Giant pacific octopus (Enteroctopus
dofleini)
N omb res comu n es: Pulpo (Español)
Si n ón i mos: Octopus dofleini
¿Tienes alguna duda, sugerencia o corrección acerca de este taxón? Envíanosla y con gusto la
atenderemos.
Foto: (c) John Carleton, algunos derechos reservados (CC BY-NC-SA)
Ver todas las fotos etiquetadas con Enteroctopus dofleini en Banco de Imagénes »
Descripción de EOL Ver en EOL (inglés) →
Distribution 1,2
Giant Pacific octopuses, Enteroctopus dofleini, are found throughout the Pacific Ocean. They have been
documented as far north as the Alaskan Aleutian Islands and as far south as the Baja California region
of Mexico. This species ranges as far northeast as Japan.
Bi ogeograp h i c R egi on s: pacific ocean (Native )
Biology 3
Bi ol ogy/N atu ral Hi story: The 3rd right arm of the male of this species has a large hectocotylus, about
1/5 the length of the arm (photo). The hectocotylus is used in transferring the male's spermatophore, or
package of sperm, which may be up to a meter long, to the female. The hectocotylus may be left within
the mantle of the female during the process. Eggs, which look like small whitish grapes, are laid
throughout the year but mainly in the winter. When the female has eggs she attaches them to the roof
of a cave and guards them until they hatch (5-7 months). She may lay 35,000 to 70,000 eggs in a single
clutch. Hatching is mainly in early spring, and the young are pelagic for one to several months before
settling. The young are sometime seen swimming near the surface. Lifespan is thought to be 4-5 years.
Prey include crustaceans (shrimp and crabs), mollusks (scallops, clams, abalones, moon snails, small
octopus), and fish (rockfish, flatfish, sculpins). The octopus are often captured in crab traps, where they
are trying (successfully) to steal the crabs. Females can be cannibalistic. The Seattle Aquarium recently
observed an octopus catching the spiny dogfish Squalus acanthias, and in 2005 we found the pickedclean skeleton of a dogfish on the shellheap outside an octopus den (photo). The species accumulates a
large pile of shells and crab carapaces outside the den, which is usually under a boulder or in a rocky
crevice. They quickly kill crabs by rasping a tiny hole (1 mm or less in diameter) through the carapace
(photo), probably with their radula, then presumably injecting poison, perhaps with their beak. Several
species may be attracted to their shell pile (midden), including Pycnopodia helianthoides and the snail
Amphissa columbiana. Predators include seals, sea otters, dogfish sharks, lingcod, and man. Parasites
include the mesozoans Dicyemenna abreida and Conocyema deca, which live in the kidney.
This octopus is said to be capable of inflicting a painful bite but I have never seen anyone bitten, even
when wrestling them off the rocks. They seem much less ready to bite than is O. rubescens.
Description 3
The skin of this octopus is not smooth; instead it has extensive skin folds and large, truncate papillae.
Color often some shade of dark red or reddish brown but can change color rapidly (for example to a
light mottled greenish). May have white spots on the dorsal mantle and on the arm web in front of the
eyes, but no "eyespots" as are seen on O. bimaculatus farther south. May grow very large, with a mantle
length over 20 cm, body weight to 272 kg, and arm spread to 9 m. This is the world's largest known
octopus.
Morphology 1,2
Giant Pacific octopuses are larger than any other species of octopus. Specimens have weighed as much
as 272 kg and measured 9.6 m in radius. However, most reach an average weight of 60 kg with a dorsal
mantle length of 50 to 60 cm. Giant Pacific octopuses are usually reddish in color but are able to change
color and texture when threatened or for camouflage. The dorsal mantle is shaped like a sack and
contains the brain, reproductive organs, digestive organs, and eyes. Giant Pacific octopuses have two
eyes, one on each side of their head, which provide extremely acute vision. Giant Pacific octopuses also
have four pairs of arms that extend from the mantle. Each pair is covered with up to 280 suckers, which
contain thousands of chemical receptors.
Average mass: 60 kg.
