
2059 ± 2633
4288 ± 4820
53 ± 55
83 ± 41
2775
5750
61
37
95% CI for the difference
between the means
−1390
−1877
−20
−28
to
to
to
to
P valuea
2188
5079
56
24
NS
NS
NS
NS
(P =
(P =
(P =
(P =
0.65)
0.36)
0.35)
0.85)
TIVA, total intravenous anesthesia with remifentanil and propofol; GAS, total inhalation anesthesia with sevoflurane; AUC60, AUC120, area
under the serum-acetaminophen concentration curve at 0–60 min and 0–120 min; Cmax, maximum acetaminophen concentration; Tmax, time taken
to reach the maximum acetaminophen concentration; CI, confidence interval; NS, not significant
a
Unpaired Student’s t-test
for statistical analysis, and P < 0.05 was considered statistically significant.
Results
Fifty patients were included in the study from April
2002 to January 2003. Five patients (TIVA, n = 4; GAS,
n = 1) were excluded due to conversion to open cholecystectomy or prolonged duration of surgery (>150 min)
due to choledochal stones. In 7 patients (TIVA, n = 3;
GAS, n = 4) there were difficulties in drawing blood
samples for the acetaminophen concentration analysis.
Hence, a total of 12 patients (TIVA, n = 7; GAS, n = 5)
were excluded from the analysis of the primary outcome
variable.
Patient characteristics are presented in Table 1. Surgery and anesthesia were uneventful in all patients.
There were no differences between the groups in duration of surgery or duration from end of surgery to start
of the gastric emptying studies.
Table 3. Number of patients without detectable serum acetaminophen (no gastric emptying at all) at different time periods
0–60 Min
0–120 Min
TIVA group
(n = 18)
GAS group
(n = 20)
P valuea
3
1
1
0
NS
NS
TIVA, total intravenous anesthesia with remifentanil and propofol;
GAS, total inhalation anesthesia with sevoflurane; NS, not significant
a
Fisher’s exact test
Acetaminophen concentration curves are presented
in Fig. 1. There were no differences between the groups
in the primary outcome variables, AUC60, AUC120, Cmax,
or Tmax (Table 2). Both groups differed significantly (P <
0.01) from the pooled historical control group. Of the 38
patients eligible for the primary outcome analysis, only
1 patient had no detectable acetaminophen in any of the
blood samples (i.e., no gastric emptying at all); see
Table 3.
J. Walldén et al.: Anesthetic technique and gastric emptying
265
Table 4. Numbers (%) of patients with events of postoperative nausea and/or vomiting
(PONV) during the study
Variable
GAS group
(n = 24)
P valuea
10 (48%)
2 (10%)
10 (48%)
15 (62%)
4 (17%)
16 (67%)
NS
NS
NS
11 (52%)
5 (24%)
12 (57%)
16 (67%)
8 (33%)
16 (67%)
NS
NS
NS
15 (71%)
6 (29%)
16 (76%)
20 (83%)
8 (33%)
20 (83%)
NS
NS
NS
STUDY II
Postoperative 0–2 h
Nausea
Vomiting
Nausea or vomiting
Postoperative 2–24 h
Nausea
Vomiting
Nausea or vomiting
Postoperative 0–24 h
Nausea
Vomiting
Nausea or vomiting
TIVA group
(n = 21)
TIVA, total intravenous anesthesia with remifentanil and propofol; GAS, total inhalation
anesthesia with sevoflurane; NS, not significant
Event of nausea 0–2 h, VAS for nausea >10 mm at day-care unit; event of nausea 2–24 h, VAS for
nausea >10 mm at day-care unit or VAS for nausea >10 mm on questionnarie, or nausea reported
at telephone interview; VAS, 100-mm visual analogue scale
a
Fisher’s exact test
Table 5. Pain variables
Variable
TIVA group
GAS group
P valuea
n = 21
5 (0–9)
4 (0–10)
17 (81%)
n = 24
4 (0–9)
4 (0–7)
20 (83%)
NS
NS
NS
n = 17
5.9 (1.5–11)
n = 20
5.0 (2.0–11)
NS
17 (0–45)
44 (0–155)
<0.01
Median (range) for the highest VAS score for pain 0–2 h
Median (range) for the highest VAS score for pain 2–24 h
Number of patients with need for opioid analgesics in recovery unit
Median (range) total dose of ketobemidone IV (mg) in patients
who received opioid analgesics
Median (range) time from arrival at recovery unit to first dose of
ketobemidone (min) in patients who received opioid analgesics
TIVA, total intravenous anesthesia with remifentanil and propofol; GAS, total inhalation anesthesia with sevoflurane; NS, not significant; VAS,
100-mm visual analogue scale
a
Mann-Whitney U-test or Fisher’s exact test
Secondary outcome variables were obtained in 45
patients (TIVA, n = 21; GAS, n = 24). The questionnaire
was completed by 20 patients (95%) in the TIVA group
and 23 patients (96%) in the GAS group. The telephone
interview was performed in 20 patients (95%) in the
TIVA group and 22 patients (92%) in the GAS group.
For the period 2–24 h postoperatively, secondary outcome variables could be obtained in all patients.
There were no statistically significant differences
between the groups in the incidence of nausea,
vomiting, or PONV (Table 4). Twelve (57%) patients in
the TIVA group and 10 (42%) patients in the GAS
group were given rescue antiemetics in the recovery
unit.
There were no differences between the groups
in maximal VAS scores for pain, the need for opioid
analgesics, or the dose of opioid analgesics. The time to
the first administration of opioids in the recovery unit
was significantly longer in the GAS group (Table 5).
Discussion
This study demonstrates that patients anesthetized with
an inhalational, opioid-free regimen with sevoflurane
had a gastric emptying pattern in the early postoperative period (0–2 h) similar to that in patients anesthetized with an intravenous propofol-remifentanil
regimen. When our results were compared with the gastric emptying pattern seen in a normal state (no anesthesia and no surgery), gastric emptying could be
considered to be delayed in both groups.
266
J. Walldén et al.: Anesthetic technique and gastric emptying
Our study was powered to detect major differences in
gastric emptying rate, and the results indicate that there
might be a small difference, with faster gastric emptying
in the total intravenous anesthesia group. However,
gastric emptying was greatly delayed in both groups,
and we do not consider a potential difference of this
small magnitude as clinically relevant.
There was great variability in the gastric emptying
rate within the groups. We tested the hypothesis of a
correlation between opioid administration in the early
postoperative period and gastric emptying rate, but we
found no relation (data not shown). There was both fast
and slow emptying among patients who received opioid
analgesics during the gastric emptying study, as well as
among those who did not receive any opioid analgesics
or those who received opioid analgesics after the gastric
emptying study was completed. The use of opioid analgesics and antiemetics in the recovery period is part of
the overall perioperative care of the patients and is
partly a consequence of the anesthetic technique. These
factors cannot be eliminated and should be considered
as part of the anesthetic technique.
It is always doubtful to include historical data as a
control. However, we thought it would be valuable to
relate the gastric emptying profile seen in the groups in
the present study to a normal gastric emptying profile,
which, in our context, means under no influence of anesthesia, surgery, drugs, pain etc. To create a reference,
we pooled data from control situations in three previous
studies performed under different conditions. The gastric emptying profiles for these data, both the individual
control groups and the pooled group, are similar to
those in other control situations published in the literature [8–10]. We consider our control dataset as an acceptable estimate of a normal gastric emptying profile.
It would have been ideal to have control values for each
patient included in the study, but, unfortunately, that
was not the study design.
We were aware that the number of patients might be
too small to detect any differences in postoperative nausea and vomiting (PONV) [11], and we could not detect
any statistically significant differences in PONV between the groups. PONV was not a primary endpoint in
this study, but we considered it valuable to have the
PONV recordings. There was a tendency in our study
toward a higher incidence of PONV in the GAS group,
and it has been reported that volatile agents may be
a main cause of vomiting in the early postoperative
period [12]. To draw any conclusions about differences
in PONV between the anesthetic techniques, a larger
number of patients must be studied.
The incidence of PONV was high in both groups. The
majority of patients were non-smoking women, and
opioids were given as analgesics in the recovery unit. If
Apfel’s simplified risk score [13] were to be applied, the
predicted incidence of PONV would be high in patients
with these characteristics. As there are no data on how
antiemetics affect gastric emptying, no prophylactic
antiemetics were given.
There is probably no direct relation between gastric
emptying and PONV. We have previously shown that
the perioperative gastric emptying rate is not a predictor for PONV [14], and gastric decompression during
anesthesia does not reduce the incidence of PONV [15].
There was a shorter time to the first dose of postoperative opioid analgesics in the group receiving the
intravenous anesthesia. This may be explained either by
a residual effect of the inhalation agent [16] or by hyperalgesia caused by remifentanil [17].
Previous studies comparing the effects on gastrointestinal motility exerted by different general anesthetic
techniques in the clinical situation are limited, and these
have not shown any differences between different techniques [9,18,19]. The results from our study are in accordance with these study results, as we found no major
differences between the groups. Nothing can be
concluded as to what extent the anesthetics used are
involved in the postoperative impairment of gastrointestinal motility. Other factors, such as the surgical
trauma or individual sensitivity to the drugs used may
be more important.
There are several experimental studies addressing the
effects of anesthetic drugs on gastrointestinal motility.
The inhibitory effect of opioids on gastrointestinal
motility has been studied extensively. This effect is
mainly mediated via opioid receptors, but the mechanism and understanding are complex and still uncertain
[20]. Opioids inhibit motility even at low doses [21], and
the mechanism is both peripherially and centrally mediated [22]. Propofol at low doses does not influence gastric motility [23], but there is evidence that propofol
may inhibit motility at higher doses. In a laboratory
setting, propofol inhibited spontaneous contractions in
human gastric tissue [24]. There are only a few studies
on volatile agents and gastrointestinal motility. Volatile
anesthetics have inhibitory effects on gastric motility,
but the effect may cease quickly after termination of the
agents [3, 25].
The anesthetic techniques used in this study, one
opioid-free and one with an ultra-short-acting opioid,
would, theoretically, be ideal for optimizing gastric
emptying. However, the majority of patients had
delayed gastric emptying with both of these methods.
This indicates that it may be difficult to further improve
early gastric emptying by further altering the methods
of general anesthesia. We cannot exclude the possibility
that all general anesthetic methods have inhibitory effects on early postoperative gastric emptying. Other
perioperative factors may also have main impacts on
early gastric emptying, and it is difficult to distinguish
J. Walldén et al.: Anesthetic technique and gastric emptying
Acknowledgments. This study was supported by grants from
Örebro County Council, Örebro, and Emil Andersson’s Fund
for Medical Research, Sundsvall.
