FEBS Letters 589 (2015) 3671–3678
journal homepage: www.FEBSLetters.org
MiR-455-3p regulates early chondrogenic differentiation via inhibiting
Runx2
Zhiqi Zhang 1, Changhe Hou 1, Fangang Meng, Xiaoyi Zhao, Ziji Zhang, Guangxin Huang, Weishen Chen,
Ming Fu ⇑, Weiming Liao ⇑
Department of Joint Surgery, First Affiliated Hospital of Sun Yat-sen University, Guangzhou, Guangdong 510080, China
a r t i c l e
i n f o
Article history:
Received 7 April 2015
Revised 20 July 2015
Accepted 24 September 2015
Available online 20 October 2015
Edited by Zhijie Chang
Keywords:
Chondrogenesis
MiR-455-3p
Runt-related transcription factor 2
a b s t r a c t
The expression of miR-455-3p has been shown to be up-regulated in chondrogenesis of mesenchymal stem cell, but its role in different stages during chondrogenesis remains unknown. Here, we
show that miR-455-3p is increased in ATDC5 cells from 0 d to 21 d, but rapidly decreases at 28 d,
and a similar expression kinetic is detected in the development of mouse embryos. We show that
miR-455-3p functions as an activator for early chondrogenic differentiation, most likely by inhibiting the expression of Runt-related transcription factor 2 (Runx2) as indicated by luciferase reporter
assays. In conclusion, miR-455-3p may activate early chondrogenesis by directly targeting Runx2.
Ó 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
1. Introduction
MicroRNAs (miRNAs) are a group of non-coding, single
stranded, small RNAs (22 nt in length) that have been identified
as important post-transcriptional regulators [2]. MiRNAs function
as regulators in gene silencing by binding to the 30 -untranslated
region (30 UTR) of target mRNAs, leading to translational repression.
miRNAs have been reported to have important roles in multiple
biological processes, including the process of cartilage differentiation
and degradation [1,3–7,38–40]. Dicer is an essential component
Author contributions: Conception and experiment design: Zhiqi Zhang, Ming Fu,
Weiming Liao; Analysis and interpretation of the data: Zhiqi Zhang, Changhe Hou,
Fangang Meng, Weiming Liao, Ming Fu, Xiaoyi Zhao, Ziji Zhang, Guangxin Huang,
Weishen Chen; Drafting of the article: Zhiqi Zhang, Changhe Hou, Fangang Meng,
Weiming Liao, Ming Fu; Critical revision of the article for important intellectual
content: Zhiqi Zhang, Ming Fu, Weiming Liao; Final approval of the article: Zhiqi
Zhang, Ming Fu, Weiming Liao; Collection and assembly of data: Zhiqi Zhang,
Changhe Hou, Fangang Meng, Xiaoyi Zhao, Guangxin Huang, Weishen Chen.
Grant support: These studies were funded by the National Natural Science
Foundation of China (Nos. 81201388, 81301558, 81171709 and 81171759)
and the Natural Science Foundation of Guangdong Province, China (No.
2014A030313186).
⇑ Corresponding authors at: Department of Orthopaedic Surgery, First Affiliated
Hospital of Sun Yat-sen University, #58 Zhongshan 2nd Road, Guangzhou 510080,
China. Fax: +86 20 8733 2150 (W. Liao). Department of Joint Surgery, First Affiliated
Hospital of Sun Yat-sen University, #58 Zhongshan 2nd Road, Guangzhou 510080,
China. Fax: +86 20 8733 2150 (M. Fu).
E-mail addresses: [email protected] (M. Fu), [email protected] (W. Liao).
1
These authors contributed equally to this study.
for the biogenesis of miRNAs, and Dicer-null growth plates showed
a progressive reduction in the proliferation of chondrocytes and
the acceleration of hypertrophy, leading to severe skeletal growth
defects and premature death in mice [8]. MiR-335-5p was
significantly increased during mouse mesenchymal stem cell
(MSC) chondrogenesis, and it could up-regulate the expression of
chondrogenic marker genes by targeting negative regulators of
SRY (sex-determining region Y)-box 9 (Sox9), including Daam1
and ROCK1 [9]. Senescent p16INK4a induced the production of
matrix metallopeptidase1 (MMP1) and MMP13, and as a negative
regulator of p16INK4a, miR-24 was repressed while p16INK4a
expression was increased upon the addition of IL-1b to
osteoarthritis (OA) cartilage and during terminal chondrogenesis
[10]. MiR-337 expression was significantly down-regulated and
disappeared in the maturation phase of endochondral ossification,
and it could regulate the expression of transforming growth factor
beta receptor II (TGFBR2); therefore, it might be associated with
chondrogenesis by regulating TGFBR2 [39]. MiR-145 is decreased
during TGF-b3-inducedchondrogenic differentiation, and it regulates chondrogenesis by directly targeting Sox9 at the early stage
of chondrogenic differentiation [40].
