Endogenously Decreasing Tissue n-6/n-3 Fatty Acid Ratio
Reduces Atherosclerotic Lesions in Apolipoprotein E–Deficient
Mice by Inhibiting Systemic and Vascular Inflammation
Jian-Bo Wan, Li-Li Huang, Rong Rong, Rui Tan, Jingdong Wang, Jing X. Kang
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Objective—To use the fat-1 transgenic mouse model to determine the role of tissue n-6/n-3 fatty acid ratio in atherosclerotic
plaque formation. Although it has been suggested that a low ratio of n-6/n-3 polyunsaturated fatty acids (PUFAs) is more
desirable in reducing the risk of atherosclerotic cardiovascular disease, the role of tissue n-6/n-3 fatty acid ratio in
atherosclerosis has not been sufficiently tested in a well-controlled experimental system. The fat-1 transgenic mouse
model, expressing an n-3 fatty acid desaturase, is capable of producing n-3 PUFAs from n-6 PUFAs and thereby has
a ratio of n-6/n-3 fatty acids close to 1:1 in tissues and organs.
Methods and Results—To generate apolipoprotein E– deficient plus fat-1 transgenic mice (apoE⫺/⫺/fat-1), we crossed
heterozygous fat-1 mice with apoE⫺/⫺ mice. After 14 weeks of a Western-type diet rich in n-6 PUFAs, the
apoE⫺/⫺/fat-1 mice showed a lower ratio of n-6/n-3 fatty acids than the apoE⫺/⫺ mice in all organs and tissues tested.
The aortic lesion area in apoE⫺/⫺/fat-1 mice was significantly reduced when compared with that of apoE⫺/⫺ littermates
(7.14⫾0.54% versus 13.49⫾1.61%). There were no differences in plasma cholesterol or high- and low-density
lipoprotein levels between the 2 groups, except for a higher triglyceride level in the apoE⫺/⫺/fat-1 mice. A significant
reduction of interleukin 6 and prostaglandin E2 in both plasma and aorta culture medium was observed in apoE⫺/⫺/fat-1
mice. RT-PCR analysis also indicated that the expression of intercellular adhesion molecule-1, monocyte chemoattractant protein-1, interleukin 6, and cyclooxygenase-2 was lower in the aortas and the circulating monocytes from
apoE⫺/⫺/fat-1 mice. In addition, the expression of nuclear factor ␬B/p65 in the aorta and the recruitment of
macrophages into atherosclerotic plaques were reduced in apoE⫺/⫺/fat-1 mice, compared with apoE⫺/⫺ mice.
Conclusion—To our knowledge, this is the first study to provide direct evidence for the role of tissue n-6/n-3 ratio in
atherosclerosis using the fat-1 transgenic mouse model. Our findings demonstrate that a decreased n-6/n-3 fatty acid ratio
reduces atherosclerotic lesions in apoE⫺/⫺ mice. This protective effect may be attributed to the antiinflammatory properties
of n-3 fatty acids, rather than their lipid-lowering effect. (Arterioscler Thromb Vasc Biol. 2010;30:2487-2494.)
Key Words: atherosclerosis 䡲 fat-1 transgenic mice 䡲 n-3 fatty acids 䡲 n-6/n-3 fatty acid ratio 䡲 inflammation
A
ccumulating epidemiological and experimental evidence
has demonstrated that dietary intake of long-chain n-3
polyunsaturated fatty acids (PUFAs), particularly those derived from fish oil, reduces the risk of cardiovascular events,
including atherosclerosis.1–5 The beneficial effects of n-3
PUFAs in atherosclerotic cardiovascular disease are associated with the reduction of endothelial adhesion molecules,3
the stabilization of atherosclerotic lesions,4 the modulation of
oxidative stress in macrophages,6 and improvement in the
function of endothelium5,7 and macrophages.8 However, several studies on animals and humans have shown somewhat
contradictory results,9 –11 possibly because they did not account for the tissue background level of n-6 PUFAs, a
potential confounding factor.
See accompanying article on page 2325
PUFAs are important precursors of eicosanoids that serve
as signaling molecules.12 The eicosanoids derived from n-6
and n-3 PUFAs are functionally distinct, and some even have
opposing physiological functions.12,13 For example, n-6 –
derived eicosanoids, such as prostaglandin E2 (PGE2)14 and
leukotriene B4,15 promote inflammation and exacerbate the
development of atherosclerosis, whereas the metabolites from
n-3 PUFAs, such as eicosapentaenoic acid (EPA)– derived
resolvins and docosahexaenoic acid (DHA)– derived protectins, have antiinflammatory properties and protect against
atherosclerosis.16 –18 According to recent findings,19,20 the
ratio of n-6/n-3 fatty acids in today’s Western diet ranges
from 10:1 to 30:1, indicating that modern Western diets are
Received on: March 28, 2010; final version accepted on: July 26, 2010.
From the Laboratory for Lipid Medicine and Technology, the Department of Medicine, (J.-B.W., L.-L.H., R.R., R.T., J.W., and J.X.K.) Massachusetts
General Hospital and Harvard Medical School, Boston and Department of Obstetrics and Gynecology (L.-L.H.), Sun Yat-sen Memorial Hospital, Sun
Yat-sen University, Guangzhou, P.R. China.
Correspondence to Jing X. Kang, MD, PhD, Massachusetts General Hospital and Harvard Medical School, 149 13th St, Room 4433, Charlestown, MA
02129. E-mail [email protected]
© 2010 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
2487
DOI: 10.1161/ATVBAHA.110.210054
2488
Arterioscler Thromb Vasc Biol
December 2010
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
deficient in n-3 fatty acids compared with the diet on which
humans evolved and on which their genetic patterns were
established (n-6/n-3 ratio, approximately 1:1). The excessive
n-6 fatty acids and high n-6/n-3 ratio result in an overproduction of n-6 – derived eicosanoids,21,22 which may contribute to the pathogenesis of modern diseases, including cardiovascular diseases.20 Thus, lowering the tissue ratio of n-6/n-3
fatty acids could be a feasible approach to controlling the
development of atherosclerosis. Emerging evidence indicates
that the efficacy of n-3 PUFAs in protection against atherosclerosis depends not only on the amount of n-3 PUFAs but
also on the background level of n-6 PUFAs.23 Recent findings20,24,25 suggest that a low ratio of n-6/n-3 fatty acids (close
to 1:1) is desirable in reducing the risk of many chronic
diseases that are highly prevalent in Western societies,
including atherosclerotic cardiovascular disease and inflammatory diseases. However, the role of the n-6/n-3 fatty acid
ratio in the development of atherosclerosis remains to be
established in well-qualified in vivo models.
