This information is current as
of June 17, 2017.
Mannose-Containing Molecular Patterns Are
Strong Inducers of Cyclooxygenase-2
Expression and Prostaglandin E2 Production
in Human Macrophages
Nieves Fernández, Sara Alonso, Isela Valera, Ana González
Vigo, Marta Renedo, Luz Barbolla and Mariano Sánchez
Crespo
References
Subscription
Permissions
Email Alerts
This article cites 62 articles, 48 of which you can access for free at:
http://www.jimmunol.org/content/174/12/8154.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2005 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
J Immunol 2005; 174:8154-8162; ;
doi: 10.4049/jimmunol.174.12.8154
http://www.jimmunol.org/content/174/12/8154
The Journal of Immunology
Mannose-Containing Molecular Patterns Are Strong Inducers
of Cyclooxygenase-2 Expression and Prostaglandin E2
Production in Human Macrophages1
Nieves Fernández,* Sara Alonso,* Isela Valera,* Ana González Vigo,* Marta Renedo,*
Luz Barbolla,† and Mariano Sánchez Crespo2*
I
nnate immunity is a mechanism of host defense widely conserved, the capacity of which to recognize pathogens depends
on germline-encoded molecules called pattern recognition receptors (PRR).3 Unlike the receptors of the adaptive immune system, PRR do not undergo somatic mutation by recombinase-mediated rearrangement and recognize conserved microbial structures
shared by large groups of pathogens, which are collectively called
pathogen-associated molecular patterns (PAMP). LPS from Gramnegative bacteria and branched sugars with ␤-glucan and ␣-mannose moieties from different microorganisms are archetypal examples of PAMP. Among PRR, the mannose receptor (MR), first
described by Stahl et al. (1), has been the object of detailed scrutiny. This receptor recognizes glycosylated molecules with termi*Instituto de Biologı́a y Genética Molecular, Consejo Superior de Investigaciones
Cientı́ficas, Valladolid, Spain; and †Centro de Hemoterapia y Hemodonación de
Castilla y León, Valladolid, Spain
Received for publication December 28, 2004. Accepted for publication April
12, 2005.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by Plan Nacional de Salud y Farmacia (Grant SAF20010506), Red Brucella, Red Respira, and Red Temática de Investigación Cardiovascular
from Ministerio de Sanidad y Consumo. N.F. is under contract with the Ramón y
Cajal Program of Ministerio de Educación y Ciencia of Spain. I.V. was the recipient
of a grant from Banco de Santander-Central-Hispano. A.G.V. was the recipient of a
grant from Instituto de Salud Carlos III.
2
Address correspondence and reprint requests to Dr. M. Sánchez Crespo, Instituto de
Biologı́a y Genética Molecular, Facultad de Medicina, 47005 Valladolid, Spain.
E-mail address: [email protected]
3
Abbreviations used in this paper: PRR, pattern recognition receptor; AU, arbitrary
unit; C3, the third component of the complement system; C3bi-IC, immune complex
bound to C3bi; COX-2, cyclooxygenase-2; CR3, complement receptor 3; DC-SIGN,
dendritic cell-specific ICAM-grabbing nonintegrin; DC-SIGNR, DC-SIGN-related;
IC, immune complex; MDM, monocyte-derived macrophage; MR, mannose receptor;
MUC-3, mucin 3; PAMP, pathogen-associated molecular pattern; PMN, polymorphonuclear leukocyte; sPLA2, secreted phospholipase A2.
Copyright © 2005 by The American Association of Immunologists, Inc.
nal mannose, fucose, or N-acetylglucosamine moieties and internalizes soluble and particulate ligands through the endocytic and
phagocytic pathways. Its capacity for ligand recognition makes
this receptor suitable to phagocytose Candida albicans, Leishmania donovani, and Pneumocytis carinni, among other microorganisms (2– 4). The MR is the prototypic element of a homonymous
family of C-type lectin receptors, which includes other members,
such as the secreted phospholipase A2 M-type receptor, the dendritic cell receptor DEC-205, and Endo180/urokinase plasminogen-activated receptor-associated protein. These receptors contain
carbohydrate recognition domains, although the chemical structure
of the ligands interacting with those domains displays wide differences (for review, see Refs. 5–7). It should be noted that the list
of elements of this receptor family could be unexpectedly enlarged, because FcRY, the avian functional equivalent of the mammalian MHC-related FcR, is a homologue of the mammalian secreted phospholipase A2 (sPLA2) M-type receptor and shares a
common domain architecture with other members of the MR family, although it binds IgY, the avian counterpart of IgG (8). The
MR is mainly expressed in alveolar macrophages, peritoneal macrophages, and macrophages derived from blood monocytes (9) and
seems to play a role in the early immune response against invading
pathogens, but it has also been detected in other cell types, such as
hepatic endothelium, kidney mesangial cells, tracheal smooth muscle cells, and retinal pigment epithelium (7).
There is some discrepancy regarding the full scope of molecules
that may be bound by the MR. ␤-Glucan- and mannan-containing
particles, such as zymosan and C. albicans, have been proposed to
be recognized by the MR (10), but other receptors involved in the
innate immune response also bind mannosylated particles.
Thereby, the mannose-specific, C-type lectin dendritic cell-specific
ICAM-grabbing nonintegrin (DC-SIGN) recognizes lipoarabinomannan, a glycoconjugate component of the Mycobacteria cell
0022-1767/05/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
The induction of cyclooxygenase-2 (COX-2) and the production of PGE2 in response to pathogen-associated molecular patterns
decorated with mannose moieties were studied in human monocytes and monocyte-derived macrophages (MDM). Saccharomyces
cerevisiae mannan was a robust agonist, suggesting the involvement of the mannose receptor (MR). MR expression increased along
the macrophage differentiation route, as judged from both its surface display assessed by flow cytometry and the ability of MDM
to ingest mannosylated BSA. Treatment with mannose-BSA, a weak agonist of the MR containing a lower ratio of attached sugar
compared with pure polysaccharides, before the addition of mannan inhibited COX-2 expression, whereas this was not observed
when agonists other than mannan and zymosan were used. HeLa cells, which were found to express MR mRNA, showed a
significant induction of COX-2 expression upon mannan challenge. Conversely, mannan did not induce COX-2 expression in
HEK293 cells, which express the mRNA encoding Endo180, a parent receptor pertaining to the MR family, but not the MR itself.
These data indicate that mannan is a strong inducer of COX-2 expression in human MDM, most likely by acting through the MR
route. Because COX-2 products can be both proinflammatory and immunomodulatory, these results disclose a signaling route
triggered by mannose-decorated pathogen-associated molecular patterns, which can be involved in both the response to pathogens
and the maintenance of homeostasis. The Journal of Immunology, 2005, 174: 8154 – 8162.
