Cathepsin S Activity Controls Injury-Related Vascular Repair in Mice

Cathepsin S Activity Controls Injury-Related Vascular
Repair in Mice via the TLR2-Mediated p38MAPK
and PI3K−Akt/p-HDAC6 Signaling Pathway
Hongxian Wu,* Xian Wu Cheng,* Lina Hu,* Kyosuke Takeshita, Chen Hu, Qiuna Du, Xiang Li,
Enbo Zhu, Zhe Huang, Maimaiti Yisireyili, Guangxian Zhao, Limei Piao, Aiko Inoue,
Haiying Jiang, Yanna Lei, Xiaohong Zhang, Shaowen Liu, Qiuyan Dai, Masafumi Kuzuya,
Guo-Ping Shi, Toyoaki Murohara
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Objective—Cathepsin S (CatS) participates in atherogenesis through several putative mechanisms. The ability of cathepsins
to modify histone tail is likely to contribute to stem cell development. Histone deacetylase 6 (HDAC6) is required in
modulating the proliferation and migration of various types of cancer cells. Here, we investigated the cross talk between
CatS and HADC6 in injury-related vascular repair in mice.
Approach and Results—Ligation injury to the carotid artery in mice increased the CatS expression, and CatS-deficient
mice showed reduced neointimal formation in injured arteries. CatS deficiency decreased the phosphorylation levels
of p38 mitogen-activated protein kinase, Akt, and HDAC6 and toll-like receptor 2 expression in ligated arteries. The
genetic or pharmacological inhibition of CatS also alleviated the increased phosphorylation of p38 mitogen-activated
protein kinase, Akt, and HDAC6 induced by platelet-derived growth factor BB in cultured vascular smooth muscle cells
(VSMCs), and p38 mitogen-activated protein kinase inhibition and Akt inhibition decreased the phospho-HDAC6 levels.
Moreover, CatS inhibition caused decrease in the levels of the HDAC6 activity in VSMCs in response to platelet-derived
growth factor BB. The HDAC6 inhibitor tubastatin A downregulated platelet-derived growth factor–induced VSMC
proliferation and migration, whereas HDAC6 overexpression exerted the opposite effect. Tubastatin A also decreased the
intimal VSMC proliferation and neointimal hyperplasia in response to injury. Toll-like receptor 2 silencing decreased the
phosphorylation levels of p38 mitogen-activated protein kinase, Akt, and HDAC6 and VSMC migration and proliferation.
Conclusions—This is the first report detailing cross-interaction between toll-like receptor 2–mediated CatS and HDAC6
during injury-related vascular repair. These data suggest that CatS/HDAC6 could be a potential therapeutic target for
the control of vascular diseases that are involved in neointimal lesion formation. (Arterioscler Thromb Vasc Biol.
2016;36:1549-1557. DOI: 10.1161/ATVBAHA.115.307110.)
Key Words: cathepsin S ◼ HDAC6 ◼ neointimal formation ◼ vascular remodeling
T
he process of neointima formation is common to various
forms of vascular diseases, such as atherosclerosis, restenosis, and transplant vasculopathy.1,2 In response to vascular
injury, the migration of vascular smooth muscle cells (VSMCs)
from the media to the intima and the proliferation of intimal
VSMCs are key events in restenotic lesion development.3 One
essential factor required for VSMC migration is degradation
of the basement membrane and surrounding extracellular
matrix.4 Cathepsins are a family of cysteine proteases localized
in lysosomes.5–7 Over the past decade, emerging data revealed
Received on: December 30, 2015; final version accepted on: June 20, 2016.
From the Department of Cardiology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China (H.W., Q. Du,
S.L., Q. Dai); Department of Cardiology, Nagoya University Graduate School of Medicine, Nagoya, Japan (H.W., X.W.C., K.T., M.Y., T.M.); Department
of Pathology and Cell Biology, University of South Florida Morsani College of Medicine, Tampa, FL (C.H., X.Z.); Department of Cardiology, Yanbian
University Hospital, Yanji, China (X.W.C., X.L., E.Z., G.Z., L.P., Y.L.); Department of and Community Healthcare & Geriatrics, Nagoya University
Graduate School of Medicine, Nagoya, Japan (X.W.C., L.H., A.I., M.K.); Department of Neurology, University of Occupational and Environmental
Health, Fukuoka, Japan (Z.H.); Department of Physiology and Pathophysiology, Yanbian University College of Medicine, Yanji, China (H.J.); Division of
Cardiology, Department of Internal Medicine, Kyung Hee University, Seoul, South Korea (X.W.C); and Department of Medicine, Brigham and Women’s
Hospital, Harvard Medical School, Boston, MA (G.P.S.).
