BIOLOGY OF REPRODUCTION 80, 674–684 (2009)
Published online before print 17 December 2008.
DOI 10.1095/biolreprod.108.074203
Identification of Differentially Expressed Genes Between Cloned and ZygoteDeveloping Zebrafish (Danio rerio) Embryos at the Dome Stage Using Suppression
Subtractive Hybridization1
Daji Luo,4,5 Wei Hu,3,5 Shangping Chen,5 Yi Xiao,4 Yonghua Sun,5 and Zuoyan Zhu2,4,5
College of Life Sciences,4 Wuhan University, Wuhan, China
State Key Laboratory of Freshwater Ecology and Biotechnology,5 Institute of Hydrobiology,
Chinese Academy of Sciences, Wuhan, China
major problem is the reprogramming of a somatic nucleus after
fusion with an oocyte [8], and the reprogramming mechanism
is poorly understood. Therefore, a better understanding of the
molecular mechanisms underlying the reprogramming process
is a central scientific issue and will enhance the efficiency of
cloning and the ability of cloned animals to survive
development.
The zebrafish is an important model for research in
vertebrate developmental biology and genetics because of its
ease of use in forward genetics and embryonic manipulations.
The transparent embryos are well suited to manipulation such
as cell labeling, microinjection, and transplantation. Because
most zebrafish genes have homologs in humans and other
vertebrates, the expression patterns of zebrafish genes can be
very instructive in mammals. Nuclear transfer in fish has been
studied since the 1960s [4, 9–11]. Recently, Sun et al. [12]
transplanted nuclei from a transgenic common carp into
enucleated goldfish eggs. Despite success in fish interspecies
and crossgenus cloning, the process remains as inefficient in
fish as it is in mammals, with most cloned embryos failing at
the midblastula to early gastrula stages of development [12].
Zebrafish SCNT research began in the late 1990s; Lee et al. [3]
transplanted long-term cultured cells into enucleated eggs and
first obtained feeding zebrafish. Our laboratory established
zebrafish nuclear transfer technology in 2002 [13]. The
research herein—a comparative analysis of differentially
expressed genes between SCNT and zygote-developing (ZD)
embryos at the dome stage—is the first reported in vivo study
(to our knowledge) of the gene expression pattern of the
reprogramming process in zebrafish.
Gene expression studies in SCNT embryos have been
conducted primarily with cattle and mice. Large-scale analysis
of gene expression in preimplantation embryos and in cloned
animals was reported first in mouse models [14]. To our
knowledge, no investigation has included systematic analysis
of the gene expression pattern of the reprogramming process
using SCNT embryos at the stage when abortion is most
prominent in vivo. Therefore, systematic analysis of differentially expressed genes in SCNT embryos at the dome stage may
yield new insights into the process of reprogramming.
Suppression subtractive hybridization (SSH) [15, 16] is an
efficient and widely used PCR-based method to obtain
subtracted libraries and identify differentially expressed genes
under two biological conditions. Modified SSH methods had
been widely used in functional genomic studies [17–19].
Suppression subtractive hybridization includes a normalization
step, which makes this approach preferable for cloning lowabundance transcripts [20]. Therefore, SSH is particularly well
suited to identifying differentially expressed genes at the early
developmental stage when only a tiny amount of RNA is
available from SCNT embryos.
ABSTRACT
Comparative analyses of differentially expressed genes between somatic cell nuclear transfer (SCNT) embryos and zygotedeveloping (ZD) embryos are important for understanding the
molecular mechanism underlying the reprogramming processes.
Herein, we used the suppression subtractive hybridization
approach and from more than 2900 clones identified 96
differentially expressed genes between the SCNT and ZD
embryos at the dome stage in zebrafish. We report the first
database of differentially expressed genes in zebrafish SCNT
embryos. Collectively, our findings demonstrate that zebrafish
SCNT embryos undergo significant reprogramming processes
during the dome stage. However, most differentially expressed
genes are down-regulated in SCNT embryos, indicating failure of
reprogramming. Based on Ensembl description and Gene
Ontology Consortium annotation, the problems of reprogramming at the dome stage may occur during nuclear remodeling,
translation initiation, and regulation of the cell cycle. The
importance of regulation from recipient oocytes in cloning
should not be underestimated in zebrafish.
embryo, differentially expressed genes, reprogramming, somatic
cell nuclear transfer, suppression subtractive hybridization
INTRODUCTION
Nuclear transfer has been studied for more than 50 years
since it was first demonstrated in frogs [1], but the use of
differentiated somatic cells has not yet produced individuals
that can survive beyond the tadpole stage. Fully differentiated
cells can undergo reprogramming after fusion with a matured
oocyte through a process commonly known as somatic cell
nuclear transfer (SCNT). The competence of blastocysts
produced by SCNT was first demonstrated by the production
of living animals [2]; since then, several successful animal
cloning experiments using SCNT have been documented [3–6].
Despite success in the cloning of many species of vertebrates,
animal cloning remains an inefficient process, with a
preponderance of reconstructed mammalian embryos failing
at the early to midgestational stages of development [7]. The
1
Supported by the Development Plan of the State Key Fundamental
Research of China (Grant No. 2007CB109206) and National Natural
Science Foundation (Grant No. 30430540).
2
Correspondence: FAX: 86 27 68780628; e-mail: [email protected]
3
Correspondence: FAX: 86 27 68780051; e-mail: [email protected]
Received: 16 October 2008.
First decision: 28 October 2008.
Accepted: 17 November 2008.
Ó 2009 by the Society for the Study of Reproduction, Inc.
eISSN: 1259-7268 http://www.biolreprod.org
ISSN: 0006-3363
674
REPROGRAMMING MECHANISM IN CLONED ZEBRAFISH EMBRYO
Using the SSH approach, we performed a large-scale search
for differentially expressed genes between SCNT embryos and
ZD embryos at the dome stage. We then validated the
differentially expressed genes using dot blot assays of more
than 2900 clones from the SSH libraries, followed by DNA
sequencing and clustering analyses. Based on Ensembl
description [21] and Gene Ontology Consortium (GO)
annotation [22, 23], we achieved an all-around analysis and
identified some of the key genes responsible for and/or
indicative of successful reprogramming. The available data
suggest that most differentially expressed genes are downregulated in SCNT embryos at the dome stage, indicating
failure of reprogramming. Reprogramming problems at the
dome stage may occur during nuclear remodeling, translation
initiation, and regulation of the cell cycle. In a crosscomparison with the existing database for mice and cattle
[24, 25], we found that problems of reprogramming from
translation initiation-related genes are shared among these
SCNT animals. Furthermore, we found that mycb and klf4 were
differentially expressed in zebrafish SCNT embryos and that
the expression trends in vivo are similar to the successful
reprogramming of differentiated somatic cells into a pluripotent
state in vitro [26, 27]. These findings suggest that the balance
between mycb and klf4 expression may be important for the
reprogramming process in zebrafish SCNT embryos.
MATERIALS AND METHODS
Ethics Statement on the Use of Animals
The research animals are provided with the best possible care and treatment
and are under the care of a specialized technician. All procedures were
approved by the Institute of Hydrobiology, Chinese Academy of Sciences, and
were conducted in accord with the Guiding Principles for the Care and Use of
Laboratory Animals.
675
blastodisc. The blastodisc of the zebrafish requires approximately 12 min to
form at 258C and becomes a full-sized one-cell egg after 40 min. Therefore,
these eggs can act as recipients for up to 40 min following activation at 288C.
Somatic Cell Nuclear Transfer
To remove the egg pronuclei, we placed recipient eggs in an agar plate
filled with Hanks saline solution. The second polar body of the dechorionated
egg was visible under a 403 stereomicroscope. The egg nucleus underneath the
second polar body was removed by aspiration with a fine glass needle.
Enucleated eggs were maintained in a 1.5% agar (w/v; Sigma) plate filled with
Hanks saline solution for further manipulation.
All nuclear transfers were conducted using either a microinjection system
(model 5171/5246; Eppendorf, Hamburg, Germany) with a Nikon (Melville,
NY) TE300 microscope or a Narishige system (NT-188NE; Leeds Precision
Instruments, Minneapolis, MN) with an Axiovert 200 microscope (Carl Zeiss,
Thornburg, NY). Donor cells were ruptured by aspiration into the transfer
needle, which had an inner diameter smaller than the cell (approximately 12
lm). Next, they were transplanted into the cytoplasm of the enucleated eggs at
the animal pole. Each of the nuclear transplants was transferred into the agar
plate filled with Holtfreter solution. Nuclear transplants were cultured in
Holtfreter solution at 288C before collection. The embryos were collected at the
dome stage and were shield-stage staged by morphological features; SCNT
embryos were usually cultured 10 h after nuclear transfer.