References
1. Watcha MF, White PF (1992) Postoperative nausea and vomiting.
Its etiology, treatment, and prevention. Anesthesiology 77:162–
184
2. Bauer AJ, Boeckxstaens GE (2004) Mechanisms of postoperative
ileus. Neurogastroenterol Motil 16 (Suppl 2):54–60
3. Schurizek BA (1991) The effects of general anaesthesia on
antroduodenal motility, gastric pH and gastric emptying in man.
Dan Med Bull 38:347–365
4. Hammas B, Thorn SE, Wattwil M (2001) Propofol and gastric
effects of morphine. Acta Anaesthesiol Scand 45:1023–1027
5. Nimmo WS, Heading RC, Wilson J, Tothill P, Prescott LF (1975)
Inhibition of gastric emptying and drug absorption by narcotic
analgesics. Br J Clin Pharmacol 2:509–513
6. Thorn SE, Wattwil M, Naslund I (1992) Postoperative epidural
morphine, but not epidural bupivacaine, delays gastric emptying
on the first day after cholecystectomy. Reg Anesth 17:91–94
7. Wallden J, Thorn SE, Wattwil M (2004) The delay of gastric
emptying induced by remifentanil is not influenced by posture.
Anesth Analg 99:429–434
8. Nimmo WS, Littlewood DG, Scott DB, Prescott LF (1978) Gastric emptying following hysterectomy with extradural analgesia.
Br J Anaesth 50:559–561
9. Mushambi MC, Rowbotham DJ, Bailey SM (1992) Gastric emptying after minor gynaecological surgery. The effect of anaesthetic
technique. Anaesthesia 47:297–299
10. Kennedy JM, van Rij AM (2006) Drug absorption from the small
intestine in immediate postoperative patients. Br J Anaesth
97:171–180
11. Apfel CC, Roewer N, Korttila K (2002) How to study postoperative nausea and vomiting. Acta Anaesthesiol Scand 46:921–
928
12. Apfel CC, Kranke P, Katz MH, Goepfert C, Papenfuss T, Rauch
S, Heineck R, Greim CA, Roewer N (2002) Volatile anaesthetics
may be the main cause of early but not delayed postoperative
vomiting: a randomized controlled trial of factorial design. Br J
Anaesth 88:659–668
13. Apfel CC, Laara E, Koivuranta M, Greim CA, Roewer N (1999)
A simplified risk score for predicting postoperative nausea and
vomiting: conclusions from cross-validations between two centers. Anesthesiology 91:693–700
14. Wattwil M, Thorn SE, Lovqvist A, Wattwil L, Klockhoff H,
Larsson LG, Naslund I (2002) Perioperative gastric emptying is
not a predictor of early postoperative nausea and vomiting in
patients undergoing laparoscopic cholecystectomy. Anesth Analg
95:476–479
15. Burlacu CL, Healy D, Buggy DJ, Twomey C, Veerasingam D,
Tierney A, Moriarty DC (2005) Continuous gastric decompression for postoperative nausea and vomiting after coronary
revascularization surgery. Anesth Analg 100:321–326
16. Matute E, Rivera-Arconada I, Lopez-Garcia JA (2004) Effects of
propofol and sevoflurane on the excitability of rat spinal
motoneurones and nociceptive reflexes in vitro. Br J Anaesth
93:422–427
17. Hood DD, Curry R, Eisenach JC (2003) Intravenous remifentanil
produces withdrawal hyperalgesia in volunteers with capsaicininduced hyperalgesia. Anesth Analg 97:810–815
18. Freye E, Sundermann S, Wilder-Smith OH (1998) No inhibition
of gastro-intestinal propulsion after propofol- or propofol/
ketamine-N2O/O2 anaesthesia. A comparison of gastro-caecal
transit after isoflurane anaesthesia. Acta Anaesthesiol Scand 42:
664–669
19. Jensen AG, Kalman SH, Nystrom PO, Eintrei C (1992) Anaesthetic technique does not influence postoperative bowel function:
a comparison of propofol, nitrous oxide and isoflurane. Can J
Anaesth 39:938–943
20. Hicks GA, DeHaven-Hudkins DL, Camilleri M (2004) Opiates in
the control of gastrointestinal tract function: current knowledge
and new avenues for research. Neurogastroenterol Motil 16
(Suppl 2):67–70
21. Yuan CS, Foss JF, O’Connor M, Roizen MF, Moss J (1998)
Effects of low-dose morphine on gastric emptying in healthy volunteers. J Clin Pharmacol 38:1017–1020
22. Thorn SE, Wattwil M, Lindberg G, Sawe J (1996) Systemic and
central effects of morphine on gastroduodenal motility. Acta
Anaesthesiol Scand 40:177–186
23. Hammas B, Hvarfner A, Thorn SE, Wattwil M (1998) Propofol
sedation and gastric emptying in volunteers. Acta Anaesthesiol
Scand 42:102–105
24. Lee TL, Ang SB, Dambisya YM, Adaikan GP, Lau LC (1999)
The effect of propofol on human gastric and colonic muscle contractions. Anesth Analg 89:1246–1249
25. Marshall FN, Pittinger CB, Long JP (1961) Effects of halothane
on gastrointestinal motility. Anesthesiology 22 363–366
26. Brandstrup B, Tonnesen H, Beier-Holgersen R, Hjortso E,
Ording H, Lindorff-Larsen K, Rasmussen MS, Lanng C, Wallin L,
Iversen LH, Gramkow CS, Okholm M, Blemmer T, Svendsen PE,
Rottensten HH, Thage B, Riis J, Jeppesen IS, Teilum D,
Christensen AM, Graungaard B, Pott F (2003) Effects of intravenous fluid restriction on postoperative complications: comparison
of two perioperative fluid regimens: a randomized assessorblinded multicenter trial. Ann Surg 238:641–648
27. Cengiz Y, Janes A, Grehn A, Israelsson LA (2005) Randomized
trial of traditional dissection with electrocautery versus ultrasonic
fundus-first dissection in patients undergoing laparoscopic cholecystectomy. Br J Surg 92:810–813
STUDY II
between all the factors involved. However, intraoperative and postoperative intravenous fluid restriction promotes the return of gastrointestinal motility and
reduces complications after abdominal surgery [26].
Minimizing the surgical trauma during the laparoscopic
procedure reduces pain and nausea [27].
The weakness in our study is that the variability of
gastric emptying was higher than expected, which
resulted in loss of power. However, we believe that our
study indicates that, even after optimizing the anesthetic regimen, gastric emptying is delayed for the
majority of patients. In both groups there were several
patients with fast gastric emptying and there may also
have been a small difference between the groups that
was not detected in our study. The high variability may
have been due to factors other than the anesthetics
used, and must be addressed in future studies.
In summary, there were no major differences in early
postoperative gastric emptying between opioid-free
sevoflurane anesthesia and intravenous propofolremifentanil anesthesia. The variability was high in both
groups, and perioperative factors other than the anesthetics used may have greater influence on early postoperative gastric emptying.
267
STUDY III
Klunserna Study
135
05-10-25, 10.13
Effects of Remifentanil on Gastric Tone
Jakob Walldén, MD * †; Sven-Egron Thörn, MD,PhD §†; Greger Lindberg, MD,
PhD ‡; Magnus Wattwil, MD, PhD §†
* Department of Anesthesia, Sundsvall Hospital, Sundsvall; † School of Health and
Medical Sciences, Örebro University, Örebro ‡ Karolinska Institutet, Department of
Medicine, Karolinska University Hospital Huddinge; Huddinge § Department of Anesthesia and Intensive Care, Örebro University Hospital, Örebro;
SWEDEN
Materials and Methods: Healthy volunteers were studied on two occasions and proximal
gastric tone was measured by a gastric barostat. On the first occasion (n=8) glucagon 1
mg IV was given as a reference for a maximal relaxation of the stomach. On the second
occasion (n=9) remifentanil was given in incremental doses (0.1, 0.2 and 0.3 μg•kg1
•min-1) for 15 min each, followed by a washout period of 30 minutes. Thereafter remifentanil was readministered, and 10 minutes later glucagon 1 mg was given. Mean intragastric bag volumes were calculated for each 5-minute interval. Analyses of single nucleotide polymorphisms (SNP) A118G and G691C in the μ-opioid receptor (MOR) gene
were done in all subjects.
Results: Glucagon decreased gastric tone in all subjects. Remifentanil had a marked effect
on gastric tone; we found two distinct patterns of reactions with both increases and decreases in gastric tone, and during the remifentanil infusion glucagon did not affect gastric tone. We found no association between SNPs A118G and G691C and the two patterns of gastric tone reactions to remifentanil.
Conclusions: Remifentanil induced changes in gastric tone with both increases and decreases in tone. As a preliminary observation, the variation between individuals could not
be explained by SNPs in the MOR gene.
Keywords: Gastrointestinal motility; Gastric tone; Analgesics, Opioid;
Polymorphism, Single Nucleotide; Receptors, Opioid, mu/*genetics; Genotype
This study was supported by grants from FoU-centrum, Sundsvall, Emil Andersson’s
Fund for Medical Research, Sundsvall and Örebro County Council Research Committee.
The manuscript is submitted.
STUDY III
Objectives: Opioids are well known for impairing gastric motility. The mechanism is far
from clear and there is wide interindividual variability. The purpose of this study was to
evaluate the effect of remifentanil on proximal gastric tone.
2 Jakob Wallden
Introduction
Preoperative fasting, bioavailability of drugs given orally (i.e. premedication), gastric retention with the associated risk of aspiration, and the postoperative start of oral intake
are examples of issues that are highly dependent on gastric motility. Gastric motility is
often impaired during and after surgery/anesthesia as a result of many contributing factors. Opioids, given as part of the anesthesia and the postoperative analgesic regimes,
play a major role in this impairment.
Gastric emptying, the functional goal of gastric motility, is determined by an integrative
motor activity in the stomach. The proximal part of the stomach acts as a reservoir and
exhibits a constant dynamic tone that adapts to the volume load. The distal part of the
stomach exhibits a distinct peristaltic activity and acts both as a pump towards the duodenum and a grinding mill.
Gastric tone can be expressed as the length of the muscle fibers in the proximal stomach.
The tone is not equivalent to pressure. As there is an adaptive relaxant reflex, a volume
load can maintain the intragastric pressure. Therefore, an almost empty stomach and a
full stomach are able to have the same intragastric pressure, but different tone. The gastric barostat, which maintain a constant pressure in an air-filled intragastric bag, measures gastric tone as isobaric volume variations (1).
Opioids are well known for impairing gastric motility and emptying (2-4). However,
knowledge about the effects of opioids on proximal gastric tone is limited and results
from published research are divergent (5, 6). There is also little knowledge about how the
highly potent μ-opioid receptor agonist remifentanil affects gastric motility.