*These authors contributed equally to this article.
The online-only Data Supplement is available with this article at http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.115.307110/-/DC1.
Correspondence to Xian Wu Cheng, MD, PhD, Institute of Innovation for Future Society, Nagoya University Graduate School of Medicine, 65 Tsurumacho, Showa-ku, Nagoya 466–8550, Japan. E-mail [email protected]; or Xianwu Cheng, MD, Department of Cardiology, Yanbian University
Hospital, 1327 Juzijie, Yanji 133000, China. E-mail [email protected]
© 2016 The Authors. Arteriosclerosis, Thrombosis, and Vascular Biology is published on behalf of the American Heart Association, Inc., by Wolters
Kluwer. This is an open access article under the terms of the Creative Commons Attribution Non-Commercial-NoDervis License, which permits use,
distribution, and reproduction in any medium, provided that the original work is properly cited, the use is noncommercial, and no modifications or
adaptations are made.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
DOI: 10.1161/ATVBAHA.115.307110
1549
1550 Arterioscler Thromb Vasc Biol August 2016
Nonstandard Abbreviations and Acronyms
CatS
Erk1/2
HDAC6
HIF-1α
PDGF-BB
p-p38MAPK
TLR2
VSMC
cathepsin S
extracellular signal-regulated protein kinases 1/2
histone deacetylases 6
hypoxia-inducible factor-1α
platelet-derived growth factor BB
phospho-p38 mitogen-activated protein kinase
toll-like receptor 2
vascular smooth muscle cell
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
unexpected roles of cathepsins in pathological conditions, such
as metabolic disorder and atherosclerosis-based cardiovascular disease.8–10 Among cathepsin family, cathepsin S (CatS)
was the first cathepsins found to be expressed in human atherosclerotic lesions.11 Previous studies showed that vascular
atherosclerotic lesions associated with the injury overexpress
the elastolytic and collagenolytic CatS but show no change in
cystatin C expression, their endogenous inhibitor,4,12 suggesting a shift in the balance between cathepsins and their inhibitor
that favors the remodeling of cardiovascular wall.
Histone deacetylases (HDACs) are a family of enzymes
that remove acetyl groups from lysine residues of histone proteins and nonhistone proteins, a modification that
results in epigenetic modulation of gene expression.13,14
Previous study reported that HDACs play a crucial role in
the development of proliferative vascular diseases, including
atherosclerosis and restenosis.13 Histone acetyltransferases
and HDACs have been shown to regulate the expression of
inflammatory and other genes involved in VSMC functions.15
Findeisen et al reported that short interfering RNA–mediated
knockdown of HDAC 1, 2, or 3 prevented mitogen-induced
SMC proliferation and that the pharmacological inhibition
of HDAC decreased neointima formation.13 Yan et al found
that HDACs modulate VSMC migration induced by cyclic
mechanical strain.16 HDAC4 was recently reported to control
neointimal hyperplasia via the stimulation of the proliferation and migration of VSMCs.17 HDAC6 has been found to
play a pivotal role in modulating the migration and proliferation of cancer cells,18 and normal cells, including fibroblasts
and epithelial cells.19 On the other hand, over the last couple
of years’ researches highlighted that the cathepsin family is
closely related to many critical signaling pathways, such as
the Notch signaling pathway (cathepsin K),9 the peroxisome
proliferator–activated receptor γ pathway (CatS),20 and histone H3 (cathepsin L).21 However, the relationship between
CatS activity and the HDAC6 activation in the cellular events
and injury-induced vascular repair is unclear.