The transgenic fat-1 mouse model, generated by our
laboratory, was engineered to express a fat-1 gene from
Caenorhabditis elegans that is absent in most animals,
including mammals.26,27 This gene encodes an n-3 fatty acid
desaturase that catalyzes conversion of n-6 to n-3 fatty acids.
When both fat-1 transgenic mice and wild-type littermates are
fed an identical diet high in n-6 but deficient in n-3 fatty
acids, the fat-1 transgenic mice show a high level of n-3 fatty
acids and a lower ratio of n-6/n-3 fatty acids in their organs
and tissues relative to those of the wild-type littermates.26,27
Thus, use of the fat-1 transgenic mouse allows us to create 2
different fatty acid profiles (high versus low n-6/n-3 ratio)
with a single diet, thereby eliminating the confounding
factors of using different diets in a comparative study. The
fat-1 transgenic mouse is an ideal animal model for elucidating the role of the n-6/n-3 fatty acid ratio in atherosclerosis.
The apolipoprotein E– deficient (apoE⫺/⫺) mouse is a
well-characterized model that spontaneously develops atherosclerotic lesions with a high consistency when fed a Westerntype diet.28 In the present study, the apoE⫺/⫺/fat-1 mice were
generated by crossing apoE⫺/⫺ mice with fat-1 transgenic
mice. The development of atherosclerosis and the status of
systemic and vascular inflammation were compared between
apoE⫺/⫺/fat-1 mice (low n-6/n-3 ratio) and apoE⫺/⫺ mice
(high n-6/n-3 ratio).
Methods
Animals and Diet
Fat-1 transgenic mice with a genetic background of C57BL/6 were
backcrossed for more than 10 generations. The heterozygous fat-1
mice (fat-1⫺/⫹), which exhibit a significant phenotype, were crossed
with apoE⫺/⫺ mice (Jackson Laboratory, Bar Harbor, Me); and the
offspring were further mated to obtain the compound apoE⫺/⫺/fat-1
mice and pure apoE⫺/⫺ colonies. The apoE genotype and the fat-1
phenotype of each animal were characterized using isolated genomic
DNA29 and analysis of total lipids26 from mouse tails, respectively,
after weaning and again after euthanization. Specific pathogen-free
animals were maintained under barrier conditions. At the age of 6
weeks, all animals were fed for 14 weeks with an identical Westerntype diet (consisting of 21% fat and 1.25% cholesterol), which is rich
in n-6 fatty acids and deficient in n-3 fatty acids (Research Diets Inc,
New Brunswick, NJ). The body weight and food intake of the
animals were recorded weekly. All animal protocols were approved
by the Center for Comparative Medicine, Massachusetts General
Hospital (Boston, Mass), in agreement with National Institutes of
Health guidelines.
Determination of n-6/n-3 Fatty Acid Ratio
After the 14-week feeding, mice were euthanized by isoflurane
inhalation (Abbott Laboratories, Chicago, Ill). Blood was immediately collected by cardiac puncture from the right ventricle. Thereafter, plasma was separated and stored at ⫺80°C, and the remaining
blood cells were replenished by an equal volume of Hank’s solution.
Then, the circulating monocytes were separated using Histopaque1083 (Sigma-Aldrich, St Louis, Mo). The main organs, including
brain, skeletal muscle, spleen, kidney, heart, liver, and lung, were
also harvested. Fatty acid profiles of plasma, monocytes, and main
organs were analyzed by using gas chromatography, as previously
described.30 In brief, tissue samples were ground to powder under
liquid nitrogen and subjected to fatty acid methylation by 14% boron
trifluoride–methanol reagent at 100°C for 1 hour. Fatty acid methyl
esters were analyzed by gas chromatography equipped with a flame
ionization detector (model HP6890N; Agilent, Palo Alto, Calif).
Peaks of fatty acids were identified by comparing the relative
retention times with their commercial standards (Nu-Chek Prep,
Elysian, Minn). The n-6/n-3 fatty acid ratio was given as follows:
(18:2 n-6⫹20:2 n-6⫹20:3 n-6⫹20:4 n-6⫹22:4 n-6⫹22:5 n-6):(18:3
n-3⫹20:5 n-3⫹22:5 n-3⫹22:6 n-3).
Assessments of Atherosclerotic Lesions
The extent of atherosclerosis was assessed in the aorta using an en
face method.31,32 Briefly, after perfusion with cold PBS (pH, 7.4), the
entire aorta was rapidly dissected from the proximal ascending aorta
to the iliac bifurcation under a dissecting microscope. The dissected
aorta was placed in PBS, and fat and connective tissue adhering to
the adventitia were removed as much as possible. The vessel was
fixed with 4% paraformaldehyde overnight at 4°C and then opened
longitudinally and pinned onto black wax plates using microneedles
(Fine Science Tools, Foster City, Calif). Lipid-rich intraluminal
lesions were stained with Sudan IV (Sigma-Aldrich). Images were
recorded using a digital camera (Coolpix 990; Nikon Corp, Tokyo,
Japan), and lesion areas were analyzed using computer software
(Image-Pro Plus; Media Cybernetics, Silver Spring, Md).
As a second assessment of atherosclerosis, the cross-sectional
lesions in the aortic sinus were analyzed, as previously described.33
Hearts with the aortic sinus were collected and embedded in optimal
cutting temperature and then frozen at ⫺80°C. The aortic sinus was
sectioned serially (10-␮m intervals), using a cryostat (model
CM1900; Leica, Richmond Hill, ON), from the appearance of the
aortic valve to the ascending aorta until the valve cusps were no
longer visible. After staining by oil red O (Sigma-Aldrich), the
atherosclerotic area in the aortic sinus was measured from the images
recorded by a charge-coupled device camera (QImaging, Surrey, BC,
Canada). The percentages of stenosis and intrusion were calculated
as follows: lesion area/(lesion area⫹lumen area)⫻100 and lesion
area/(lesion area⫹media area)⫻100, respectively.
Plasma Analysis
The analysis of plasma total cholesterol, triglyceride (TG), and highand low-density lipoproteins was performed at the Core Laboratory
at Massachusetts General Hospital, Boston. The levels of cytokines
(tumor necrosis factor [TNF] ␣ and interleukin [IL] 6) and the
inflammatory lipid mediator (PGE2) in the plasma were determined
using commercial ELISA kits (BD Biosciences, San Jose, Calif) and
enzyme immunoassay kits (Cayman, Ann Arbor, Mich), respectively, following their manufacturer protocols.
