0021-972X/98/$03.00/0
Journal of Clinical Endocrinology and Metabolism
Copyright © 1998 by The Endocrine Society
Vol. 83, No. 5
Printed in U.S.A.
Assessment of Turner’s Syndrome by Molecular Analysis
of the X Chromosome in Growth-Retarded Girls*
CHRISTINE GICQUEL, VÉRONIQUE GASTON, SYLVIE CABROL,
YVES LE BOUC
AND
Laboratoire d’Explorations Fonctionnelles Endocriniennes, Hôpital Trousseau, 75012 Paris, France
ABSTRACT
Turner’s syndrome (TS) is a common disorder (1/2500 to 1/5000
female births) which is diagnosed at birth in approximately 20% of
patients and during childhood or at puberty for the rest. Growth
retardation is the most frequent clinical feature of TS, so we systematically searched for TS in female patients referred to our center
because of short stature. Three hundred seventy-five female patients,
1 month to 18 yr old (mean 6 SD 5 97/12 6 39/12), with growth retardation (less than 22 SD) and/or decreased height velocity were included in the study. Mean growth retardation was 22.57 SD 6 0.79
(range: 21 to 27). Thirty-two percent of the patients had reached
puberty. GH provocative tests were performed in 329 patients
(87.7%), and 36 of these patients (11%) had impaired GH secretion (5
complete and 31 partial GH deficiency).
TS was evaluated by Southern blot analysis of leukocyte DNA
using a multiallelic polymorphic X chromosome marker (88% heterozygosity rate). Y chromosome PCR analysis was carried out if a
pattern indicative of TS was obtained. Leukocyte DNA analysis pro-
T
URNER’S syndrome (TS) is one of the most common
chromosomal abnormalities, its incidence being between 1/2500 and 1/5000 live births among girls (1). Twenty
percent of the cases are diagnosed at birth because of typical
clinical features or somatic abnormalities (2, 3), which are
often related to 45 X monosomy. Diagnosis of the remaining
patients is made during childhood (usually because of
growth retardation) or later (because of lack of pubertal
development). In approximately 50% of the cases, the karyotype anomaly is 45 X monosomy, but a variety of other
anomalies, including mosaicism, Xp or Xq deletion, and isochromy of the X long arm are known (4).
Recombinant DNA technology makes possible the analysis of sex chromosome abnormalities at the molecular level.
It has helped to identify the parental origin of the abnormality, the existence of cytogenetically hidden mosaicism,
and the correlation between genotype and phenotype (5–7).
Recognition of the disease is important, in view of GH
therapy, as is precise diagnosis of the chromosome anomalies
responsible for the varying prognoses, in terms of growth
and fertility. Growth response would be negatively correReceived September 17, 1997. Revised January 21, 1998. Accepted
February 3, 1998.
Address all correspondence and requests for reprints to: Dr. Christine
Gicquel, Laboratoire d’Explorations Fonctionnelles Endocriniennes,
Hôpital Trousseau, 26 Avenue Arnold Netter, 75012 Paris, France.
* This work was supported by the University of Paris VI, Faculté
Saint-Antoine (DRED EA 1531).
duced an abnormal restriction pattern for 20 of the 375 cases (5.3%).
There was a single hybridizing band in 13 cases, an allelic disproportion indicative of mosaicism in 6 cases, and 3 hybridizing bands in
1 case. One patient tested positive in the Y chromosome PCR analysis.
Cytogenetic analysis showed 47 XXX trisomy in the patient with a
3-hybridizing-band pattern and confirmed the diagnosis of TS for 17
of the 19 suspected cases: 45 X: n 5 7; 45 X/46 Xi(Xq): n 5 4; 45 X/46
XX: n 5 2; 46 Xi(Xq): n 5 1; 45 X/46 Xr(X): n 5 1; 45 X/46 XX/47 XXX:
n 5 1; 45 X/46 XY: n 5 1. Cytogenetic analysis was normal (46 XX)
for the 2 other patients.
The TS phenotype is variable: dysmorphism is often missing or
mild (particularly in cases of mosaicism), but growth is reduced in
virtually all patients. Screening of 375 growth-retarded girls identified 18 cases of TS, of which 17 were diagnosed by molecular analysis.
This incidence (4.8%) was significantly higher than the expected incidence in this population (0.8 –1.6%: P , 0.001). (J Clin Endocrinol
Metab 83: 1472–1476, 1998)
lated with age at the start of therapy (8, 9), and so, early
diagnosis of TS is important.