The Journal of Immunology
8155
Materials and Methods
Reagents
Zymosan, soluble ␤-glucan from seaweed (laminarin, ⬃8 kDa), soluble
␣-mannan from Saccharomyces cerevisiae, and porcine mucin 3 (MUC-3),
a mucin from the gastrointestinal tract, which is a natural ligand of the MR,
were purchased from Sigma-Aldrich. 4-[5-(4-Chlorophenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]benzenesulfonamide (SC-236; a COX-2 inhibitor)
and 5-(4-chlorophenyl)-1-(4-methoxyphenyl)-3-trifluoromethylpyrazole
(SC-560; a COX-1 inhibitor) were obtained from Calbiochem. Mouse
monoclonal anti-human CD206/mannose receptor and CD16/Fc␥RIII were
purchased from BD Pharmingen. IgG-OVA equivalence immune complexes (IC) were made according to classical procedures with optimal
amounts of Ag using IgG Ab raised in rabbits. To obtain IC bound covalently to C3bi, IC were extensively washed with PBS and incubated with
normal human serum as previously described (24). Coating of C3bi to
zymosan was conducted by incubation with normal human serum, followed
by extensive washing with PBS. The characteristics of the oligonucleotide
primers used in PCRs for the detection of dectin-1 mRNA (26), DC-SIGN
(27), DC-SIGN-related (DC-SIGNR) (28), Endo180 (29), TLR-2 (30), MR
(31), and sPLA2 M-type receptor (32) are shown in Table I. Hemagglutinin-tagged cDNA of human TLR-2 and the mutation corresponding to the
dominant negative TLR4 (P712H substitution) in C3H/HeJ-mice (33)
cloned into the expression plasmid pRc/CMV (Invitrogen Life Technologies) were provided by Dr. M. Rehli (University of Regensburg, Regensburg, Germany).
Cell culture
THP-1 cells were cultured in RPMI 1640 medium supplemented with 2
mM glutamine and 10% heat-inactivated FBS. Human monocytes were
isolated from buffy coats of healthy volunteer donors by centrifugation
onto Ficoll cushions and adherence to plastic dishes for 2 h. At the end of
this period, nonadhered cells were removed by extensive washing. Differentiation of monocytes into macrophages was conducted by culture of adhered monocytes in the presence of 5% human serum for 2 wk in Primaria
six-well dishes (BD Biosciences), in the absence of exogenous cytokine
mixtures. HEK293 cells and HeLa cells were transiently transfected using
the calcium phosphate method.
Assays for endo/phagocytosis and flow cytometry
Cells were incubated for different times at 37°C with FITC-labeled mannosylated BSA and subsequently washed and resuspended in 500 ␮l of
PBS supplemented with 1 mM EDTA for analysis by flow cytometry in a
FACScan cytofluorometer (BD Biosciences). Parallel controls were performed at 4°C to block endocytic uptake of the particles. The surface display of both CD16 and CD206/mannose receptor was determined by indirect immunofluorescence with mouse anti-human CD206 and CD16
IgG1 mAb, followed by washing with PBS and incubation with goat
Table I. Oligonucleotide primers used for the detection of the mRNA encoding for receptors of the innate immune system
Gene
Orientation
Sequence (5⬘-3⬘)
GeneBank Accession No.
Ref. No.
Dectin-1
Forward
Reverse
TTTAGAAAATTTGGATGAAGATGGA
ATATGAGGGCACACTACACAGTTG
AY009090
26
DC-SIGN
Forward
Reverse
AGGTCCCCAGCTCCATAAGT
TCTCTGGAAGCTCACCCACT
NM_021155
27
DC-SIGNR
Forward
Reverse
GCAACTCCTCTCCTTCATGC
TCCGTCAGCTCCCTGGTAGAT
AF245219
28
Endo180
Forward
Reverse
ATTTTGAGTGGTCTGACGGG
AGCTGAGAGCCATGGTCAGT
AF134838
29
TLR-2
Forward
Reverse
GCCAAAGTCTTGATTGATTGG
TTGAAGTTCTCCAGCTCCTG
NM_003264
30
MR
Forward
Reverse
GCTGAACCTGGAAAAAGCTG
ACGAAGCCATTTGGTAAACG
NM_002438
31
sPLA2M-type
Forward
Reverse
AAAGAAACCCACTG-AATGCC
TTCTTGAAGTCCAATCCACC
U17033
32
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
wall (11–13). Some members of the MR family have been associated with signal transduction events, for instance, the secreted
phospholipase A2 M-type receptor (14, 15), but few reports have
addressed this functional capacity for the MR itself. In fact, the
function of the MR has currently been related to the capture, internalization, and presentation of mannosylated Ags (16) bypassing the oxidative burst in human macrophages (17) as well as to
the activation of an anti-inflammatory and immunosuppressive
program in monocyte-derived dendritic cells (18). This agrees with
the finding of normal defense against Candida and Pneumocystis
infection in animals with targeted disruption of the MR gene (19,
20). Conversely, the synthesis of proinflammatory cytokines (21)
and matrix metalloproteinase-9 (22) by engaging the MR has also
been reported, and a recent study has described the ability of the
MR to trigger activation of the transcription factor NF-␬B and the
induction of IL-8, thus suggesting a central role for the MR in
the defense by human alveolar macrophages against Pneumocytis
infection (23) in the context of HIV infection (4).
In a previous study we addressed the effect of both mannoseand ␤-glucan-containing polysaccharides on the release of arachidonic acid by human monocytes (24), which might be of some
relevance in the inflammatory response in view of the wide scope
of physiological actions of eicosanoids. In the present study we
addressed the effect of mannan-containing polysaccharide on the
expression of cyclooxygenase-2 (COX-2), the inducible isoform of
cyclooxygenase that converts arachidonic acid into the unstable
PGG2. PGG2 is subsequently reduced to PGH2 and serves as a
substrate for the production of other PGs, such as PGE2 and PGD2,
through the action of isomerases and synthases. The effect of mannan is more potent than that elicited by similar concentrations of
zymosan particles and seems to be mediated by the MR. The observed response cannot be accounted for by LPS contamination, is
sensitive to blockade by mannosylated BSA, and is more remarkable in cells showing a robust expression of the MR, for instance,
monocyte-derived macrophages (MDM). Because 15-deoxy-PGJ2,
the final product of the metabolism of the PGD2 series, has been
reported to modulate MR gene expression in macrophages (25),
our findings disclose an autocrine/paracrine mechanism coupled to
PG production that might influence the immune response and the
defense against pathogens as well as the expression of their
own MR.
8156
MANNOSE RECEPTOR AND COX-2 INDUCTION
anti-mouse IgG-FITC conjugate Ab (Sigma-Aldrich; 1/100 dilution) for 30
min at 4°C. Isotype-matched irrelevant Ab was used as a control.
Confocal microscopy
Human monocytes were seeded in 35-mm Primaria culture dishes (BD
Biosciences) to allow their differentiation into MDM as described above.
Twenty-four hours before being used, cells were serum-starved. At different times after the addition of stimuli, MDM were extensively washed with
HBSS to discard background extracellular fluorescence, and the dishes
were observed in vivo by confocal microscopy using a Bio-Rad Laser
scanning system Radiance 2100 coupled to a Nikon inverted microscope
with a thermostatized chamber. The objective was a ⫻20 and numerical
aperture of 0.5. Green fluorescence (fluorescein) was monitored at 488 nm
argon excitation using a HQ500 long-bandpass blocking filter. Images were
merged using Adobe Photoshop 6.0 software.