Embryo Collection and tRNA Extraction
For SSH analysis, embryos were collected at the dome stage from SCNT
embryos and from ZD embryos. Total RNA was extracted from batches of
embryos (n ¼ 100) using the SV tRNA isolation system kit (Promega, Madison,
WI). We analyzed the integrity of the RNA by examining its electrophoretic
mobility on 1.5% agarose gels in 13 Tris-acetate-EDTA buffer. The UV
absorbance of the RNA was measured (using an Eppendorf biometer) at 260
nm (A260) and 280 nm (A280), and RNA purity was determined using the
A260:A280 ratio.
For real-time quantitative RT-PCR analysis, three independent groups of
new embryos (n ¼ 30) were collected at the dome stage from SCNT embryos
and from ZD embryos (SCNT1, ZD1, SCNT2, ZD2, SCNT3, and ZD3). Total
RNA was extracted from batches of embryos (n ¼ 30) using the SV tRNA
isolation system kit. Either RNA integrity or RNA purity criteria were met.
Zebrafish Strain and Maintenance
We used the AB/Tübingen zebrafish (Danio rerio) for these experiments.
Zebrafish were raised and maintained under standard laboratory conditions, and
embryos were staged by morphological features [28].
Media for Nuclear Transfer
Eggs were held in Hanks saline solution (0.137 M NaCl, 5.4 mM KCl,
0.025 mM Na2HPO4, 0.44 mM KH2PO4, 1.3 mM CaCl2, 1.0 mM MgSO4, 4.2
mM NaHCO3) supplemented with 1.5% bovine serum albumin (w/v; Sigma,
St. Louis, MO). This working medium was kept at 48C until nuclear transfer.
Before the nuclear transfer, streptomycin (100 IU/ml) and ampicillin (100 IU/
ml) were added to the working medium and mixed briefly.
Preparation of Donor Cells
On the day before nuclear transfer, primary cells were collected from
kidney tissues of adult male zebrafish. Briefly, kidney tissues were placed into
a 0.25% trypsin solution (w/v; Sigma) for 15 min at 20–258C, dissociated in
Holtfreter dissociation solution (Ca2 þ-free Holtfreter solution containing 0.15
mM edetic acid [EDTA]), collected by centrifugation, and washed several times
using Holtfreter solution (0.35% NaCl, 0.01% CaCl2, 0.005% KCl [w/v], 100
IU/ml of streptomycin, and 100 IU/ml of ampicillin). The dissociated cells were
maintained at 48C in JM199 medium until nuclear transfer. Normally, the
dissociated cells were used for nuclear transfer within 60 min.
Preparation of Recipient Eggs
For egg collection, zebrafish were artificially induced to spawn. The quality
of eggs has an important role in SCNT. High-quality eggs are slightly granular
and yellowish in color, whereas immature eggs are whitish or withered, and the
best eggs appear intact and smooth on the yolk surface. Unfertilized embryos
were placed into a trypsin solution of 0.25% (w/v; Sigma) for 3 min, and the
softened chorion was subsequently removed by microsurgery. Once activated,
the egg cytoplasm coalesces, moves toward the animal pole, and forms the
Construction of SSH cDNA Libraries
The tester to driver hybridization steps in the SSH procedure require 100 ng
of tester and driver cDNA; however, a preimplantation early developmentalstage embryo contains only a few picograms of mRNA. Furthermore, SCNT
embryos are difficult to achieve, which prohibits larger-scale acquisition of
mRNA. For this reason, we used the SMART PCR cDNA synthesis kit
(Clontech, Palo Alto, CA), starting with tRNA as the template. The optimum
number of PCR cycles using the Perkin-Elmer (Norwalk, CT) GeneAmp PCR
system 9600 was ysed as suggested in the SMART PCR cDNA synthesis kit
protocol.
Suppression subtractive hybridization libraries were generated using the
reagents and protocols included with the Clontech PCR-Select cDNA
subtraction kit. In one SSH library (referred to herein as ZB-CB), the RNA
from ZD embryos (referred to herein as ZB) was used as the tester, and the
RNA from SCNT embryos (referred to herein as CB) was used as the driver. In
another SSH library (referred to herein as CB-ZB), CB was used as the tester,
and ZB was used as the driver. The PCR analysis of the SSH products showed
that the level of the housekeeping gene gapdh decreased significantly in the
ZB-CB and CB-ZB cDNA libraries relative to unsubtracted cDNA (data not
shown), suggesting that the subtraction procedure was very effective. As the
final step, the subtracted DNAs were ligated into the pMD18-T vector (Takara,
Gennevilliers, France), and the plasmid was used to transform Escherichia coli
DH5a by electroporation (Pulse Controller; BioRad, Hercules, CA).
Preparation of Templates and Probes
We plated cDNA libraries onto solid Luria Bertani medium containing
ampicillin. Clones were randomly selected and amplified in a 25-ll PCR
system using nested PCR primer 1 and nested PCR primer 2R (Clontech). We
selected single-insert clones as templates for the dot blot assays.
After the second hybridization (performed following the Clontech PCRSelect cDNA subtraction kit protocol), we used cDNAs from two libraries as
templates to prepare the digoxigenin (DIG) probe. One microgram of cDNA
was denatured by heating in a boiling water bath for 10 min, followed by quick
676
LUO ET AL.
TABLE 1. Primers used to detect 16 chosen genes in real-time RT-PCR.
Detector
B20(napa)
B27(ddx4l)
B44(ccna1)
B56(abcf2)
B76(cdc20)
B88(arpc3)
B92 (klf4)
B94(mycb)
B101(psmd13)
B103(ccne)
B104(mtch2)
B112(rpp21)
CB7(tp53)
CB111(eif4a1a)
CB120(nat13)
CB123(bzw1)
actb
Primer name
Primer sequence (5 0 –3 0 )
napaþ
napa–
ddx41þ
ddx41–
cca1þ
cca1–
abcf2þ
abcf2–
cdc20þ
cdc20–
arpc3þ
arpc3
klf4þ
klf4–
mycbþ
mycb
psmd13þ
psmd13–
cceþ
cce–
mtch2þ
mtch2–
rpp21 þ
rpp21–
tp53þ
tp53–
eif4a1aþ
eif4a1a
nat13þ
nat13–
bzw1þ
bzw1–
bactinþ
bactin–
CAAATCCTCGCAGTCGT
TCGCAGCCCTTCCATAC
GTGCCGTATGTTCCTGTC
TTCTCCACCACTGTCCTTC
GAACCAACGCACCAGG
GAAGGCAGCAGGAATGT
AGCCTACCAATCACCTCG
ACCAGCATCATTCCACCC
GGTCATTCAGCAAGGGTG
GTGTCCGCCGAAGGTA
AAATCCGCCAGGAGACC
ATCCACATCCCGCACA
GTTGGGAAGGTTGTGG
ATCTGAGCGGGAGAAA
TGCGATGATGCGGACTA
TCAGCGTGCAAAGACG
GCAAGTATTACCGCATCAT
CTTCTGGCAAGTCTTTAGC
GCTGGGAAAGGTTCACTC
GCTTGGTGGTGGCGTA
GTTGGACTCCTAACCCTTCT
GCTGATGCTGGAAACTGA
GATTCGCAATGAAGTGAT
GGGAAGCCATAAAGAGTT
TGTGGCTGAAGTGGTC
TTTGCTCGCTGATTGC
GGTGGTTGAAGGCATTAG
GTGAGGTAGGTTACAGGAGC
GCGGGAAACTGCTCGTGT
CGTGCTTTTGGAGGTGGC
GTATCTGCCGCCTTCG
TCCATTAGCCTGTTGTCC
GATGATGAAATTGCCGCACTG
ACCAACCATGACACCCTGATGT
chilling on ice. Next, 4 ll of thoroughly mixed DIG-high prime were added to
the denatured DNA, followed by mixing and brief centrifugation. Following
overnight incubation at 378C, the reaction was stopped by adding 2 ll of 0.2 M
EDTA (all reagents were supplied by Roche Applied Science, Penzberg,
Germany). The efficiency of DIG-labeled DNA was determined using the direct
detection method (DIG-High Prime DNA Labeling and Detection Starter Kit I;
Roche Applied Science). When the expected labeling efficiency was achieved,
we used the labeled probe at the recommended concentration in the
hybridization reaction.
Dot Blot Assays of Differentially Expressed Genes in Tester
and Driver Materials
For dot blot assays, all reagents were supplied by Roche Applied Science.