The primary aim of this study was to evaluate the effect of the μ-opioid receptor agonist
remifentanil on proximal gastric tone during fasting conditions. The study was performed in healthy volunteers and the gastric barostat was used to measure gastric tone.
There are substantial inter-individual differences in the general response to opioids (7),
and recent studies have suggested that polymorphism of the μ-opioid receptor (MOR)
gene, with an altering of the receptor-function, may be a cause of the variation (8-10).
Since we found large variations in gastric tone in response to remifentanil in this study,
we also investigated if the variation was correlated to the presence of two different polymorphisms in the μ-opioid receptor gene.
Methods
Following approval of the study protocol by the Ethics Committee of the Örebro County
Council, 10 healthy male volunteers with a mean age of 24 years (range, 19-31 years), a
mean weight of 75 kg (range, 60-84 kg) and a mean height of 182 cm (range, 171-185
cm) were recruited to the study. The subjects gave their informed consent to participate
after receiving verbal and written information. Only men were recruited, since the menstrual cycle may alter gastric motility (11). None of them were taking any medications
and there was no history of gastrointestinal disturbances.
Each subject underwent two study protocols on two separate days. In the first study, the
effect of glucagon on gastric tone was measured. Glucagon is a potent inhibitor of gastrointestinal motility and induces a powerful relaxation of the stomach, resulting in an
increase in gastric volume (12). The objectives were to study the effect of glucagon in order to obtain an estimate of maximal stomach relaxation and to test the performance of
the gastric barostat system.
Remifentanil and Gastric Tone 3
In the second study, gastric tone was measured during and after a remifentanil infusion
and, after a washout time of 30 minutes, also during readministration of remifentanil in
combination with glucagon. Remifentanil is an ultra-short-acting opioid (μ-opioid receptor agonist) with a predictable and constant effect.
Procedure
The subjects fasted for at least six hours before each study. An IV line was established in
one arm and an IV-infusion of 5% buffered glucose 100ml/hour was given. Before the
gastric intubation the subjects received a bolus dose of propofol (0.3 mg/kg IV). Previous
studies in volunteers have shown that this dose of propofol, which was given at least 30
min before the study started, does not influence gastric tone (6). The intragastric bag was
folded carefully around the gastric tube and positioned in the gastric fundus via oral intubation. Thereafter, the gastric bag was unfolded by being slowly inflated with 300 ml
of air under controlled pressure (<20mmHg), and the correct position of the bag was
verified by traction of the gastric tube.
The gastric bag was completely deflated and thereafter inflated with air to a pressure 2
mmHg above the intragastric pressure. During the study the participants were lying
down, positioned on their right side, and were asked to relax comfortably. Volume and
pressure in the gastric bag were continuously recorded by the electronic barostat and
sampled in the computer. The mean gastric bag volume during each 5-min interval was
calculated.
Glucagon study
After 10 min of stable basal gastric tone recording the subjects were given an intravenous
bolus dose of 1 mg glucagon. Mean gastric volumes before the injection, and during the
time intervals 0 – 5 min, 5 –10 min, and 10-15 min after the injection, were calculated.
For a schematic illustration of the study protocol, see Figure 1.
Remifentanil Study
After 10 minutes of stable basal gastric tone recordings, a continuous intravenous infusion of remifentanil was started. The initial dose was 0.1 μg•kg-1•min-1, after 15 minutes
the dose was increased to 0.2 μg•kg-1•min-1, and after a further 15 minutes the dose was
increased to 0.3 μg•kg-1•min-1. The infusion was discontinued after 45 minutes, following which there was a washout period of 30 minutes. Thereafter, remifentanil was readministered in a dose of 0.3 μg·kg-1·min-1, and 10 minutes later glucagon 1 mg was given
intravenously and the remifentanil infusion was continued for a further 10 minutes. For a
schematic illustration of the study protocol, see Figure 1.
STUDY III
Measurement of gastric tone
Gastric tone was measured by an electronic barostat (SVS®; Synetics AB, Stockholm,
Sweden). The gastric barostat is an instrument with an electronic control system that
maintains a constant preset pressure within an air-filled flaccid intragastric bag by momentary changes in the volume of air in the bag. When the stomach contracts, the barostat aspirates air to maintain the constant pressure within the bag, and when the stomach
relaxes, air is injected. The pressure in the bag was set at 2 mmHg above the basal intragastric pressure. The pressure change at which respiration is perceived on the pressure
tracing- without an increase or decrease in the average volume- is the basal intragastric
pressure. The bag, made of ultrathin polyethylene, has a capacity of 900 ml and is connected to the barostat by a double-lumen 16 Ch gastric tube. The barostat measurements
were performed following the recommendations presented in a review article by an international working team, and the barostat instrument fulfilled the criteria determined by
this group (13).
4 Jakob Wallden
Figure 1 (opposite page)
Schematic illustration of the study design
Monitoring and safety
During both studies, the usual monitors were used. Heart rate, blood pressure, oxygen
saturation, end-tidal carbon-dioxide (CO2), respiratory rate and sedation level were recorded every fifth minute. At the same intervals, the subjects were asked if they were experiencing nausea or any other symptoms. The sedation level was recorded as follows:
No sedation = 1, Light sedation =2, Moderate sedation = 3 and Deep sedation = 4. A visual analog scale (VAS) ranging from 0-10 was used for nausea, where VAS 0 was no subjective symptoms and VAS 10 was the worst nausea the subjects could imagine. Blood
glucose was followed during both studies. In the glucagon study, blood glucose was
measured just before and 15 min after the administration of glucagon. In the remifentanil
study, blood glucose was measured during the baseline period and just before and 15
minutes after the administration of glucagon.
If the subject showed signs of excessive sedation, respiratory depression, severe nausea or
vomiting, or showed signs of other severe symptoms related to the infusion of remifentanil, the dose was reduced or discontinued.
Genetic analyses
Due to the large inter-individual variations in the gastric tone response after remifentanil,
we investigated if this variation could be explained by genetic variability, polymorphisms, in the μ-opioid receptor gene. After reviewing the literature, we decided to analyze polymorphisms with relative high frequencies and with reports of altered responses.
Therefore, we focused on the μ-opioid receptor gene polymorphisms A118G and G691C
(14). As ethnicity has impact on genetic expressions, we reviewed patient data and found
that all of the subjects were Caucasians.
DNA collection and purification. Venous blood (10 ml) was collected from the subjects
in EDTA tubes and the samples were stored frozen at –70°C. Genomic DNA was purified from peripheral leukocytes in 1 ml of EDTA blood on a MagNA Pure LC DNA extractor, using the MagNA Pure LC Total Nucleic Acid Isolation Kit – Large Volume
(Roche Diagnostics Corporation, Indianapolis, IN, USA).
Genotyping. Genotyping was performed at CyberGene AB, Huddinge, Sweden. The
A118G SNP in Exon 1 and the IVS2 G691C SNP in Intron 2 were genotyped using polymerase chain reaction amplification and sequencing. Oligonucleotide primers (forward:
5'-GCGCTTGGAACCCGAAAAGTC; reverse: 5'-CATTGAGCCTTGGGAGTT) and
(forward: 5'-CTAGCTCATGTTGAGAGGTTC; reverse:
5'-CCAGTACCAGGTTGGATGAG) were used for amplifying gene fragments containing Exon 1 and Intron 2, respectively. PCR conditions comprised an initial denaturing
step at 95°C for 1 min followed by 30 cycles at 94°C for 1 min, annealing at 47.2-53.4°C
(depending on primer) for 1 min and extension at 68°C for 3 min, and a final extension
at 68°C for 3 min. The amplified fragments were sequenced using the same primers with
the addition of Rev 1-2 5'-TTAAGCCGCTGAACCCTCCG and the BigDye Terminator
v1.1Cycle Sequence Kit (Applied Biosystems, Foster City, CA, USA). PCR amplification
and sequence reactions were done on ABI GeneAmp 2400 and 9700 (Applied Biosystems). Sequence analysis was first done on MegaBACE 1000 (Amersham Biosciences)
and then confirmed with ABI 377XL (Applied Biosystems).
Glucagon Study
Propofol
0.3 mg ·kg-1
-40- -80 min
Glucagon
STUDY III
0 min
Glucagon
1 mg
-10 min
15 min
-1
-1
0.2 μg·kg ·min
15 min
Measurement of Gastric Tone
0 min
0.1μg·kg ·min
-1
Start Remifentanil
-10 min
Remifentanil Study
Propofol
0.3 mg ·kg-1
-40- -80 min
Remifentanil
Glucagon
-1
45 min
Stop Remifentanil
-1
0.3 μg·kg ·min
30 min
-1
Measurement of Gastric Tone
Start Remifentanil
Glucagon
1 mg Stop Remifentanil
-1
75 min 85 min 95 min
-1
0.3 μg·kg ·min
6 Jakob Wallden
Statistics
The results are presented as means with standard deviations and medians with ranges.
Repeated measures ANOVA was used for evaluating overall differences between the
study situations. If the statistical analysis showed differences, Fisher’s PLSD was used for
comparisons between the situations. For the analysis, the remifentanil study was split
into two parts. The Chi-square test was used for analysis of the genetic variations. The
significance level was set at 5% in all tests.
Results
Eight subjects completed the glucagon study and nine subjects completed the remifentanil
study. One subject (no. 8) did not tolerate the gastric tube during the glucagon study and
terminated participation in both study protocols. One subject refused to participate in
the glucagon study after completing the remifentanil study.
Glucagon study
Glucagon induced a significant decrease in gastric tone (increase in volume) in all subjects (n=8) (Table 1 and Fig. 2).
There was a temporary increase in heart rate after the injection of glucagon (Before: 70
(6.1) min-1; 0-5 min: 87 (8.7) min-1; p<0.001), other vital variables were normal and stable. Blood glucose increased after glucagon (Before: 5.4 (1.4) mmol L-1; After: 11.1 (2.2)
mmol L-1; p<0.001). 5 subjects experienced nausea (VAS 4 (2-8)) after receiving glucagon.
Table 1
Gastric tone in healthy volunteers (n=8) studied with a barostat. Intragastric bag volumes (ml)
after intravenous glucagon 1 mg.