Ex Vivo Aorta Organ Culture
The aortic arch segment of apoE⫺/⫺/fat-1 and apoE⫺/⫺ mice was
dissected and washed with PBS several times. Thereafter, aorta
samples were cut into 2-mm rings and placed into 1 mL of
serum-free medium (Ultraculture; Lonza, Walkersville, Md). Tissue
Wan et al
Role of n-6/n-3 Fatty Acid Ratio in Atherosclerosis
2489
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 1. Differential fatty acid profiles in apoE ⫺/⫺ and apoE ⫺/⫺/fat-1 mice. A through C, Representative gas chromatogram (partial) of total
lipids extracted from circulating monocytes (A); the fatty acid ratios, including n-6/n-3 fatty acid ratio (B); and AA/(EPA⫹DPA⫹DHA) (C) in different organs and tissues from apoE⫺/⫺ and apoE⫺/⫺/fat-1 mice. AA indicates arachidonic acid (20:4 n-6); DHA, 22:6 n-3; DPA, 22:5 n-3;
DTA, docosatetraenoic acid (22:4 n-6); EPA, (20:5 n-3); and n-6 DPA, all-cis-4,7,10,13,16-DPA (22:5 n-6). The n-6/n-3 fatty acid ratio is as
follows: (18:2 n-6⫹20:2 n-6⫹20:3 n-6⫹20:4 n-6⫹22:4 n-6⫹22:5 n-6):(18:3 n-3⫹20:5 n-3⫹22:5 n-3⫹22:6 n-3). Data are given as mean⫾SEM
(n⫽3 to 4). *P⬍0.05 and **P⬍0.01 vs the apoE⫺/⫺ group.
was incubated for 24 hours at 37°C in a humidified atmosphere
containing 5% CO2. The culture supernatant was then removed and
frozen at ⫺80°C before analysis. The genomic DNA of the remaining aorta was isolated using a DNA miniprep kit (Sigma-Aldrich)
and quantified by UV spectrophotometer. The levels of TNF-␣, IL-6,
and PGE2 in the culture medium were assayed as described in the
“Plasma Analysis” subsection of the “Methods” section. Their values
were normalized to genomic DNA content.
Real-Time RT-PCR Analysis
Total RNA was isolated from both circulating monocytes and the entire
aorta using reagent (Trizol; Invitrogen, Carlsbad, Calif). First-strand
cDNA was synthesized from 1 ␮g of total RNA using a random primer
and Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase
(Promega, Madison, Wis). The sequences of PCR primers were obtained from the Primer bank (http://pga.mgh.harvard.edu/primerbank)
and are shown in supplemental Table I (available online at http://
atvb.ahajournals.org). PCR reactions were performed in duplicate
using a commercially available system (SYBR green PCR Master
Mix in a StepOnePlus Real-Time PCR System; Applied Biosystems,
Carlsbad, Calif) and normalized to 18S content.
Immunofluorescent Staining
Cryostat sections of the aortic sinus were fixed in 4% paraformaldehyde for 15 minutes and washed with PBS. After blocking the
endogenous peroxidase with 5% goat serum in PBS (containing
0.3% Triton X-100) and washing with PBS, the sections were
incubated with 1:100 rabbit anti–mouse nuclear factor (NF) ␬B/p65
(Cell Signaling, Danvers, Mass) and rabbit anti–mouse F4/80 individually overnight at 4°C and then exposed to 1:100 IgG (Alexa
Fluor 488 conjugate anti–rabbit IgG; Cell Signaling) for 1 hour at
room temperature in the dark. To quench the autofluorescence
caused by the internal elastic lamina, the labeling sections were
incubated with 0.5% pontamine sky blue (Sigma-Aldrich) in PBS for
10 minutes, followed by a 5-minute wash before mounting.34
Statistical Analysis
Results were expressed as the mean⫾SEM. Data were analyzed by
ANOVA and, subsequently, the unpaired t test for between-group
comparisons. P⬍0.05 was considered statistically significant.
Results
Food Intake, Body Weight, and Plasma Lipids
From the age of 6 weeks, all animals received a specially
formulated Western-type diet for 14 weeks. There were no
significant differences in food intake and body weight between the apoE⫺/⫺/fat-1 and the apoE⫺/⫺ mice throughout
the feeding period. The plasma TG level in apoE⫺/⫺/fat-1
mice was significantly higher than that in apoE⫺/⫺ mice
(123.3⫾21.1 versus 81.8⫾3.8 mg/dL), but no statistical
differences for plasma cholesterol and high- and low-density
lipoprotein levels were observed between the 2 groups
(supplemental Table II).
Fatty Acid Profiles
Both apoE⫺/⫺/fat-1 and apoE⫺/⫺ littermates born to the same
mother were maintained on a specially designed Westerntype diet high in n-6 but deficient in n-3 fatty acids. Because
the fat-1 gene encodes an n-3 fatty acid desaturase enzyme
that converts n-6 to n-3 fatty acids, the apoE⫺/⫺/fat-1 mice
had significantly higher amounts of long-chain n-3 PUFAs,
such as EPA, DHA, and docosapentaenoic acid (DPA); and
2490
Arterioscler Thromb Vasc Biol
Table.