Immunoblots of COX-2
RT-PCR assays for dectin-1, Endo180, DC-SIGN, DC-SIGNR,
TLR-2, MR, and sPLA2 M-type receptor
Total cellular RNA was extracted by the TRIzol method (Invitrogen Life
Technologies). First-strand cDNA was synthesized from total RNA by RT
reaction. The reaction mixture containing 0.2 mg/ml total RNA, 2.5 ␮l of
H2O, 20 U of RNasin RNase inhibitor, 4 ␮l of 5⫻ buffer, 2 ␮l of 0.1 M
DTT, 4 ␮l of 2.5 mM dNTP, 1 ␮l of 0.1 mM hexanucleotide, and 200 U
of Moloney murine leukemia virus reverse transcriptase. The reaction was
conducted at 37°C for 60 min in a volume of 20 ␮l. The cDNA was
amplified by PCR in a reaction mixture containing 2 ␮l of DNA template;
10 ␮l of H2O; 2.5 ␮l of 10⫻ buffer; 0.75 ␮l of 50 mM MgCl2; 1.0 ␮l of
2.5 mM dNTP; 1.25 ␮l of each forward and reverse primer of dectin-1,
DC-SIGN, DC-SIGNR, TLR-2, MR, and ␤-actin; and 0.25 ␮l of 5 U/ml
Taq DNA polymerase. The amplification profile for detection included one
cycle of initial denaturation at 94°C for 5 min, 30 cycles of denaturation at
94°C for 30 s, primer annealing at 60°C for 30 s, and extension at 72°C for
30 s, and one cycle of final extension at 72°C for 7 min. The expression of
␤-actin was used as a control for the assay of a constitutively expressed
gene. PCR products were identified by automatic sequencing of the DNA
eluted from the agarose gel by excision of the band under UV light, followed by purification using a QIAquick PCR purification kit (Qiagen).
FIGURE 1. Effects of mannan and ␤-glucan particles on COX-2 expression. Monocytes adhered to plastic dishes by overnight culture at 37°C
(A), monocytes cultured in the presence of 5% human serum for 7 days (B),
and MDM (C and D) obtained after culture for 14 days in the presence of
5% human serum were incubated for 6 h in the presence of various stimuli,
then the cell lysates were collected and used for the immunodetection of
COX-2 and COX-1 (D). ␤-Actin was immunodetected to address the occurrence of similar protein loading across the gels. These data are representative of three to five experiments with identical results. C3bi indicates
particles coated with C3bi.
ELISA for PGE2
Quantitation of cellular PGE2 levels was determined using an enzyme immunoassay kit (Amersham Biosciences) according to the manufacturer’s
instructions. This assay is based on competition between unlabeled PGE2
in the sample and a fixed amount of labeled PGE2 for a PGE2-specific Ab.
The detection limit of this assay is 20 pg/ml. The samples for the assay
were collected 24 h after addition of the stimuli, because this allows the
detection of PGE2 produced during a prolonged period by the action of
COX enzymes on the arachidonate made available in the deacylation/
reacylation cycle.
Results
Induction of COX-2 protein and production of PGE2 by
mononuclear phagocytes in response to different stimuli
Incubation of overnight-adhered monocytes with mannan induced
a mild expression of COX-2 protein above basal levels, whereas
treatment with laminarin, zymosan particles, complement-coated
zymosan particles, and preformed IC did not noticeably increase
COX-2 above the levels observed in resting adhered monocytes
(Fig. 1A, left panel). Because mannan appeared as the most potent
stimuli, additional experiments were conducted using different
concentrations of this substance. However, a clear dose-dependency of the response was not observed for concentrations ⬎5
mg/ml (Fig. 1A, right panel), most likely because of the possible
induction of COX-2 expression by adherence-dependent signals
(34), which could impede the correct appraisal of receptor-mediated induction. By contrast, in experiments conducted on monocytes cultured in the presence of human serum for 7 days, there
was no expression of COX-2 in resting cells, suggesting that these
conditions are most adequate for a fine-tuning assessment of ligand-induced COX-2 expression. In keeping with this view, both
mannan and zymosan induced a net expression of COX-2 protein,
with mannan clearly behaving as the most potent stimulus (Fig.
1B). MDM obtained after 2 wk of culture showed noticeable induction of COX-2 protein with concentrations of mannan as low as
0.1 mg/ml, 1 mg/ml zymosan, and 5 mg/ml soluble ␤-glucan laminarin (Fig. 1C). Interestingly, the natural ligand of the mannose
receptor, MUC-3, also induced COX-2 expression; this effect was
not synergistic with that produced by the combination of MUC-3
and mannan, thereby agreeing with the hypothesis that both molecules act through the same receptor (Fig. 1C, lower panel). It is
noteworthy that COX-1 expression was not influenced by mannan
and zymosan treatment (Fig. 1D).
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
The amount of protein in each cell lysate was assayed using the Bradford
reagent, and 50 ␮g of protein from each sample was loaded on each lane
of a 10% SDS-PAGE gel. Proteins were transferred to nitrocellulose membranes using a semidry transfer system. The membranes were blocked with
dry milk and used for immunoblot using a goat polyclonal antiserum (SC1745) and, in some experiments, rabbit anti-COX-1 Ab (SC-7950) from
Santa Cruz Biotechnology. This was followed by incubation with donkey
anti-goat IgG-HRP-conjugated Ab. Detection was performed using the
Amersham Biosciences ECL system. ␤-Actin immunodetection was used
to address the occurrence of similar protein loading across the gels.
The Journal of Immunology
FIGURE 2. Effects of mannan and zymosan particles
on COX-2 expression and PGE2 production. MDM were
incubated in the presence of the indicated additions for
the times indicated, then the cell lysates were collected
for immunodetection of COX-2 (A). Cell culture medium of both monocytes and MDM treated for 24 h in
the presence of the indicated additions was used for the
assay of PGE2 (B). These are typical experiments of
three or four performed with identical results. In the case
of the PGE2 assay, results express the mean ⫾ SEM of
three independent experiments (ⴱ, p ⬍ 0.05, SC-236treated vs vehicle-treated MDM). THP-1 cells were incubated for 6 h in the presence of the various stimuli,
then the cell lysates were collected for the immunodetection of COX-2 (C). ␤-Actin was detected to address the
occurrence of similar protein loading across the gels. These
data are representative of three experiments with identical
results. The surface display of both CD206/MR and CD16/
Fc␥RIII in THP-1 cells assayed by immunofluorescence
flow cytometry is shown in D. Zymosan-C3bi indicates
zymosan particles coated with C3bi.
PGE2 on COX-2 induction (37) was addressed by assaying the
effect of exogenous PGE2. However, concentrations of PGE2 as
high as 15 ng/ml failed to induce COX-2 protein expression (data
not shown), which most likely indicates that under these experimental conditions, E-prostanoid receptors engaged by PGE2 are
not involved in autocrine COX-2 synthesis.
Expression of PRR in monocytic cells
Because the effect of zymosan (a polymer of ␤-glucan that can also
contain mannose) on myeloid cells has been associated with the
engagement of several receptors, namely, dectin-1 (38, 39), DCSIGNR (40), MR (9, 17, 41), and CR3 (42), and the effect of
mannose-containing particles has been associated to the engagement of MR, TLR-2 (43– 45), and DC-SIGN (11–13), the expression of this set of receptors was assessed in different cell types.
As shown in Fig. 3A, the expression of dectin-1 mRNA was
observed in all cell types studied at all stages of differentiation;
however, semiquantitative PCRs showed the highest levels of expression in both polymorphonuclear leukocyte (PMN) and MDM.