Short stature is the most common clinical feature of TS, and
the aim of this work was to systematically search for TS in
female patients referred on the basis of short stature. Three
hundred and seventy-five patients were investigated. We
tested for TS by Southern blot analysis of leukocyte DNA
with a highly polymorphic marker of the X chromosome (10).
Eighteen patients were diagnosed with TS (17 by molecular
analysis). Fourteen of theses patients had no clinical features
indicative of TS. One of these patients also tested positive for
chromosome Y by PCR. The incidence of TS in this population (4.8%) was higher than the expected incidence of TS in
a female population of short stature (0.8 –1.6%). We could not
define a population for molecular diagnosis screening based
on clinical, auxological, or hormonal data; but this study
suggests that patients with mild growth retardation should
be tested for TS.
Subjects and Methods
Patients
Clinical data. Growth-retarded patients referred to our center for TS or
chronic illness (respectively, 23 and 42 patients for the same period) were
not included in this study.
Three hundred seventy-five girls, 1 month to 18 yr old (mean 6 sd
5 9 7/12 6 39/12), were referred to our center for investigation of growth
retardation. Mean growth retardation was 22.57 sd 6 0.79 (range: 21
to 27). Forty-nine patients had growth retardation less than 22 sd,
according to French growth charts (11), but exhibited a decreased height
velocity.
1472
TURNER’S SYNDROME IN GROWTH-RETARDED GIRLS
Pubertal stage was available for 370 of the patients. Six percent (n 5
23) were postpubertal and 25.7% (n 5 95) were at puberty at the time
of molecular analysis. Two patients exhibited precocious puberty.
Birth length was recorded for 330 of the 375 patients. Two hundred
and sixty-four were full-term babies, and their mean birth length was
47.8 6 2.05 cm. Twenty-five percent of the patients (n 5 83/330) had
birth lengths below the third percentile (12).
Mean maternal height (n 5 363) was 157.5 6 6.8 cm (138 –180 cm), and
mean paternal height (n 5 360) was 169.7 6 7.4 cm (150 –190 cm). These
parental heights were slightly lower than the mean French adult heights,
which are 163.2 6 5.6 cm for women and 174.5 6 6 cm for men.
Eighty percent (n 5 300) had no clinical features of TS. Twenty
percent (n 5 75) had clinical features consistent with TS. Sixty-three of
these patients had one of the following features: mild cubitus valgus,
short neck, widely separated nipples, pigmented nevi, or short 4th
metacarpal bone. Twelve had a more suggestive Turner’s dysmorphia,
with square thorax and two of the other features.
1473
shown to be accurate for the diagnosis of TS, the drawback being its
inability to recognize the distal Xp deletion (10).
PCR analysis. Four different loci of the Y chromosome, the open
reading frame of the SRY gene (Yp11.3), the ZFY gene (Yp11.3), the DYZ3
sequence (Y centromere), and the repeated sequence DYZ1 (Yq12) were
studied. Sense and antisense primers were, respectively, 59-GTCGCACTCTCCTTGTTTTTTGAC and 59- CCGATTGTCCTACAGCTTTGTC for SRY (648 bp), 59-AATTCATGAGGAGACC-AGAAG and 59CACAGAATTTACACTTGTGCAT for ZFY (400 bp), 59-ATGATAGAACGGAAATATG and 59-AGTAGAATGCAAAGGGCTCC for
DYZ1 (170 bp), 59-TCCACTTTATTCCAGGCCTGTCC and 59-TTGAATGGAATGGGAACGAATGG for DYZ1 (154 bp).
Amplified samples were subjected to electrophoresis in a 1.5% agarose gel, stained with ethidium bromide.
Karyotype. Karyotype analysis and fluorescence in situ hybridization
(FISH) were done as previously described (14, 15). X chromosome FISH
analysis was performed using a DXZ1 probe.
Hormonal data. GH provocative tests were performed in 329 patients
(87.7%). The first test for most patients (97%) was an ornithine stimulation test. An impaired GH response to the first provocative test (peak
GH level below 10 ng/mL) was found in 70 (21.3%) patients. A second
test [insulin induced hypoglycemia or sequential test (arginine-insulin
tolerance test or betaxolol-glucagon stimulation test)] was performed in
64 of these 70 patients. This led to the diagnosis of complete GH deficiency (peak GH level below 5 ng/mL) in 5 patients and the diagnosis
of partial GH deficiency (peak GH level below 10 ng/mL) in 31 patients.