We previously profiled miRNA expression during chondrogenesis of human adipose-derived stem cells (hADSCs) by miRNA
microarray and found that the expression of several miRNAs
changed significantly, which included eight up-regulated
miRNAs (miR-193b, miR-199a-3p/hsa-miR-199b-3p, miR-4553p, miR-210, miR-381, miR-92a, miR-320c, and miR-136) and
http://dx.doi.org/10.1016/j.febslet.2015.09.032
0014-5793/Ó 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
3672
Z. Zhang et al. / FEBS Letters 589 (2015) 3671–3678
four down-regulated miRNAs (miR-490-5p, miR-4287, miRBART8⁄, and miR-US25-1⁄) [1]. MiR-455-3p was first sequenced
in 250 small RNA libraries from 26 different organ systems and
types of cells in humans and rodents that were enriched in neuronal as well as normal and malignant hematopoietic cells and
tissues [11]; it was then found in human cancer cells [12,13].
Recently, miR-455-3pwas found to be involved in chondrogenesis, and its actions against the DPP homologs in the (Smad)-2/3
pathway were suppressed by regulating TGFb signaling [1,5].
Based on our continuing investigation on the exact biological
function and mechanisms of these miRNAs, we found that
miR-455-3p was an interesting regulator during chondrogenesis
and might have a role in osteoarthritis by potentially targeting
Runt-related transcription factor 2 (Runx2) as we previously
reported after computational analysis [1].
Runx genes are a set of multi-function transcriptional factors
that regulate the expression of genes involved in cellular differentiation, including chondrogenesis [14,15]. Runx2, also known as
core-binding factor subunit alpha-1 (CBF-alpha-1), is a member
of the Runx family. Runx2 was first shown to be a key transcription
factor associated with osteoblast differentiation, but it also has an
important role in the acceleration of hypertrophic chondrocyte differentiation and endochondral ossification [16–19]. Deletion of
Runx2 in chondrocytes causes failure of endochondral ossification
and lethality at birth, and it directly regulates a set of cell cycle
genes Gpr132, Sfn, c-Myb, and Cyclin A1 to control the proliferative
capacity of chondrocytes [20]. Runx2 also mediates chondrogenesis and ossification as a co-regulator with Smad, TGF-b, and
CCAAT/enhancer binding protein beta (C/EBPb) [5,21]. Furthermore, Runx2 regulates the differentiation of MSCs as the target
of miRNAs [22,23]. Recently, miR-455-3p was found to be
expressed in the ATDC5 cell model of chondrogenesis and in adult
articular cartilage, as shown in human MSCs, and it regulated TGFb
signaling by suppressing the Smad2/3 pathway, which contributes
to cartilage destruction [5]. In this study, we investigated the
function of miR-455-3p in early chondrogenesis to explore its
relationship with Runx2.
2. Materials and methods
2.1. Cell culture
ATDC5 mouse cells (Riken Cell Bank, Ibaraki, Japan) were
cultured with DMEM/F12 plus 5% fetal bovine serum (FBS), 1%
penicillin and streptomycin in a 37 °C and 5% CO2 humid
atmosphere. The culture medium was changed every 2 d and
subculture was performed when cells reached confluence during
expansion culture. All of the experiments were finished within
20 passages. Chondrogenic differentiation was induced with
ITS+ (BD Biosciences, USA). The chondrogenic culture medium
was changed every day. 293T cells were grown in DMEM (Gibco,
USA) supplemented with 10% FBS.
(IACUC No. 2012-0704). They were sacrificed at E10.5, E14.5, and
E18.5. Embryos were collected, fixed in DEPC-treated 10% formalin
at 4 °C overnight, and stored in DEPC-treated 70% ethanol. Embryos
were embedded in paraffin and cut continually at 5-um thickness.
Sections were incubated in 10 lg/mL Proteinase K (Promega, USA)
at 37 °C for 20 min. The sections were incubated with 50 -labeled
miR-455-3p probe (Exiqon, Denmark) at 56 °C for 60 min after
dehydration. Endogenous alkaline phosphatase was blocked at
room temperature for 15 min, and anti-Digoxigenin-AP (1: 500,
Roche, USA) was applied at room temperature for 1 h. Then, nitrobluetetrazolium (NBT)/BCIP (Sigma, USA) staining reactions were
performed. The sections were counterstained with nuclear fast
red solution (Sigma, USA) and dehydrated with ethanol. The
semi-quantitative analysis was performed with Image J. Signals
in the blue channel were obtained from five random areas and converted to optical density values, and the background was subtracted.
2.4. RNA extraction and reverse transcription
Total RNA was extracted with miRNeasy Mini Kit (Qiagen, USA)
following the manufacturer’s instructions. The concentration and
purity of the extracted RNA were analyzed using an Epoch
Multi-Volume Spectrophotometer System (Biotek, USA). The cDNA
of mRNA and miRNAs was obtained using PrimeScriptÒ miRNA
cDNA Synthesis Kit (Takara, Japan) following the manufacturer’s
instructions. The cDNA was then used for real-time quantitative
PCR (qPCR).
2.5. qPCR analysis
qPCR was performed using a SYBRÒ Premix Ex TaqTM II (Takara,
Japan) and BioRad IQ5 system by following the manufacturer’s
instructions. Primers were designed using Primer Express Version
5.0 (Applied Biosystems, Foster City, CA). The primer sequences
are listed in Table 1. The reverse primer for miRNAs was the UnimiRqPCR Primer (Takara, Japan). Quality control was ensured by
monitoring the melting curve. The fold differences of gene expression were normalized to U6 and GAPDH for miRNA and mRNA,
respectively. The fold difference of RNA expression was calculated
as v = 2DDCt. Each experiment was performed in triplicate and
repeated at least twice.