December 2010
Profiles of Fatty Acids in Plasma, Circulating Monocytes, and Aorta From ApoEⴚ/ⴚ and ApoEⴚ/ⴚ/fat-1 Mice*
Plasma (n⫽6)
PUFAs
⫺/⫺
ApoE
Monocytes (n⫽3)
⫺/⫺
ApoE
/fat-1
⫺/⫺
⫺/⫺
ApoE
ApoE
Aorta (n⫽3)
/fat-1
⫺/⫺
ApoE
ApoE⫺/⫺/fat-1
n-6
LA (18:2 n-6)
26.10⫾0.67
9.04⫾0.22
12.25⫾0.13†
22.99⫾0.86
21.02⫾0.38
EDA (20:2 n-6)
0.26⫾0.01
0.21⫾0.01†
0.87⫾0.01
0.81⫾0.08
0.37⫾0.03
0.25⫾0.01
DGLA (20:3 n-6)
0.82⫾0.06
0.94⫾0.03
1.24⫾0.13
1.10⫾0.08
0.31⫾0.01
0.29⫾0.01
AA (20:4 n-6)
6.43⫾0.37
3.94⫾0.15†
19.21⫾0.05
9.35⫾1.82†
2.40⫾0.02
1.64⫾0.03†
DTA (22:4 n-6)
0.27⫾0.01
ND
2.66⫾0.10
0.62⫾0.17†
0.68⫾0.04
0.23⫾0.03†
DPA (22:5 n-6)
0.64⫾0.05
ND
2.71⫾0.25
0.47⫾0.19†
0.41⫾0.02
ND
34.52⫾0.81
30.32⫾1.00†
35.73⫾0.05
24.60⫾2.05†
27.16⫾0.29
24.06⫾0.30†
ALA (18:3 n-3)
ND
0.40⫾0.11
ND
0.30⫾0.08
ND
0.44⫾0.19
EPA (20:5 n-3)
ND
0.28⫾0.03
ND
1.74⫾0.10
ND
ND
DPA (22:5 n-3)
ND
0.26⫾0.01
0.27⫾0.08
2.93⫾0.60†
ND
0.23⫾0.01
DHA (22:6 n-3)
0.47⫾0.02
1.72⫾0.06†
0.84⫾0.10
3.74⫾0.51†
0.24⫾0.02
0.45⫾0.01†
Total
25.13⫾0.94
n-3
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Total
0.47⫾0.02
1.11⫾0.18
8.71⫾1.13†
0.24⫾0.02
32.93⫾0.80
36.84⫾0.22
33.3⫾3.19
27.21⫾0.11
25.78⫾0.78
38.98⫾1.27
36.7⫾1.64
40.83⫾0.62
42.18⫾2.59
42.40⫾2.00
38.30⫾5.63
18.78⫾1.30
20.54⫾0.61
9.79⫾1.72
11.19⫾1.66
29.30⫾0.39
29.49⫾1.21
n-6/n-3 (of total fractions)
73.55⫾3.48
11.73⫾0.86†
33.49⫾5.38
2.85⫾0.14†
116.78⫾12.13
20.91⫾2.71†
AA/EPA⫹DHA⫹DPA
13.62⫾0.72
1.52⫾0.11†
18.01⫾2.87
1.10⫾0.06†
10.31⫾0.98
2.20⫾0.10†
Total PUFAs
34.76⫾0.85
SFA
MFA
2.62⫾0.12†
1.18⫾0.17†
AA indicates arachidonic acid; ALA, ␣-linolenic acid; DGLA, dihomo-␥-linolenic acid; DTA, docosatetraenoic acid; EDA, eicosadienoic acid; LA,
linoleic acid; MFA, monounsaturated fatty acids (the value is given as follows: 16:1⫹18:1); ND, not detected; SFA, saturated fatty acids (the value
is given as follows: 14:0⫹16:0⫹18:0⫹20:0).
*Data are given as mean⫾SEM percentages (of total fatty acids) (n⫽3– 6).
† Significant P⬍0.05.
much lower amounts of n-6 PUFAs, such as arachidonic acid,
n-6 DPA, and docosatetraenoic acid, compared with apoE⫺/⫺
mice (Figure 1A and Table). Also, we observed that the
plasma, circulating monocytes, and aorta from the apoE⫺/⫺/
fat-1 mice exhibited higher total n-3 fatty acids but lower
total n-6 fatty acids without a change in the total amount of
PUFAs, saturated fatty acids, and monounsaturated fatty
acids (P⬎0.05) (Table). This enrichment of n-3 fatty acids at
the expense of n-6 in apoE⫺/⫺/fat-1 mice resulted in a
significantly lower ratio of n-6/n-3 fatty acids and arachidonic
acid/(EPA⫹DPA⫹DHA) in all organs and tissues tested
(Figure 1B and C). In particular, the ratios of arachidonic
acid/(EPA⫹DPA⫹DHA) in the plasma, aorta, and circulating monocytes were 13.6, 10.31, and 18.0, respectively, in
apoE⫺/⫺ mice; whereas the respective ratios were 1.5, 2.2,
and 1.1 in apoE ⫺/⫺/fat-1 mice, showing that although both
groups were fed the same diet, their body fatty acid profiles
were quite different.
Atherosclerotic Lesions
At the end of feeding, apoE⫺/⫺ mice developed severe
atherosclerotic lesions, as measured by the en face method.
Sudan IV stains of the entire aortas from the mice indicated
that the total lesion areas of prominent lipid-rich atheromas
were dramatically reduced in apoE⫺/⫺/fat-1 mice (Figure
2A). Quantitative analysis revealed that the percentage of
Sudan IV–stained area of the entire aorta in apoE⫺/⫺/fat-1
mice was significantly lower than that in apoE⫺/⫺ mice, by
46.7% (Figure 2B). The atherosclerotic plaques in the segments of the aortic arch and the thoracic aorta were also
significantly less in apoE⫺/⫺/fat-1 mice (17.47⫾2.08% and
0.97⫾0.17%, respectively), compared with apoE⫺/⫺ mice
(30.74⫾2.77% and 4.34⫾0.96%, respectively). However,
there was no significant difference in the abdominal aorta
between the 2 groups (Figure 2C).
The crosssectional histological features of the aortic sinus
from apoE⫺/⫺ and apoE⫺/⫺/fat-1 mice stained with oil red O
(lipid-containing lesions) and subsequent hematoxylin (nucleus) are shown in supplemental Figure A and B. The largest
lesions were found in the proximal aorta near the aortic valve.
The atherosclerotic plaques of the aortic sinus were more
prominent in apoE⫺/⫺ mice than in apoE⫺/⫺/fat-1 mice.
Because of variation in the size of the aortas, the percentages
of stenosis and intrusion were calculated to quantify the
extent of atherosclerosis in the aortic sinus (supplemental
Figure, C and D). The stenosis and intrusion in the aortic sinus
were significantly reduced in apoE⫺/⫺ /fat-1 mice
(30.34⫾1.98% and 47.57⫾2.58%, respectively), compared with
apoE⫺/⫺ littermates (39.67⫾1.83% and 59.54⫾1.52%,
respectively).
Production of Cytokines and Inflammatory
Lipid Mediators
To obtain insight into the underlying mechanism by which
the decreased tissue ratio of n-6/n-3 fatty acids reduced the
development of atherosclerotic lesions, the status of systemic
Wan et al
Role of n-6/n-3 Fatty Acid Ratio in Atherosclerosis
2491
monocytes (Figure 3C) and atherosclerotic aorta (Figure 3D).