In keeping with the previously reported existence of two predominant and six minor transcripts obtained by alternative splicing and
small insertions in the human dectin-1 gene (26), a main PCR
product of ⬃558 bp was found in all cell types together with a
lower Mr product and other minor products. The expression of
Endo180 mRNA in monocytic cells was somewhat similar to that
of dectin-1, inasmuch as it increased with monocyte differentiation
into macrophages and was also detected in THP-1 cells. By contrast, Endo180 mRNA was not observed in PMN, and only a slight
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
The time course of COX-2 induction was studied in MDM.
Maximal induction occurred at 4 –7 h with all agonists (Fig. 2A);
the soluble ␤-glucan laminarin was again the stimulus displaying
the lowest potency, whereas mannan was the strongest stimulus.
The production of PGE2 showed a good correlation with COX-2
induction, because in keeping with the noticeable basal expression
of COX-2 protein, mannan slightly increased PGE2 production
above that observed in resting adhered monocytes, whereas it was
a potent stimulus in MDM (Fig. 2B). It should be noted that PGE2
production was most inhibited by 10 ␮M SC-236, a highly selective inhibitor of COX-2, the reported IC50 value of which for
COX-1 inhibition is 17.8 ␮M. In contrast, a more limited inhibition was produced by 0.3 ␮M SC-560, i.e., a concentration significantly higher than its reported IC50 value of 9 nM for COX-1
inhibition (35). THP-1 cells are currently used as an archetypal
model for human monocytes, because they display many different
PRR even though they do not express CD14 (36) and do not adhere
to plastic surfaces in the absence of phorbol ester treatment. On
this basis, this cell line was used to obtain additional insight into
the results observed in both monocytes and MDM. As shown in
Fig. 2C, zymosan was a robust inductor of COX-2; this effect was
enhanced by C3 bi-coating, which agrees with previous observations indicating a synergistic effect of complement coating on the
proinflammatory effects of zymosan particles, most likely explained by the ability of zymosan-C3bi to concomitantly engage
both dectin-1 (see below) and complement receptor 3 (CR3) (24).
In contrast, the response to mannan was less remarkable, thus
agreeing with the lower expression of MR in THP-1 cells (Fig. 2D)
compared with MDM (see below). The possible autocrine effect of
8157
8158
MANNOSE RECEPTOR AND COX-2 INDUCTION
FIGURE 3. Expression of mRNA
encoding for PRR in different cell
types. Total mRNA extracted from
blood leukocytes and cell lines was extracted and used for RT-PCR amplification with primers for dectin-1 (A),
Endo180 (A and B), TLR-2 (A), MR (C
and D), and type M sPLA2 receptor (C,
lower panel). The expression of ␤-actin
mRNA is shown as an example of constitutive gene expression (A, lower
panel). These data are representative of
three experiments with similar results.
COX-2 induction by mannan is not accounted for by TLR-2
activation nor LPS contamination
Because the most robust induction of COX-2 by mannan was observed in MDM after 14 days in culture, and the receptors capable
of binding terminal mannose residues preferentially expressed in
these cells are MR, Endo180, and TLR-2, these receptors were
envisaged as being involved in conveying signals for COX-2 induction. Additional experiments were conducted in cell lines that
have been used for similar purposes, namely, HEK293 (47) and
HeLa cells (48). Unlike blood cells, these cell lines do not express
type-M sPLA2 receptor (Fig. 3C) or TLR-2 mRNA (Fig. 6A), but
readily express TLR-2 mRNA upon transfection with an expression vector encoding for human TLR-2 (Fig. 6A). However, upon
stimulation with mannan, TLR-2-expressing HEK293 cells did not
exhibit COX-2 protein expression (data not shown), whereas they
produced an 8-fold increase in ␬B-driven transcriptional activity
upon transfection with a firefly luciferase-linked 5⫻ NF-␬B reporter plasmid DNA and stimulation with 10 ␮g/ml peptidoglycan,
i.e., a natural ligand for TLR-2 (49). In contrast, HeLa cells
showed a noticeable basal expression of COX-2, which was enhanced by 10 mg/ml mannan (Fig. 6B). This response was not
influenced by transfection of empty vector (pRc/CMC) and TLR2-encoding vector (Fig. 6, C and D, upper panels), although transfection with TLR-2-encoding vector endowed HeLa cells with the
ability to respond to the TLR-2 ligand peptidoglycan (Fig. 6, C and
D, lower panels). Moreover, transfection of HeLa cells with the
TLR-2 dominant negative mutant (P712H) did not abrogate mannan response, whereas these cells did not show COX-2 induction
in response to peptidoglycan above the expression level observed
in control cells (Fig. 6E). Taken together, these data indicate that
a receptor other than TLR-2, most likely the MR, should be involved in mannan-induced COX-2 expression in HeLa cells. As
shown in Fig. 7A, polymyxin B blocked the effect of Escherichia
coli LPS on human MDM, whereas this was not observed after
mannan treatment. This finding allows us to rule out a contamination of mannan by LPS. Conversely, mannose-BSA treatment
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
expression was observed in adhered monocytes (Fig. 3A). Interestingly, Endo180 mRNA showed a high expression level in both
HEK293 cells and HUVEC, thus agreeing with the reported expression of this receptor in endothelial cells (29) (Fig. 3B). Of note,
the mRNA of neither DC-SIGNR nor DC-SIGN could be detected
in the same set of cell types (not shown). TLR-2 mRNA was detected in blood and THP-1 cells (Fig. 3A). It is noteworthy that
THP-1 cells expressed high amounts of sPLA2 M-type receptor
(Fig. 3C). As shown in Fig. 3D, maximal expression of MR was
observed in MDM, although a weak, but significant, expression
was also observed in nonadhered mononuclear cells, THP-1 monocytes, and HeLa cells (Fig. 3, C and D). This point was addressed
in additional detail by indirect immunofluorescence flow cytometry. As shown in Fig. 4A, the surface display of MR was barely
detectable in monocytes, but it blatantly increased after several
days in culture, pari passu with the increasing size of the cells (Fig.
4B). The fluorescence intensity on day 1 was 3.6 ⫾ 0.3 (mean ⫾
SEM; n ⫽ 6; arbitrary units (AU)) and increased to 6.38 ⫾ 0.4 and
39.2 ⫾ 4 at 7 and 14 days, respectively. Moreover, FITC-conjugated, mannosylated BSA was readily uptaken by MDM, as assessed by flow cytometric assays (Fig. 5A). Confocal immunofluorescence microscopy showed that under these conditions, the
uptake of FITC-conjugated, mannosylated BSA was very rapid,
with focal images compatible with capping being detected as early
as 2 min after addition of the stimulus, and label reaching the
whole cytoplasm by 20 min. FITC-mannosylated BSA uptake was
not observed at 4°C nor in the presence of 10 mg/ml mannoseBSA. Moreover, it was not observed in HEK293 cells after long
periods of incubation (Fig. 5B).
The expression of CD16/Fc␥RIII, a receptor involved in the
adaptive humoral immune responses, also increased along the
macrophage differentiation route (Fig. 4A), with mean fluorescence
intensity values of 0.34 ⫾ 0.05, 2 ⫾ 0.03, and 4.77 ⫾ 0.2 (mean ⫾
SEM; n ⫽ 6; AU) on days 1, 7, and 14, respectively, thus indicating that this marker is a good indicator of macrophage differentiation, which is only detected in ⬃10% of peripheral blood
monocytes (46).