Mean (SD) ml
Before Glucagon
-10 to -5 minutes
-5 to 0 minutes
138 (16)
156 (20)
After Glucagon 1mg
0 to 5 minutes
5 to 10 minutes
10 to 15 minutes
362 (40)*
456 (47)*
448 (50)*
ANOVA
Median (range) ml
168 (65-224)
158 (68-192)
P <0.0001
329 (230-454)
410 (299-701)
387 (330-714)
Change over time evaluated with repeated measures ANOVA. Pairwise comparison between the periods with
Fisher’s PLSD. * = Significant difference (p<0.05) compared to “Before Glucagon -5 to 0 min”
Figure 2 (opposite page)
Gastric tone measured with a gastric barostat. The curves represent individual intragastric bag
volumes during the studies. In the first part, glucagon 1 mg was given as an intravenous bolus injection. In the second part, remifentanil was given at the doses of 0.1, 0.2 and 0.3 μg•kg-1•min-1
Intragastric Bag Volume (ml)
Figure 2
0 - 5 min
5 - 10 min
STUDY III
Glucagon Study
n=8
5 - 10 min
Glucagon
1000
800
600
400
200
0
Baseline 0 - 5 min
10 - 15 min
Remifentanil Study
n=9
Baseline 0 - 5 min
5 - 10 min
Remi 0.1
0 - 5 min
5 - 10 min
10 - 15 min
Remi 0.2
0 - 5 min
Time
5 - 10 min
10 - 15 min
0 - 5 min
5 - 10 min
Glucagon
0 - 5 min
5 - 10 min
Washout
0 - 5 min
5 - 10 min
Subj 1
25 - 30 min
Remi 0.3
Subj 2
20 - 25 min
Subj 3
15 - 20 min
Subj 4
10 - 15 min
Subj 5
0 - 5 min
5 - 10 min
Subj 6
Washout
Subj 7
10 - 15 min
Subj 8
0 - 5 min
5 - 10 min
Subj 10
Remi 0.3
8 Jakob Wallden
Remifentanil study
There were variable responses in gastric tone during the initial 45-minute infusion of remifentanil and the subsequent washout period of 30 minutes (Table 2 and Fig. 2). Four
subjects (no. 1, 2, 3, 7) responded to remifentanil with a marked increase in gastric tone
(decreased volume) that decreased during washout. Four subjects (no. 4, 6, 8, 10) responded to remifentanil with a marked decrease in gastric tone (increased volume) and
maintained a low gastric tone during the washout period. In one subject (no. 5) gastric
tone was almost unaffected. The mean gastric tone was significantly lower during the
washout period than before starting the infusion.
Table 2
Gastric tone in healthy volunteers (n=9) studied with a gastric barostat. Intragastric bag volumes
(ml) during infusion of remifentanil and in combination with intravenous glucagon 1 mg.
Intragastric bag volumes (ml)
Mean (SD) ml Median (range)
Interval
during the study
Period for volume
measurement
-5 to 0 min
Before Remifentanil
117 (44)
107 (62-192)
-10 to 0 min
During Remifentanil
0.1 μg•kg-1•min-1
0.2 μg•kg-1•min-1
0.3 μg•kg-1•min-1
156 (170)
219 (240)
250 (291)
114(1 - 473)
70 (1-542)
59 (0-722)
0 to 45 min
0 to 15 min 10 to 15 min
15 to 30 min
25 to 30 min
30 to 45 min
40 to 45 min
320 (276)*
394 (237)*
304 (25–785)
379 (90 – 820)
45 to 75 min
55 to 60 min
70 to 75 min
Readmin Remifentanil
0.3 μg•kg-1•min-1
+ Glucagon 1 mg
342 (314)
308 (316)
367 (0-856)
339 (0-879)
75 to 95 min
at 85 min
80 to 85min
90 to 95 min
Washout period 2
347 (310)
242 (1-839)
95 to 105 min
100 to 105 min
Washout period 1
Repeated Measure
ANOVA
P=0.0012
P=0.6
Change over time evaluated with repeated measures ANOVA. Pairwise comparison between the periods with Fisher’s
PLSD. * = Significant difference (p<0.05) compared to “Before Remifentanil”.
During the initial remifentanil infusion there were significant decreases in heart rate (Before: 67 (4.9 min-1; Minimum during Remi 0.1: 61 (4.6) min-1; p<0.001) and respiratory
rate (Before: 12 (1.8) min-1; Minimum during Remi 0.2: 8 (2.3) min-1; p<0.001) and significant increases in end-tidal CO2 (Before: 5.4 (0.3) %; Maximum during Remi 0.3: 7.4
(1.3) %; p<0.001) and sedation level (Before: 1 (0); Maximum during Remi 0.3: 2 (0.7);
p<0.05). The administration of glucagon at the end of the study induced a significant increase in systolic blood pressure (Before: 122 (9) mmHg; After: 137 (22) mmHg;
p<0.001), heart rate (Before: 61 (4.1) min-1; After: 85 (22) min-1; p<0.001) and blood
glucose (Before: 6.2 (1.1) mmol L-1; After: 10.3 (1.1) mmol L-1; p<0.001).
One subject (no. 3) became too sedated during the highest dose of remifentanil and thinfusion was discontinued. During readministration this subject received remifentanil 0.2
μg kg-1min-1.
Remifentanil and Gastric Tone 9
Subjects experienced pruritus (n=7), nausea (n=3, VAS 1 (1-3)), headache (n=3) and difficulties swallowing (n=2) during the remifentanil infusion. After glucagon, the incidence
of nausea increased (n=6; VAS 4.5 (2-7)).
During the readministration of remifentanil there were increases in gastric tone among
subjects with increased tone during the previous remifentanil infusion. The subject with
unaffected tone during the previous infusion had an increase in gastric tone. The subjects
who maintained a low gastric tone during washout continued to maintain a low gastric
tone.
Only one subject (no. 5) responded with a decrease in gastric tone after the injection of
glucagon during the readministration of remifentanil.
Table 3
Gastric tone response to remifentanil and correlation to genotype groups (n=9).
118 A>G genotype
Wild Type
Hetero
zygous
(AA)
(AG)
n=7
n=2
78%
22%
Increased tone (n=4)
Unchanged tone (n=1)
Decreased tone (n=4)
4
3
1
1
Variant
(GG)
n=0
0%
IVS2 + 691 G>C genotype
Wild Type
Heterozygous
(GG)
(GC)
n=5
n=2
56%
22%
3
1
1
Variant
(CC)
n=1
11%
1
2
1
No association found between gastric tone response to remifentanil and presence of polymorphism A118G [Wild Type vs
(Heterozygous OR Variant)] ; Chi-square test, P=0.097
No association found between gastric tone response to remifentanil and presence of polymorphism in G691C [Wild Type
vs (Heterozygous OR Variant)]; Chi-square test , P =0.23
Discussion
The major finding in this study is the marked effect of remifentanil on gastric tone. We
found two distinctly different patterns of reactions, with about half of the subjects increasing in gastric tone (decreased volume) and about half of the subjects decreasing in
gastric tone (increased volume). Due to this variability, we were not able to statistically
prove a response during remifentanil. However, the gastric tone was significantly lower
(higher volume) after the infusion of remifentanil compared to the baseline period. We
believe these are important findings, as they show that opioid effects on human gastric
motility are variable and complex. As expected, we found that glucagon decreased gastric
tone in all subjects. In addition, we evaluated if the variable response in gastric tone to
remifentanil could be explained by the single nucleotide polymorphisms A118G and
G691C in the μ-opioid receptor gene, but we found no association.
STUDY III
Genotype study
Blood samples for genetic analysis were obtained from all 9 subjects in the study. We
found no correlation between the gastric response to remifentanil and the polymorphisms
A118G and G691C (Table 3).
10 Jakob Wallden
We have tried to explain the variability in gastric tone during the remifentanil infusion.
We do not believe this is due to a methodological problem with the gastric barostat. During the glucagon part of the study all subjects responded with a clear decrease in tone
(increased volume). This validates that the gastric barostat was working properly, as an
expected relaxant stimulus, glucagon, decreased tone in all subjects. Also, the same barostat equipment and setup have been used in previous studies by our group (6, 15) and we
have not observed this kind of variation.
There are several limitations in our study. There was no control group, and we cannot
completely rule out that there was a time effect involved for the change in gastric tone.
However, there was a stable baseline level in gastric tone before remifentanil and the distinct changes in gastric tone after start of the infusion, as well as the changes after discontinuation, are in agreement with the timing of the pharmacodynamic properties of
remifentanil (16). This provides us with evidence that the effects are mediated by remifentanil.
The number of subjects in this study was small. We expected a similar response to remifentanil in all subjects, but instead there were two kinds of divergent responses. As this
is the first study to describe this dual effect, we consider our observations as important
despite the lack of statistical power. Future studies may evaluate the quantitative relation
between the responses, and the mechanisms behind them, in a larger group of subjects.
Basic knowledge about the regulation of gastric tone is needed to explain the effects of
opioids. Proximal gastric tone is an important part of gastric motility and is mainly controlled by the autonomous nerve system. Vagal cholinergic nerves mediate excitation
(contraction) while vagal non-cholinergic non-adrenergic (NANC) nerves mediate inhibition (relaxation) (17). Recent studies have identified nitrous oxide as one of the main
transmitters in the NANC pathway. In humans, the NANC pathway is believed to be
silent during fasting conditions and to be activated by the adaptive reflex (18). In addition, there are sympathetic adrenerigic spinal nerves that inhibit motility mainly through
cholinergic inhibition (19).
Several animal studies have tried to identify targets for the opioid induced inhibition of
gastric motility. It is widely believed that μ-opioid receptor (MOR) agonists inhibit the
release of Ach in the stomach (20), and there is also evidence that MOR agonists reduce
the relaxation induced by the NANC pathway (21). Opioids might also have a direct excitatory effect on gastric smooth muscles (22). Hence, depending on the current state of
autonomous and enteric nerve systems and the main effect site, opioids have the potential
to both relax and contract the stomach.
Opioids also act in the central nervous system (CNS). There is evidence that MORs are
present on and inhibit excitatory neurons projecting to gastrointestinal motor neurons in
the dorsal motor complex (DMV) of the medulla (23). In this way activation of central
MORs inhibits the excitatory vagal output, leading to inhibition of intestinal transit and
induction of gastric relaxation in animal models. In humans, there is evidence that
opioids inhibit gastric motility through a central mechanism (24).
There are diverging results in the literature regarding the effects of opioids on gastric
tone in humans. Penagini found that morphine increased gastric tone (5) while Hammas
reported a decrease in gastric tone (6). Both studies used the same dose of intravenous
morphine (0.1 mg/kg) and both used a gastric barostat. However, there were important
differences between the studies. In the first study, baseline gastric tone was set to resemble a gastric load of a meal and in the second study, baseline was set to fasting conditions. The stomach wall was probably more distended (higher volumes in intragastric
Remifentanil and Gastric Tone 11
bag) before morphine in Penagani’s study compared to Hammas’ study, resulting in an
activated adaptive reflex. This leads to completely different baseline conditions. In
Penagini’s subjects there were probably low cholinergic and high NANC vagal inputs to
the stomach and the reverse baseline conditions were probably present in Hammas’ subjects. This might explain why a MOR antagonist contracted the stomach (through
NANC inhibition) in one study and relaxed the stomach (through cholinergic inhibition)
in the other study.