Oth er Ph ysi cal Featu res: ectothermic ; bilateral symmetry
Type information 4
Hol otyp e for Polypus gilbertianus Berry, 1912
Catal og N u mb er: USNM 214320
Col l ecti on : Smithsonian Institution, National Museum of Natural History, Department of Invertebrate
Zoology
Sex/Stage: male;
Prep arati on : Isopropyl Alcohol
Col l ector(s): United States Fish Commission
Year Col l ected : 1903
Local i ty: Alexander Archipelago, Revillagigedo Island, Behm Canal, Naha Bay, Indian Point, Alaska,
United States, North Pacific Ocean
Dep th (m): 75 to 245
Vessel : Albatross R/V
Look alikes 3
How to Di sti n gu i sh from Si mi l ar Sp eci es: Octopus rubescens is smaller, with mantle length less
than 10 cm and weight less than 200 g; its skin has small, pointed papillae but not the large skin folds
found on O. dofleini .
Habitat 5,6
coastal to shelf
Trophic strategy 1,2
Giant Pacific octopuses are considered generalist foragers. They return to their den in order to
consume their prey, and they deposit the prey's remains at the entrance of their den. This collection of
skeletal remains is known as a middens. Examination of middens indicates that the diet of giant Pacific
octopuses is primarily composed of clams, crabs, fish, and squid. Giant Pacific octopuses are visual
hunters that utilize a variety of hunting strategies including stalking, chasing, and camouflaging
themselves in order to ambush prey. They possesses a well-developed sense of vision, allowing them to
coordinate the use of all eight arms to attack their victim. Members of this species also use different
methods to prepare meals for consumption. One method includes pulling the protective shell apart in
order to reach the meat contained inside. Another method involves crushing prey with their strong
beak located in the center of its appendages. The most common method of obtaining food, however,
involves drilling a hole in the prey's shell, in which an octopus injects its toxic saliva.
An i mal Food s: fish; mollusks; aquatic crustaceans
Pri mary Di et: carnivore (Molluscivore )
Associations 1,2
Giant Pacific octopuses do not specialize on any one particular species of prey and are not the main
source of food for any particular predator. They do, however, serve as host to some dicyemid
mesozoans. Dicyemennea nouveli is a large, conical-shaped species that reaches up to 12,000 um in
length. Dicyemennea nouveli inserts the pointed anterior end of its body into the folds of the renal
appendages of giant Pacific octopuses. Other members of g. Dicyemennea are also found in shallowwater cephalopods.
Commen sal /Parasi ti c Sp eci es:
Dicyemennea nouveli
g. Dicyemennea
Behaviour 1,2
Each pair of arms of giant Pacific octopuses has up to 280 suckers, which have thousands of chemical
receptors. These provide an acute sense of touch and taste, which this species use to help detect prey.
Typically calm animals, giant Pacific octopuses are unusually adept at navigating by using landmarks in
the wild and at adapting objects as tools. They are the only invertebrate known to use their welldeveloped vision to learn through observation. Giant Pacific octopuses are considered extremely
intelligent, partially do to their larger-than-average brain-to-body weight ratio. Individuals in captivity
are known for having having unique temperaments and personalities, ranging from playful to
destructive. Their high level of intelligence and desire to interact with human caretakers have earned
captive members of this spices a reputation as notorious escape artists.
Percep ti on Ch an n el s: visual ; tactile ; chemical
Life cycle 1,2
The lifespan of giant Pacific octopuses is characterized by a fast growth period that continues
throughout its entire life of 4 to 5 years. Larvae hatch from a cluster of eggs and are on average 9.5 to
10.1 mm in length. The larvae, with limited swimming ability, move to the surface to begin a planktonic
existence that lasts 1 to 3 months. At the end of the planktonic stage, juveniles descend to the benthos
where they undergo rapid growth. Giant Pacific octopuses continue to grow until they reproduce.
Within 3 months of breeding, males normally undergo a period of senescence and die. Symptoms of
senescence in this species include reduced food intake, retraction of skin around the eyes, aimless
movement (wandering) and lesions that do not heal. Females that survive brooding undergo a similar
period of senescence and die within weeks of the eggs hatching.
Life expectancy 1,2
Giant Pacific octopuses on average live 4.5 to 5 years in the wild. A similar lifespan has been observed
for members this species held in public aquariums.
Average l i fesp an
Statu s: wi l d : 4.5 to 5 years.
Average l i fesp an
Statu s: cap ti vi ty : 4.5 to 5 years.