2.6. Western blotting
ATDC5 cells were lysed in lysis solution containing a protease
inhibitor cocktail. After centrifugation, the protein was separated
by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis
and transferred to nitrocellulose membranes, which were blocked
in 5% skim milk for 40 min at room temperature and probed with
antibodies against Runx2 (1:1000) and b-actin (Cell Signaling
Technology, USA) at 4 °C overnight. The anti-b-actin antibody
was used as an internal control. Protein bands were detected with
an enhanced chemiluminescence system (GE healthcare, England).
2.2. Alcian blue staining and morphological analysis
2.7. Mimics and inhibitor transfection assays
Cultured cells were fixed in formalin for 4 h at room temperature and then stained with alcian blue 8GX (Cyagen, USA) for
20 min at room temperature. The stained ATDC5 cells were
examined by microscopy (ZEISS, Axio Imager Z1). Photographs
were taken and saved.
2.3. In situ hybridization
The pregnant C57BL/6J mice were purchased from the Animal
Center of First Affiliated Hospital of Sun Yat-Sen University with
approval of the ethical committee at Sun Yat-Sen University
The ATDC5 cells were seeded in a 6-well plate with DMEM/F12
plus 10% FBS and allowed to grow to 70% confluence. Then, lipofectamineÒ 2000 Transfection Reagent (Invitrogen, USA) was used to
transfect the miR-455-3p mimics/inhibitor (Ribobio, China) into
cells according to the manufacturer’s instructions. After 6 h of
transfection, chondrogenic differentiation was induced by changing the medium to chondrogenic medium containing ITS+ Premix.
Total RNA was isolated from the transfected cells, followed by
qPCR. Each transfection experiment was performed in triplicate
samples and repeated at least twice.
Z. Zhang et al. / FEBS Letters 589 (2015) 3671–3678
Table 1
Primer sequences used for real-time quantitative PCR analysis.
Genes
Primer sequences
U6
Forward
Reverse
Forward
Reverse
Forward
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
mGAPDH
mMiR-455-3p
mCol2a1
mCol10a1
mAggrecan
mCOMP
mMMP13
mAdamts-5
mRunx-2
mC/EBPb
mSox9
mNF-kB2
CTCGCTTCGGCAGCACA
AACGCTTCACGAATTTGCGT
TGTGTCCGTCGTGGATCTGA
TTGCTGTTGAAGTCGCAGGAG
ACACTCCAGCTGGGGCAGTCCACGGGCATATACAC
CCCGCCTTCCCATTATTGAC
GGGAGGACGGTTGGGTATCA
TTCTGCTGCTAATGTTCTTGACC
GGGATGAAGTATTGTGTCTTGGG
CGCCACTTTCATGACCGAGAGAC
CCCCTTCGATAGTCCTGTCATTC
GCCGCCTGGGTGTCTTCTGCTTC
CCCCCACACACACACCCGTAGC
CCTTGATGCCATTACCAGTCT
ATAAGGTCACGGGATGGATGT
AACTTCGGTACTACAGAAGACAAGC
TTCCGTGGTAGGTCTAGCAAAC
ATGCTTCATTCGCCTCACAAA
GCACTCACTGACTCGGTTGG
GCGCCATCGACTTCAGCCCCTAC
CCGGCTTCTTGCTCGGCTTGG
GAGCCGGATCTGAAGAGGGA
GCTTGACGTGTGGCTTGTTC
GGCCGGAAGACCTATCCTACT
CTACAGACACAGCGCACACT
2.8. Dual luciferase reporter assay
The psiCHECK2 luciferase vector (Promega, USA) was used for
the dual luciferase assays. The 30 UTR of Runx2 was inserted using
the XhoI/NotI sites. Fragments of the 30 UTR of Runx2 were
obtained by PCR using Runx2 cDNA as the template. The primers
for Runx2 30 UTR were XhoIF, 50 -CCGCTCGAGCTAGAGTC-CTTCTGT
GGCATGCAC-30 , NotIR, 50 -ATAAGAATGCGGCCGCTAACAAAA-CCAA
AAAAGCCATTTTATTG-30 . The primers for mutation Runx2
(mutRunx2) F, 50 -AAGGATTCCCTCAATTCCGAGGAAAGCCTGACGCC
CAGAATCCAGGTT-AATACATGGA-30 , R, 50 -TCCATGTATTAACCTG
GATTCTGGGCGTCAGGC-TTTCCTCGGAATTGAGGGAATCCTT-30 . PCR
products were digested using XhoI/NotI (for wild-type) or DnpI
(for mutations) and cloned into the psiCHECK2 plasmid.
Luciferase assays were performed using the Dual-Luciferase
assay kit as described previously (Promega, USA). 293T cells were
co-transfected in 24-well plates with the indicated psiCHECK2
luciferase construct (0.5 lg/well) and miR-455-3p (mimic, inhibitor or negative control) (20 lM) using Lipofectamine 2000. After
48 h, the cells were harvested in passive lysis buffer, and luciferase
activity was determined using a GloMaxTM 20/20 luminometer
(Promega, USA). The luciferase data are expressed as a ratio of
Renilla luciferase (RL) to firefly luciferase (FL) to normalize for
the transfection variability between samples. Luciferase experiments were repeated in triplicate using independent samples as
indicated.