The mRNA levels of the intercellular adhesion molecule-1
(ICAM-1), cytokines (TNF- ␣ and IL-6), chemokine
(monocyte chemoattractant protein-1 [MCP-1]), and cyclooxygenase-2 (COX-2), a key enzyme in the production of
PGE2, in the circulating monocytes were decreased significantly in apoE⫺/⫺/fat-1 mice; and vascular cell adhesion
molecule-1 mRNA expression was also lower but not statistically different. In the atherosclerotic aorta, the mRNA
expression of all genes tested was lower in apoE⫺/⫺/fat-1
mice compared with their apoE⫺/⫺ littermates, although the
changes in vascular cell adhesion molecule-1 and TNF-␣
expression did not reach statistical significance.
Nuclear Factor ␬B Expression and
Macrophage Accumulation
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 2. Effect of the n-6/n-3 fatty acid ratio on atherosclerotic
plaque development in apoE⫺/⫺ mice. A through C, Atherosclerotic lesions were assessed by staining with Sudan IV (A) and
expressed as percentage surface area for the entire aorta (B)
and individual segments (C). Data are given as mean⫾SEM
(n⫽6). *P⬍0.05 and **P⬍0.01 vs the apoE⫺/⫺ group.
and vascular inflammation was investigated. We examined
the production of cytokines (TNF-␣ and IL-6) and the
inflammatory lipid mediator (PGE2) in the plasma and aorta
culture medium. In contrast to their apoE⫺/⫺ counterparts,
plasma levels of both IL-6 and PGE2 in apoE⫺/⫺/fat-1 mice
were significantly decreased by 47.1% and 36.3%, respectively (Figure 3A). However, TNF-␣ levels in the plasma
from both groups of mice were less than the limit of
detection.
To measure the secretion of cytokines and lipid mediators
in the aorta, we developed an ex vivo organ culture assay by
using isolated aorta. The amounts of TNF-␣, IL-6, and PGE2
in the organ culture medium released from the aortic tissue
were measured. To account for differences in tissue size and
total cellular composition, total genomic DNA of each aorta
was extracted after the 24-hour incubation. The amounts of
TNF-␣, IL-6, and PGE2 released from the isolated aorta of
apoE⫺/⫺/fat-1 mice were significantly less than those released from apoE⫺/⫺ counterpart aortas, after normalization
to genomic DNA content (Figure 3B).
Expression of Inflammation-Related Genes
To examine whether the alteration of tissue n-6/n-3 fatty acid
ratio affects the expression of inflammation-related genes, we
evaluated the mRNA transcription of several key factors
using real-time RT-PCR. The decreased ratio of n-6/n-3 fatty
acids resulted in changes of gene expression in circulating
We subsequently examined the expression of NF-␬B, a
pivotal transcription factor that regulates the transcription of
many inflammatory genes in atherosclerosis, such as cytokines, chemokines, and adhesion molecules,35 by using immunofluorescent staining. The expression of NF-␬B/p65, the
most abundant complex of the NF-␬B family, was lower in
the plaque of apoE⫺/⫺/fat-1 mice compared with their
apoE⫺/⫺ counterparts (Figure 4A).
Increasing expression of chemokines and adhesion molecules results in the migration of monocytes to the site where
the monocytes will differentiate into macrophages, causing
lesions to develop.35 To examine macrophage accumulation
in atherosclerosis, the specific monocyte/macrophage marker
F4/80 in plaque was stained and evaluated. As shown in
Figure 4B, a weaker F4/80 staining was observed in the
plaque of apoE⫺/⫺/fat-1 mice, indicating a decreased accumulation of F4/80-positive macrophage in atherosclerotic
lesions.
Discussion
We used the fat-1 transgenic model to investigate the role of
tissue n-6/n-3 fatty acid ratio in the development of atherosclerosis. Our results demonstrate that a decreased tissue
n-6/n-3 fatty acid ratio notably reduced the atherosclerotic
lesions in the aorta of apoE⫺/⫺ mice fed a Western-type diet.
This protection against atherosclerosis correlated with reduced expression of proinflammatory cytokines, chemokines,
and adhesion molecules in aortas and circulating monocytes;
and decreased NF-␬B expression and recruitment of macrophages into atherosclerotic plaques. These findings suggest
that a low tissue ratio of n-6/n-3 fatty acids is protective
against atherosclerosis in apoE⫺/⫺ mice by reducing inflammation both systemically and within the arterial wall, independent of a lipid-lowering effect.
Although a number of previous studies have examined the
preventive effect of dietary long-chain n-3 PUFAs against the
formation of atherosclerotic lesions in apoE-deficient
mice,3,4,6 the outcomes were inconsistent or conflicting.9 –11,36
These studies focused on the preventive effect of n-3 PUFAs
against atherosclerosis, whereas the potential effects of the
background n-6 PUFA levels were not addressed. Furthermore, dietary supplementation, a traditional approach to
modifying tissue nutrient composition, was used in these
2492
Arterioscler Thromb Vasc Biol
December 2010
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 3. The production and expression of inflammation-related factors. A and B, The levels of cytokines (TNF-␣ and IL-6) and the
inflammatory lipid mediator (PGE2) in the plasma (A, n⫽10) and ex vivo culture medium of aorta (B, n⫽4) were examined. The TNF-␣
level in the plasma of all animals was less than the limit of detection. The levels of TNF-␣, IL-6, and PGE2 in culture medium were normalized to the genomic DNA content. C and D, The expression of inflammation-related genes in circulating monocytes (C) and entire
aorta tissue (D) in apoE⫺/⫺ and apoE ⫺/⫺/fat-1 mice was measured using real-time RT-PCR. Data are given as the mean⫾SEM.
*P⬍0.05 and **P⬍0.01 vs the apoE ⫺/⫺ group.
studies. However, the inevitable differences between diets
can act as confounding factors that may contribute to inconsistent results and make the results of these studies difficult to
compare. The problems described could easily be resolved by
using the fat-1 transgenic model, as presented in this study.
This genetic approach to modifying fatty acid composition by
endogenously converting n-6 to n-3 fatty acids not only
effectively increases the absolute amounts of n-3 fatty acids
but also significantly decreases the levels of n-6 fatty acids,
leading to a low n-6/n-3 fatty acid ratio in body tissues
without changing the tissue mass of total PUFAs (Table).27
More importantly, this animal model allows us to generate 2
different fatty acid profiles between 2 experimental groups
while feeding them the same high n-6 diet. Thus, many
variables that may arise from differing diets and feeding
procedures, such as impurities, unwanted components of oils
used, flavor, oxidation, diet freshness, and storage, can be
avoided. As a well-controlled system, the fat-1 transgenic
mouse was chosen to be the model of a low n-6/n-3 fatty acid
ratio in the present study.