Can we explain the variable responses seen in our study within this context? Remifentanil is a potent MOR agonist and the effect sites are probably both at the stomach level
and in the CNS. We speculate that the “normal” opioid response during fasting conditions, as seen in Hammas’ study, is a decreased cholinergic activity resulting in a decrease
in gastric tone. However, due to the high potency of remifentanil, direct smooth muscle
effects might predominate in some subjects, resulting in an increase in tone. Like propofol, remifentanil might also have properties that modulate the opioid response. The focus of these speculations is that opioid effects on gastric tone are variable and depend on
factors like the state of the subject and the current status of the neural pathways and
smooth muscles involved. This might be an explanation for the variable results in our
study.
As expected, glucagon decreased gastric tone in all subjects. The effect of glucagon is believed to be an indirect inhibition of cholinergic activity (26). Among those subjects who
already had low gastric tone a further decrease was not expected. With the exception of
one subject, the administration of glucagon during the remifentanil infusion did not result in a change in gastric tone. As the opioids might act on the smooth muscle level,
glucagon might not have the ability to modulate the opioidergic effects on gastric motility.
We tested the hypothesis that pharmacogenetic differences in the μ-opioid receptor gene
were responsible for the variable outcome. Investigators recently reported that the occurrence of single nucleotide polymorphisms (SNP) in the μ-opioid receptor gene is associated with altered responses to an opioid (8-10). We found no association between the
presence of SNPs and the response in gastric tone after remifentanil. The results are in
agreement with a recent published study by our group where we evaluated a variable effect of fentanyl on electrogastrography (EGG) recordings (27). However, the results from
the genetic analysis must be interpretated with care. The study was designed and powered for the barostat variables and to investigate associations to genetic factors, a larger
sample size is needed (28). The result of no association must be regarded as preliminary
observations and has to be confirmed in properly designed studies. The observation
might be an indication that the SNP A118G and G691C are not major factors for the
observed variability, but we can neither confirm nor rule out that the presence of SNPs in
the MOR alter opioid effects on motility.
Do our results have any implications for the clinical situation? The main message is that
gastric effects of opioids are variable, and it is not possible today to predict the response
STUDY III
An interesting finding in Hammas’ study was that the concurrent administration of propofol altered the effect of morphine on gastric tone. Propofol per se had no effect on gastric tone, but after the subsequent administration of morphine, gastric tone increased
(volume decreased), contrary to the response of morphine alone. We cannot explain the
mechanism behind this modulation, but there is evidence for central interactions and
modulations between GABAergic and opioid pathways (25). Other types of modulations
of gastric tone have also been described; in animals with an intact vagus nerve,
noradrenaline relaxed the proximal stomach while vagotomy reversed this response (17).
12 Jakob Wallden
in the individual patient. An example of the variability is seen in the clinic, where opioids
induce nausea and vomiting in some patients while other patients are totally unaffected.
In future studies we need to evaluate whether the different kinds of gastric responses are
of clinical significance.
In summary, remifentanil induced distinct changes in gastric tone with both increases and
decreases in tone. The effect of remifentanil on gastric tone is probably dependent on the
current state of the systems involved. As a preliminary observation, the variations between individuals could not be explained by SNPs in the MOR gene.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Azpiroz F. Control of gastric emptying by gastric tone. Dig Dis Sci 1994:39(12 Suppl):18S-19S.
Nimmo WS, Heading RC, Wilson J, Tothill P, Prescott LF. Inhibition of gastric emptying and drug
absorption by narcotic analgesics. Br J Clin Pharmacol 1975:2(6):509-13.
Lewis TD. Morphine and gastroduodenal motility. Dig Dis Sci 1999:44(11):2178-86.
Wallden J, Thorn SE, Wattwil M. The delay of gastric emptying induced by remifentanil is not influenced by posture. Anesth Analg 2004:99(2):429-34.
Penagini R, Allocca M, Cantu P, Mangano M, Savojardo D, Carmagnola S, Bianchi PA. Relationship
between motor function of the proximal stomach and transient lower oesophageal sphincter relaxation after morphine. Gut 2004:53(9):1227-31.
Hammas B, Thorn SE, Wattwil M. Propofol and gastric effects of morphine. Acta Anaesthesiol Scand
2001:45(8):1023-7.
Coulbault L, Beaussier M, Verstuyft C, Weickmans H, Dubert L, Tregouet D, Descot C, Parc Y, Lienhart A, Jaillon P, Becquemont L. Environmental and genetic factors associated with morphine response in the postoperative period. Clin Pharmacol Ther 2006:79(4):316-324.
Klepstad P, Rakvag TT, Kaasa S, Holthe M, Dale O, Borchgrevink PC, Baar C, Vikan T, Krokan HE,
Skorpen F. The 118 A > G polymorphism in the human micro-opioid receptor gene may increase
morphine requirements in patients with pain caused by malignant disease. Acta Anaesthesiol Scand
2004:48(10):1232-9.
Chou WY, Yang LC, Lu HF, Ko JY, Wang CH, Lin SH, Lee TH, Concejero A, Hsu CJ. Association of
mu-opioid receptor gene polymorphism (A118G) with variations in morphine consumption for analgesia after total knee arthroplasty. Acta Anaesthesiol Scand 2006:50(7):787-92.
Klepstad P, Dale O, Skorpen F, Borchgrevink PC, Kaasa S. Genetic variability and clinical efficacy of
morphine. Acta Anaesthesiol Scand 2005:49(7):902-8.
Notivol R, Carrio I, Cano L, Estorch M, Vilardell F. Gastric emptying of solid and liquid meals in
healthy young subjects. Scand J Gastroenterol 1984:19(8):1107-13.
Notivol R, Coffin B, Azpiroz F, Mearin F, Serra J, Malagelada JR. Gastric tone determines the sensitivity of the stomach to distention. Gastroenterology 1995:108(2):330-6.
Whitehead WE, Delvaux M. Standardization of barostat procedures for testing smooth muscle tone
and sensory thresholds in the gastrointestinal tract. The Working Team of Glaxo-Wellcome Research,
UK. Dig Dis Sci 1997:42(2):223-41.
Ikeda K, Ide S, Han W, Hayashida M, Uhl GR, Sora I. How individual sensitivity to opiates can be
predicted by gene analyses. Trends Pharmacol Sci 2005:26(6):311-7.
Levein NG, Thorn SE, Lindberg G, Wattwill M. Dopamine reduces gastric tone in a dose-related
manner. Acta Anaesthesiol Scand 1999:43(7):722-5.
Burkle H, Dunbar S, Van Aken H. Remifentanil: a novel, short-acting, mu-opioid. Anesth Analg
1996:83(3):646-51.
Jahnberg T. Gastric adaptive relaxation. Effects of vagal activation and vagotomy. An experimental
study in dogs and in man. Scand J Gastroenterol Suppl 1977:46:1-32.
Tack J, Demedts I, Meulemans A, Schuurkes J, Janssens J. Role of nitric oxide in the gastric accommodation reflex and in meal induced satiety in humans. Gut 2002:51(2):219-24.
Abrahamsson H, Glise H. Sympathetic nervous control of gastric motility and interaction with vagal
activity. Scand J Gastroenterol Suppl 1984:89:83-7.
Yokotani K, Osumi Y. Involvement of mu-receptor in endogenous opioid peptide-mediated inhibition
of acetylcholine release from the rat stomach. Jpn J Pharmacol 1998:78(1):93-5.
Remifentanil and Gastric Tone 13
21.
22.
23.
24.
25.
26.
27.
STUDY III
28.
Storr M, Gaffal E, Schusdziarra V, Allescher HD. Endomorphins 1 and 2 reduce relaxant nonadrenergic, non-cholinergic neurotransmission in rat gastric fundus. Life Sci 2002:71(4):383-9.
Grider JR, Makhlouf GM. Identification of opioid receptors on gastric muscle cells by selective receptor protection. Am J Physiol 1991:260(1 Pt 1):G103-7.
Browning KN, Kalyuzhny AE, Travagli RA. Opioid peptides inhibit excitatory but not inhibitory synaptic transmission in the rat dorsal motor nucleus of the vagus. J Neurosci 2002:22(8):2998-3004.
Thorn SE, Wattwil M, Lindberg G, Sawe J. Systemic and central effects of morphine on gastroduodenal motility. Acta Anaesthesiol Scand 1996:40(2):177-86.
Browning KN, Zheng Z, Gettys TW, Travagli RA. Vagal afferent control of opioidergic effects in rat
brainstem circuits. J Physiol 2006:575(Pt 3):761-76.
Shimatani T. Involvement of cholinergic motor neurons in pharmacological regulation of gastrointestinal motility by glucagon in conscious dogs. J Smooth Muscle Res 1997:33(4-5):145-62.
Wallden J, Lindberg G, Sandin M, Thorn S-E, Wattwil M. Effects of fentanyl on gastric myoelectrical
activity - a possible association to polymorphisms of the μ-opioid receptor gene? Acta Anaesthesiol
Scand 2008:In Press.
Belfer I, Wu T, Kingman A, Krishnaraju RK, Goldman D, Max MB. Candidate gene studies of human
pain mechanisms: methods for optimizing choice of polymorphisms and sample size. Anesthesiology
2004:100(6):1562-72.
STUDY IV
Klunserna Study
161
05-10-25, 10.15
Effects of fentanyl on gastric myoelectrical activity
– a possible association to polymorphisms of the
μ-opioid receptor gene?
Jakob Walldén, MD * †; Greger Lindberg, MD, PhD ‡ ;Mathias Sandin, MD §;
Sven-Egron Thörn, MD,PhD §†;Magnus Wattwil, MD, PhD §†
* Department of Anesthesia, Sundsvall Hospital, Sundsvall; † Department of Clinical
Medicine, Örebro University, Örebro; ‡ Karolinska Institutet, Department of Medicine,
Karolinska University Hospital Huddinge; Stockholm; § Department of Anesthesia and
Intensive Care, Örebro University Hospital, Örebro; SWEDEN
Methods: We used cutaneous multichannel electrogastrography (EGG) to study myoelectrical activity in 20 patients scheduled for elective surgery. Fasting EGG was recorded for
30 minutes, followed by intravenous administration of fentanyl 1μg•kg-1 and subsequent
EGG recording for 30 minutes. Spectral analysis of the two recording periods was performed and variables assessed were dominant frequency (DF) of the EGG and its power
(DP). Genetic analysis of the SNP A118G and G691C of the μ-opioidreceptor gene were
performed with PCR-technique.