Thyroid function was investigated in 364 patients (97%) and was
normal for all patients, except two with treated congenital
hypothyroidism.
Statistical analysis. If binary variables were examined, between-group
comparisons were made using a chiquare test for two independent
samples. The Fisher’s exact test was used if necessary.
Comparison of the distribution of a continuous variable was tested
using the nonparametric Kolmogorov-Smirnov test.
Results
Restriction profiles of the X chromosome in patients with
growth retardation
Normal restriction patterns were found in 355 (94.7%) of
the patients (Table 1). Eighty-eight percent of these patients
(n 5 311) were heterozygous for the X chromosome marker,
with two bands of the same intensity, and twelve percent
(n 5 44) were homozygous (Fig. 1).
Despite their normal restriction profiles, karyotype analysis was performed in 85 of these 355 patients. Karyotype
analysis was generally performed for patients with the most
severe growth retardation (mean 6 sd 5 22.8 6 0.8 in the
group of 85 patients with karyotype analysis, and 22.46 6
0.7 in the group of 270 patients without karyotype analysis),
to exclude a distal Xp deletion that cannot be detected by the
molecular technique. There was a normal karyotype for 84 of
them and one 45 X/46 XX mosaicism with only 4% 45 X cells,
which were identified after a second karyotype analysis using 50 cells (Table 1).
Abnormal restriction patterns were found in 20 (5.3%) of
the patients (Table 1).
Thirteen had a single hybridization band of 50% reduced
intensity, compared with the homozygous reference 46 XX
Methods
Molecular analysis
Preparation of genomic DNA.
Leukocyte DNA was isolated from 10-mL blood samples collected in
EDTA and extracted as previously described (10).
Southern-blot analysis
DNA (10 mg) was digested with 100 U EcoRI (New England Biolabs,
Beverly, MA), and the digested DNA was analyzed by Southern blotting,
as previously described (10).
Hybridization was carried out using the X-chromosome M27b probe,
which maps to Xcen-p11.22 in a variable number tandem repeat region
and recognizes a highly informative (88%) multiallelic polymorphism
(13).
Hybridization signals were quantified by densitometric analysis, using a GS700 imaging densitometer and the molecular analyst data system (Bio-rad, Rockland, CA), in comparison with two female reference
DNAs (a homozygous 46 XX and a heterozygous 46 XX) and a male
reference 46 XY DNA. A single band of reduced intensity (50% of the
homozygous 46 XX control DNA) indicates the presence of a single X
chromosome. Two bands of different intensities indicate mosaicism. The
use of Southern-blot analysis with the M27b probe has been previously
TABLE 1. Southern blot restriction patterns in female patients with growth retardation
Normal pattern
Abnormal pattern
Total
Karyotype analysis
Restriction pattern
n
Normal heterozygous
Normal homozygous
One-band pattern
311
44
13
71
14
13
70
14
1
1 Turner
0
12 Turner
Mosaicism
6
6
1
Three-band pattern
1
1
0
375
105
86
n
Normal
Abnormal
Karyotype
45 X/46 XX 5 1
45
45
45
46
X57
X/46 Xi(Xq) 5 3
X/46 XY 5 1
Xi(Xq) 5 1
5 Turner
45
45
45
45
X/46
X/46
X/46
X/46
1X Trisomy
47 XXX 5 1
19
XX 5 2
Xr(X) 5 1
Xi(Xq) 5 1
XX/47 XXX 5 1
1474
GICQUEL ET AL.
JCE & M • 1998
Vol 83 • No 5
DNA (Fig. 1). Cytogenetic analyses are presented in Table 1.
One of these patients had a normal chromosomal formula
(false positive).
In 6 cases, there were 2 bands of different intensities,
suggesting that there was mosaicism (Fig. 1). The karyotype
analysis of 5 of these 6 patients confirmed the mosaicism TS:
45 X/46 XX, 45 X/46 XX, 45 X/46 Xr(X), 45 X/46 Xi(Xq), and
45 X/46 XX/47 XXX (Table 1), with (respectively) 15%, 50%,
60%, 50%, and 90% blood cell population carrying 45 X. The
2-bands pattern of the 45 X/46 Xi(Xq) mosaicism is caused
by a dicentric isochromy of the long arm of X chromosome
with maintenance of a part of the short arm. In the sixth case
(false positive), the restriction pattern was indicative of a
mosaicism with 10% 45 X cells, but karyotype analysis of 48
cells was normal.