The Journal of Immunology
inhibited in a dose-dependent manner the effect of mannan,
whereas it did not influence LPS effect (Fig. 7, B and C). Of note,
mannose-BSA partially inhibited the zymosan effect (Fig. 7C,
right panel), whereas this was not observed on the response to the
pure ␤-glucan laminarin (Fig. 7C, left panel). These findings and
the previously observed inhibition of zymosan uptake by mannan
(24) are in keeping with previous reports indicating that the MR
may be involved in a portion of the biological effects of zymosan,
which are purportedly related to its content in mannose moieties
(10, 17, 40).
Discussion
Molecular structures containing terminal mannose are unusual
components of mammalian tissues; however, they are abundant in
the walls of a variety of microorganisms, which is a prime condition for these structures to behave as PAMP. Moreover, host cells
express different PRR able to recognize mannose-decorated components. The MR is the archetypal receptor, but DC-SIGN and
FIGURE 5. Uptake of FITC-conjugated, mannosylated BSA by MDM.
Adhered macrophages were incubated with various concentrations of
FITC-conjugated, mannosylated BSA at both 4 and 37°C, as indicated,
then cells were scraped and used for fluorescence flow cytometry. These
data are typical recordings of three independent experiments (A). Typical
patterns of merged images from phase-contrast transmission microscopy
and green fluorescence of MDM are shown. Cells were incubated with 200
␮g/ml FITC-conjugated, mannosylated BSA, and images were taken at the
times indicated (B). The panel marked mannose-BSA indicates MDM incubated with 10 mg/ml mannose-BSA for 10 min at 4°C, followed by
thermal equilibration at 37°C in the presence of FITC-conjugated mannose-BSA. Images were taken 30 min thereafter. The panel marked 60 min,
4°C, shows MDM incubated for 60 min at 4°C with FITC-conjugated,
mannose-BSA. The panel marked HEK293 shows a typical image of
HEK293 cells taken after 60 min of incubation with FITC-conjugated
mannose-BSA.
Endo180 have the ability to recognize mannose moieties, thus
making it difficult to ascertain the role displayed by each receptor
in physiologically relevant cell systems. Inhibition of proinflammatory cytokines has been related to the engagement of the MR
(44) and DC-SIGN (12, 13), whereas the proinflammatory effects
of mycobacterial lipomannans depend on their ability to interact
with TLR-2 (43– 45), which is reminiscent of the ability of this
receptor to interact with ␤-glucans (50), although most recent studies have disclosed a more complex paradigm in which dectin-1
behaves as the recognition receptor (38, 39) and TLR-2 acts as a
signal integrator targeting intracellular molecules into a signaling
complex involving MyD88, IL-1R-associated kinase, and TNFRassociated factor-6 (51).
Our first approach to address this interplay of receptors was to
analyze the pattern of receptors expressed in monocytic cells and
its correlation with the cell response along the route to macrophage
differentiation. We observed a reduced surface display of the MR
on human monocytes, which agrees with previous reports (16), and
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 4. Surface expression of CD206/MR and CD16/Fc␥RIII in
monocytes and MDM. Adhered monocytes were cultured in plastic dishes
in the presence of 5% human serum for the times indicated. After these
periods, cells were scraped and incubated with FITC-conjugated mouse
anti-human CD206 and CD16 at a concentration of 1 ␮g/106 cells, then
used for flow cytometry. Isotype-matched Ab was used as the control
(shown by the thin tracing on the left). These data are representative recordings of six identical experiments (A). Lower panels, Phase-contrast
transmission microscopic images of cells at various times of differentiation,
indicating the blatant changes in cell size (B).
8159
8160
MANNOSE RECEPTOR AND COX-2 INDUCTION
FIGURE 6. Effect of ectopic expression of TLR-2 on mannan-induced
COX-2 expression. The expression of TLR-2 mRNA in THP-1 monocytes
and HEK293 and HeLa cells in both the absence and the presence of
transfection with a vector encoding human TLR-2 sequence is shown in A.
The effect of various agonists on the expression of COX-2 in HeLa cells is
shown in nontransfected cells (B) or after transfection of both a mock
vector (pRc/CMV; C) and TLR-2 vector (D) 6 h after addition of stimuli.
The effect of transfection of HeLa cells with both a TLR-2 vector and a
dominant negative TLR-2 construct on the response to mannan and peptidoglycan is shown in E. These data are representative experiments of
three with similar results. The expression of ␤-actin is shown as an example of constitutive gene expression.
an increased expression of this receptor along the macrophage differentiation route, pari passu with the expression of CD16/
Fc␥RIII, a receptor implicated in adaptive immunity that is a wellknown marker of macrophage differentiation. In contrast, we have
not observed the expression of DC-SIGN at any point in the differentiation process, which is in keeping with the reported pattern
of expression of this receptor in cell microdomains during the development of human monocyte-derived dendritic cells (52). Furthermore, we have not detected the expression of DC-SIGNR
mRNA at any time of macrophage differentiation. This finding and
the unique activation of DC-SIGNR by ␤-glucan make it unlikely
that this receptor is involved in the response to ␣-mannan moieties.
With regard to dectin-1, our data agree with the preferential involvement of this receptor in the response to ␤-glucan particles,
inasmuch as the response to zymosan is clearly observed in THP-1
cells, which definitely express dectin-1 mRNA, and is enhanced by
C3bi coating, thus indicating a potentiation of the response by the
simultaneous engagement of CR3. The involvement of MR in me-
diation of the COX-2 induction produced by mannan is suggested
by several factors: 1) the correlation of the magnitude of the response with the extent of MR expression, as assessed by both
RT-PCR and flow cytometry; 2) the inhibition by mannose-BSA,
a ligand for the MR that is engulfed upon receptor binding and
leads to noticeable endocytosis, but behaves as a weak agonist
because it contains a lower ratio of attached sugar compared with
pure polysaccharides (16); and 3) the similar effect of a natural
ligand of the MR (MUC-3) together with the lack of synergism of
mannan and MUC-3, thus pointing to an effect of both ligands on
the same receptor. With regard to the possible involvement of
Endo180, initial studies have stressed its preferential binding by
N-acetylglucosamine, suggesting the existence of a different array
of ligands for this receptor and the MR (29). Even though this idea
has recently been modified by showing that under certain circumstances mannose oligosaccharides can bind to the receptor in a
Ca2⫹-dependent manner (53), this has been observed for Ca2⫹
concentrations of ⬃10 mM, suggesting that this binding might
only occur at concentrations well above physiological Ca2⫹ levels.
Moreover, unlike HeLa cells, which express the MR and show
COX-2 expression upon mannan challenge, HEK293 cells, which
do express Endo180 mRNA, do not show COX-2 induction upon
mannan challenge.