Results: There was a significant reduction in DF and DP after intravenous fentanyl.
However, there was a large variation between the patients. In eight subjects EGG was
unaffected, five subjects had a slower DF (bradygastria) and in six subjects the slow
waves disappeared. We found no correlation between the EGG outcome and presence of
A118G or G691C in the μ-opioidreceptor gene.
Conclusions: Fentanyl inhibited gastric myoelectrical activity in about half of the subjects. The variation could not be explained by SNP in the μ-opioid receptor gene. Due to
small sample size, results must be regarded as preliminary observations.
Keywords: Gastrointestinal motility; Gastric myoelectrical activity; Electrogastrography;
Analgesics, Opioid; Polymorphism, Single Nucleotide; Receptors, Opioid, mu/*genetics;
Genotype
This study was supported by grants from FoU-centrum, Sundsvall and Emil Andersson’s
Fund for Medical Research, Sundsvall.
Accepted for publication in Acta Anaesthesiologica Scandinavica on January 2, 2008.
STUDY IV
Background: Opioids have inhibitory effects on gastric motility, but the mechanism is far
from clear. Electrical slow waves in the stomach determine the frequency and the peristaltic nature of gastric contractions. The primary aim of this study was to investigate the
effects of the opioid fentanyl on gastric myoelectric activity. As there were large variations between the subjects we investigated if the variation was correlated to single nucleotide polymorphisms (SNP) of the μ-opioidreceptor gene.
2 Jakob Wallden
Introduction
Electrogastrography (EGG) is the cutaneous recording of gastric myoelectrical activity
and the activity is closely associated to gastric motility (1). Gastric smooth muscles display a rythmic electrical activity, slow-waves, with a frequency of approximately 3 cycles
per minute. These slow-waves originate from a gastric pacemaker region in the corpus
and propagate towards the pylorus. With influence of the enteric nervous system and
other regulatory mechanisms, the slow-waves trigger the onset of spike potentials, which
in turn initiate coordinated contractions of the gastric smooth muscles (2). Gastric motility and emptying depend on these slow waves.
Opiate drugs are well known to impair gastric motility. The mechanistic understanding
how this impairment is mediated is far from clear (3) although opioid receptors are distributed all over the gastrointestinal tract. To our knowledge there is only one study in
the literature where cutaneous EGG was used for studying gastric effects of opiates (4)
and in that study morphine induced tachygastria. The primary aim of our study was to
investigate how the short acting opiate fentanyl affects gastric myoelectrical activity as
recorded with cutaneous EGG.
There are substantial inter-individual differences in the general response to opioids (5)
and recent studies have suggested that polymorphism of the μ-opioid receptor (MOR)
gene with an altering of the receptor-function may be a cause of the variation (6). Since
we found large variations in the EGG response to an opioid, we also investigated if this
variation was correlated to the presence of two different polymorphisms in the μ-opioid
receptor gene.
Methods
After approval of the study protocol by the ethics committee of the Örebro County
Council, 20 patients undergoing surgery on an ambulatory basis were recruited to the
study. The subjects gave their informed consent to participate after receiving verbal and
written information. Patient characteristics are presented in Table 1.
The study was done before the induction of anesthesia in a pre-anesthetic area. Patients
had fasted for at least 6 hours from solid foods and 2 hours from clear fluids. No premedication was given. While the patient was lying in a comfortable bed rest position, an
intravenous line was inserted and the EGG recordings were initiated. After achieving a
stable EGG signal, a 30-minute baseline EGG recording was collected. Without discontinuation of the EGG recording, 1 μgram•kg-1 of fentanyl was given as an intravenous
bolus through the intravenous line and the EGG recording continued for another 30
minutes.
Multichannel Electrogastrography
Six EGG electrodes were placed on the abdomen after skin preparation. The electrodes
consisted of four active electrodes, one reference electrode and one ground electrode as
illustrated in Figure 1. A motion sensor was also attached to the abdomen. We used
Medtronic Polygram NET EGG system (Medtronic A/S, Denmark) for the simultaneous
recording of four EGG signals. Our EGG system was configured to accept an electrode
impedance of less than 11 kΩ after skin preparation. The EGG signal was sampled at
~105 Hz, and this was downsampled to 1 Hz as part of the acquisition process (7).
EGG analysis
All EGG tracings were first examined manually by two of the authors (JW, GL). Prior
the analysis motion artifact in the EGG signal, indicated by the motion sensor, were iden-
Effects of Fentanyl on EGG 3
tified and removed manually. For each patient, the EGG channel with the most typical
slow-wave pattern during baseline recording (before fentanyl) was selected for further
analysis.
An overall spectrum analysis was performed on each of the two main 30 minute segments (before and after fentanyl respectively) of the selected channel using the entire
time-domain EGG signal (7). Sequential sets of measurement data for 256s with an overlap of 196s were analyzed using fast Fourier transforms and a Hamming window for the
calculation of running power spectra. When the entire signal was processed, the power
spectra for each segment were combined to arrive at the overall dominant frequency (DF)
and power of the dominant frequency (DP).
Age (yr)
45 (28-67)
Height (cm)
169 (155-180)
Weight (kg)
77 (54-124)
Body Mass Index
27 (18-39)
Females
16
Males
4
Smokers
3
ASA I
16
ASA II
4
Values are given as means with ranges or numbers.
Figure 1
Electrogastrography electrode placement:
-Electrode 3 was placed halfway between the xyphoid process and the umbilicus.
-Electrode 4 was placed 4 cm to the right of electrode 3.
-Electrode 2 and 1 were placed 45 degree to the
upper left of electrode 3, with an interval of 4 to 6
cm.
-The ground electrode was placed on the left costal
margin horizontal to electrode 4.
-The reference electrode (electrode 0) was placed
at the cross point of the horizontal line containing
electrode 1 and the vertical line containing electrode 3.
STUDY IV
Table 1
Patient characteristics
4 Jakob Wallden
The EGG segments and the spectral analysis after fentanyl were further classified either
as 1) Unaffected EGG (no change in DF after fentanyl), 2) Bradygastric EGG (decrease in
DF >=0.3 after fentanyl) or 3) Flatline-EGG (total visual disappearance of a previously
clear sinusoidal 3 cpm EGG-curve after fentanyl) (see example in figure 3) without any
quantifiable DF. When DF was not quantifiable, DF was set to 0.
Data from the baseline EGG were compared to data from a previous multicenter study in
normal subjects (7) to test if our study group was similar to a normal population.
Predicted fentanyl concentrations in blood was calculated using Shibutani’s modification
of Shafer’s formula (8, 9).
Genetic analyses
Due to the large interindividual variation in the EGG pattern after fentanyl, we decided
to investigate if this variation could be explained by genetic variability, polymorphisms,
in the μ-opioid receptor gene. We decided to analyze polymorphisms with a relative high
frequency and after reviewing the literature, we focused on the μ-opioid receptor gene
polymorphisms A118G and G691C (10). As ethnicity has impact on genetic expressions,
we reviewed patient data and found that all of the subjects were Caucasians.
DNA collection and purification. Venous blood (10 ml) was collected from the subjects
in EDTA tubes and the samples were stored frozen at –70°C. Genomic DNA was purified from peripheral leukocytes in 1 ml of EDTA blood on a MagNA Pure LC DNA extractor, using the MagNA Pure LC Total Nucleic Acid Isolation Kit – Large Volume
(Roche Diagnostics Corporation, Indianapolis, USA).
Genotyping. Genotyping was performed at CyberGene AB, Huddinge, Sweden. The
A118G SNP in Exon 1 and the IVS2 G691C SNP in Intron 2 were genotyped using polymerase chain reaction amplification and sequencing. Oligonucleotide primers (forward:
5'-GCGCTTGGAACCCGAAAAGTC; reverse: 5'-CATTGAGCCTTGGGAGTT) and
(forward: 5'-CTAGCTCATGTTGAGAGGTTC; reverse:
5'-CCAGTACCAGGTTGGATGAG) were used for amplifying gene fragments containing Exon 1 and Intron 2, respectively. PCR conditions comprised an initial denaturing
step at 95°C for 1 min followed by 30 cycles at 94°C for 1 min, annealing at 47.2-53.4°C
(depending on primer) for 1 min and extension 68°C for 3 min, and a final extension at
68°C for 3 min. The amplified fragments were sequenced using the same primers with
the addition of Rev 1-2 5'-TTAAGCCGCTGAACCCTCCG and the BigDye Terminator
v1.1 Cycle Sequence Kit (Applied Biosystems, Foster City, CA, USA). PCR amplification
and sequence reactions were done on ABI GeneAmp 2400 and 9700 (Applied Biosystems). Sequence analysis was first done on MegaBACE 1000 (Amersham Biosciences,
CA, USA) and then confirmed with ABI 377XL (Applied Biosystems).
Postoperative data
Charts and notes from the recovery unit were reviewed and we collected data regarding
analgesic and antiemetic requirements. The decision to include these data was done after
the initial study was terminated.
Statistics
In order to detect a mean intraindividual difference of 1 cpm in the dominant frequency
(DF) with 1 cpm as the expected standard deviation of the difference, a sample size of 12
was calculated (alpha=0.05, beta = 0.2). To further increase power and compensate for
possible exclusions sample size was set to 20. The results are presented as medians with
interquartile ranges. Wilcoxon's signed rank test and the 95% confidence interval of the
difference between the medians were used for analysis of the primary EGG outcome
Effects of Fentanyl on EGG 5
variables. The unpaired t-test was used for the comparisons of baseline EGG data to the
historical controls and for the comparisons of predicted fentanyl concentrations and
body composition between the outcome groups. Analysis of change over time for the vital variables (blood pressure, heart rate, oxygen saturation) was performed using a general linear model of variance for repeated measures. The Chi-squared test was used for
the analysis of associations between the EGG outcome and the genetic variations. The
significance level was set to 5% in all statistical tests.
Results
All patients (n=20) tolerated the administration of fentanyl well and there were no adverse events. One patient was excluded from the EGG analysis due to major artifacts in
the EGG recording (both before and after fentanyl). We interpreted the artifacts as electromagnetical interference in the ambience.
Blood pressure, heart rate and oxygen saturation were normal during the whole study
period with small statistically significant decreases in systolic and diastolic blood pressure
after administration of fentanyl (data not shown).
After the administration of intravenous fentanyl, there was a significant reduction in
both dominant frequency (DF) and dominant power (DP) of the EGG spectra, see Table
3. Individual changes in DF and DP are presented in Figure 2.
There was large variation between patients in the response to intravenous fentanyl. EGG
recordings were unaffected in 8 patients, 5 patients developed a slower DF (bradygastria)
and in 6 patients the slow-wave tracings disappeared totally (flatline-EGG). For an illustration of the effect, see Figure 3.