In this study, we examined the hypothesis that CatS activity could modulate HDAC6 activation to stimulate VSMC
migration and proliferation in vascular remodeling and neointimal hyperplasia in response to injury. We believed that this
newly discovered CatS–HDAC6 interaction-mediated cellular
mechanism has key roles in the hyperproliferative restenosis
associated with endovascular treatments.
Figure 1. CatS−/− reduces neointimal formation in ligation-injured carotid arteries of mice. A, Representative images (van Geison staining)
and quantitative data of hematoxylin and eosin (H&E) staining on cross-sections from injured carotid arteries of CatS+/+ and CatS−/− mice
at day 28. Scale bar: 100 μm. B and C, The intimal area and intima/media ratio of injured arteries on day 28 were lower in CatS−/− mice.
Data are mean±SEM (n=8), Student unpaired t test. D and E, Representative images (van Geison staining) and quantitative data of H&E
on longitudinal sections from injured carotid arteries of CatS+/+ and CatS−/− mice. Scale bar: 200 μm. Data are mean±SEM (n=12 and 10,
respectively), Student unpaired t test. F and G, Representative images and quantitative data of proliferating cell nuclear antigen (PCNA)
staining on cross-sections from injured carotid arteries of CatS+/+ and CatS−/− mice. Scale bar: 50 μm. Data are mean±SEM (n=6), Student
unpaired t test. Triangles indicate PCNA-stained cells. CatS indicates cathepsin S.
Wu et al CatS and HDAC6 on Intimal Hyperplasia 1551
Materials and Methods
Materials and Methods are available in the online-only Data
Supplement.
Results
Reduced Neointimal Formation in the CatS−/− Mice
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
The ligation injury induced CatS expression in carotid arteries.
The relative mRNA levels of CatS on day 1, 2, 4, 14, and 28 after
ligation were increased by 25-fold over those of the uninjured
control vessels of CatS+/+ mice (Figure IA in the online-only
Data Supplement). CatS protein expression was also increased
in the injured arteries by 4-fold (Figure IB in the online-only
Data Supplement). As shown in Figure 1A and 1D, marked
intimal lesion formation and long lesion lengths were observed
in the samples from CatS+/+ mice at day 28 after the ligation
injury. Much less intimal lesion formation was observed in the
samples from the CatS−/− mice. The quantitative measurements
revealed significantly lower levels of intimal areas from CatS−/−
mice compared with those from the CatS+/+ mice (Figure 1B
and 1E), but no significant difference in media thickness was
observed between the CatS+/+ and CatS−/− mice (32.3±1.7 versus 29.1±1.4×103 /μm2; P=0.182). Therefore, the ratio of intimal to medial area was higher in the CatS+/+ mice (Figure1C).
The proliferating cell nuclear antigen staining showed a low
level of proliferative activity in both the intima and media of
injured carotid arteries from CatS−/− mice compared with those
of CatS+/+ mice (Figure 1F and 1G). As shown in Figure IC and
ID in the online-only Data Supplement, we could not detect the
expression of CatS gene and protein in the tail tissues and in
the cultured VSMCs of CatS−/− mice.
The macrophage activation–related release of inflammatory chemokines is an important hallmark of human and
animal vascular repair and is mediated by a toll-like receptor
(TLR) signaling pathway in cardiovascular disease.10,22 Here,
we evaluated TLRs and inflammatory chemokine expressions. The quantitative polymerase chain reaction revealed
that compared with the CatS+/+ mice, the lesions in CatS−/−
mice that received a ligation injury had lower mRNA levels
of TLR2, as well as monocyte chemoattractant protein-1,
whereas TLR4 exhibited no significant difference (Figure
IIA–IIC in the online-only Data Supplement). As shown in
Figure IIF in the online-only Data Supplement, the TLR2positive cells were higher in the neointima of the injured
vessels from CatS+/+ mice on days 4 than in that of CatS−/−
mice. There was also no significant difference in the cathepsin K or cystatin C mRNA expressions between the CatS+/+
and CatS−/− mice (Figure IID and IIE in the online-only Data
Supplement).