3. Results
3.1. Chondrogenic differentiation of ATDC5
ATDC5 cells at passage 3 were cultured in chondrogenic induction medium for the time indicated. The cells were then fixed and
stained with Alcian blue, where blue staining indicated the
synthesis of proteoglycans by chondrocytes. Chondrogenic ATDC5
cells stained positively for Alcian blue at 14 d, 21 d and 28 d
(Supplementary Fig. 1B–D), whereas cells without chondrogenic
induction were negatively stained at 14 d (Supplementary Fig. 1A).
To ascertain whether ATDC5 were chondrogenically differentiated with chondrogenic induction, the chondrogenesis-related
3673
gene expression detected by qPCR was illustrated (Fig. 1A–D).
Throughout the entire study period, levels of type II collagen
(Col2a1), Aggrecan and cartilage oligomeric matrix protein (COMP)
were significantly higher in the chondrogenic-induced group than
those in the control group; type X collagen (Col10a1) increased
slowly before 21 d, but was up-regulated quickly after 21 d. Overall, after chondrogenic differentiation, the expression of chondrogenic genes gradually and steadily increased, but did not reach
peak expression by the end of the four-week observation period.
These results provide evidence of chondrogenic differentiation
after the cells were exposed to the chondrogenic induction buffer.
3.2. The expression of miR-455-3p in the chondrogenic ATDC5 cell line
and mouse embryos
We reported that several miRNAs that are significantly
up-regulated during chondrogenic differentiation in human MSCs,
including miR-455-3p (approximately three-fold up-regulation)
[1]. Here, we showed that miR-455-3p was increased in ATDC5
cells in the 28-day time period, although the expression level
was higher (Fig. 1E). MiR-455-3p demonstrated a continuous
increase to 21 d in chondrogenic ATDC5 cells when compared to
0 d, but then rapidly decreased during the remaining time period
at 28 d.
We further examined expression of miR-455-3pin the development of mouse embryos (Fig. 2A–L). MiR-455-3p was expressed in
the skeletons of the developing limbs as early as E10.5 (Fig. 2C).
Strong expression was detected in developing long bones on
E10.5 to E14.5 (Fig. 2C and F). Later in the course of the mouse’s
development (E18.5), the expression became weaker and more
restricted to developing joints, especially in the middle part of
the finger bone, where ossification was initiated (Fig. 2I and K).
This trend in expression was similar to that of miR-455-3p
expression in ATDC5cells (Fig. 2L).
3.3. MiR-455-3p functions as an activator of early chondrogenic
differentiation
To confirm the function of miR-455-3p on chondrogenesis, the
miR-455-3p mimic and inhibitor were transfected into chondrogenic ATDC5 cells and incubated in the presence of chondrogenic
induction medium for an additional 4 d. Then, Col2a1, COMP, and
a disintegrin-like metallopeptidase with a thrombospondin
type 1 motif (Adamts-5) were tested after miR-455-3p was
over-expressed and knocked down by the miR-455-3p mimic and
inhibitor, respectively.
The expression of Col2a1 and COMP was approximately threeto eight-fold stronger than that of controls after transient transfection of the miR-455-3p mimic into chondrogenic ATDC5 cells, and
Adamts-5 was significantly decreased in a dose-dependent manner, confirming that miR-455-3p acts as an activator of chondrogenic differentiation (Fig. 3A). Moreover, Col2a1 and COMP were
down-regulated in a dose-dependent manner after the miR-4553p inhibitor was transfected into ATDC5 cells, but Adamts-5 was
up-regulated approximately seven-fold (Fig. 3B). Taken together,
these results indicate that miR-455-3p is the functional factor in
early chondrogenic differentiation.
3.4. The expression of Runx2 in the ATDC5 cell line during
chondrogenic differentiation
To identify the target genes of miR-455-3p, we first examined
whether the expression kinetics of SOX9, C/EBPb, nuclear factor
of the kappa light polypeptide gene enhancer in B-cells 2
(NF-kB2) and Runx2 were related tomiR-455-3p in the ATDC5 cell
line during chondrogenic differentiation, which we predicted in
3674
Z. Zhang et al. / FEBS Letters 589 (2015) 3671–3678
Fig. 1. The expression of chondrogenesis-related genes and miR-455-3p in the chondrogenic ATDC5 cell line. To determine the chondrogenesis-related gene expression and
confirm chondrogenic differentiation, cells were collected with/without chondrogenic induction at the indicated days. Col2a1, Col10a1, Aggrecan, COMP, and miR-455-3p
were detected using qPCR (A–E). The basal level was obtained using parallel growth media without chondrogenic induction at the same time point. Mean ± S.D. values
(n = 3 cultures) are presented on the graph.
previous computational studies [1]. The expression level of Runx2
steadily increased before 21 d, when miR-455-3p reached its
highest expression level, but significantly increased at 28 d, after
which miR-455-3p rapidly decreased (Fig. 4A). SOX9, C/EBPb and
NF-kB2 were more steadily expressed in the 28-day time period.
Therefore, Runx2 is a potential target of miR-455-3p during ATDC5
chondrogenesis. We further tested Runx2 by Western blot, and the
protein expression of Runx2 was similarly increased during
chondrogenesis.