The PCR products were spotted (1 ll per dot) onto the same position on each of
two positive nylon membranes (Millipore Corporation, Bedford, MA) and
denatured by 0.6 M NaOH in situ. Spotted membranes were presoaked for 2–5
min at room temperature in 23 saline-sodium citrate solution and were baked at
808C for 2 h. Dried filters were prehybridized with preheated DIG Easy Hyb
solution at 428C in the hybridization incubator (model 40; Robbins Scientific,
Sunnyvale, CA), followed by hybridization with the probe (about 25 ng/ml) at
428C overnight. After stringent washes, the immunological detection protocol
was conducted following the manufacturer’s instructions. For color detection
using nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate, the reaction
was stopped using Tris-EDTA buffer (pH, 8.0) when the desired spot or band
intensity was achieved.
Sequencing and Clustering Analysis
Each candidate DNA fragment was sequenced in a single pass using the
M13 þ primer site, and reverse sequencing was conducted when the forward
sequences failed or the fractions were larger than 800 bp using the M13
primer (Applied Invitrogen, Shanghai, China). Vector DNA sequences were
removed automatically using computer program routines. Sequence analysis
and clustering were performed as the data set.
Amplicon size (bp)
94
87
98
82
98
96
96
89
100
94
92
98
91
100
100
98
134
Validation of Dot Blot Assays by Real-Time Quantitative
RT-PCR Analysis
A set of 16 genes was chosen to validate the dot blot assays using real-time
quantitative RT-PCR analysis. Real-time quantitative RT-PCR was performed
using an Applied Biosystems (Foster City, CA) 7000 real-time PCR system.
Table 1 lists the primers used in this analysis. Complementary DNA samples
and a pair of primers were diluted in bidistilled H2O and plated in triplicate in
adjacent wells. b-Actin (actb) was amplified together with the target gene as an
endogenous control in each well with a VIC-labeled probe (Applied
Biosystems) to normalize expression levels among samples. Reactions were
performed using the following conditions: an initial incubation at 958C for 10
min, followed by 40 cycles at 958C for 10 sec and 608C for 1 min. Output data
generated by the instrument onboard software were transferred to a customdesigned Microsoft (Redmond, WA) Excel spreadsheet for analysis. The
differential mRNA expression of each candidate gene was calculated by the
comparative Ct method using the formula 2(Delta Delta C(T)) method [29].
Moreover, every reaction was performed in triplicate, and the means of three
independent experiments between SCNT embryos and ZD embryos were
evaluated using Student t-test (P , 0.01).
RESULTS
Development of SCNT Embryos Derived from Kidney Cells
Following the transfer of nuclei from differentiated cells to
enucleated eggs, whether in lower vertebrates or in mammals,
only a few of the nuclear transplants are able to develop into
adult animals. The SCNT experiments in fish are limited by the
inability to directly label the SCNT embryos. To address this
issue, we created a negative control (Table 2) by microinjecting
a small amount of Hanks saline solution, rather than the kidney
cell, into the enucleated egg; 4 h later, none of the Hanks saline
solution-injected embryos survived. Tables 2 and 3 summarize
that the embryos we collected at the dome stage following
677
REPROGRAMMING MECHANISM IN CLONED ZEBRAFISH EMBRYO
TABLE 2. The efficiency of the enucleated procedure.
Donor cells (buffer)a
No. of
enucleated
eggs
No. of
embryos
at 1 h
No. of
embryos
at 2 h
No. of
embryos
at 4 h
Control experiment 1
Control experiment 2
20
20
0
0
0
0
0
0
a
Zebrafish eggs were enucleated and used as the recipient cells.
injection with the kidney cell were a result of SCNT. When
kidney cells as donor cells were injected to the enucleated eggs,
the SCNT embryos were sampled at the dome stage and the
shield stage to identify some key factors underlying the
reprogramming processes, so no successful SCNT offspring
were produced. Although 72.1% (2640/3660) of the transplanted eggs cleaved, 16.8% (444/2640) of these transplants
developed to the dome stage, and 80.8% (359/444) of these
blastulae failed to undergo gastrulation (Table 3); thus, most of
the SCNT embryos we collected at the dome stage were a
failure of reprogramming. In the investigation of nuclear
transplants, there were differences in the speed of development
between zebrafish SCNT embryos and ZD embryos. The
development of SCNT embryos lagged behind that of ZD
embryos at the high stage. Significant differences were found at
the dome stage and shield stage (Luo et al., unpublished
results).
Using the SSH Approach to Identify Differentially
Expressed Genes in SCNT Embryos
To conduct the comparative transcriptomic study of genes
present at low levels in abnormally developed SCNT embryos,
we followed the approach shown in Figure 1. We used a PCRbased SSH approach to comparatively analyze the whole
genome of embryos at the dome stage and to enrich for
differentially expressed cDNA clones between SCNT embryos
and ZD embryos at the dome stage. The SSH was conducted in
a forward and reverse manner: Total RNA prepared from ZD
embryos and SCNT embryos (Fig. 2A) was used as the tester
and driver, respectively, to yield ZD subtracted amplicons, and
tRNA prepared from SCNT embryos and ZD embryos was
used as the tester and driver, respectively, to yield SCNT
subtracted amplicons. The optimum number of PCR cycles was
17 cycles for ZD embryos and 20 cycles for SCNT embryos.
We plated cDNA libraries onto Luria Bertani medium
containing ampicillin. More than 3000 clones were randomly
selected and amplified using nested PCR primer 1 and nested
PCR primer 2R (Fig. 2B). The PCR amplification showed that
97% of the clones contained the insert fragments and that 93%
of the clones contained the single-insert fragment. We selected
2900 single-insert clones as templates for the dot blot assays.
Figure 3 shows representative results obtained from dot blot
assays. Genes expressed at the dome stage of ZD embryos were
used as the standard, so that up- or down-regulated genes were
identified relative to the ZD embryos. Both up-regulated and
FIG. 1. Experimental flowchart. Total RNA was prepared from ZD
embryos and SCNT embryos at the dome stage for subjection to PCRbased SSH. The resulting subtracted cDNA libraries were labeled with
DIG for dot blot assays. The SSH was performed in both the forward (ZB as
tester) and reverse (CB as tester) manners to enrich up-regulated (ZB-CB
amplicon) and down-regulated (CB-ZB amplicon) transcriptomes, respectively, in the reprogramming process. The two subtracted amplicons were
selected as targets for dot blot assays. The results were further confirmed
by real-time quantitative RT-PCR analysis using three independent SCNT
embryos and ZD embryos. Differentially expressed genes were characterized using GO analyses and homologs with Bos taurus, Homo sapiens,
Mus musculus, Oryzias latipes, and Xenopus typicalis.
down-regulated genes were detected in zebrafish SCNT
embryos (Fig. 3). The differentially expressed genes in the
ZB-CB and CB-ZB libraries were identified with direct vision
based on a qualitative judgment. A more sensitive detection of
these differentially expressed genes was obtained using realtime quantitative RT-PCR analysis. We repeated 100 clones
randomly selected from 2900 clones using dot blot assays; no
significant differences were observed (data not shown).
Identification of Differentially Expressed Genes Between
SCNT Embryos and ZD Embryos at the Dome Stage
Using dot blot assays of 2900 random clones, we identified
242 gene fragments representing significant differences
between SCNT embryos and ZD embryos at the dome stage,
and we selected these fragments for sequencing. After
sequencing these clones and clustering them according to
sequence similarity (BLAST cutoff, 1e-50), we found 96
fragments that were differentially expressed. Of these 96
fragments, 25 were unknown zebrafish expressed sequence
tags, and the remaining 71 had high homology to defined or
predicted zebrafish genes. In dot blot assays, 17 fragments
were up-regulated in zebrafish SCNT embryos, and 79
fragments were down-regulated.
For each cluster, the longest representative clone was
chosen from results of BLAST against the National Institutes
of Health National Center for Biotechnology Information
RefSeq database for zebrafish. All hits with an E value less
than 1e-5 were displayed. When we analyzed these differentially expressed fragments in terms of gene ontology using
GeneInfoViz constructing [21], we found that these fragments
TABLE 3. Nuclear transplants generated using kidney cells.
Donor cells
(kidney cells)
No. of eggs
transplanted
No. of embryos
cleaved
No. of embryos
developed
to 256-cell stage
Experiment 1
Experiment 2
1600
2060
997
1643
787
1228
a
No. of embryos
developed to blastulae
at dome stage
(partial)a
No. of embryos
developed to gastrula
at shield stage
(partial)a
149 (30)
295 (49)
24 (0)
61 (0)
Partial: In several SCNT embryos, some of the animal pole cells did not participate in the development of SCNT embryos.