Reduced Levels of Phospho-HDAC6 in CatS−/− Mice
Representative immunoblots showed that the level of
phospho-HDAC6 (p-HDAC6) was increased in the injured
arteries of CatS+/+ mice, and this increased expression was
ablated in the CatS−/− mice on day 1 after ligation injury
(Figure 2A and 2B). However, there are no significant differences in the total HDAC6 protein or HDAC6 mRNA
levels between the injured and uninjured arteries of CatS+/+
mice (Figure 2A; Figure IIIA and IIIB in the online-only
Data Supplement). With the exception of HDAC4, HDAC5,
HDAC8, and HDAC9, we also observed that there were no
between-group differences in other HDAC family members (including HDAC1, HDAC2, HDAC3, HDAC6, and
HDAC7). As shown in Figure 2A, 2C, and 2D, we observed
lower levels of phospho-p38 mitogen-activated protein
kinase (p-p38MAPK) and p-Akt proteins in the injured
arteries of CatS−/− mice. On operative day 1, compared with
Figure 2. The levels of targeted protein in the ligation-injured arteries of the 2 experimental groups. On day 1 after injury, equal amounts
of total protein extraction were immunoblotted using p-HDAC6, t-HDAC6, p-p38MAPK, t-p38MAPK, p-Akt, t-Akt, p-Erk1/2, t-Erk1/2, and
β-actin antibodies. Representative immunoblots (A) and quantitative data (B–D) show reduced levels of p-HDAC6, p-p38MAPK, and p-Akt
proteins in the injured arteries of CatS−/− mice, but show no changes in the levels of p-Erk1/2 between the CatS+/+ mice and CatS−/− mice
(A and E). Data are mean±SEM of 4 independent experiments, Student unpaired t test or ANOVA and Bonferroni post hoc tests. ANOVA
indicates analysis of variance; CatS, cathepsin S; ERK1/2, extracellular signal-regulated protein kinases 1/2; HDAC6, histone deacetylase
6; p-HDAC6, phospho-histone deacetylase 6; and p-p38MAPK, phospho-p38 mitogen-activated protein kinase.
1552 Arterioscler Thromb Vasc Biol August 2016
uninjured arteries, we observed an increase in the levels of
hypoxia-inducible factor-1α (HIF-1α) gene in the injured
arteries of CatS+/+ mice, indicating that ligation injury contributes to vascular local hypoxia (Figure IIG in the onlineonly Data Supplement). CatS deficiency caused decrease
in HIF-1α gene change (Figure IIH in the online-only Data
Supplement). The levels of plasma platelet-derived growth
factor-BB (PDGF-BB) were increased on day 4 after ligation
in the CatS+/+ mice and regressed on day 28 (Table I in the
online-only Data Supplement). Interestingly, we observed
that this increased expression of plasma PDGF was blunted
in the CatS−/− mice on day 4, but there was no difference on
day 28 between the 2 genotype groups.
HDAC6 Inhibition With Tubastatin A Decreased
the Mitogen-Induced VSMC Proliferation and
Migration and Induced Cell-Cycle Arrest
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
As shown in Figure 3A, the HDAC6-specific inhibitor
tubastatin A reduced the PDGF-BB–induced proliferation of
VSMCs at 48 hours after incubation. We also observed that
tubastatin A reduced the PDGF-BB–induced migration of
VSMCs at 36 hours after incubation (Figure 3B and 3C). To
further explore the mechanisms by which HDAC inhibition
prevents VSMC proliferation, we determined the cell-cycle
distribution using flow cytometry. As shown in Figure 3D–3G,
tubastatin A reduced the proportion of cells at S and G2/M
stage. As anticipated, tubastatin A mitigated PDGF-induced
HDAC6 phosphorylation in cultured VSMCs (Figure IV in the
online-only Data Supplement). Moreover, HDAC6 silencing
mitigated VSMC proliferation and migration in response to
PDGF-BB (Figure V in the online-only Data Supplement).
Thus, these findings indicate that HDAC6 activity may play a
pivotal role in VSMC proliferation and migration, which are
main processes of vascular remodeling. However, tubastatin
A exhibited no effect on proliferation (0.11±0.02 versus
0.13±0.02; P=0.46) and migration (7.3±0.9 versus 9.1±1.0;
P=0.81; n= 7 for each) in cultured VSMCs without PDGF-BB
stimulation.