Regardless of the receptors involved in mannan effects, our data
show that the soluble mannose polysaccharide mannan from S.
cerevisiae as well as the natural ligand of the mannose receptor
MUC-3 produce both COX-2 induction and PGE2 release in human macrophages, which, in combination with our previous description of the release of arachidonic acid by mannan, links this
polysaccharide to the eicosanoid cascade (24). This finding raises
several questions of functional relevance, because the MR might
limit inflammation by counterbalancing signals from TLR and
other PRR (54), and PGE2 down-regulates inflammation and dendritic cell migration via E-prostanoid receptor 2 (55). Interestingly,
microarray analysis of gene expression in human dendritic cells
stimulated with mannan has shown a significant enhancement of
COX-2 expression in the context of an outstanding overlap of the
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 7. Effects of polymyxin B and mannose-BSA on the induction
of COX-2 produced by different stimuli. MDM were incubated with mannan and LPS in the presence and the absence of various concentrations of
polymyxin B. After 6 h, cell lysates were collected and used for the immunodetection of COX-2 (A). The effect of the preincubation of MDM
with mannosylated BSA on the induction of COX-2 by various stimuli is
shown in B and C. These are representative of three independent
experiments.
The Journal of Immunology
Acknowledgments
We thank Cristina Gómez for technical help, Dr. Padrón and the staff of
Centro de Hemoterapia y Hemodonación de Castilla y León for their help
with the separation and culture of blood monocytes, and Dr. Michael Rehli
(University of Regensburg, Regensburg, Germany) for the generous gift of
hemagglutinin-tagged cDNA of human TLR-2.
Disclosures
The authors have no financial conflict of interest.
References
1. Stahl, P. D., J. S. Rodman, M. J. Miller, and P. H. Schlesinger. 1978. Evidence
for receptor-mediated binding of glycoproteins, glycoconjugates, and lysosomal
glycosidases by alveolar macrophages. Proc. Natl. Acad. Sci. USA 75:
1399 –1403.
2. Porcaro, I., M. Vidal, S. Jouvert, P. D. Stahl, and J. Giaimis. 2003. Mannose
receptor contribution to Candida albicans phagocytosis by murine E-clone 774
macrophages. J. Leukocyte Biol. 74: 206 –215.
3. Basu, N., R. Sett, and P. K. Das. 1991. Down-regulation of mannose receptors on
macrophages after infection with Leishmania donovani. Biochem. J. 277:
451– 456.
4. Koziel, H., Q. Eichbaum, B. A. Kruskal, P. Pinkston, R. A. Rogers,
M. Y. Armstrong, F. F. Richards, R. M. Rose, and R. A. Ezekowitz. 1998. Reduced binding and phagocytosis of Pneumocystis carinii by alveolar macrophages from persons infected with HIV-1 correlates with mannose receptor
downregulation. J. Clin. Invest. 102: 1332–1244.
5. Stahl, P. D., and R. A. Ezekowitz. 1998. The mannose receptor is a pattern
recognition receptor involved in host defense. Curr. Opin. Immunol. 10: 50 –55.
6. East, L., and C. M. Isacke. 2002. The mannose receptor family. Biochim. Biophys. Acta 1572: 364 –386.
7. Taylor, P. R., S. Gordon, and L. Martı́nez-Pomares. 2005. The mannose receptor:
linking homeostasis and immunity through sugar recognition. Trends Immunol.
26: 104 –110.
8. West, A. P., Jr., A. B. Herr, and P. J. Bjorkman. 2004. The chicken yolk sac IgY
receptor, a functional equivalent of the mammalian MHC-related Fc receptor, is
a phospholipase A2 receptor homolog. Immunity 20: 601– 610.
9. Linehan, S. A., L. Martinez-Pomares, P. D. Stahl, and S. Gordon. 1999. Mannose
receptor and its putative ligands in normal murine lymphoid and nonlymphoid
organs: in situ expression of mannose receptor by selected macrophages, endothelial cells, perivascular microglia, and mesangial cells, but not dendritic cells.
J. Exp. Med. 189: 1961–1972.
10. Sung, S. S., R. S. Nelson, and S. C. Silverstein. 1983. Yeast mannans inhibit
binding and phagocytosis of zymosan by mouse peritoneal macrophages. J. Cell
Biol. 96: 160 –166.
11. Geijtenbeek, T. B., S. J. Van Vliet, E. A. Koppel, M. Sánchez-Hernández,
C. M. Vandenbroucke-Grauls, B. Appelmelk, and Y. Van Kooyk. 2003. Mycobacteria target DC-SIGN to suppress dendritic cell function. J. Exp. Med. 197:
7–17.
12. Kaufmann, S. H., and U. E. Schaible. 2003. A dangerous liaison between two
major killers: Mycobacterium tuberculosis and HIV target dendritic cells through
DC-SIGN. J. Exp. Med. 197: 1–5.
13. Maeda, N., J. Nigou, J. L. Herrmann, M. Jackson, A. Amara, P. H. Lagrange,
G. Puzo, B. Gicquel, and O. Neyrolles. 2003. The cell surface receptor DC-SIGN
discriminates between Mycobacterium species through selective recognition of
the mannose caps on lipoarabinomannan. J. Biol. Chem. 278: 5513–5516.
14. Hernández, M., L. Fuentes, F. J. Fernández Avilés, M. Sánchez Crespo, and
M. L. Nieto. 2002. Secretory phospholipase A2 elicits proinflammatory changes
and upregulates the surface expression of Fas ligand in monocytic cells: Potential
relevance for atherogenesis. Circ. Res. 90: 38 – 45.
15. Fuentes, L., M. Hernández, F. J. Fernández-Avilés, M. Sánchez Crespo, and
M. L. Nieto. 2002. Cooperation between secretory phospholipase A2 and TNFreceptor superfamily signaling: implications for the inflammatory response in
atherogenesis. Circ. Res. 91: 681– 688.
16. Sallusto, F., M. Cella, C. Danielli, and A. Lanzavecchia. 1995. Dendritic cells use
macropinocytosis and the mannose receptor to concentrate macromolecules in the
major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products. J. Exp. Med. 182: 389 – 400.
17. Astarie-Dequeker, C., E. N. N⬘Diaye, V. Le Cabec, M. G. Rittig, J. Prandi, J., and
I. Maridonneau-Parini. 1999. The mannose receptor mediates uptake of pathogenic and nonpathogenic mycobacteria and bypasses bactericidal responses in
human macrophages. Infect. Immun. 67: 469 – 477.
18. Chieppa, M., G. Bianchi, A. Doni, A., Del Prete, M. Sironi, G. Laskarin,
P. Monti, L. Piemonti, A. Biondi, A. Mantovani, et al. 2003. Cross-linking of the
mannose receptor on monocyte-derived dendritic cells activates an antiinflammatory immunosuppressive program. J. Immunol. 171: 4552– 4560.
19. Lee, S. J., N. Y. Zheng, M. Clavijo, and M. C. Nussenzweig. 2003. Normal host
defense during systemic candidiasis in mannose receptor-deficient mice. Infect.
Immun. 71: 437– 445.
20. Swain, S. D., S. J. Lee, M. C. Nussenzweig, and A. G. Harmsen. 2003. Absence
of the macrophage mannose receptor in mice does not increase susceptibility to
Pneumocystis carinii infection in vivo. Infect. Immun. 71: 6213– 6221.
21. Shibata, Y., W. J. Metzger, and Q. N. Myrvik. 1997. Chitin particle-induced
cell-mediated immunity is inhibited by soluble mannan: mannose receptor-mediated phagocytosis initiates IL-12 production. J. Immunol. 159: 2462–2467.
22. Rivera-Marrero, C. A., W. Schuyler, S. Roser, J. D. Ritzenthaler, S. A. Newburn,
and J. Roman. 2002. M. tuberculosis induction of matrix metalloproteinase-9: the
role of mannose and receptor-mediated mechanisms. Am. J. Physiol. 282:
L546 –L555.