Among patients with a flatline-EGG (n=6), the median (range) time from the administration of intravenous fentanyl to the observed disappearance of the slow waves was 5 (1-9)
minutes. In 5 of these patients, there was a reapperance of the 3 cpm slow-wave EGG
pattern 30 (29-35) minutes after the administration of fentanyl.
We found no difference between the outcome groups in predicted fentanyl concentrations
derived from a pharmacokinetic model (unaffected vs affected group (ng·mL-1): 10 min:
0.45 (0.061) vs 0.43 (0.065) (p=0.6); 20 min: 0.34 (0.046) vs 0.32 (0.049) (p=0.6); 30
min: 0.26 (0.035) vs 0.25 (0.037) (p=0.6)). Further, there were no difference between the
groups in body weight (unaffected vs affected group (kg): 73.8 (13.5) vs 79 (19.3)
(p=0.29)) or BMI (unaffected vs affected group (kg·m-2): 25.3 (4.8) vs 27.9 (5.1)
(p=0.50)).
Blood samples for genetic analysis were obtained from 18 subjects in the study. We
found no correlation between the gastric response to fentanyl and the polymorphisms
A118G or G691C (Table 4).
We found an association between requirement for postoperative antiemetic and the gastric response to fentanyl (Table 5).
STUDY IV
Compared to historical controls (7), there were no differences in the baseline EGG variables, see Table 2.
6 Jakob Wallden
Table 2
EGG parameters from the baseline recordings compared to a multicenter study in normal subjects (7).
Baseline
recording
(n=19)
Historical
control
(n=60).
Dominant Frequency (cpm)
2.92 ± 0.17
2.89 ± 0.26
0.03 (-0.1 to 0.16)
p=0.64
Dominant Power (dB)
42.1 ± 3.8
42.4 ± 6.3
-0.30 (-3.5 to 2.7)
p=0.85
Difference between
means with 95% C.I.
P-value
Values are means (SD). Paired students t-test.
Table 3
Changes in EGG variables before (-30 to 0 min) and after (0 to 30 min) the administration of 1μg•kg-1 intravenous fentanyl.
Dominant Frequency (cpm)
Dominant Power (dB)
Baseline
recording
After fentanyl
1μg•kg-1 I.V.
Difference between the
medians with 95% C.I.
P-value
2.9 ( 2.8 - 3.0 )
2.5 ( 0 – 2.9 )
0.4 (0-2.9)
p=0.002
41 ( 39 – 45 )
38 ( 35 – 40 )
3 (0.6-3.5)
p=0.002
Values are medians with interquartile ranges. Wilcoxons signed rank test. C.I. = Confidence Interval.
Figure 2
A: Individual values for the dominant frequency (DF) in the electrogastrographic (EGG)
spectra before and after intravenous fentanyl 1μg•kg-1. If there was no dominant frequency, DF was set to zero. B: Individual values for the dominant power (DP) in the
EGG spectra before and after intravenous fentanyl 1μg·kg-1. (* = Wilcoxons signed rank
test, p<0.05)
A
B
55
*
*
50
3
Dominant Power (dB)
Dominant Frequency (cpm)
3,5
2,5
2
1,5
1
45
40
35
30
0,5
0
25
Baseline
After Fentanyl 1μg/kg
Baseline
After Fentanyl 1μg/kg
Effects of Fentanyl on EGG 7
Figure 3
Electrogastrographic (EGG) tracing in a patient where the gastric slow waves disappeared after intravenous fentanyl 1μg•kg-1 with a close-up of the period were fentanyl
was administered.
80
Fentanyl 1μg/kg I.V.
60
40
μV
20
0
-20
STUDY IV
-40
Slow-waves 3 cpm
-60
-80
25:00
Disappearance of Slow-waves
30:00
35:00
40:00
Time (min)
Table 4
EGG classification and genotype groups (n=18).
118 A>G genotype
Unaffected EGG
(n=6)
Bradygastria (n=5)
Flatline (n=6)
Excluded from the
EGG-analysis
(n=1)
Wild Type
(AA)
n=15
83%
Heterozygous
(AG)
n=2
11%
5
1
4
5
1
IVS2 + 691 G>C genotype
Variant
(GG)
n=1
6%
Heterozygous
(GC)
(n=14)
78%
Variant
(CC)
(n=4)
22%
6
1
1
Wild Type
(GG)
(n=0)
0%
2
3
5
1
1
No association found between EGG-classification and prescence of polymorphism A118G [Wild
Type vs (Heterozygous OR Variant)] ; Chi-square test, P=0.99. No association found between
EGG-classification and prescence of polymorphism in G691C [Wild Type vs (Heterozygous OR
Variant)]; Chi-square test was not possible to perform as there were no cases in “Wild type”. Two
subjects, both classified as “Unaffected EGG”, did not participate in the genotype analysis.
8 Jakob Wallden
Table 5
PONV, Postopertive antiemetic and the correlation to the EGG outcome after fentanyl.
EGG after fentanyl
PONV at the recovery unit
No (n=9)
Yes (n=10)
Unaffected
(n=8)
Bradygastric or flatline
(n=11)
6
2
3
8
Antiemetic administration at recovery unit No (n=10)
7
Yes (n=9)
1
Fishers exact test (2-sided): PONV vs EGG-classification; P=0.070;
Antiemetics vs EGG-classification; P=0.020*
PONV= Postopertive Nausea and Vomiting; EGG = Electrogastrography.
3
8
Discussion
In this study, we found that intravenous administration of the opioid fentanyl 1μg·kg-1
inhibited gastric myoelectric activity with a decrease in both the dominant frequency and
the dominant power of the electrogastrographic spectra. The responses were highly individual with responders and non-responders. We tested if this variability could be explained by the single nucleotide polymorphisms A118G and G691C of the μ-opioid receptor gene, but we found no association. We found that the EGG response to fentanyl
predicted the need for postoperative antiemetic treatment.
The results from the genetic analysis must be interpretated with care. The study was designed and powered for the EGG variables and to investigate associations to genetic factors, a larger sample size is needed (11). The result of no association must be regarded as
preliminary observations and has to be confirmed in properly designed studies. The observation might be an indication that the SNP A118G and G691C are not major factors
for the observed variability, but we can neither confirm nor rule out that the presence of
SNPs in the MOR alter opioid effects on motility.
In this study, we hypothesized that opioids would impair gastric electrical activity. Coordinated peristaltic contractions of gastric smooth muscles, initiated by electrical depolarization, are the bases for gastric emptying of solids. The stomach displays a rhythmic depolarization that is characterized by slow waves with a frequency of about 3 cycles per
minute (cpm). The electrical activity originates in the corpus region of the stomach and
propagates towards the pylorus. Specialized pacemaker cells, the interstitial cells of Cajal
(ICC), are localized as a network around the myenteric plexus of the stomach and are
responsible for the generation and conduction of the slow waves (1). We used cutaneous
electrogastrography, which revealed 3 cpm slow wave activity 30 minutes before the intervention with fentanyl in all subjects. Data from the baseline period did not differ from
a recent multicenter electrogastrography study in normal subjects (7) and we consider the
baseline period in our subjects as normal electrical activity. The electrical activity was
disrupted after the administration of fentanyl and we observed both bradygastria and
disappearance of the slow wave activity. However, in about half of the subjects, EGG
was unaffected.
Effects of Fentanyl on EGG 9
Opioids are known inhibitors of gastrointestinal motility and there are numerous studies
in the literature regarding the effect of opioids on gastroduodenal function. Gastric emptying is delayed (12-14), antroduodenal motility increased (15), pyloric spasm induced
(16) and there are reports of both relaxation (17) and contraction (18) of the gastric fundus. The understanding how these effects are mediated is far from clear (3) and the
opioids might act on opioid receptors at different levels, both within the stomach (19,
20) and in the central nervous system (4, 21, 22).
There are only a few reports in the literature about the effects of opioids on gastric electrical activity. Invasive recordings of gastric myoelectric activity have shown that morphine transiently distort the slow-wave activity and initiate migrating myoelectric complexes (23, 24). Cutaneous recordings with EGG showed that morphine induced tachygastria (4). The shift in the basal EGG frequency towards bradygastria that we observed
in some of the subjects indicates that opioids inhibit the ICC-network. Bradygastria is
believed to be a decrease in the frequency of the normal pacemaker cells while other dysrhythmias like tachygastria have ectopic origins in the stomach (25).
We tried to explain the variability seen with responders and non-responders. One hypothesis may be a difference between the individuals in the plasma concentration of fentanyl. Unfortunately we did not collect blood samples during the EGG study. By using a
pharmacokinetic model (8, 9), we calculated the predicted plasma concentrations of fentanyl for each subject. We were not able to find any differences in the predicted concentrations between the outcome groups. However, there is a notable wide variability in the
model that may conceal relevant differences. Further, as body composition affects the
pharmacokinetic profiles of a drug, we tested for differences in body weight and body
mass index between the groups, but found no differences. Also, we cannot rule out that
differences between the subjects in pharmacokinetic factors, i.e. distribution volume, metabolism or clearance, alter the effect-site concentration of fentanyl and thus the effect on
gastric motility.
We tested the hypothesis if pharmacogenetic differences in the μ-opioid receptor were
responsible for the variable outcome. Recently investigators have reported that occurrence of single nucleotide polymorphisms (SNP) in the μ-opioid receptor gene are associated with an altered responses to an opioid (26, 27). There are data supporting that genetic differences are able to alter gastrointestinal response to opioids. The variable analgesic effect of codein is related to genetic variations, leading to different expression of the
enzyme (CYP2D6) that metabolizes codein to morphine. Among extensive metabolizers,
oro-cecal transit time is prolonged compared to poor metabolizers and correlates to
higher morphine concentrations in plasma (28). To our knowledge there are no studies
on the relation of SNP in the μ-opioid receptor to the outcome of opioids on gastrointestinal motility. After reviewing the literature, we decided to analyze two SNPs in the μopioid receptor gene with a high reported frequency (10). The SNP A118G is also the
polymorphism that is believed to have clinical significance.
STUDY IV
There was no randomization or blinding in this study. We compared the EGG before and
after an intervention and the subjects acted as their own control. We were aware that
there are risks for bias and other errors with this study design. Other factors like timeeffects, emotions or other stimuli may have contributed to the outcome. However, the
onset-time of the effect among the responders was consistent with the pharmacological
properties of fentanyl and we suggest that fentanyl is responsible for the EGG-changes.
To further investigate and verify our results, a double-blinded randomized control trial is
needed.