3.5. MiR-455-3p functions as an inhibitor for Runx2 in chondrogenesis
To confirm the function of miR-455-3p on Runx2, the mimic or
inhibitor (0 nM, 50 nM, and 100nM) of miR455-3p were transiently
transfected into ATDC5 cells and stimulated for chondrogenesis for
approximately 4 d. The miR-455-3p was approximately 150-fold
higher and Runx2 was approximately 80% lower afterATDC5 cells
were transfected with miR-455-3p mimic (Fig. 5A). Furthermore,
when the miR-455-3p inhibitor was transfected into ATDC5 cells,
the miR-455-3p was decreased approximately 50% compared to
the control, and Runx2 was increased approximately three-fold
(Fig. 5B). The regulation of miR-455-3p showed a dosedependent response on Runx2 (Fig. 5A and B).
To further test whether the 30 UTR of Runx2 contained
sequences capable of interacting with miR-455-3p, luciferase
reporter assays were performed. The 30 UTR of Runx2 was inserted
into the psiCHECKTM-2 Vector using the XhoI/NotI sites and replicated with a vector. The relevant Runx2 30 UTR fragment was fused
to luciferase and transiently transfected into 293T cells and then
analyzed for its ability to repress luciferase activity. When a
miR-455-3p mimic (20 nM) that interacted with Runx2 30 UTR
was added, the luciferase activity of the Runx2 was approximately
30%weaker than that found when a miR-455-3p inhibitor, negative
control and blank were added; however, the luciferase activity of
Z. Zhang et al. / FEBS Letters 589 (2015) 3671–3678
3675
Fig. 2. The expression of miR-455-3p in mouse embryos. The presence of miR-455-3p in developing limb buds and claws of mice embryos was tested by in situ hybridization.
A–C, limb buds from E10.5 mice embryos were collected (100); D–F, claws from E14.5 mice embryos (100); G–I, claws from E18.5 mice embryos (100). A, D and G,
sections were stained following the standard protocol of Safrinin O staining. B, E, and H, negative control of in situ hybridization. C, F, I, J and K, sections were stained with the
probe of miR-455-3p. MiR-455-3p was detected throughout the entire chondrogenic limb bud as early as E10.5 (C). At E14.5, miR-455-3p was confined in the finger bone
(F, black arrow) compared to their negative control (E, white arrow). At E18.5, expression of miR-455-3p was also detected in the finger bone (I, K amplified from I) compared
to the negative control (H, J amplified from H, blue arrow). However, miR-455-3p expression decreased, especially in the middle part of the finger bone, where ossification
began (K, red and green arrow). The quantitative analysis of the expression of miR-455-3p was performed with Image J. Optical density values of five random areas in each
section were obtained and the background was subtracted (L).
3676
Z. Zhang et al. / FEBS Letters 589 (2015) 3671–3678
Fig. 3. Mir-455-3p functions as an activator of early chondrogenic differentiation.
The miR-455-3p mimic (A) and inhibitor (B) were transfected into chondrogenic
ATDC5 cells and incubated in the absence or presence of chondrogenic induction
medium for an additional 4 d. Expressions were measured by qPCR and expressed
relative to the level of 0 nM samples (set as 1) from three samples, and each
was repeated three times. Each bar represents the mean ± S.D. of at least three
independent experiments (*indicates P < 0.05; **indicates P < 0.01; ***indicates
P < 0.001).
between 7 d and 21 d. Col2a1 mRNA also gradually and steadily
increased, reaching peak expression at 21 d and then decreasing
throughout the 28 d observation period. As we know, chondrogenic cells commonly begin hypertrophic differentiation after
21 d [28–31], and we also showed that the hypertrophic marker
Col10a1 was significantly increased after 21 d of chondrogenic differentiation; thus, miR-455-3p might be involved in the acceleration of early chondrogenesis, but not hypertrophic differentiation.
Runx2 is an important regulator in chondrogenic differentiation
and endochondral ossification, and it was shown that Runx2
regulated endochondral ossification by controlling chondrocyte
proliferation and differentiation [1,27,32–34]. Runx2 was highly
expressed in hypertrophic chondrocytes and osteoblasts
[19,27,28], and C/EBPb could enhance Runx2 activity in ossification
[21]. The Runx2-dependent expression of sphingomyelin phosphodiesterase 3 (Smpd3) was increased by Bone morphogenic protein
2 (BMP-2) stimulation, and Smpd3 knockdown decreased the
apoptosis of terminally matured ATDC5 chondrocytes [33].
Furthermore, Runx2 regulated the differentiation of MSCs as the
target of miRNAs [22,23], such as miR-199a⁄, a BMP2-responsive
miRNA that regulates chondrogenesis via the direct targeting of
Smad1 in murine MSCs [35]. In this study, we showed that Runx2
was expressed more steadily before 21 d, then quickly increased
after 21 d, which indicated the involvement of Runx2 in hypertrophic differentiation. In contrast to Runx2 expression, the
increase of miR-455-3p was reversed during chondrogenesis.
Considering the time course of expression of miR-455-3p and
Runx2, we suggest that miR-455-3p is involved in the regulation
of Runx2 over time, especially in early chondrogenic differentiation. Co-regulation by miR-455 and Runx2 has been indirectly
the mutation Runx2 did not significantly change when a miR-4553p mimic was added (Fig. 5D). Taken together, these results
indicate that miR-455-3p acts as an inhibitor of Runx2.