678
LUO ET AL.
ygenase activity, translation initiation factor activity, and
isomerase activity.
Validation of Dot Blot Assays Using Real-Time Quantitative
RT-PCR Analysis
FIG. 2. The quality of tRNA and the subtracted library. A) The integrity of
tRNA was detected by agarose gel electrophoresis: 1 shows tRNA of
fertilized control embryos, and 2 shows tRNA of SCNT embryos; 28s and
18s rRNA are marked with arrows. A260:A280 ¼ 1.97:1.94. B) The
subtracted library was screened by PCR. M is the DL2000 DNA ladder
marker; 1–23 are PCR results by nested PCR primers 1 and 2R. The PCR
fragments were 200-2000 bp, and the single-insert PCR fragments were
selected as templates for dot blot assays.
at the dome stage in zebrafish SCNT embryos were involved
mainly in physiological processes and regulation of biological
process (Fig. 4A, a). The differentially expressed genes were
concentrated in pathways, including regulation of DNAdependent transcription, the ubiquitin cycle, protein modification, protein folding, regulation of the cell cycle, chromosome
organization and biogenesis, cytokinesis, the cell cycle,
transport, and nucleosome assembly (Fig. 4B, a). The main
molecular function of these differentially expressed genes was
related to binding and transporter activity (Fig. 4A, b); the top
10 overrepresented GO molecular functions associated with
these differentially expressed genes in zebrafish SCNT
embryos were nucleic acid binding, protein domain-specific
binding, zinc ion binding, DNA binding, ligase activity,
ubiquitin-conjugating enzyme activity, ATP binding, monooxFIG. 3. Representative results of SSH/dot
blot assays. DNA was prepared from ZD
embryos and SCNT embryos as drivers of
SSH libraries, and DNA samples were
dotted on the same location in two membranes: A) Representative results using ZBDIG-labeled probes. B) Representative results using CB-DIG-labeled probes. Squares
indicate clones that are up-regulated in
SCNT embryos; circles, clones that are
down-regulated in SCNT embryos.
We selected 16 genes (Table 1) for real-time quantitative
RT-PCR analysis to validate the results from the dot blot
assays. We used the actb gene as the endogenous control, and
the analysis was performed using the comparative Ct method
with the formula 2(Delta Delta C(T)) method as the calibrator.
Table 1 gives the primers used for the real-time quantitative
RT-PCR. Using Statistica 6.0 (Statsoft, Krakow, Poland), three
independent experiments between SCNT embryos and ZD
embryos were evaluated by means of statistical methods of the
nonparametric correlation coefficients (Spearman r); the results
showed significant correlation among three independent
experiments (P , 0.01). Sixteen genes showed real-time
quantitative RT-PCR results that were consistent with those
from the dot blot assays (Fig. 5). These results provide strong
support for the differential gene expression data obtained using
dot blot assays, and significant differences in dot blot assays
show more than 3-fold change compared with the normal
expression level.
DISCUSSION
Gene Expression Profiles of SCNT Embryos
at the Dome Stage
In our study, we used the SSH approach to study the
differential transcript profiles in zebrafish SCNT embryos
relative to ZD embryos at the dome stage. The identification of
REPROGRAMMING MECHANISM IN CLONED ZEBRAFISH EMBRYO
679
FIG. 4. Gene ontology analysis of differentially expressed genes showing functional
categories overrepresented among differentially expressed genes in zebra fish SCNT
embryos. Gene ontology was detected for
biological processes and molecular functions using GeneInfoViz for constructing
and visualizing gene relation networks. A)
Distribution of differentially expressed
genes (biological process [a] and molecular
function [b]). B) Top 10 functional categories overrepresented among differentially
expressed genes (biological process [a] and
molecular function [b]).
differentially expressed genes may provide new insights into
the reprogramming process of donor nuclei in SCNT embryos.
Nuclear reprogramming is tightly linked to chromatin
structure, and chromatin remodeling is extensively involved
in epigenetic reprogramming in mammalian cells [30].
Chromatin remodeling is not an isolated event: it is highly
coordinated by many binding processes and forms large
multiprotein complexes [31–34]. Using the SSH approach,
we first identified a number of differentially expressed genes
related to binding processes in zebrafish SCNT embryos;
among them, nine genes were implicated in protein binding
(nat13, ywhab, ywhabl, ywhae, ywhag, ywhaq, ywhaz, ywhai,
and ywhah), 17 in nucleic acid binding (ddx4l, eif4a1a,
hnrpab, klf 2a, klf2b, klf 4, klfd, nono, atf 3, cnr1, zgc:100951,
zgc:66483, mycb, h3f 3d, h3f 3c, zgc:66241, and eif 4e3), one in
lipid binding (rgl1), eight in ion binding (klf 2a, klf2b, klf 4,
klfd, zgc:100951, zgc:66483, rcc1, and zgc:92066), and five in
ATP or guanosine triphosphate binding (abcf 2, ddx41, eif4a1a,
gtf 2f 2, and zgc:76988). In addition, some factors were
identified as related to isomerase activity, ligase activity,
ubiquitin-conjugating enzyme activity, helicase activity, oxidoreductase activity, ATPase activity, and ATP-dependent
helicase activity, all of which are indispensable in the binding
process. Therefore, our findings suggest that nuclear remodeling occurs at the early developmental stage in SCNT
embryos, which is consistent with previous studies [35, 36]
proposing that nuclear reprogramming requires prior remodeling of nuclear structures. Notably, some genes related to
chromatin organization, including rcc1, were down-regulated
in the cloned embryos, which is in agreement with the results
of other studies [37, 38]. Most of these genes were downregulated in SCNT embryos, which indicates a failure of
nuclear remodeling in SCNT embryos. Thus, it is highly
possible that factors related to nuclear remodeling have
important roles in the reprogramming of zebrafish SCNT
embryos.
Among the genes identified in our study, several involved in
the process of translation, including bzw1 and eif 4a1a, were
down-regulated in SCNT embryos. Other researchers have
reported that bzw1 and eif4a have key regulatory roles in
translation initiation [39, 40]. Down-regulation of these genes
in the present study indicates that the failure in translation may
contribute to the reprogramming problems that occur in SCNT
embryos. In a cross-comparison with the existing database of
mice and cattle [24, 25], translation initiation-related genes
such as eif4a were shared. It is possible that the failure in
translation may represent a root cause of reprogramming failure
in SCNT embryos across species.
Moderate abnormality of nuclear transplants has been well
documented in studies [41, 42] of nuclear transfer, and it is
thought to be caused by asynchrony between the cell cycles of
the recipient egg and donor nucleus. In lower vertebrates, this
asynchrony is conspicuous [43]. To confirm the importance of
cell cycle synchrony on the reprogramming process in SCNT
embryos, we chose kidney cells without culturing them as
donor cells, and then we identified many genes related to
regulation of the cell cycle. In our study, ccna1, ccnb1, ccne,
and cdc20 were down-regulated in SCNT embryos. A previous
study [44] demonstrated that oscillation of cyclins A and B
caused the loss of the gap phase and the alternation of the M
phase and S phase. Furthermore, in mammalian cells the G1-S
transition requires the activation of cyclins D and E, which
form a complex with cdk4/6 and cdk2, respectively [45].
FIG. 5. Validation of dot blot assay results using real-time quantitative
RT-PCR. Sixteen genes were selected for real-time quantitative RT-PCR
analysis. All genes showed the same pattern of expression as that on the
dot blot assays.
680
LUO ET AL.
TABLE 4. Ninety-six genes differentially expressed between SCNT and ZD embryos at dome stage.