The apoE-deficient mice, generated in 1992, are perhaps
the most popular model for atherosclerotic studies because
of their propensity to spontaneously develop atherosclerotic
lesions, highly characteristic in appearance and distribution of
those observed in humans.28 ApoE acts as a ligand for
low-density lipoprotein receptors, low-density lipoprotein
receptor–related protein, and cell surface proteoglycans;
thereby, it has an important role in the clearance of remnants
of TG-rich lipoproteins. Genetic deficiency of apoE in
murine results in major defects in TG and very-low-density
lipoprotein clearance from blood circulation.37 Long-chain
n-3 fatty acids or fish oils are well known to be efficient
TG-lowering agents in both human and animal models38,39
and can reduce TG synthesis in apoE⫺/⫺ mice.40 However, in
the present study, the heightened n-3 fatty acid tissue status
significantly increased the plasma TG concentration in
apoE⫺/⫺ mice; no differences in plasma cholesterol or highand low-density lipoprotein levels were observed between the
fat-1 and control groups. These observations in apoE⫺/⫺ mice
are consistent with the results obtained in previous reports.3,4,6,40 These results suggest that the decreased TG
synthesis caused by n-3 fatty acids is not sufficient in
lowering the circulating TG concentrations and that apoE is
necessary for n-3 fatty acids to reduce TG levels in mice.40
Although a lipid-lowering effect has been thought to be one
of the major antiatherosclerotic mechanisms, it seems that the
antiatherosclerotic effect of n-3 fatty acids observed in our
study is independent of the lipid-lowering effect.
It has become well established that inflammatory events,
both systemically and in the arterial wall, play a pivotal role
Wan et al
Role of n-6/n-3 Fatty Acid Ratio in Atherosclerosis
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 4. A and B, Representative light and immunofluorescent
staining of NF-␬B/p65 (A) and macrophage marker F4/80 (B) in
the frozen section of the proximal aorta isolated from apoE⫺/⫺
and apoE⫺/⫺/fat-1 mice. To quench the autofluorescence
caused by the internal elastic lamina, the labeling sections were
incubated with 0.5% pontamine sky blue in PBS for 10 minutes,
followed by a 5-minute wash before mounting (original magnification ⫻200).
during all phases of atherosclerosis, from fatty streak formation to plaque destabilization and, subsequently, atherothrombosis.41– 43 The systemic inflammatory disorders are characterized by activation of leukocytes and increased
concentrations of cytokines and other inflammatory lipid
mediators. This may result in endothelial dysfunction and
secondary dyslipidemia and, subsequently, accelerate the
atherosclerotic process.41 Our data revealed that a decreased
tissue ratio of n-6/n-3 fatty acids remarkably reduced both
IL-6 and PGE2 levels in plasma and downregulated several
inflammatory genes in circulating monocytes, including
ICAM-1, IL-6, TNF-␣, MCP-1, and COX-2, suggesting that
a decreased n-6/n-3 fatty acid ratio can reduce systemic
inflammation in the atherosclerotic process.
Circulating monocyte activation and transendothelial migration, with subsequent differentiation into macrophages,
are important events in the initial pathogenesis of atherosclerosis.42 The recruitment of monocytes to lesion-prone arterial
sites is regulated by cell adhesion molecules, such as ICAM-1
2493
and vascular cell adhesion molecule-1, which are expressed
on the surface of endothelial cells, and chemotactic proteins,
including MCP-1.42,44 The cytokines produced by various cell
types, including infiltrated macrophages, endothelial cells,
and smooth muscle cells, are critically important in the
progression of atherosclerosis.42 The present study clearly
demonstrates that a decreased ratio of n-6/n-3 fatty acids has
an inhibitory effect on inflammation in the local arterial wall,
as evidenced by the reduced expression of inflammationrelated genes, including ICAM-1, MCP-1, IL-6, and COX-2,
less macrophage infiltration; and lower production of IL-6,
TNF-␣, and PGE2. Given the fact that NF-␬B controls the
transcription of many genes with an established role in
atherosclerosis, such as cytokines, chemokines, adhesion
molecules, and macrophage infiltration,45 the most plausible
underlying mechanism for the antiinflammatory effect of a
low n-6/n-3 fatty acid ratio may be the inhibition of NF-␬B
expression, as demonstrated by an immunohistochemical
assay. This result was in agreement with previous reports.3,46
Altogether, a decreased tissue n-6/n-3 fatty acid ratio appears
to inhibit vascular inflammation via multiple mechanisms
during atherosclerosis. The observation that the conversion of
n-6 PUFAs to n-3 PUFAs leads to a reduction in vascular
inflammation and plaque formation in apoE⫺/⫺ mice supports
the notion that the effects of n-6 and n-3 PUFAs in atherosclerosis are differential or opposing.
In conclusion, to our knowledge, this is the first study to
provide direct evidence for the role of tissue n-6/n-3 ratio in
atherosclerosis using the fat-1 transgenic mice model. The
decreased n-6/n-3 fatty acid ratio reduced atherosclerotic
lesions in apoE⫺/⫺ mice, likely because of the antiinflammatory effects of n-3 fatty acids rather than a lipidlowering effect. Our findings provide new insights into the
role of tissue n-6/n-3 fatty acid ratio in the development of
atherosclerosis.
Acknowledgments
The authors thank Chengwei He, PhD, and Jing Liu, MD, PhD, for
their excellent technical assistance; and Shannon Bates, BS, and
Marina Kang for their help in manuscript polishing.
Sources of Funding
This study is partly supported by the E-fund Education Foundation,
Guangzhou, China.
Disclosures
None.
References
1. Allayee H, Roth N, Hodis HN. Polyunsaturated fatty acids and cardiovascular disease: implications for nutrigenetics. J Nutrigenet Nutrigenomics. 2009;2:140 –148.
2. Yashodhara BM, Umakanth S, Pappachan JM, Bhat SK, Kamath R, Choo
BH. Omega-3 fatty acids: a comprehensive review of their role in health
and disease. Postgrad Med J. 2009;85:84 –90.
3. Casos K, Saiz MP, Ruiz-Sanz JI, Mitjavila MT. Atherosclerosis prevention by a fish oil-rich diet in apoE(-/-) mice is associated with a
reduction of endothelial adhesion molecules. Atherosclerosis. 2008;201:
306 –317.