4. Discussion
MiRNAs play an important role in differentiation and development across a wide range of organisms and tissue types, including
bone and cartilage development [1,5,6,8,24–26,38]. To explore the
specific involvement of miRNAs in the chondrogenesis of MSCs, we
previously used the miRNA microarray technique to profile miRNA
expression and screen miRNAs with significant differences in
expression before and after chondrogenic induction. We found that
miR-455-3p, miR-193b, miR-199a-3p/hsa-miR-199b-3p, miR-210,
miR-381, miR-92a, miR-320c, and miR-136 were up-regulated
[1]. In this work, we further studied the expression and regulation
of one representative miRNA known to be increased in chondrogenesis, miR-455-3p [1,5]. We demonstrated a critical role for
miR-455-3p as an activator in early chondrogenesis. We also
showed the regulatory role of miR-455-3p as an inhibitor of
the expression of Runx2 during chondrogenic differentiation.
Considering the important roles of Runx2 in the acceleration of
hypertrophic chondrocyte differentiation and endochondral
ossification [5,16,17,21,27], we concluded from these data that
miR-455-3p potentially alters chondrogenic differentiation.
Considering the time course of miR-455-3p expression, we suggested that miR-455-3p was involved in the early stage of chondrogenic differentiation, which was induced more quickly
Fig. 4. The expression of related transcription factors in chondrogenically differentiated ATDC5 cells from computational analysis. RNAs from different time points
of differentiated ATDC5 were tested, including 0 d, 14 d, 21 d, and 28 d (A).
Quantitative real-time PCR was performed with the indicated primers and the
fold-change of mRNA was normalized. Each bar represents the mean ± S.D. of fold
change compared with 0 d control samples (set as 1) from three samples, and each
was repeated three times. Runx2 proteins were examined by Western blot at
different time points of differentiated ATDC5 (B).
Z. Zhang et al. / FEBS Letters 589 (2015) 3671–3678
3677
Fig. 5. Mir-455-3p functions as an inhibitor of Runx2 in chondrogenesis. The 0 nM, 50 nM and 100 nM of miR-455-3p mimic (A) and inhibitor (B) were transfected into
chondrogenic ATDC5 cells and incubated in the presence of chondrogenic induction medium for an additional 4 d. Expressions of Runx2 and miR-455-3pwere measured by
qPCR and expressed relative to the level of control (0 d or 0 nM) samples (set as 1) from three samples, and each was repeated three times. Lastly, the Runx2 30 UTR reporter
plasmid or mutated 30 UTR reporter plasmid (mutRunx2) was co-transfected with miR-455-3p mimic (20 nM), inhibitor (20 nM) and negative control (20 nM) into 293T cells
(C). Statistical analysis indicated that in the group of cells transfected with the luciferase vector alone, the activity of miRNAs was similar to NC (negative control) and the
blank psi luciferase vector alone. In the group of cells transfected with the Runx2 30 UTR vector, the miR-455-3p mimic was able to reduce luciferase activity significantly
compared with the blank (set as 1), the miR-455-3p inhibitor and NC, but this reduction was not represented when transfected with mutRunx2 30 UTR vector. Each bar
represents the mean ± S.D. of at least three independent experiments (*indicates P < 0.05; **indicates P < 0.01; ***indicates P < 0.001).
found in several studies. It has been shown that Runx-2 could
co-regulate chondrogenesis with Smad genes [36,37], and miR-455
can suppress the Smad pathway during chondrogenesis [5]. We
further tested the co-regulation of miR-455-3p and Runx2 by the
transfection of a miR-455-3p mimic or inhibitor; the result showed
that the miR-455-3p mimic or inhibitor inhibited or induced
Runx2 expression, respectively. Moreover, the co-regulation of
Runx2 and miR-455-3p were confirmed by dual luciferase reporter
assay. Therefore, miR-455-3p could be an important regulator of
early chondrogenesis by suppressing the function of Runx2.
In summary, the data presented here show that miR-455-3p is
increased in the early stage of chondrogenesis, and it could
enhance early chondrogenesis by inhibitingRunx2. It can be
expected that this increase of miR-455-3p will have a significant
impact on cartilage cells and should be considered in the pathophysiology of cartilage regeneration. These studies provide the
basis for further investigation into the complicated function and
regulation of miR-455-3p in cartilage regeneration and degeneration, including the regulatory network of miR-455-3p, Runx2,
Smad2/3, and C/EBPb and the control of miR455-3p expression in
different stages during cartilage regeneration.
Conflicts of interest
The authors declare that they have no conflicts of interest.
Acknowledgments
The authors would like to thank Drs. Xuerong Li, Aishan He, Yan
Kang, and Zibo Yangat Sun Yat-Sen University for their valuable
assistance. The authors would also like to thank the Guangzhou
Elite Project (JY201420) for PhD Students.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.febslet.2015.09.
032.
References
[1] Zhang, Z., Kang, Y., Zhang, Z., Zhang, H., Duan, X., Liu, J., et al. (2012) Expression
of microRNAs during chondrogenesis of human adipose-derived stem cells.
Osteoarthritis Cartilage 20, 1638–1646.
[2] Carthew, R.W. and Sontheimer, E.J. (2009) Origins and mechanisms of miRNAs
and siRNAs. Cell 136, 642–655.
[3] Chen, C.Z., Li, L., Lodish, H.F. and Bartel, D.P. (2004) MicroRNAs modulate
hematopoietic lineage differentiation. Science 303, 83–86.