User_Id
dbEST_Id
Sequence identifier
Seventy-nine genes down-regulated in SCNT embryos
B4
FD487114
NM_001004555.1
B5
FD487115
NM_200294.1
B6
FD487116
XM_696928.1
B7
FD487117
XM_704560.1
B8
B13
FD487118
FD487123
XM_688491.1
XM_683028.1
B17
B18
B20
FD487127
FD487128
FD487130
NM_001004548.1
NM_212670.1
NM_199766.1
B27
B30
FD487137
FD487140
XM_695585.1
XM_701747.1
B44
B48
FD487154
FD487158
NM_212818.1
XM_698991.1
B50
B54
B59
B61
B66
FD487160
FD487164
FD487169
FD487171
FD487176
NM_214817.1
NM_001017593.1
XM_687848.1
NM_001002127.1
NM_201513.1
B67
FD487177
XM_692196.1
B74
FD487184
XM_683556.1
B76
B80
FD487186
FD487190
XM_697535.1
XM_680521.1
B84
FD487194
XM_678002.1
B87
B88
B91
B94
B96
B100
B101
FD487197
FD487198
FD487201
FD487204
FD487206
FD487210
FD487211
NM_001013300.1
NM_001002114.1
XM_696483.1
NM_200172.1
NM_001002378.1
NM_212996.1
NM_200948.1
B102
FD487212
XM_678430.1
B103
FD487213
XM_702578.1
B104
B111
B112
B113
B114
B115
B116
CB2
CB4
CB7
CB10
CB12
CB16
FD487214
FD487221
FD487222
FD487223
FD487224
FD487225
FD487226
FD487229
FD487231
FD487234
FD487237
FD487239
FD487243
NM_131382.1
XM_679269.1
NM_001003530.1
NM_001002124.1
NM_213178.1
NM_001004589.1
XM_695667.1
NM_001003991.1
NM_213527.1
XM_680315.1
NM_201514.1
XM_697083.1
XM_684580.1
CB25
CB51
FD487252
FD487276
NM_214805.1
XM_694025.1
CB65
CB73
CB75
CB76
CB81
CB100
CB101
CB106
FD487290
FD487298
FD487300
FD487301
FD487306
FD487325
FD487326
FD487331
NM_212587.2
NM_201468.1
NM_212758.1
NM_001017797.1
NM_200866.1
XM_697434.1
XM_681649.1
NM_199863.1
Gene description (gene symbol)
a
Danio rerio reticulon 4a (rtn4a), mRNA
Danio rerio UDP-N-acteylglucosamine pyrophosphorylase 1, like 1 (uap1l1), mRNA
PREDICTED: Danio rerio hypothetical protein LOC555084 (LOC555084), mRNA
PREDICTED: Danio rerio similar to AKT1 substrate 1 (proline-rich), transcript variant 2
(LOC566559), mRNA
PREDICTED: Danio rerio similar to host cell factor C1 (LOC565206), mRNA
PREDICTED: Danio rerio similar to chromosome adhesion protein SMC1-like (LOC559665),
mRNA
Danio rerio T-cell activation GTPase activeating protein (tagap), mRNA
Danio rerio zgc:77560 (zgc:77560), mRNA
Danio rerio N-ethylmaleimide sensitive fusion protein attachment protein alpha (napa),
mRNA
PREDICTED: Danio rerio similar to rhamnose-binding lectin OLL (LOC571939), mRNA
PREDICTED: Danio rerio similar to restricted expression proliferation associated protein-100,
transcript variant 3 (LOC557321), mRNA
Danio rerio cyclin A1 (ccna1), mRNA
PREDICTED: Danio rerio hypothetical protein LOC561719, transcript variant 1
(LOC561719), mRNA
Danio rerio zgc:85812 (zgc:85812), mRNA
Danio rerio zgc:110304 (zgc:110304), mRNA
PREDICTED: Danio rerio similar to LOC431817 protein (LOC564521), mRNA
Danio rerio general transcription factor IIF, polypeptide 2 (gtf2f2), mRNA
Danio rerio tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein,
theta polypeptide (ywhaq), mRNA
PREDICTED: Danio rerio similar to zinc finger protein 91 (HPF7, HTF10) (LOC568840),
mRNA
PREDICTED: Danio rerio similar to ubiquitin-conjugating enzyme E2D 4 (putative), transcript
variant 1 (LOC573457), mRNA
PREDICTED: Danio rerio hypothetical protein LOC554402 (LOC554402), mRNA
PREDICTED: Danio rerio similar to Zona pellucida sperm-binding protein 3 precursor (Zona
pellucida glycoprotein ZP3) (Zona pellucida protein C) (Sperm receptor) (ZP3A/ZP3B),
transcript variant 1 (LOC563179), mRNA
PREDICTED: Danio rerio similar to Mknk1-prov protein, transcript variant 1 (LOC555974),
mRNA
Danio rerio zgc:112980 (zgc:112980), mRNA
Danio rerio actin related protein 2/3 complex, subunit 3 (arpc3), mRNA
PREDICTED: Danio rerio hypothetical protein LOC554649 (LOC554649), mRNA
Danio rerio myelocytomatosis oncogene b (mycb), mRNA
Danio rerio zgc:92066 (zgc:92066), mRNA
Danio rerio H3 histone, family 3A (h3f3a), mRNA
Danio rerio proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 (psmd13),
mRNA
PREDICTED: Danio rerio similar to ADP-ribosylation factor-like 6 interacting protein 2,
transcript variant 1 (LOC555608), mRNA
PREDICTED: Danio rerio similar to G2/mitotic-specific cyclin A, transcript variant 2
(LOC561391), mRNA
Danio rerio mitochondrial carrier homolog 2 (mtch2), mRNA
PREDICTED: Danio rerio similar to c-src tyrosine kinase (LOC556454), mRNA
Danio rerio ribonuclease P 21 subunit (rpp21), mRNA
Danio rerio PSMC3 interacting protein (psmc3ip), mRNA
Danio rerio regulator of chromosome condensation 1 (rcc1), mRNA
Danio rerio eukaryotic translation initiation factor 4E family member 3 (eif4e3), mRNA
PREDICTED: Danio rerio similar to expressed sequence AV312086 (LOC572014), mRNA
Danio rerio Yip1 domain family, member 1 (yipf1), mRNA
Danio rerio hippocampus abundant transcript 1 (hiat1), mRNA
PREDICTED: Danio rerio similar to novel apoptosis-stimulating protein of p53 (tp53), mRNA
Danio rerio zgc:55813 (zgc:55813), mRNA
PREDICTED: Danio rerio hypothetical protein LOC554918 (LOC554918), mRNA
PREDICTED: Danio rerio similar to KH-type splicing regulatory protein (FUSE binding
protein 2) (LOC573065), mRNA
Danio rerio pKU-alpha protein kinase (TLK2), mRNA
PREDICTED: Danio rerio similar to bromodomain-containing protein 4 isoform long
(LOC570531), mRNA
Danio rerio heterogeneous nuclear ribonucleoprotein A/B (hnrnpab), mRNA
Danio rerio SET translocation (myeloid leukemia-associated) B (setb), mRNA
Danio rerio peptidylprolyl isomerase A (cyclophilin A) (ppia), mRNA
Danio rerio zgc:112425 (zgc:112425), mRNA
Danio rerio catenin, beta like 1 (ctnnbl1), mRNA
PREDICTED: Danio rerio hypothetical protein LOC554490 (LOC554490), mRNA
PREDICTED: Danio rerio hypothetical protein LOC558435 (LOC558435), mRNA
Danio rerio ubiquitin-conjugating enzyme E2G 2 (ube2g2), mRNA
REPROGRAMMING MECHANISM IN CLONED ZEBRAFISH EMBRYO
681
TABLE 4. Continued.
User_Id
dbEST_Id
Sequence identifier
CB107
CB111
CB112
FD487332
FD487336
FD487337
XM_686123.1
NM_198366.1
XM_680455.1
CB114
FD487339
XM_682985.1
CB115
FD487340
XM_684187.1
CB118
CB120
CB122
CB123
CB124
CB125
CB127
FD487343
FD487345
FD487347
FD487348
FD487349
FD487350
FD487352
NM_200675.2
NM_001003623.1
NM_205717.2
NM_199708.1
NM_201469.1
XM_696969.1
NM_199719.1
Seventeen genes up-regulated in SCNT embryosb
B3
FD487113
NM_200014.1
B29
FD487139
NM_200507.2
B56
FD487166
NM_201315.1
B92
FD487202
NM_131723.1
Gene description (gene symbol)
PREDICTED: Danio rerio hypothetical protein LOC553758 (LOC553758), mRNA
Danio rerio eukaryotic translation initiation factor 4A, isoform 1A (eif4a1a), mRNA
PREDICTED: Danio rerio similar to UNR protein (N-ras upstream gene protein), transcript
variant 1 (LOC558349), mRNA
PREDICTED: Danio rerio hypothetical protein LOC553496, transcript variant 1
(LOC553496), mRNA
PREDICTED: Danio rerio similar to Poly [ADP-ribose] polymerase-1 (PARP-1) (ADPRT)
(NAD(þ) ADP-ribosyltransferase-1) (Poly[ADP-ribose] synthetase-1) (LOC560788), mRNA
Danio rerio RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) (rer1), mRNA
Danio rerio N-acetylatranferase 13 (nat13), mRNA
Danio rerio solute carrier family 31 (copper transporters), member 1 (slc31a1), mRNA
Danio rerio basic leucine zipper and W2 domains 1 (bzw1), mRNA
Danio rerio FK506 binding protein 4 (fkbp4), mRNA
PREDICTED: Danio rerio hypothetical protein LOC554501 (LOC554501), mRNA
Danio rerio zgc:55512 (zgc:55512), mRNA
Danio
Danio
Danio
Danio
rerio
rerio
rerio
rerio
zgc:56134 (zgc:56134), mRNA
family with sequence similarity 46, member C (fam46c), mRNA
ATP-binding cassette, sub-family F (GCN20), member 2 (abcf2), mRNA
Kruppel-like factor 4 (klf4), mRNA
a
Twelve of seventy-nine genes down-regulated in SCNT embryos, which have no similarity sequences using BLAST the NCBI Refseq database of
zebrafish, were not shown here.