23. Zhang, J., J. Zhu, A. Imrich, M. Cushion, T. B. Kinane, and H. Koziel. 2004.
Pneumocystis activates human alveolar macrophage NF-␬B signaling through
mannose receptors. Infect. Immun. 72: 3147–3160.
24. Fernández, N., M. Renedo, S. Alonso, and M. Sánchez Crespo. 2003. Release of
arachidonic acid by stimulation of opsonic receptors in human monocytes: the
Fc␥R and the complement receptor 3 pathways. J. Biol. Chem. 278:
52179 –52187.
25. Coste, A., M. Dubourdeau, M. D. Linas, S. Cassaing, J. C. Lepert, P. Balard, P.,
S. Chalmeton, J. Bernad, C. Orfila, J. P. Seguela, et al. 2003. PPAR␥ promotes
mannose receptor gene expression in murine macrophages and contributes to the
induction of this receptor by IL-13. Immunity 19: 329 –339.
26. Willment, J. A., S. Gordon, and G. D. Brown. 2001. Characterization of the
human ␤-glucan receptor and its alternatively spliced isoforms. J. Biol. Chem.
276: 43818 – 43823.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
set of genes elicited by C. albicans (56), thus attesting to the relevance of PRR in the recognition of mannose-decorated PAMP in
antifungal responses (57). Moreover, tumor-associated macrophages show a functional polarization associated with MR expression, endocytic activity, and poor cytotoxicity, which can be explained by the action of tumor mucins on the MR (54, 58). That
this could be due to PGE2 production elicited by mucins via the
MR/COX-2 route is a tempting hypothesis. However, because several receptors can be activated by mannose-containing PAMP, it
should be taken into account that the final response might be determined by a complex balance resulting from the concomitant
activation of distinct receptors on host cells by microorganismand tumor-derived products (59).
The characterization of the signaling route triggered by MR engagement is an important issue. In light of the mechanisms usually
associated with the innate immune response, the NF-␬B route
would appear at first glance to be involved. This pathway has
recently been explored in human alveolar macrophages and found
to be involved in the defense against P. carinii infection (23), thus
locating the MR with other PRR in the classical pathway of NF-␬B
activation leading to the increased transcription of genes encoding
chemokines, adhesion molecules, and enzymes that synthesize inflammatory mediators, i.e., COX-2 (60). These data have recently
been enlarged by showing the involvement of the GTPases, Cdc42
and Rho, in the nonopsonic phagocytosis of Pneumocystis by alveolar macrophages (61), and it has been suggested that reduced
mannose receptor-mediated Cdc42 and Rho activation in alveolar
macrophages in the context of HIV infection might be a mechanism that contributes to the pathogenesis of opportunistic pneumonia. In contrast, studies of monocyte-derived dendritic cells
have revealed no activation of ␬B-driven transcription upon MR
cross-linking, whereas blockade of the PI3K route showed marked
inhibition of MR signaling (18). The possibility that cell-specific
signaling pathways might be coupled to the MR, thus yielding
different patterns of response, seems to be of pathophysiological
relevance. In this connection, MR is to date the only innate PRR
known to be significantly up-regulated in a typical chronic inflammatory condition such as nasal polyposis, thus suggesting a central
role for MR in the pathophysiology of this disease (62).
In summary, our data have shown a strong capacity of ligands
displaying terminal mannoses to induce COX-2 in human mononuclear phagocytes. This capacity increases along the differentiation of these cells into the macrophage route and best correlates
with the expression of MR. These findings disclose the existence
of a paracrine immunomodulatory route associated with PG production, which is associated with the endocytosis of mannose-decorated molecules and might also influence the expression of the
MR (25).
8161
8162
44. Nigou, J., C. Zelle-Rieser, M. Gilleron, M. Thurnher, and G. Puzo. 2001. Mannosylated lipoarabinomannans inhibit IL-12 production by human dendritic cells:
evidence for a negative signal delivered through the mannose receptor. J. Immunol. 166: 7477–7485.
45. Gibson, K. J., M. Gilleron, P. Constant, T. Brando, G. Puzo, G. S. Besra, and
J. Nigou. 2004. Tsukamurella paurometabola lipoglycan, a new lipoarabinomannan variant with pro-inflammatory activity. J. Biol. Chem. 279: 22973–22982.
46. Passlick, B., D. Flieger, and H. W. Ziegler-Heitbrock. 1989. Identification and
characterization of a novel monocyte subpopulation in human peripheral blood.
Blood 74: 2527–2534.
47. Grab, L. T., M. W. Kearns, A. J. Morris, and L. W. Daniel. 2004. Differential role
for phospholipase D1 and phospholipase D2 in 12-O-tetradecanoyl-13-phorbol
acetate-stimulated MAPK activation, Cox-2 and IL-8 expression. Biochim. Biophys. Acta 1636: 29 –39.
48. Deva, R., P. Shankaranarayanan, R. Ciccoli, and S. Nigam. 2003. Candida albicans induces selectively transcriptional activation of cyclooxygenase-2 in HeLa
cells: pivotal roles of Toll-like receptors, p38 mitogen-activated protein kinase,
and NF-␬B. J. Immunol. 171: 3047–3055.
49. Dueñas, A. I., A. Orduña, M. Sánchez Crespo, and M. C. Garcı́a-Rodrı́guez.
2004. Interaction of endotoxins with Toll-like receptor 4 correlates with their
endotoxic potential and may explain the proinflammatory effect of Brucella spp.
LPS. Int. Immunol. 16: 1467–1475.
50. Underhill, D. M., A. Ozinsky, A. M. Hajjar, A. Stevens, C. B. Wilson,
M. Bassetti, and A. Aderem. 2000. The repertoire for pattern recognition of
pathogens by the innate immune system is defined by cooperation between Tolllike receptors. Proc. Natl. Acad. Sci. USA 97: 13766 –13771.
51. Sabroe, I., R. C. Read, M. K. Whyte, D. H. Dockrell, S. N. Vogel, and
S. K. Dower. 2003. Toll-like receptors in health and disease: complex questions
remain. J. Immunol. 171: 1630 –1635.
52. Cambi, A., F. De Lange, N. M. Van Maarseveen, M. Nijhuis, B. Joosten,
E. M. Van Dijk, B. I. De Bakker, J. A. Fransen, P. H. Bovee-Geurts,
F. N. Van Leeuwen, et al. 2004. Microdomains of the C-type lectin DC-SIGN are
portals for virus entry into dendritic cells. J. Cell Biol. 164: 145–155.
53. East, L., S. Rushton, M. E. Taylor, and C. M. Isacke. 2002. Characterization of
sugar binding by the mannose receptor family member, Endo180. J. Biol. Chem.
277: 50469 –50475.
54. Allavena, P., M. Chieppa, P. Monti, and L. Piemonti. 2004. From pattern recognition receptor to regulator of homeostasis: the doubled-faced macrophage
mannose receptor. Crit. Rev. Immunol. 24: 179 –192.
55. Baratelli, F. E., N. Heuze-Vourc’h, K. Krysan, M. Dohadwala, K. Riedl,
S. Sharma, and S. M. Dubinett. 2004. Prostaglandin E2-dependent enhancement
of tissue inhibitors of metalloproteinases-1 production limits dendritic cell migration through extracellular matrix. J. Immunol. 173: 5458 –5466.