In 1 case, there was a three-band pattern (Fig. 1). Karyotype analysis showed there was a 47 XXX trisomy (Table 1).
These data also indicate the good accuracy of molecular
diagnosis, with a sensitivity of 94.7% (5.2% false negatives)
and a specificity of 97.7% (2.3% false positives).
Y chromosome PCR analysis
PCR analysis was performed for patients with an X-chromosome restriction pattern indicative of TS. One patient
tested positive for the Y chromosome, by PCR analysis, with
the characteristic bands of the four Y loci studied. There was
no clinical or biological hyperandrogenism in this patient.
Karyotype analysis with Y chromosome FISH detected a 10%
46 XY cell population.
Correlation of clinical, auxological, hormonal, molecular,
and cytogenetic data
Differences in age at diagnosis (Fig. 2A), birth length (Fig.
2B) or severity of growth retardation (Fig. 2C), were studied
FIG. 2. Comparison of age at the diagnosis (A), birth length (B), and
growth retardation (C) in patients diagnosed with TS and in all
patients with growth retardation. TS, patients diagnosed as TS; GR
patients, growth-retarded patients without TS.
FIG. 1. Southern blot analysis of patients with growth retardation.
Ten micrograms of leukocyte DNA restricted with EcoRI. The blot was
hybridized with the M27b probe.
in patients diagnosed with TS and growth-retarded girls
without TS. We found that TS patients who were undiagnosed at birth were referred late to our center (mean age at
diagnosis: 98/12 6 4 yr) at the same age than patients without
TS (97/12 6 310/12 yr). Birth length was normal for 43.75% of
TS patients, and there was no significant difference in mean
birth length between the two groups. However, Fig. 2B
shows a bimodal distribution for birth length in TS girls with
50% (8/16) less than 46 cm. The growth retardation of 33%
of TS patients was within 2 sd of normal, and mean growth
retardation was not significantly different between the two
groups. Finally none of these variables made it possible to
select a defined population for molecular analysis.
Patients were classified into 3 groups, according to clinical
TURNER’S SYNDROME IN GROWTH-RETARDED GIRLS
phenotype: group A (n 5 300), without Turner’s phenotype;
group B (n 5 63), with only 1 feature of Turner’s phenotype
restricted to mild cubitus valgus, short neck, widely separated nipples, pigmented nevi, or short 4th metacarpal bone;
and group C (n 5 12), with a more suggestive Turner’s
phenotype (Table 2). Karyotype analysis was performed in
105 of 375 patients. The variable percentage of patients that
had karyotypes in each group (20.3% in group A, 54% in
group B, and 83.3% in group C) was determined by a more
severe growth retardation and/or TS-like feature(s). There
was a significantly higher rate of TS (P , 0.001) in patients
with TS-like feature(s) (groups B and C), even if only one
feature (group B) was present. However, 7 TS (including 45
X monosomy) were found in patients without any clinical
features indicative of TS, except growth retardation (Table 2).
Discussion
TS is one of the most frequent chromosome abnormalities
and, recognition of the disease is important for GH therapy
(8, 9). Growth response is negatively correlated with age at
the start of therapy and duration of treatment (8, 16). Thus,
early diagnosis of TS is important. Short stature is a symptom
in 98% of cases of TS, but dysmorphia is often absent (4). It
is, thus, important to accurately assess the incidence of TS in
growth-retarded girls.
We have previously demonstrated the routine use of
Southern-blot analysis for diagnosis of TS and used the same
tool to screen for TS in a growth-retarded female population.
In the previous study, the sensitivity of the test was estimated
to be 92% and its specificity, 100% (10).
The frequency of TS is between 1/2500 and 1/5000 female
live births (1), and growth is reduced in virtually all TS
patients. Growth retardation (#22 sd) affects 2.5% of the
whole female population; thus, the theorical frequency of TS
in growth-retarded girls was estimated to be between 0.8 and
1.6%. This theorical frequency is actually overrated for two
reasons: 1) 20% of TS cases are diagnosed at birth; and 2)
patients referred to our center for TS were excluded, and only
patients referred for growth retardation were included in this
study. Thus, the expected frequency of TS in growthretarded girls is probably below 1%. A Scottish study (17) of
2- to 4-yr-old children used diagnostic tests (and particularly
conventional chromosome analysis) on girls with heights
below 22.5 sd. With these criteria, one TS case was detected
in a group of 208 growth-retarded girls.