[4] Yan, C., Wang, Y., Shen, X.Y., Yang, G., Jian, J., Wang, H.S., et al. (2011)
MicroRNA regulation associated chondrogenesis of mouse MSCs grown on
polyhydroxyalkanoates. Biomaterials 32, 6435–6444.
[5] Swingler, T.E., Wheeler, G., Carmont, V., Elliott, H.R., Barter, M.J., Abu-Elmagd,
M., et al. (2012) The expression and function of microRNAs in chondrogenesis
and osteoarthritis. Arthritis Rheum. 64, 1909–1919.
3678
Z. Zhang et al. / FEBS Letters 589 (2015) 3671–3678
[6] Wu, C., Tian, B., Qu, X., Liu, F., Tang, T., Qin, A., et al. (2014) MicroRNAs play a
role in chondrogenesis and osteoarthritis (review). Int. J. Mol. Med. 34,
13–23.
[7] Brennecke, J., Hipfner, D.R., Stark, A., Russell, R.B. and Cohen, S.M. (2003)
Bantam encodes a developmentally regulated microRNA that controls cell
proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113,
25–36.
[8] Kobayashi, T., Lu, J., Cobb, B.S., Rodda, S.J., McMahon, A.P., Schipani, E., et al.
(2008) Dicer-dependent pathways regulate chondrocyte proliferation and
differentiation. Proc. Natl. Acad. Sci. U.S.A. 105, 1949–1954.
[9] Lin, X., Wu, L., Zhang, Z., Yang, R., Guan, Q., Hou, X., et al. (2014) MiR-335-5p
promotes chondrogenesis in mouse mesenchymal stem cells and is regulated
through two positive feedback loops. J. Bone Miner. Res. 29, 1575–1585.
[10] Philipot, D., Guerit, D., Platano, D., Chuchana, P., Olivotto, E., Espinoza, F., et al.
(2014) P16INK4a and its regulator miR-24 link senescence and chondrocyte
terminal differentiation-associated matrix remodelling in osteoarthritis.
Arthritis Res. Ther. 16, R58.
[11] Landgraf, P., Rusu, M., Sheridan, R., Sewer, A., Iovino, N., Aravin, A., et al. (2007)
A mammalian microRNA expression atlas based on small RNA library
sequencing. Cell 129, 1401–1414.
[12] Lui, W.O., Pourmand, N., Patterson, B.K. and Fire, A. (2007) Patterns of
known and novel small RNAs in human cervical cancer. Cancer Res. 67, 6031–
6043.
[13] Hamilton, M.P., Rajapakshe, K., Hartig, S.M., Reva, B., McLellan, M.D., Kandoth,
C., et al. (2013) Identification of a pan-cancer oncogenic microRNA
superfamily anchored by a central core seed motif. Nat. Commun. 4, 2730.
[14] Cohen, M.J. (2009) Perspectives on RUNX genes: an update. Am. J. Med. Genet.
A 149A, 2629–2646.
[15] Nah, G.S., Lim, Z.W., Tay, B.H., Osato, M. and Venkatesh, B. (2014) Runx family
genes in a cartilaginous fish, the elephant shark (Callorhinchus milii). PLoS One
9, e93816.
[16] Takeda, S., Bonnamy, J.P., Owen, M.J., Ducy, P. and Karsenty, G. (2001)
Continuous expression of Cbfa1 in nonhypertrophic chondrocytes uncovers its
ability to induce hypertrophic chondrocyte differentiation and partially
rescues Cbfa1-deficient mice. Genes Dev. 15, 467–481.
[17] Ueta, C., Iwamoto, M., Kanatani, N., Yoshida, C., Liu, Y., Enomoto-Iwamoto, M.,
et al. (2001) Skeletal malformations caused by overexpression of Cbfa1 or its
dominant negative form in chondrocytes. J. Cell Biol. 153, 87–100.
[18] Hinoi, E., Bialek, P., Chen, Y.T., Rached, M.T., Groner, Y., Behringer, R.R., et al.
(2006) Runx2 inhibits chondrocyte proliferation and hypertrophy through its
expression in the perichondrium. Genes Dev. 20, 2937–2942.
[19] Chen, W., Ma, J., Zhu, G., Jules, J., Wu, M., McConnell, M., et al. (2014) Cbfbeta
deletion in mice recapitulates cleidocranial dysplasia and reveals multiple
functions of Cbfbeta required for skeletal development. Proc. Natl. Acad. Sci. U.
S.A. 111, 8482–8487.
[20] Chen, H., Ghori-Javed, F.Y., Rashid, H., Adhami, M.D., Serra, R., Gutierrez, S.E.,
et al. (2014) Runx2 regulates endochondral ossification through control of
chondrocyte proliferation and differentiation. J. Bone Miner. Res. 29, 2653–
2665.
[21] Tominaga, H., Maeda, S., Hayashi, M., Takeda, S., Akira, S., Komiya, S., et al.
(2008) CCAAT/enhancer-binding protein beta promotes osteoblast
differentiation by enhancing Runx2 activity with ATF4. Mol. Biol. Cell 19,
5373–5386.
[22] Zhang, Y., Xie, R.L., Croce, C.M., Stein, J.L., Lian, J.B., van Wijnen, A.J., et al.
(2011) A program of microRNAs controls osteogenic lineage progression by
targeting transcription factor Runx2. Proc. Natl. Acad. Sci. U.S.A. 108, 9863–
9868.