56. Huang, Q., D. Liu, P. Majewski, L. C. Schulte, J. M. Korn, R. A. Young,
E. S. Lander, and N. Hacohen. 2001. The plasticity of dendritic cell responses to
pathogens and their components. Science 294: 870 – 875.
57. O’Neill, L. A. J. 2004. TLRs: Professor Metchnikov, sit on your hat. Trends
Immunol. 25: 687– 693.
58. Mantovani, A., S. Sozzani, M. Locati, P. Allavena, and A. Sica. 2002. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized
M2 mononuclear phagocytes. Trends Immunol. 23: 549 –555.
59. Romani, L., C. Montagnoli, S. Bozza, K. Perruccio, A. Spreca, P. Allavena,
S. Verbeek, R. A. Calderone, F. Bistoni, and P. Puccetti. 2004. The exploitation
of distinct recognition receptors in dendritic cells determines the full range of host
immune relationships with Candida albicans. Int. Immunol. 16: 149 –161.
60. Bonizzi, G., and M. Karin. 2004. The two NF-␬B pathways and their role in
innate and adaptive immunity. Trends Immunol. 25: 280 –288.
61. Zhang, J., J. Zhu, X. Bu, M. Cushion, T. B. Kinane, H. Avraham, and H. Koziel.
2005. Cdc42 and RhoB activation are required for mannose receptor-mediated
phagocytosis by human alveolar macrophages. Mol. Biol. Cell 16: 824 – 834.
62. Claeys, S., T. De Belder, G. Holtappels, P. Gevaert, B. Verhasselt,
P. Van Cauwenberge, and C. Bachert. 2004. Macrophage mannose receptor in
chronic sinus disease. Allergy 59: 606 – 612.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
27. Curtis, B. M., S. Scharnowske, and A. J. Watson. 1992. Sequence and expression
of a membrane-associated C-type lectin that exhibits CD4-independent binding of
human immunodeficiency virus envelope glycoprotein gp120. Proc. Natl. Acad.
Sci. USA 89: 8356 – 8360.
28. Soilleux, E. J., R. Barten, and J. Trowsdale. 2000. DC-SIGN; a related gene,
DC-SIGNR; and CD23 form a cluster on 19p13. J. Immunol. 165: 2937–2942.
29. Sheikh, H., H. Yarwood, A. Ashworth, and C. M. Isacke. 2000. Endo180, an
endocytic recycling glycoprotein related to the macrophage mannose receptor is
expressed on fibroblasts, endothelial cells and macrophages and functions as a
lectin receptor. J. Cell. Sci. 113: 1021–1032.
30. Meng, G., A. Grabiec, M. Vallon, B. Ebe, S. Hampel, W. Bessler, H. Wagner, and
C. J. Kirschning. 2003. Cellular recognition of tri-/di-palmitoylated peptides is
independent from a domain encompassing the N-terminal seven leucine-rich repeat (LRR)/LRR-like motifs of TLR2. J. Biol. Chem. 278: 39822–39829.
31. Taylor, M. E., J. T. Conary, M. R. Lennartz, P. D. Stahl, and K. Drickamer. 1990.
Primary structure of the mannose receptor contains multiple motifs resembling
carbohydrate-recognition domains. J. Biol. Chem. 265: 12156 –12162.
32. Ancian, P., G. Lambeau, M. G. Mattei, and M. Lazdunski. 1995. The human
180-kDa receptor for secretory phospholipases A2: molecular cloning, identification of a secreted soluble form, expression, and chromosomal localization.
J. Biol. Chem. 270: 8963– 8970.
33. Asea, A., M. Rehli, E. Kabingu, J. A. Boch, O. Bare, P. E. Auron,
M. A. Stevenson, and S. K. Calderwood. 2002. Novel signal transduction pathway utilized by extracellular HSP70: role of Toll-like receptor (TLR) 2 and
TLR4. J. Biol. Chem. 277: 15028 –15034.
34. Fernández, N., M. A. Renedo, M. C. Garcı́a-Rodrı́guez, and M. Sánchez Crespo.
2002. Activation of monocytic cells through Fc␥ receptors induces the expression
of macrophage-inflammatory protein (MIP)-1␣, MIP-1␤, and RANTES. J. Immunol. 169: 3321–3328.
35. Smith, C. J., Y. Zhang, C. M. Koboldt, J. Muhammad, B. S. Zweifel, A. Shaffer,
J. J. Talley, J. L. Masferrer, K. Seibert, and P. C. Isakson. 1998. Pharmacological
analysis of cyclooxygenase-1 in inflammation. Proc. Natl. Acad. Sci. USA 95:
13313–13318.
36. Tamai, R., S. Sugawara, O. Takeuchi, S. Akira, and H. Takada. 2003. Synergistic
effects of lipopolysaccharide and interferon-␥ in inducing interleukin-8 production in human monocytic THP-1 cells is accompanied by up-regulation of CD14,
Toll-like receptor 4, MD-2 and MyD88 expression. J. Endotoxin Res. 9: 145–153.
37. Faour, W. H., Y. He, Q. W. He, M. de Ladurantaye, M. Quintero, A. Mancini, and
J. A. Di Battista. 2001. Prostaglandin E2 regulates the level and stability of cyclooxygenase-2 mRNA through activation of p38 mitogen-activated protein kinase in IL-1␣-treated human synovial fibroblasts. J. Biol. Chem. 276:
31720 –31731.
38. Gantner, B. N., R. M. Simmons, S. J. Canavera, S. Akira, and D. M. Underhill.
2003. Collaborative induction of inflammatory responses by dectin-1 and Tolllike receptor 2. J. Exp. Med. 197: 1107–1117.
39. Brown, G. D., J. Herre, D. L. Williams, J. A. Willment, A. S. Marshall, and
S. Gordon. 2003. Dectin-1 mediates the biological effects of ␤-glucans. J. Exp.
Med. 197: 1119 –1124.
40. Taylor, P. R., G. D. Brown, J. Herre, D. L. Williams, J. A. Willment, and
S. Gordon. 2004. The role of SIGNR1 and the ␤-glucan receptor (dectin-1) in the
nonopsonic recognition of yeast by specific macrophages. J. Immunol. 172:
1157–1162.
41. Speert, P. D., and S. C. Silverstein. 1985. Phagocytosis of unopsonized zymosan
by human monocyte-derived macrophages: maturation and inhibition by mannan.
J. Leukocyte Biol. 38: 655– 658.
42. Thornton, B. P., V. Vetvicka, M. Pitman, R. C. Goldman, and G. D. Ross. 1996.
Analysis of the sugar specificity and molecular location of the ␤-glucan-binding
lectin site of complement receptor type 3 (CD11b/CD18). J. Immunol. 156:
1235–1246.
43. Quesniaux, V. J., D. M. Nicolle, D. Torres, L. Kremer, Y. Guerardel, J. Nigou,
G. Puzo, F. Erard, and B. Ryffel. 2004. Toll-like receptor 2 (TLR2)-dependentpositive and TLR2-independent-negative regulation of proinflammatory cytokines by mycobacterial lipomannans. J. Immunol. 172: 4425– 4434.
MANNOSE RECEPTOR AND COX-2 INDUCTION