4. Matsumoto M, Sata M, Fukuda D, Tanaka K, Soma M, Hirata Y, Nagai
R. Orally administered eicosapentaenoic acid reduces and stabilizes atherosclerotic lesions in ApoE-deficient mice. Atherosclerosis. 2008;197:
524 –533.
2494
Arterioscler Thromb Vasc Biol
December 2010
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
5. Rizza S, Tesauro M, Cardillo C, Galli A, Iantorno M, Gigli F, Sbraccia P,
Federici M, Quon MJ, Lauro D. Fish oil supplementation improves
endothelial function in normoglycemic offspring of patients with type 2
diabetes. Atherosclerosis. 2009;206:569 –574.
6. Wang HH, Hung TM, Wei J, Chiang AN. Fish oil increases antioxidant
enzyme activities in macrophages and reduces atherosclerotic lesions in
apoE-knockout mice. Cardiovasc Res. 2004;61:169 –176.
7. De Caterina R, Massaro M. Omega-3 fatty acids and the regulation of
expression of endothelial pro-atherogenic and pro-inflammatory genes.
J Membr Biol. 2005;206:103–116.
8. Li S, Sun Y, Liang CP, Thorp EB, Han S, Jehle AW, Saraswathi V,
Pridgen B, Kanter JE, Li R, Welch CL, Hasty AH, Bornfeldt KE, Breslow
JL, Tabas I, Tall AR. Defective phagocytosis of apoptotic cells by
macrophages in atherosclerotic lesions of ob/ob mice and reversal by a
fish oil diet. Circ Res. 2009;105:1072–1082.
9. Ascherio A, Rimm EB, Stampfer MJ, Giovannucci EL, Willett WC.
Dietary intake of marine n-3 fatty acids, fish intake, and the risk of
coronary disease among men. N Engl J Med. 1995;332:977–982.
10. De Caterina R, Zampolli A. n-3 Fatty acids: antiatherosclerotic effects.
Lipids. 2001;36(suppl):S69 –S78.
11. Adan Y, Shibata K, Ni W, Tsuda Y, Sato M, Ikeda I, Imaizumi K.
Concentration of serum lipids and aortic lesion size in female and male
apo E-deficient mice fed docosahexaenoic acid. Biosci Biotechnol
Biochem. 1999;63:309 –313.
12. James MJ, Gibson RA, Cleland LG. Dietary polyunsaturated fatty acids
and inflammatory mediator production. Am J Clin Nutr. 2000;71:
343S–348S.
13. Serhan CN, Chiang N, Van Dyke TE. Resolving inflammation: dual
anti-inflammatory and pro-resolution lipid mediators. Nat Rev Immunol.
2008;8:349 –361.
14. Schonbeck U, Sukhova GK, Graber P, Coulter S, Libby P. Augmented
expression of cyclooxygenase-2 in human atherosclerotic lesions. Am J
Pathol. 1999;155:1281–1291.
15. Sanchez-Galan E, Gomez-Hernandez A, Vidal C, Martin-Ventura JL,
Blanco-Colio LM, Munoz-Garcia B, Ortega L, Egido J, Tunon J. Leukotriene B4 enhances the activity of nuclear factor-kappaB pathway
through BLT1 and BLT2 receptors in atherosclerosis. Cardiovasc Res.
2009;81:216 –225.
16. Kang JX, Weylandt KH. Modulation of inflammatory cytokines by
omega-3 fatty acids. Subcell Biochem. 2008;49:133–143.
17. Massaro M, Scoditti E, Carluccio MA, Campana MC, De Caterina R.
Omega-3 fatty acids, inflammation and angiogenesis: basic mechanisms
behind the cardioprotective effects of fish and fish oils. Cell Mol Biol
(Noisy-le-grand). 2010;56:59 – 82.
18. Merched AJ, Ko K, Gotlinger KH, Serhan CN, Chan L. Atherosclerosis:
evidence for impairment of resolution of vascular inflammation governed
by specific lipid mediators. FASEB J. 2008;22:3595–3606.
19. Leaf A, Weber PC. A new era for science in nutrition. Am J Clin Nutr.
1987;45:1048 –1053.
20. Simopoulos AP. Evolutionary aspects of diet, the omega-6/omega-3 ratio
and genetic variation: nutritional implications for chronic diseases.
Biomed Pharmacother. 2006;60:502–507.
21. Xia S, Lu Y, Wang J, He C, Hong S, Serhan CN, Kang JX. Melanoma
growth is reduced in fat-1 transgenic mice: impact of omega-6/omega-3
essential fatty acids. Proc Natl Acad Sci U S A. 2006;103:12499 –12504.
22. Seaman DR. The diet-induced proinflammatory state: a cause of chronic
pain and other degenerative diseases? J Manipulative Physiol Ther. 2002;
25:168 –179.
23. Zhang L, Geng Y, Xiao N, Yin M, Mao L, Ren G, Zhang C, Liu P, Lu
N, An L, Pan J. High dietary n-6/n-3 PUFA ratio promotes HDL cholesterol level, but does not suppress atherogenesis in apolipoprotein E-null
mice 1. J Atheroscler Thromb. 2009;16:463– 471.
24. Simopoulos AP. The importance of the omega-6/omega-3 fatty acid ratio
in cardiovascular disease and other chronic diseases. Exp Biol Med
(Maywood). 2008;233:674 – 688.
25. Kang JX. The importance of omega-6/omega-3 fatty acid ratio in cell
function: the gene transfer of omega-3 fatty acid desaturase. World Rev
Nutr Diet. 2003;92:23–36.
26. Kang JX, Wang J, Wu L, Kang ZB. Transgenic mice: fat-1 mice convert
n-6 to n-3 fatty acids. Nature. 2004;427:504.
27. Kang JX. Fat-1 transgenic mice: a new model for omega-3 research.
Prostaglandins Leukot Essent Fatty Acids. 2007;77:263–267.
28. Nakashima Y, Plump AS, Raines EW, Breslow JL, Ross R. ApoEdeficient mice develop lesions of all phases of atherosclerosis throughout
the arterial tree. Arterioscler Thromb Vasc Biol. 1994;14:133–140.
29. Piedrahita JA, Zhang SH, Hagaman JR, Oliver PM, Maeda N. Generation
of mice carrying a mutant apolipoprotein E gene inactivated by gene
targeting in embryonic stem cells. Proc Natl Acad Sci U S A. 1992;89:
4471– 4475.
30. Kang JX, Wang J. A simplified method for analysis of polyunsaturated
fatty acids. BMC Biochem. 2005;6:5.