Thirteen of seventeen genes up-regulated in SCNT embryos, which have no similarity sequences using BLAST the NCBI Refseq database of zebrafish,
were not shown here.
b
Xenopus blastomeres undergoing cleavage exhibit a distinctive
cell division cycle that is characterized by an extended S phase
accompanied by very short or absent G1 and G2 phases, and a
similar dynamic process was observed in mammalian embryos
[46]. Within this context, it is conceivable that undergoing a
distinctive cell division cycle such as that which occurs in
Xenopus may also be important to zebrafish SCNT embryos.
Therefore, the factors that regulate the cell cycle may have
important roles in the reprogramming of SCNT embryos. Our
data provide molecular evidence suggesting that a number of
failures in SCNT embryos may contribute to asynchrony
between the cell cycles of the recipient egg and donor nucleus.
Synchronization between the cell cycles of the recipient egg
and donor nucleus could improve efficiency in cloning.
In our study, mycb and tp53 (B94 and CB7, respectively)
were identified and were down-regulated in SCNT embryos. In
addition, klf 4 and rpp21 (B92 and B112, respectively) were
identified and up-regulated in SCNT embryos. In mammals,
the helix-loop-helix/leucine zipper transcription factor MYC is
associated with a number of cellular functions, including cell
growth, differentiation, and proliferation, and Myc has been
shown to alter cellular responses to oncogenes in a culture
system [47]. MYC has been proposed as a major downstream
target for two pathways that support the maintenance of
pluripotency. The Krüppel-type zinc finger transcription factor
KLF4, like MYC, is a downstream target of activated STAT3
in leukemia inhibitory factor-induced embryonic stem (ES)
cells. KLF4 overexpression leads to the inhibition of
differentiation in ES cells [48]. KLF4 has been shown to
repress TP53 directly [49], and TP53 protein has been shown
to suppress NANOG during ES cell differentiation [50].
Takahashi and Yamanaka [26] found that induced pluripotent
stem cells showed levels of TP53 protein that were lower than
those in mouse embryonic fibroblasts. Thus, KLF4 may
contribute to the activation of NANOG and other ES cellspecific genes through TP53 repression. Alternatively, KLF4
might function as an inhibitor of MYC-induced apoptosis
through the repression of TP53 [51]. In contrast, KLF4
activates CDKN1ACIP1, thereby suppressing cell proliferation
[52]. This antiproliferative function of KLF4 may be inhibited
by MYC, which suppresses the expression of CDKN1ACIP1
[53]. Compared with fertilized control embryos, KLF4 was
overexpressed in mouse SCNT embryos during the first two
cell cycles of development [54]. This suggests that KLF4 may
be important for the reprogramming process in vivo. As
discussed previously, the balance between MYC and KLF4
may be important for the generation of induced pluripotent
stem cells in mammals. Surprisingly, four factors (B92, B94,
B112, and CB7) in zebrafish SCNT embryos were differentially expressed in the same manner as those in the
reprogrammed mammalian cells in vitro. To date, there is no
evidence that these factors perform similar functions in
zebrafish, but the differentially expressed genes may be related
to the reprogramming process of donor nuclei in the SCNT
embryos. Therefore, the balance between mycb and klf 4 may
be important for the reprogramming process in zebrafish SCNT
embryos. In addition, five recent studies [26, 27, 55–57] show
that transfection of mammalian somatic cells with special
factors was sufficient to induce the cells to show stem cell
characteristics in vitro. However, there is no evidence (to our
knowledge) that these specific factors have a role in the
reprogramming of SCNT embryos in vivo. Based on our data
from zebrafish SCNT embryos, we provide in vivo evidence
that mycb and klf 4 were retrovirally transduced into donor
cells. However, the embryos in our study failed to complete the
reprogramming process. This implies that, although B92 and
B94 (klf 4 and mycb, respectively) were regulated in SCNT
embryos, their expression was not sufficient to induce a
complete reprogramming process.
Traditionally, it was believed that the genome from the
donor cell has an exclusive role in the regulation of SCNT
embryos. However, recent evidence from crossgenus-cloned
fish has shown that the somite development process and somite
number of nuclear transplants were consistent with the
recipient species (goldfish) rather than the nuclear donor
species (common carp) [12]. We speculated that there might be
a subset of genes from recipient oocytes that could have a role
in reprogramming. To test our hypothesis, we performed a
682
LUO ET AL.
temporal expression analysis of 16 differentially expressed
genes, 12 of which could be identified in unfertilized embryos
(data not shown). This result provides some molecular
evidence that the fish egg cytoplasm not only supports the
development driven by transplanted nuclei but also modulates
development of the nuclear transplants.
Successful cloning in zebrafish [3], as well as in other
species, indicates that the oocytes possess all of the
components required for the establishment of a pluripotent
phenotype. According to our data, 82.3% (79/96) of the
identified genes were down-regulated in SCNT embryos, and
this may shed light on the low survival rate of zebrafish clones.
With this result in mind, we speculate that coinjection with
specific factors may be the most efficient approach for
increasing the viability of zebrafish clones.
A New Model of Reprogramming Research Using Zebrafish
SCNT Embryos
Identification of the differentially expressed genes between
SCNT embryos and ZD embryos is important for the
comprehensive study of reprogramming. Although growing
numbers of studies [14, 24, 25, 54, 58, 59] have conducted
large-scale analyses of gene expression in preimplantation
embryos and in cloned mammals in mouse and bovine models,
the mechanism and process of reprogramming in SCNT
embryos remain largely unknown. The differences in gene
expression reported in these studies may be due to not only the
stages of development analyzed or the different species used
but also the stochastic nature of nuclear reprogramming after
nuclear transfer [59]. Large-scale analyses of gene expression
in cloned mammals usually analyzed single nuclear transfer
embryos and were restricted in ovulation quantity in mammals.
Fish are generally fecund and can produce hundreds of eggs on
a periodic basis. Zebrafish and medaka especially have a good
research base on SCNT [3, 4, 13, 60, 61], which facilitated our
analyzing 3660 zebrafish SCNT embryos and sampling 444
SCNT embryos at the dome stage (Table 3). These SCNT
embryos covered various elements of the stochastic nature of
nuclear reprogramming after nuclear transfer. From the
perspective of statistical analysis, the findings from a large
number of SCNT embryos have good reproducibility. Many
key factors of our findings in zebrafish SCNT embryos were
found in mice and cattle [24, 25, 54]; compared with fertilized
control embryos, klf4 is overexpressed not only in zebrafish
SCNT embryos but also in mouse SCNT embryos [54]. Using
zebrafish SCNT embryos as a model would increase our
understanding of more comprehensive reprogramming processes. In addition, the analysis of early developmental
embryos after nuclear transfer is very important to elucidate
the reprogramming processes; the natural fertilization and
development in vitro in fish facilitate observation and sampling
of the development of SCNT embryos after nuclear transfer.
Initial reprogramming research has been reported in medaka,
including chromosomal abnormalities after nuclear transfer
[60]. Therefore, fish offer special advantages as a model of
reprogramming research.
Regarding the development of zebrafish SCNT embryos,
two dramatic decreases in the number of surviving embryos
occurred in the dome and shield stages: only 10%–15% of the
SCNT embryos reached the dome stage, and 1%–3% reached
the shield stage, whereas 65%–80% entered the cleavage stage
(Table 3). Recent observations show a similar decrease at
midblastulation to early gastrulation with SCNT embryos from
amphibians [62, 63] and cross-species nuclear transfer fish [12,
64]. Obviously, two dramatic decreases point to incomplete
reprogramming processes after nuclear transfer. Therefore, we
chose embryos at the dome and shield stages for our SSH
analysis to reveal the molecular mechanisms underlying
reprogramming processes. It is widely accepted that reprogramming can be divided into two major events that occur just
after SCNT: 1) the reversal to pluripotency and 2) the
establishment of new differentiation programs [8]. In our
study, we used the SSH approach to study the differential
transcript profiles of zebrafish SCNT embryos relative to those
of ZD embryos at the dome stage. Identification of differentially expressed genes between SCNT embryos and ZD
embryos (Table 4) provides evidence for a failure to reverse
to pluripotency at the dome stage. Based on the available data,
we speculate that the two major reprogramming events are
associated with the dome stage and the shield stage.