Reproduction 1,2
Male reproductive organs of great Pacific octopuses are enclosed inside the mantle cavity within a
genital bag. Spermatozoa are encapsulated in a spindle-shaped spermatophoric sac. Males utilizes a
hectocotylized arm, a specialized tentacle used for the transfer of sperm, to insert the two
spermatophores (each 1 m in length) into an oviduct located in the mantle of the female. The balloon
part of the spermatophore remains inside the oviduct while the remainder of the sac hangs from the
female. Eventually, the sac bursts and releases millions of spermatozoa. The entire mating process
takes 2 to 3 hours. Giant Pacific octopuses are polygynous.
M ati n g System: polygynous
Giant Pacific octopuses breed throughout the year, though spawning peaks in winter. Males may breed
with several females, but females mate only once in their lifetime. Over several days, females lay 20,000
to 100,000 rice-shaped eggs (avg. 50,000) in grape-like clusters of 200 to 300 eggs each. These clusters
are hung from the ceiling of the den. Females remain with the eggs throughout the entire brooding
period, guarding them from predators and using her syphon to aerate and clean the clusters. Hatching
can take anywhere from 150 days to almost 1 year depending on water temperature. Cooler
temperatures delay the development of the embryo and therefore lengthen incubation time.
Breed i n g i n terval : Male giant Pacific octopuses may breed with several females once reaching
maturity, but females mate only once in their lifetime.
Breed i n g season : Giant Pacific octopuses breed year-round.
R an ge n u mb er of offsp ri n g: 20,000 to 100,000.
Average n u mb er of offsp ri n g: 50,000.
Average ti me to i n d ep en d en ce: 0 minutes.
R an ge age at sexu al or rep rod u cti ve matu ri ty (femal e): 3 to 5 years.
R an ge age at sexu al or rep rod u cti ve matu ri ty (mal e): 3 to 5 years.
K ey R ep rod u cti ve Featu res: semelparous ; year-round breeding ; sexual ; fertilization (Internal );
broadcast (group) spawning; oviparous
Female giant Pacific octopuses remain with their eggs throughout the entire brooding period, guarding
them from predators and using their syphon to aerate and clean the clusters. Females do not leave the
den during this period, not even to eat. Females die during the brooding period or shortly thereafter,
and males die within three months of breeding. Therefore, there is no post-hatching parental
investment evident in giant Pacific octopuses.
Paren tal In vestmen t: pre-hatching/birth (Provisioning: Female, Protecting: Female)
Barcode data: enteroctopus dofleini 7
The following is a representative barcode sequence, the centroid of all available sequences for this
species.
There are 2 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member
of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other
sequences.
ACATTATATTTTATTTTTGGAATTTGATCAGGTTTACTAGGTACATCATTA--AGATTAATAATTCGAACAGAACTAGGACAACCTGGATCTTTACTAAATGAT--GATCAACTTTATAACGTTATTGTTACTGCCCACGCTTTTGTAATAATTTTCTTTTTAGTTATACCCGTAATAATTGGAGGATTTG
-TTAGGAGCTCCAGATATAGCATTCCCACGAATAAACAATATAAGATTTTGATTACTTCCCCCCTCTTTAACTCTCCTATTAACTT
-GCAATTTTTTCCCTTCATTTAGCAGGTATTTCCTCTATTTTAGGAGCTATTAATTTCATCACAACTATTATTAATATACGATGAG
-GCCATTACTATACTTCTTACTGATCGTAACTTCAATACAACTTTTTTTGACCCAAGAGGAGGAGGAGATCCTATTCTATATCAA
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT
-- end -Download FASTA File
Conservation status 1,2
Giant Pacific octopuses are not considered at risk by the IUCN Red List, CITES, or the US Federal List of
Endangered Species. Although this spices is commercially fished in some areas, this does not appear to
be greatly affecting population sizes.
US Fed eral Li st: no special status
CITES: no special status
Uses 1,2
There are no known adverse effects of giant Pacific octopuses on humans.
References
1. Hartis, C. 2011. "Enteroctopus dofleini" (On-line), Animal Diversity Web. Accessed April 27, 2013 at
http://animaldiversity.ummz.umich.edu/site/accounts/information/Enteroctopus_dofleini.html
2. © The Regents of the University of Michigan and its licensors, some rights reserved
3. © Rosario Beach Marine Laboratory, some rights reserved
4. © Smithsonian Institution, National Museum of Natural History, Department of Invertebrate
Zoology, some rights reserved
5. van der Land, J. (ed). (2008). UNESCO-IOC Register of Marine Organisms (URMO).
6. © WoRMS Editorial Board, some rights reserved
7. © Barcode of Life Data Systems, some rights reserved