In this study, we diagnosed 18 (4.8%) cases of TS in a group
of 375 girls, 17 of which were diagnosed by molecular analysis. This incidence is significantly higher than the expected
incidence (0.8 –1.6%; P , 0.001).
1475
Many authors have suggested that 45 X monosomy is
lethal and that most surviving 45 X individuals are actually
mosaicisms undetected by cytogenetic tests. The prevalence
of micromosaicism recorded for TS patients depends on the
methods used and the number of tissues screened (7). 45 X
monosomy is usually detected in 50% of patients with TS,
and mosaicism and X anomaly are detected in the other half.
In this study, mosaicism and X anomaly were detected in
61.1% of the cases of diagnosed TS. These data are consistent
with the fact that we selected patients on the basis of growth
retardation and that 45 X monosomy is usually diagnosed in
the first few years of life because of dysmorphia. However,
we detected 45 X monosomy in two patients who had no
clinical features consistent with TS (except growth retardation), one of them being at puberty. We also diagnosed five
patients with isochromy of the long arm of the X chromosome who had no (n 5 1) or only mild (n 5 4) Turner’s
phenotype. The dissociation between karyotype and phenotype is probably caused by a tissue-confined mosaicism, as
previously described in monozygotic triplets (18).
To preselect a group of patients for molecular analysis, we
assessed clinical data (such as birth length, age, and severity
of growth retardation at the time of molecular diagnosis) and
hormonal data in the patients who were diagnosed with TS
and in all the other patients with growth retardation. None
of these features might allow us to define a group of patients
for this analysis. This study showed that 43.75% of patients
diagnosed with TS had birth lengths within the normal
range. It also showed that 33.3% had moderate growth retardation (within 2 sd of normal). There was impaired GH
response to provocative test for 4 of 17 (23.5%) TS patients,
and 2 of them were overweighted. Nevertheless, there was
a higher frequency of TS (12.7%) for patients with only one
of the features of TS (63 patients in this study, group B).
The presence of a Y chromosome or Y-chromosome derivative material in TS is correlated with the risk of gonadoblastoma, and prophylactic gonadectomy could be recommended in these cases (19). Presence of Y-chromosome
material accounts for approximately 5% of TS cases (20, 21),
but the observed frequency of Y-chromosome material also
depends on the methods used (22). The presence of a normal
Y chromosome in 10% of blood cells and the lack of clinical
virilization and hyperandrogenism in our patient suggest a
very low proportion of Y chromosome cells in gonads at the
time of gonadal differentiation.
In conclusion, the incidence of TS in this population (4.8%)
was higher than the expected incidence of TS in a female
population of short stature (0.8 –1.6%). It remains to be established whether this higher incidence of TS in patients with
TABLE 2. Clinical features indicative of Turner’s syndrome in patients with growth retardation
Patients phenotype
n
No Turner phenotype
GROUP A
Mild Turner phenotype
GROUP B
More suggestive Turner phenotype
GROUP C
300
Abnormal restriction
pattern
Karyotype analysis
n
normal
abnormal
7 (2.3%)
61
54
7
63
9 (14.3%)
34
26
8
12
4 (33%)
10
6
4
1476
GICQUEL ET AL.
growth retardation justifies a systematic screening for TS in
growth-retarded girls. In this regard, molecular analysis of
the X chromosome is a valuable alternative to cytogenetic
analysis in cases where growth retardation is not accompanied by Turner’s phenotype.
Acknowledgments
We thank Drs. B Estéva, M. Gourmelen, M. Houang, T. Pierret, M. C.
Raux-Demay, and C. Saab for samples from patients; Dr. M. F. Portnoı̈
for FISH techniques; and Dr. D. Costagliola for statistical analysis.
References
1. Gravholt C, Juul S, Naeraa R, Hansen J. 1996 Prenatal and postnatal prevalence of Turner’s syndrome: a registry study. Br Med J. 312:16 –21.
2. Massa G, Vandershueren-Lodeweyckx M, Malvaux P. 1990 Linear growth in
patients with Turner syndrome: influence of spontaneous puberty and parental height. Eur J Pediatr. 149:246 –250.