Furthermore, abortion before the dome stage is due to failed
reversal to pluripotency, and abortion between the dome stage
and the shield stage is due to a failure to establish new
differentiation programs. Future studies will focus on the
analysis of differentially expressed genes at the shield stage
(Luo et al., unpublished data). Taken together, our findings
provide molecular evidence to explain two dramatic decreases
in the number of surviving embryos during the development of
SCNT embryos, and our results will enable the use of zebrafish
SCNT embryos as a new model of reprogramming research.
Using the SSH approach, the results herein provide a
systemic database of gene expression profiles of zebrafish
SCNT embryos compared with ZD embryos at the dome stage.
Striking differences in gene expression profiles were identified
between SCNT embryos and ZD embryos. Our data suggest
that the one broadly defined major reprogramming event—
reversal to pluripotency—occurred at the dome stage in
zebrafish SCNT embryos. Based on GO analyses, the factors
related to nuclear remodeling, translation initiation, and
regulation of the cell cycle may represent the most important
roles in the reprogramming of SCNT embryos. In addition, we
propose that klf 4 and mycb, whose homologs in mice provide a
powerful combination for more efficient reprogramming of
somatic cells, are of significant importance in the reprogramming process in zebrafish SCNT embryos [8]. Although the
donor cell genome seems capable of exclusively regulating the
process of nuclear reprogramming after SCNT, the importance
of regulation from recipient oocytes in cloning experiments
should not be underestimated in zebrafish.
Using zebrafish SCNT embryos, we provide initial
molecular evidence that abortion of SCNT embryos at the
dome stage is due to failed major reprogramming processes
after nuclear transfer. In a future article, we will describe the
gene expression profiles of SCNT embryos compared with ZD
embryos at the shield stage in zebrafish. Collectively, the
results of these studies should provide new insights that will
enhance our understanding of the reprogramming mechanism
after nuclear transfer.
ACKNOWLEDGMENTS
We greatly appreciate Ming Li for supplying experimental materials
and Wuming Gong (Department of Genetics, Cell Biology and
Development, University of Minnesota) for his assistance regarding
bioinformatics questions.
REFERENCES
1. Briggs R, King TJ. Transplantation of living nuclei from blastula cells into
enucleated frogs’ eggs. Proc Natl Acad Sci U S A 1952; 38:455–463.
2. Wilmut I, Schnieke AE, McWhir J, Kind AJ, Campbell KH. Viable
offspring derived from fetal and adult mammalian cells. Nature 1997; 385:
810–813.
REPROGRAMMING MECHANISM IN CLONED ZEBRAFISH EMBRYO
3. Lee KY, Huang H, Ju B, Yang Z, Lin S. Cloned zebrafish by nuclear
transfer from long-term-cultured cells. Nat Biotechnol 2002; 20:795–799.
4. Wakamatsu Y, Ju B, Pristyaznhyuk I, Niwa K, Ladygina T, Kinoshita M,
Araki K, Ozato K. Fertile and diploid nuclear transplants derived from
embryonic cells of a small laboratory fish, medaka (Oryzias latipes). Proc
Natl Acad Sci U S A 2001; 98:1071–1076.
5. Wakayama T, Perry AC, Zuccotti M, Johnson KR, Yanagimachi R. Fullterm development of mice from enucleated oocytes injected with cumulus
cell nuclei. Nature 1998; 394:369–374.
6. Tian XC, Xu J, Yang X. Normal telomere lengths found in cloned cattle.
Nat Genet 2000; 26:272–273.
7. Rideout WM III, Eggan K, Jaenisch R. Nuclear cloning and epigenetic
reprogramming of the genome. Science 2001; 293:1093–1098.
8. Alberio R, Campbell KH, Johnson AD. Reprogramming somatic cells into
stem cells. Reproduction 2006; 132:709–720.
9. Gasaryan KG, Hung NM, Neyfakh AA, Ivanenkov VV. Nuclear
transplantation in teleost Misgurnus fossilis L. Nature 1979; 280:585–587.
10. Yan SY, Lu DY, Du M, Li GS, Lin LT, Jin GQ, Wang H, Yang YQ, Xia
DQ, Liu AZ, Zhu ZY, Yi YL, Chen HX. Nuclear transplantation in
teleosts: hybrid fish from the nucleus of crucian and the cytoplasm of carp.
Sci Sin [B] 1984; 27:1029–1034.
11. Zhu ZY, Sun YH. Embryonic and genetic manipulation in fish. Cell Res
2000; 10:17–27.
12. Sun YH, Chen SP, Wang YP, Hu W, Zhu ZY. Cytoplasmic impact on
cross-genus cloned fish derived from transgenic common carp (Cyprinus
carpio) nuclei and goldfish (Carassius auratus) enucleated eggs. Biol
Reprod 2005; 72:510–515.
13. Hu W, Wang YP, Chen SP, Zhu ZY. Nuclear transplantation in different
strains of zebrafish. Chin Sci Bull 2002; 47:1277–1280.
14. Humpherys D, Eggan K, Akutsu H, Friedman A, Hochedlinger K,
Yanagimachi R, Lander ES, Golub TR, Jaenisch R. Abnormal gene
expression in cloned mice derived from embryonic stem cell and cumulus
cell nuclei. Proc Natl Acad Sci U S A 2002; 99:12889–12894.
15. Diatchenko L, Lukyanov S, Lau YF, Siebert PD. Suppression subtractive
hybridization: a versatile method for identifying differentially expressed
genes. Methods Enzymol 1999; 303:349–380.
16. Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B,
Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD.
Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl
Acad Sci U S A 1996; 93:6025–6030.
17. Hepworth PJ, Leatherbarrow H, Hart CA, Winstanley C. Use of
suppression subtractive hybridisation to extend our knowledge of genome
diversity in Campylobacter jejuni. BMC Genomics 2007; 8:e110.
18. Altincicek B, Vilcinskas A. Analysis of the immune-inducible transcriptome from microbial stress resistant, rat-tailed maggots of the drone
fly Eristalis tenax. BMC Genomics 2007; 8:e326.
19. Herrero S, Gechev T, Bakker PL, Moar WJ, de Maagd RA. Bacillus
thuringiensis Cry1Ca-resistant Spodoptera exigua lacks expression of one
of four Aminopeptidase N genes. BMC Genomics 2005; 6:e96.
20. Ji W, Wright MB, Cai L, Flament A, Lindpaintner K. Efficacy of SSH
PCR in isolating differentially expressed genes. BMC Genomics 2002; 3:
e12.
21. Kasprzyk A, Keefe D, Smedley D, London D, Spooner W, Melsopp C,
Hammond M, Rocca-Serra P, Cox T, Birney E. EnsMart: a generic system
for fast and flexible access to biological data. Genome Res 2004; 14:160–
169.
22. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis
AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, et al. Gene
Ontology Consortium. Gene ontology: tool for the unification of biology.
Nat Genet 2000; 25:25–29.
23. Zhou M, Cui Y. GeneInfoViz: constructing and visualizing gene relation
networks. In Silico Biol 2004; 4:323–333.
24. Smith SL, Everts RE, Tian XC, Du F, Sung LY, Rodriguez-Zas SL, Jeong
BS, Renard JP, Lewin HA, Yang X. Global gene expression profiles
reveal significant nuclear reprogramming by the blastocyst stage after
cloning. Proc Natl Acad Sci U S A 2005; 102:17582–17587.
25. Beyhan Z, Ross PJ, Iager AE, Kocabas AM, Cunniff K, Rosa GJ, Cibelli
JB. Transcriptional reprogramming of somatic cell nuclei during
preimplantation development of cloned bovine embryos. Dev Biol 2007;
305:637–649.
26. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell 2006; 126:
663–676.
27. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K,
Yamanaka S. Induction of pluripotent stem cells from adult human
fibroblasts by defined factors. Cell 2007; 131:861–872.
683
28. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages
of embryonic development of the zebrafish. Dev Dyn 1995; 203:253–310.
29. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods
2001; 25:402–408.