We also observed that pharmacological intervention
targeted toward CatS mitigated VSMC proliferation and
migration in response to PDGF-BB or 2% FBS (Figure
VIA, VIC, and VID in the online-only Data Supplement).
Likewise, CatS deficiency impaired VSMC proliferation
in response to PDGF-BB (Figure VIB in the online-only
Data Supplement). Compared with the CatS+/+ explants,
the sprouting VSMC numbers and areas were markedly
decreased in the aorta explants of the CatS−/− mice during
the follow-up periods (Figure VII in the online-only Data
Supplement). These data showed that both CatS and HDAC6
play an import role in VSMC proliferation and migration.
CatS inhibitor had no effect on migration (4.0±1.2 versus 5.7±0.9; P=0.38) and proliferation (0.09±0.01 versus 0.10±0.00; P=0.91; n=5 for each) in cultured VSMCs
without PDGF-BB stimulation. In vivo, CatS inhibitor also
had no effects on the neointima areas (14 971±2371 versus 15 747±2101 μm2; P=0.23) and the ratio of intima to
media (0.48±0.07 versus 0.51±0.08; P=0.66; n= 6 for each)
in CatS deficiency mice.
Figure 3. Histone deacetylase 6 (HDAC6) inhibition suppressed the growth factor–stimulated vascular smooth muscle cell (VSMC) proliferation and migration and blocked cell-cycle progression in vitro. A, VSMCs were grown in a 96-well plate in the absence or presence
of tubastatin A (Tuba, 10 μM or 20 μM) with platelet-derived growth factor BB (PDGF-BB; 20 ng/mL) for 48 h. Data are mean±SEM (n=7).
Representative images (B) and quantitative data (C) of effect of tubastatin A on the PDGF-BB–induced migration of VSMCs. Mouse
VSMCs were scratched with a 1-mL pipet tip and cultured for 36 h in DMEM containing PDGF-BB (20 ng/mL) with or without tubastatin A
(Tuba, 10 μM and 20 μM; n=7). The dotted lines define the areas lacking cells; ANOVA and Bonferroni post hoc tests. D-G, Representative
images (D) and the quantitative data (E, F, and G) show the distribution of cells in G1 (E), S (F), and M (G) stage expressed as percentage
of total cells. Data are mean±SEM (n=4), Student unpaired t test.
Wu et al CatS and HDAC6 on Intimal Hyperplasia 1553
HDAC6 Inhibition Reduced the Neointima
Formation After Vascular Injury
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Compared with the mice treated with vehicle, HDAC6 inhibition with tubastatin A reduced the neointimal formation in
the ligation-injured arteries of CatS+/+ mice as determined by
hematoxylin and eosin staining (Figure 4A and 4C). On day
14 after the surgery, we detected double-positive staining of
bromodeoxyuridine and hematoxylin for proliferative VSMCs
in the neointima of injured arteries from the CatS+/+ mice. The
immunostaining of these cells was greatly decreased in the
tubastatin A–treated mice (Figure 4B and 4D), indicating that
HDAC6 activity plays a role in the process of proliferation
of VSMCs. We also observed a decreased level of plasma
HDAC6 activity in tubastatin A–treated group (Figure 4E).
However, tubastatin exhibited no beneficial effects on neointima areas (15 392±1736 versus 16 079±2383 μm2; P=0.87)
and the ratio of intima to media (0.52±0.10 versus 0.49±0.11;
P=0.71; n= 6 for each) in CatS deficiency mice.