10 Jakob Wallden
We found no association between the presence of SNPs and EGG changes after the intervention with fentanyl. Two subjects, both classified as “unaffected EGG”, refused to participate in the genotyping study. By using simulated genotype data with all hypothetical
outcomes for the two subjects, we found that there were no changes in the results if they
have been participating. The frequencies of A118G in our material were similar to the
reported frequencies in the literature. All investigated subjects were either heterozygote
or homozygote to G691C and there were no normal “wild types” of G691C. This SNP is
reported in a high frequency, but the distribution in our study is not consistent with the
expected distributions from the Hardy-Weinberg equilibrium. Our study group may not
represent a normal population, as the majority of the subjects are woman and almost all
of them had a gallbladder disease and this may introduce a selection bias. However, with
the small sample size it is difficult to draw any conclusions regarding the distribution.
Our results indicate that pharmacogenetic differences in the opioid receptor gene may
not be a major factor for the variable gastric outcome by an opioid. However, due to the
small sample size, we want to emphasis that our results are preliminary observations and
the interpretation of the results have to be cautious.
Retrospectively we reviewed the anesthetic and postoperative records regarding intraoperative and postoperative opioid requirements, pain assessments, postoperative nausea or
vomiting (PONV) and antiemetic treatments. We correlated the data to the EGG and
pharmacogenetic results. We found a higher requirement of antiemetic treatments among
the subjects classified as responders to fentanyl. There was also a tendency towards a
higher incidence of PONV in this group. As we investigated many factors, these results
may have resulted by chance, so other explanations are possible. Those subjects who responded with gastric effects of fentanyl may somehow have a higher sensitivity to
opioids, which may also results in higher emetic response to opioids. There is also a possibility that the changes in gastric motility per se induce emesis. As there are great limitations in the retrospective review, we want to emphasis that our results are only an indication for a possible association between PONV and opioid induced changes in gastric motility.
The pattern of responders and non-responders on the EGG after fentanyl raises the question if opioid-side effects follow a present or non-present pattern. In daily clinical routine, we also observe that some patients experience PONV on opioid treatment, while
others are totally unaffected. If there is such “switch”, the “trigger” must be identified.
The issue is probably complex and might i.e. include pharmacokinetic, pharmacodynamic and pharmacogenetic factors.
In summary, the opioid fentanyl induced changes in the gastric slow waves with bradygastria and disappearance of the slow waves. Pharmacogenetic differences in the μ-opioid
receptor gene could not explain the variability with responders and non-responders, but
as our sample size was small the findings must be regarded as preliminary observations.
Further studies are needed to survey the mechanism of gastric effects of opioids and the
source of the great variability.
References
1.
2.
Sanders KM, Ördög T, Koh SD, Ward SM. Properties of Electrical Rhytmicity in the Stomach. In: Koch
KL, Stern RM, editors. Handbook of Electrogastrography. New York: Oxford University Press; 2004. p.
13-36.
Chang FY. Electrogastrography: Basic knowledge, recording, processing and its clinical applications. J
Gastroenterol Hepatol 2005:20(4):502-16.
Effects of Fentanyl on EGG 11
3.
4.
5.
6.
7.
8.
9.
10.
11.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
STUDY IV
12.
Hicks GA, DeHaven-Hudkins DL, Camilleri M. Opiates in the control of gastrointestinal tract function:
current knowledge and new avenues for research. Neurogastroenterol Motil 2004:16 Suppl 2:67-70.
Thorn SE, Wattwil M, Lindberg G, Sawe J. Systemic and central effects of morphine on gastroduodenal
motility. Acta Anaesthesiol Scand 1996:40(2):177-86.
Coulbault L, Beaussier M, Verstuyft C, Weickmans H, Dubert L, Tregouet D, Descot C, Parc Y, Lienhart A, Jaillon P, Becquemont L. Environmental and genetic factors associated with morphine response
in the postoperative period. Clin Pharmacol Ther 2006:79(4):316-324.
Klepstad P, Rakvag TT, Kaasa S, Holthe M, Dale O, Borchgrevink PC, Baar C, Vikan T, Krokan HE,
Skorpen F. The 118 A > G polymorphism in the human micro-opioid receptor gene may increase morphine requirements in patients with pain caused by malignant disease. Acta Anaesthesiol Scand
2004:48(10):1232-9.
Simonian HP, Panganamamula K, Parkman HP, Xu X, Chen JZ, Lindberg G, Xu H, Shao C, Ke MY,
Lykke M, Hansen P, Barner B, Buhl H. Multichannel electrogastrography (EGG) in normal subjects: a
multicenter study. Dig Dis Sci 2004:49(4):594-601.
Shibutani K, Inchiosa MA, Jr., Sawada K, Bairamian M. Accuracy of pharmacokinetic models for predicting plasma fentanyl concentrations in lean and obese surgical patients: derivation of dosing weight
("pharmacokinetic mass"). Anesthesiology 2004:101(3):603-13.
Shafer SL, Varvel JR, Aziz N, Scott JC. Pharmacokinetics of fentanyl administered by computercontrolled infusion pump. Anesthesiology 1990:73(6):1091-102.
Ikeda K, Ide S, Han W, Hayashida M, Uhl GR, Sora I. How individual sensitivity to opiates can be predicted by gene analyses. Trends Pharmacol Sci 2005:26(6):311-7.
Belfer I, Wu T, Kingman A, Krishnaraju RK, Goldman D, Max MB. Candidate gene studies of human
pain mechanisms: methods for optimizing choice of polymorphisms and sample size. Anesthesiology
2004:100(6):1562-72.
Wallden J, Thorn SE, Wattwil M. The delay of gastric emptying induced by remifentanil is not influenced by posture. Anesth Analg 2004:99(2):429-34.
Nimmo WS, Heading RC, Wilson J, Tothill P, Prescott LF. Inhibition of gastric emptying and drug absorption by narcotic analgesics. Br J Clin Pharmacol 1975:2(6):509-13.
Yuan CS, Foss JF, O'Connor M, Roizen MF, Moss J. Effects of low-dose morphine on gastric emptying
in healthy volunteers. J Clin Pharmacol 1998:38(11):1017-20.
Lewis TD. Morphine and gastroduodenal motility. Dig Dis Sci 1999:44(11):2178-86.
Edin R, Lundberg J, Terenius L, Dahlstrom A, Hokfelt T, Kewenter J, Ahlman H. Evidence for vagal
enkephalinergic neural control of the feline pylorus and stomach. Gastroenterology 1980:78(3):492-7.
Hammas B, Thorn SE, Wattwil M. Propofol and gastric effects of morphine. Acta Anaesthesiol Scand
2001:45(8):1023-7.
Penagini R, Allocca M, Cantu P, Mangano M, Savojardo D, Carmagnola S, Bianchi PA. Relationship
between motor function of the proximal stomach and transient lower oesophageal sphincter relaxation
after morphine. Gut 2004:53(9):1227-31.
Bitar KN, Makhlouf GM. Specific opiate receptors on isolated mammalian gastric smooth muscle cells.
Nature 1982:297(5861):72-4.
De Schepper HU, Cremonini F, Park MI, Camilleri M. Opioids and the gut: pharmacology and current
clinical experience. Neurogastroenterol Motil 2004:16(4):383-94.
Aicher SA, Mitchell JL, Mendelowitz D. Distribution of mu-opioid receptors in rat visceral premotor
neurons. Neuroscience 2002:115(3):851-60.
Browning KN, Kalyuzhny AE, Travagli RA. Opioid peptides inhibit excitatory but not inhibitory synaptic transmission in the rat dorsal motor nucleus of the vagus. J Neurosci 2002:22(8):2998-3004.
Telford GL, Hoshmonai M, Moses AJ, Szurszewski JH. Morphine initiates migrating myoelectric complexes by acting on peripheral opioid receptors. Am J Physiol 1985:249(5 Pt 1):G557-62.
Thorn SE, Wickbom G, Philipson L, Leissner P, Wattwil M. Myoelectric activity in the stomach and
duodenum after epidural administration of morphine or bupivacaine. Acta Anaesthesiol Scand
1996:40(7):773-8.
Qian LW, Pasricha PJ, Chen JD. Origins and patterns of spontaneous and drug-induced canine gastric
myoelectrical dysrhythmia. Dig Dis Sci 2003:48(3):508-15.
Klepstad P, Dale O, Skorpen F, Borchgrevink PC, Kaasa S. Genetic variability and clinical efficacy of
morphine. Acta Anaesthesiol Scand 2005:49(7):902-8.
Chou WY, Yang LC, Lu HF, Ko JY, Wang CH, Lin SH, Lee TH, Concejero A, Hsu CJ. Association of
mu-opioid receptor gene polymorphism (A118G) with variations in morphine consumption for analgesia
after total knee arthroplasty. Acta Anaesthesiol Scand 2006:50(7):787-92.
Mikus G, Trausch B, Rodewald C, Hofmann U, Richter K, Gramatte T, Eichelbaum M. Effect of codeine on gastrointestinal motility in relation to CYP2D6 phenotype. Clin Pharmacol Ther
1997:61(4):459-66.
Publikationer i serien Örebro Studies in Medicine
1.
Bergemalm, Per-Olof (2004). Audiologic and cognitive long-term
sequelae from closed head injury.
2.
Jansson, Kjell (2004). Intraperitoneal Microdialysis. Technique and
Results.
3.
Windahl, Torgny (2004). Clinical aspects of laser treatment of
lichen sclerosus and squamous cell carcinoma of the penis.
4.
Carlsson, Per-Inge (2004). Hearing impairment and deafness. Genetic
and environmental factors – interactions – consequences. A clinical
audiological approach.
5.
Wågsäter, Dick (2005). CXCL16 and CD137 in Atherosclerosis.
6.
Jatta, Ken (2006). Inflammation in Atherosclerosis.
7.
Dreifaldt, Ann Charlotte (2006). Epidemiological Aspects on Malignant Diseases in Childhood.
8.
Jurstrand, Margaretha (2006). Detection of Chlamydia trachomatis
and Mycoplasma genitalium by genetic and serological methods.
9.
Norén, Torbjörn (2006). Clostridium difficile, epidemiology and
antibiotic resistance.
10. Anderzén Carlsson, Agneta (2007). Children with Cancer – Focusing
on their Fear and on how their Fear is Handled.
11. Ocaya, Pauline (2007). Retinoid metabolism and signalling in vascular smooth muscle cells.
12. Nilsson, Andreas (2008). Physical activity assessed by accelerometry
in children.
13. Eliasson, Henrik (2008). Tularemia – epidemiological, clinical and
diagnostic aspects.
14. Walldén, Jakob (2008). The influence of opioids on gastric function:
experimental and clinical studies.