30. Oliveri RS, Kalisz M, Schjerling CK, Andersen CY, Borup R, Byskov
AG. Evaluation in mammalian oocytes of gene transcripts linked to
epigenetic reprogramming. Reproduction 2007; 134:549–558.
31. Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN,
Bird A. Transcriptional repression by the methyl-CpG-binding protein
MeCP2 involves a histone deacetylase complex. Nature 1998; 393:386–
389.
32. Wade PA, Gegonne A, Jones PL, Ballestar E, Aubry F, Wolffe AP. Mi-2
complex couples DNA methylation to chromatin remodelling and histone
deacetylation. Nat Genet 1999; 23:62–66.
33. Robertson KD, Ait-Si-Ali S, Yokochi T, Wade PA, Jones PL, Wolffe AP.
DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses
transcription from E2F-responsive promoters. Nat Genet 2000; 25:338–
342.
34. Rountree MR, Bachman KE, Baylin SB. DNMT1 binds HDAC2 and a
new co-repressor, DMAP1, to form a complex at replication foci. Nat
Genet 2000; 25:269–277.
35. Alberio R, Johnson AD, Stick R, Campbell KH. Differential nuclear
remodeling of mammalian somatic cells by Xenopus laevis oocyte and egg
cytoplasm. Exp Cell Res 2005; 307:131–141.
36. Kikyo N, Wade PA, Guschin D, Ge H, Wolffe AP. Active remodeling of
somatic nuclei in egg cytoplasm by the nucleosomal ATPase ISWI.
Science 2000; 289:2360–2362.
37. Moreira PN, Robl JM, Collas P. Architectural defects in pronuclei of
mouse nuclear transplant embryos. J Cell Sci 2003; 116:3713–3720.
38. Sullivan EJ, Kasinathan S, Kasinathan P, Robl JM, Collas P. Cloned
calves from chromatin remodeled in vitro. Biol Reprod 2004; 70:146–153.
39. Svitkin YV, Pause A, Haghighat A, Pyronnet S, Witherell G, Belsham GJ,
Sonenberg N. The requirement for eukaryotic initiation factor 4A (elF4A)
in translation is in direct proportion to the degree of mRNA 5’ secondary
structure. RNA 2001; 7:382–394.
40. Lister JA, Robertson CP, Lepage T, Johnson SL, Raible DW. nacre
Encodes a zebrafish microphthalmia-related protein that regulates neuralcrest-derived pigment cell fate. Development 1999; 126:3757–3767.
41. Kurosaka S, Imai H. Cell-cycle coordination and nuclear reprogramming
in nuclear transfer embryos [in Japanese]. Tanpakushitsu Kakusan Koso
2002; 47:1804–1809.
42. Wells DN, Laible G, Tucker FC, Miller AL, Oliver JE, Xiang T, Forsyth
JT, Berg MC, Cockrem K, L’Huillier PJ, Tervit HR, Oback B.
Coordination between donor cell type and cell cycle stage improves
nuclear cloning efficiency in cattle. Theriogenology 2003; 59:45–59.
43. Di Berardino D, Ramunno L, Jovino V, Pacelli C, Lioi MB, Scarfi MR,
Burguete I. Spontaneous rate of sister chromatid exchanges (SCEs) in
mitotic chromosomes of sheep (Ovis aries L.) and comparison with cattle
(Bos taurus L.), goat (Capra hircus L.) and river buffalo (Bubalus bubalis
L.). Hereditas 1997; 127:231–238.
44. Hartley RS, Rempel RE, Maller JL. In vivo regulation of the early
embryonic cell cycle in Xenopus. Dev Biol 1996; 173:408–419.
45. Sherr CJ. G1 phase progression: cycling on cue. Cell 1994; 79:551–555.
46. Campbell KH, Loi P, Cappai P, Wilmut I. Improved development to
blastocyst of ovine nuclear transfer embryos reconstructed during the
presumptive S-phase of enucleated activated oocytes. Biol Reprod 1994;
50:1385–1393.
47. Rawson C, Shirahata S, Collodi P, Natsuno T, Barnes D. Oncogene
transformation frequency of nonsenescent SFME cells is increased by cmyc. Oncogene 1991; 6:487–489.
48. Li Y, McClintick J, Zhong L, Edenberg HJ, Yoder MC, Chan RJ. Murine
embryonic stem cell differentiation is promoted by SOCS-3 and inhibited
by the zinc finger transcription factor Klf4. Blood 2005; 105:635–637.
49. Rowland BD, Bernards R, Peeper DS. The KLF4 tumour suppressor is a
transcriptional repressor of p53 that acts as a context-dependent oncogene.
Nat Cell Biol 2005; 7:1074–1082.
50. Lin T, Chao C, Saito S, Mazur SJ, Murphy ME, Appella E, Xu Y. p53
Induces differentiation of mouse embryonic stem cells by suppressing
Nanog expression. Nat Cell Biol 2005; 7:165–171.
51. Zindy F, Eischen CM, Randle DH, Kamijo T, Cleveland JL, Sherr CJ,
Roussel MF. Myc signaling via the ARF tumor suppressor regulates p53dependent apoptosis and immortalization. Genes Dev 1998; 12:2424–
2433.
52. Zhang W, Geiman DE, Shields JM, Dang DT, Mahatan CS, Kaestner KH,
Biggs JR, Kraft AS, Yang VW. The gut-enriched Krüppel-like factor
684
53.
54.
55.
56.
57.
58.
LUO ET AL.
(Krüppel-like factor 4) mediates the transactivating effect of p53 on the
p21WAF1/Cip1 promoter. J Biol Chem 2000; 275:18391–18398.
Seoane J, Le HV, Massague J. Myc suppression of the p21(Cip1) Cdk
inhibitor influences the outcome of the p53 response to DNA damage.
Nature 2002; 419:729–734.
Vassena R, Han Z, Gao S, Baldwin DA, Schultz RM, Latham KE. Tough
beginnings: alterations in the transcriptome of cloned embryos during the
first two cell cycles. Dev Biol 2007; 304:75–89.
Takahashi K, Okita K, Nakagawa M, Yamanaka S. Induction of
pluripotent stem cells from fibroblast cultures. Nat Protoc 2007; 2:
3081–3089.
Hanna J, Wernig M, Markoulaki S, Sun CW, Meissner A, Cassady JP,
Beard C, Brambrink T, Wu LC, Townes TM, Jaenisch R. Treatment of
sickle cell anemia mouse model with iPS cells generated from autologous
skin. Science 2007; 318:1920–1923.
Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL,
Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson
JA. Induced pluripotent stem cell lines derived from human somatic cells.
Science 2007; 318:1917–1920.
Pfister-Genskow M, Myers C, Childs LA, Lacson JC, Patterson T,
Betthauser JM, Goueleke PJ, Koppang RW, Lange G, Fisher P, Watt SR,
Forsberg EJ, et al. Identification of differentially expressed genes in
59.
60.
61.
62.
63.
64.
individual bovine preimplantation embryos produced by nuclear transfer:
improper reprogramming of genes required for development. Biol Reprod
2005; 72:546–555.
Somers J, Smith C, Donnison M, Wells DN, Henderson H, McLeay L,
Pfeffer PL. Gene expression profiling of individual bovine nuclear transfer
blastocysts. Reproduction 2006; 131:1073–1084.
Kaftanovskaya E, Motosugi N, Kinoshita M, Ozato K, Wakamatsu Y.
Ploidy mosaicism in well-developed nuclear transplants produced by
transfer of adult somatic cell nuclei to nonenucleated eggs of medaka
(Oryzias latipes). Dev Growth Differ 2007; 49:691–698.
Bubenshchikova E, Kaftanovskaya E, Motosugi N, Fujimoto T, Arai K,
Kinoshita M, Hashimoto H, Ozato K, Wakamatsu Y. Diploidized eggs
reprogram adult somatic cell nuclei to pluripotency in nuclear transfer in
medaka fish (Oryzias latipes). Dev Growth Differ 2007; 49:699–709.
Gurdon JB, Byrne JA, Simonsson S. Nuclear reprogramming by Xenopus
oocytes. Novartis Found Symp 2005; 265:129–141,204–111.
Gurdon JB, Byrne JA, Simonsson S. Nuclear reprogramming and stem cell
creation. Proc Natl Acad Sci U S A 2003; 100(suppl 1):11819–11822.
Pei DS, Sun YH, Chen SP, Wang YP, Hu W, Zhu ZY. Identification of
differentially expressed genes from the cross-subfamily cloned embryos
derived from zebrafish nuclei and rare minnow enucleated eggs.
Theriogenology 2007; 68:1282–1291.