CatS Regulates HDAC6 Phosphorylation
via the p38MAPK/Akt Signaling
Pathway in Cultured VSMCs
We have observed a reduced expression of p-HDAC6 in the
injured vessels of CatS−/− mice compared with those of CatS+/+
mice (Figure 2A and 2B). Here, we investigated how CatS regulates p-HDAC6 in cultured VSMCs. First, we observed that
PDGF-BB increased the phosphorylation levels of HDAC6,
p38MAPK, Akt, and extracellular signal-regulated protein
kinases 1/2 (Erk1/2), with the peak at 10 to 30 minutes (Figure
VIIIA and VIIIB in the online-only Data Supplement) in CatS+/+
VSMCs. Interestingly, the increased levels of p-HDAC6,
p-p38MAPK, and p-Akt were blunted in CatS−/− VSMCs, with
the exception of p-Erk (Figure 5A and 5B). And an increased
HDAC6 activity in cell lysates of CatS+/+ VSMCs was also
ablated by CatS−/− (Figure 5C). These results indicate that CatS
regulates HDAC6 phosphorylation and activity in VSMCs. As
shown in Figure 5D and 5E, CatS inhibitor reduced the PDGFinduced phosphorylation of HDAC6, p38MAPK, and Akt, but
had no effect on that of p-Erk1/2. Likewise, the HDAC6 activity
in cell lysates of CatS+/+ VSMCs was increased by PDGF-BB,
and these changes were ablated by CatS inhibition (Figure 5F).
We also found that p38MAPK and Akt inhibitor blocked the
PDGF-induced phosphorylations of HDAC6 or eEF-2 (eukaryotic elongation factor-2; Figure VIIIC–VIIIE in the online-only
Data Supplement), whereas Erk1/2 inhibitor alone had no effect
(data not shown). These results indicate that CatS may regulate
HDAC6 phosphorylation and activity through the p38MAPK/
Akt signaling pathway in VSMCs. In addition, SMCs were transfected with a HDAC6 plasmid to dramatically increase HDAC6
expression, which resulted in enhanced levels of p-HDAC6 protein (Figure IX in the online-only Data Supplement).
HDAC6 Plasmid Transfection Increased
the In Vitro VSMC Proliferation,
Migration, and Cell-Cycle Progression
To further determine the effect of HDAC6 on VSMC proliferation and migration, we enhanced the HDAC6 expression
by transfecting HDAC6 plasmid into VSMCs in vitro. As
Figure 4. Histone deacetylase 6 (HDAC6) inhibition reduced the neointima formation after vascular injury. After tubastatin A (Tuba) was
intraperitoneally administered to 10-week-old mice at a dose of 10 mg/kg every day for 2 weeks (n=6), the carotid artery was harvested
and set in 5-μm paraffin sections. Representative images (A) and quantitative data (C) of hematoxylin and eosin (H&E) staining on crosssections from injured carotid arteries of CatS+/+ mice treated with or without tubastatin A (Tuba). Scale bar: 100 μm. The intimal area and
intima/media ratio of injured arteries were much lower in the tubastatin A–treated mice. Data are mean±SEM, Student unpaired t test. Representative images (B) of the bromodeoxyuridine (BrdU) staining on cross-sections from injured carotid arteries and quantitative data (D) of
the BrdU labeling index. The BrdU labeling index was calculated by dividing the number of BrdU-labeled cells by the number of total cells
in the neointima (n=5, each group). Triangles indicate BrdU-labeled cells. Tubastatin A reduced the plasma HDAC6 activity (E) as compared
with control group (n=5, each group). Data are mean±SEM, Student unpaired t test. CatS indicates cathepsin S.
1554 Arterioscler Thromb Vasc Biol August 2016
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 5. Cathepsin S (CatS) regulates histone deacetylase 6 (HDAC6) activity in vascular smooth muscle cells (VSMCs). Mouse aortic
VSMCs were cultured in 10% FBS/DMEM medium and then subjected to serum-free medium for 12 h before the following treatment. Protein samples were isolated and used for a Western blotting analysis. Representative immunoblots (A) and quantitative data (B) show that
the increased levels of p-HDAC6, p-p38MAPK, and p-Akt were blunted in CatS−/− VSMCs, with the exception of p-Erk. CatS−/− decreased
HDAC6 activity in VSMCs in response to platelet-derived growth factor BB (PDGF-BB; C). Representative immunoblots (D) and quantitative data (E) show that the CatS inhibitor (CatS-I, 10 μM) reduced the PDGF-induced phosphorylation of HDAC6, p38MAPK, and Akt, but
had no effect on that of p-Erk1/2. PDGF-BB–induced HDAC6 activity of CatS+/+ VSMCs was reduced by CatS inhibition (F). PDGF-BB,
20 ng/mL, for 10 minutes. Data are mean±SEM of 4 independent experiments, ANOVA and Bonferroni post hoc tests. ERK1/2 indicates
extracellular signal-regulated protein kinases 1/2; p-HDAC6, phospho-histone deacetylase 6; and p-p38MAPK, phospho-p38 mitogenactivated protein kinase.