31. Yagyu H, Ishibashi S, Chen Z, Osuga J, Okazaki M, Perrey S, Kitamine
T, Shimada M, Ohashi K, Harada K, Shionoiri F, Yahagi N, Gotoda T,
Yazaki Y, Yamada N. Overexpressed lipoprotein lipase protects against
atherosclerosis in apolipoprotein E knockout mice. J Lipid Res. 1999;40:
1677–1685.
32. Wan JB, Lee SM, Wang JD, Wang N, He CW, Wang YT, Kang JX.
Panax notoginseng reduces atherosclerotic lesions in ApoE-deficient
mice and inhibits TNF-alpha-induced endothelial adhesion molecule
expression and monocyte adhesion. J Agric Food Chem. 2009;57:
6692– 6697.
33. Olszanecki R, Jawien J, Gajda M, Mateuszuk L, Gebska A, Korabiowska
M, Chlopicki S, Korbut R. Effect of curcumin on atherosclerosis in
apoE/LDLR-double knockout mice. J Physiol Pharmacol. 2005;56:
627– 635.
34. Cowen T, Haven AJ, Burnstock G. Pontamine sky blue: a counterstain for
background autofluorescence in fluorescence and immunofluorescence
histochemistry. Histochemistry. 1985;82:205–208.
35. de Winther MP, Kanters E, Kraal G, Hofker MH. Nuclear factor kappaB
signaling in atherogenesis. Arterioscler Thromb Vasc Biol. 2005;25:
904 –914.
36. Zampolli A, Bysted A, Leth T, Mortensen A, De Caterina R, Falk E.
Contrasting effect of fish oil supplementation on the development of
atherosclerosis in murine models. Atherosclerosis. 2006;184:78 – 85.
37. Osada J, Joven J, Maeda N. The value of apolipoprotein E knockout mice
for studying the effects of dietary fat and cholesterol on atherogenesis.
Curr Opin Lipidol. 2000;11:25–29.
38. Schmidt EB, Kristensen SD, De Caterina R, Illingworth DR. The effects
of n-3 fatty acids on plasma lipids and lipoproteins and other cardiovascular risk factors in patients with hyperlipidemia. Atherosclerosis. 1993;
103:107–121.
39. Harris WS. n-3 fatty acids and serum lipoproteins: animal studies. Am J
Clin Nutr. 1997;65:1611S–1616S.
40. Asset G, Bauge E, Fruchart JC, Dallongeville J. Lack of triglyceridelowering properties of fish oil in apolipoprotein e-deficient mice. Arterioscler Thromb Vasc Biol. 2001;21:401– 406.
41. van Leuven SI, Franssen R, Kastelein JJ, Levi M, Stroes ES, Tak PP.
Systemic inflammation as a risk factor for atherothrombosis. Rheumatology (Oxford). 2008;47:3–7.
42. Libby P. Inflammation in atherosclerosis. Nature. 2002;420:868 – 874.
43. Keaney JF Jr, Vita JA. The value of inflammation for predicting unstable
angina. N Engl J Med. 2002;347:55–57.
44. Greaves DR, Channon KM. Inflammation and immune responses in
atherosclerosis. Trends Immunol. 2002;23:535–541.
45. Xanthoulea S, Curfs DM, Hofker MH, de Winther MP. Nuclear factor
kappa B signaling in macrophage function and atherogenesis. Curr Opin
Lipidol. 2005;16:536 –542.
46. Mishra A, Chaudhary A, Sethi S. Oxidized omega-3 fatty acids inhibit
NF-kappaB activation via a PPARalpha-dependent pathway. Arterioscler
Thromb Vasc Biol. 2004;24:1621–1627.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Endogenously Decreasing Tissue n-6/n-3 Fatty Acid Ratio Reduces Atherosclerotic Lesions
in Apolipoprotein E−Deficient Mice by Inhibiting Systemic and Vascular Inflammation
Jian-Bo Wan, Li-Li Huang, Rong Rong, Rui Tan, Jingdong Wang and Jing X. Kang
Arterioscler Thromb Vasc Biol. 2010;30:2487-2494; originally published online August 12,
2010;
doi: 10.1161/ATVBAHA.110.210054
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2010 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/30/12/2487
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2010/08/12/ATVBAHA.110.210054.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Supplement Materials
Table I. Primer sequences used in the study
Gene
Primer Sequences
Sizes of products (bp)
18S
Forward:
Reverse:
CTGCCGTCTGAGTGTATCGC
GCTGGGGCTGAGGAAAGTG
85
ICAM-1
Forward:
Reverse:
GTGATGCTCAGGTATCCATCCA
CACAGTTCTCAAAGCACAGCG
213
VCAM-1
Forward:
Reverse:
AGTTGGGGATTCGGTTGTTCT
CCCCTCATTCCTTACCACCC
112
MCP-1
Forward:
Reverse:
TTAAAAACCTGGATCGGAACCAA
GCATTAGCTTCAGATTTACGGGT
121
TNF-α　Forward:
Reverse:
CCCTCACACTCAGATCATCTTCT
GCTACGACGTGGGCTACAG
61
IL-6
Forward:
Reverse:
TAGTCCTTCCTACCCCAATTTCC
TTGGTCCTTAGCCACTCCTTC
76
COX-2
Forward:
Reverse:
TGAGCAACTATTCCAAACCAGC
GCACGTAGTCTTCGATCACTATC
74
Table II. Food intake, body weight gain and plasma lipid profiles in apoE
−/−
and
apoE−/−/fat-1 mice.
Group
Food intake
(g/animal/day)
Body weight
gain (g)
Cholesterol
(mg/dl)
Triglycerides
(mg/dl)
HDL
(mg/dl)
LDL
(mg/dl)
apoE −/−
5.45±0.08
14.2±1.1
613.2±120.6
81.8±3.8
84.0±7.0
510.2±112.6
apoE −/−/fat-1
5.58±0.03
15.8±1.2
681.0±150.1
123.3±21.1*
79.7±8.2
576.9±138.6
Supplemental Figure
Figure I. Representative cross sections of aortic sinus from apoE −/− (A) and apoE −/−/fat-1 (B)
mice after oil red O staining. Data of atherosclerotic lesions was expressed as
percentage of stenosis (C) and intrusion (D), which were calculated as lesion
area/(lesion area + lumen area)×100 and lesion area/(lesion area + media area)×100,
respectively. Values are mean±SEM (n=4-5), *P < 0.05 and **P < 0.01 vs apoE −/−
group (Magnification, ×40).