3. Cabrol S, Saab C, Gourmelen M, Raux-Demay M, Le Bouc Y. 1996 Syndrome
de Turner: croissance staturopondérale et maturation osseuse spontanées.
Arch Pédiatrie. 3:313–318.
4. Fergusson-Smith M. 1993 Genotype-phenotype correlations in Turner syndrome. In: Hibi I, Takano K, eds. Basic and clinical approach to Turner syndrome. Amsterdam: Elsevier Science; 17–25.
5. Connor J, Loughlin S. 1989 Molecular genetics of Turner’s syndrome. Acta
Paediatr Suppl. 356:77– 80.
6. Chu C, Donaldson M, Kelnar C, et al. 1994 Possible role of imprinting in the
Turner phenotype. J Med Genet. 31:840 – 842.
7. Held K, Becker B, Kaminsky E, et al. 1995 Do all Turner individuals have
mosaicism? state of the art. In: Albertsson-Wikland K, Ranke M, eds. Turner
syndrome in a life span perspective: research and clinical aspects. Amsterdam:
Elsevier; 33–39.
8. Ranke M, Price D, Maes M, Albertsson-Wikland K, Lindberg A. 1995 Factors
influencing final height in Turner syndrome following GH treatment: results
of the Kabi international growth study (KIGS). In: Albertsson-Wikland K,
Ranke M, eds. Turner syndrome in a life span perspective: research and clinical
aspects. Amsterdam: Elsevier; 161–165.
JCE & M • 1998
Vol 83 • No 5
9. Rochiccioli P, Battin J, Bertrand A, et al. 1995 Final height in Turner syndrome
patients treated with growth hormone. Horm Res. 44:172–176.
10. Gicquel C, Cabrol S, Schneid H, Girard F, Le Bouc Y. 1992 Molecular diagnosis of Turner’s syndrome. J Med Genet. 29:547–551.
11. Sempé M, Pedron G, Roy-Pernot MP. 1979 Auxologie: méthode et séquences.
Paris: Laboratoire Théraplix.
12. Leroy B, Lefort F. 1971 A propos du poids et de la taille des nouveaux-nés à
la naissance. Rev Fr Gynecol. 66:391–396.
13. Fraser N, Boyd Y, Craig I. 1989 Isolation and characterization of a
human variable copy number tandem repeat at X cen-p11.22. Genomics.
5:144 –148.
14. De Grouchy J, Turleau C. 1984 Clinical atlas of human chromosomes. New
York: John Wiley.
15. Pinkel D, Straume T, Gray J. 1986 Cytogenetic analysis using quantitative,
high-sensitivity, fluorescence hybridization. Proc Natl Acad Sci USA.
83:2934 –2938.
16. Rosenfeld R, Frane J, Attie K, et al. 1992 Six year results of a randomized,
prospective trial of human growth hormone and oxandrolone in Turner syndrome. J Pediatr. 121:49 –55.
17. Vimpani G, Vimpani A, Pocock S, Farquhar J. 1981 Differences in physical
characteristics, perinatal histories and social backgrounds between children
with growth hormone deficiency and constitutional short stature. Arch Dis
Child. 56:922–928.
18. Lespinasse J, Gicquel C, Robert M, Le Bouc Y. 1997 Mosaicism in 45,X Turner
syndrome in triplets: interest of cytogenetic analysis of different tissues and
contribution of molecular biology. 1st European Cytogenetics Conference,
Athènes. Cytogenet Cell Genet. 77:44.
19. Verp M, Simpson J. 1987 Abnormal sexual differentiation and neoplasia.
Cancer Genet Cytogenet. 25:191–218.
20. Lindgren V, Chen C, Bryke C, Lichter P, Page D, Yang-Feng T. 1992 Cytogenetic and molecular characterization of marker chromosomes in patients
with mosaic 45,X karyotypes. Hum Genet. 88:393–398.
21. Medlej R, Lobaccaro J, Berta P, et al. 1992 Screening for Y-derived sex determining gene SRY in 40 patients with Turner syndrome. J Clin Endocrinol
Metab. 75:1289 –1292.
22. Binder G, Koch A, Wajs E, Ranke M. 1995 Evaluation of hidden Y-chromosome in Turner syndrome (TS): a review of screening results. In: AlbertssonWikland K, Ranke M, eds. Turner syndrome in a life span perspective: research
and clinical aspects. Amsterdam: Elsevier; 25–32.