[23] Huang, J., Zhao, L., Xing, L. and Chen, D. (2010) MicroRNA-204 regulates Runx2
protein expression and mesenchymal progenitor cell differentiation. Stem
Cells 28, 357–364.
[24] Yamasaki, K., Nakasa, T., Miyaki, S., Ishikawa, M., Deie, M., Adachi, N., et al.
(2009) Expression of MicroRNA-146a in osteoarthritis cartilage. Arthritis
Rheum. 60, 1035–1041.
[25] O’Hara, S.P., Splinter, P.L., Gajdos, G.B., Trussoni, C.E., Fernandez-Zapico, M.E.,
Chen, X.M., et al. (2010) NFkappaB p50-CCAAT/enhancer-binding protein beta
(C/EBPbeta)-mediated transcriptional repression of microRNA let-7i following
microbial infection. J. Biol. Chem. 285, 216–225.
[26] Dong, S., Yang, B., Guo, H. and Kang, F. (2012) MicroRNAs regulate
osteogenesis and chondrogenesis. Biochem. Biophys. Res. Commun. 418,
587–591.
[27] Chen, H., Ghori-Javed, F.Y., Rashid, H., Adhami, M.D., Serra, R., Gutierrez, S.E.,
et al. (2014) Runx2 regulates endochondral ossification through control of
chondrocyte proliferation and differentiation. J. Bone Miner. Res..
[28] Ding, M., Lu, Y., Abbassi, S., Li, F., Li, X., Song, Y., et al. (2012) Targeting Runx2
expression in hypertrophic chondrocytes impairs endochondral ossification
during early skeletal development. J. Cell. Physiol. 227, 3446–3456.
[29] van der Stok, J., Koolen, M.K., Jahr, H., Kops, N., Waarsing, J.H., Weinans, H.,
et al. (2014) Chondrogenically differentiated mesenchymal stromal cell pellets
stimulate endochondral bone regeneration in critical-sized bone defects. Eur.
Cell Mater. 27 (137–148), 148.
[30] Cooke, M.E., Allon, A.A., Cheng, T., Kuo, A.C., Kim, H.T., Vail, T.P., et al. (2011)
Structured three-dimensional co-culture of mesenchymal stem cells with
chondrocytes promotes chondrogenic differentiation without hypertrophy.
Osteoarthritis Cartilage 19, 1210–1218.
[31] Shen, M., Yoshida, E., Yan, W., Kawamoto, T., Suardita, K., Koyano, Y., et al.
(2002) Basic helix-loop-helix protein DEC1 promotes chondrocyte
differentiation at the early and terminal stages. J. Biol. Chem. 277, 50112–
50120.
[32] Zhang, Z.J., Zhang, H., Kang, Y., Sheng, P.Y., Ma, Y.C., Yang, Z.B., et al. (2012)
MiRNA expression profile during osteogenic differentiation of human adiposederived stem cells. J. Cell. Biochem. 113, 888–898.
[33] Kakoi, H., Maeda, S., Shinohara, N., Matsuyama, K., Imamura, K., Kawamura, I.,
et al. (2014) Bone morphogenic protein (BMP) signaling up-regulates neutral
sphingomyelinase 2 to suppress chondrocyte maturation via the Akt protein
signaling pathway as a negative feedback mechanism. J. Biol. Chem. 289,
8135–8150.
[34] Nishimura, R., Wakabayashi, M., Hata, K., Matsubara, T., Honma, S., Wakisaka,
S., et al. (2012) Osterix regulates calcification and degradation of chondrogenic
matrices through matrix metalloproteinase 13 (MMP13) expression in
association with transcription factor Runx2 during endochondral
ossification. J. Biol. Chem. 287, 33179–33190.
[35] Lin, E.A., Kong, L., Bai, X.H., Luan, Y. and Liu, C.J. (2009) MiR-199a, a bone
morphogenic protein 2-responsive MicroRNA, regulates chondrogenesis via
direct targeting to Smad1. J. Biol. Chem. 284, 11326–11335.
[36] Guang, L.G., Boskey, A.L. and Zhu, W. (2012) Regulatory role of stromal cellderived factor-1 in bone morphogenetic protein-2-induced chondrogenic
differentiation in vitro. Int. J. Biochem. Cell Biol. 44, 1825–1833.
[37] Leboy, P., Grasso-Knight, G., D’Angelo, M., Volk, S.W., Lian, J.V., Drissi, H., et al.
(2001) Smad–Runx interactions during chondrocyte maturation. J. Bone Joint
Surg. Am. 83-A (Suppl. 1), S15–S22.
[38] Shang, J., Liu, H. and Zhou, Y. (2013) Roles of microRNAs in prenatal
chondrogenesis, postnatal chondrogenesis and cartilage-related diseases.
Cell. Mol. Med. 17, 1515–1524.
[39] Zhong, N., Sun, J., Min, Z., Zhao, W., Zhang, R., Wang, W., Tian, J., Tian, L., Ma, J.,
Li, D., Han, Y. and Lu, S. (2012) MicroRNA-337 is associated with
chondrogenesis through regulating TGFBR2 expression. Osteoarthritis
Cartilage 20, 593–602.
[40] Yang, B., Guo, H., Zhang, Y., Chen, L., Ying, D. and Dong, S. (2011) MicroRNA145 regulates chondrogenic differentiation of mesenchymal stem cells by
targeting Sox9. PLoS One 6, e21679.