anticipated, we observed increased proliferation and migration ability in VSMCs transfected with HDAC6 plasmid compared with those transfected with vector plasmids (Figure
XA–XC in the online-only Data Supplement). HDAC6 transfection also enhanced the cell-cycle progression by increasing
the proportion of cells in the S/G2/M stage (Figure XD and
XE in the online-only Data Supplement).
Hypoxia Increased the HDAC6 Signaling and
VSMC Proliferation and Migration In Vitro
Because we observed an increased expression of HIF-1α
gene in injured arteries, which is a marker of hypoxia, we
further investigated whether hypoxia plays a role in the CatS/
p38MAPK/Akt/HDAC6 signaling pathway. As shown in
Figure 6A and 6B, hypoxia increased the levels of PDGFBB–induced p-HDAC6, p-p38MAPK, and p-Akt, indicating
that hypoxic stress could enhance p38MAPK/Akt/HDAC6
signaling cascade activation in VSMCs. However, hypoxia
had no effect on the levels of p-Erk1/2 protein (Figure 6C).
Moreover, we found that hypoxia increased the proliferation and migration of VSMCs in response to PDGF-BB
(Figure 6D–6F). In addition, CatS ablation diminished
hypoxia-induced VSMC proliferation (0.48±0.6 versus
0.62±0.08; P<0.01) and migration (23.0±3.1 versus 47.2,
cells; P<0.01).
TLR2 Was Required in HDAC6
Signaling and VSMC Events
To further investigate the interaction between TLR2 and
HDAC6 signaling pathways, siTLR (short interfering RAN
against toll-like receptor-2) was applied to use in the cellular
experiments. Results indicated that TLR2 silencing mitigated
HDAC6 as well as p38MAPK and Akt activations in cultured
VSMCs in response to PDGF-BB (Figure XIA and XIB in the
online-only Data Supplement). As anticipated, siTLR ameliorated cell proliferation and migration (Figure XIC–XIE in the
online-only Data Supplement).
Discussion
Endovascular treatment–related maladaptive vascular remodeling represents the leading cause of restenosis and cardiovascular
events.10 Identifying novel targets to suppress vascular negative
remodeling will contribute to therapeutic strategies to preempt
restenosis.10 The significant finding of our present study is that
mice lacking the CatS gene are resistant to acute injury-induced
intimal hyperplasia via the HDAC6-induced proliferation and
migration of VSMCs. At the molecular level, CatS deletion
retards injury-induced TLR2 gene and its downstream inflammatory genes and p38MAPK, Akt, and HDAC6 signaling activations. The pharmacological inhibition of HDAC6 activity
also results in vascular protective actions via the reduction of
Wu et al CatS and HDAC6 on Intimal Hyperplasia 1555
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 6. Hypoxia increased the histone deacetylase 6 (HDAC6) signaling and vascular smooth muscle cell (VSMC) proliferation and
migration in vitro. Mouse VSMCs were cultured in 10% FBS/DMEM medium and then subjected to serum-free medium for 12 h. After
starvation, cells were incubated with or without CoCl2 (600 μM) for 20 minutes and then stimulated with or without platelet-derived growth
factor BB (PDGF-BB; 20 ng/mL) for 10 minutes. Protein samples were isolated and used for a Western blotting analysis as indicated. The
representative image (A) and quantitative data (B) show that hypoxia increased the PDGF-BB–induced p-HDAC6, p-p38MAPK, and p-Akt
levels, but had no effect on p-ERK1/2 signaling (C, n=3). Hypoxia increased VSMC proliferation (D, n=7). Representative images
(E) and quantitative data (F) that hypoxia increased PDGF-BB–induced VSMC migration. Data are mean±SEM, Student unpaired t test, or
ANOVA and Bonferroni post hoc tests. ERK1/2 indicates extracellular signal-regulated protein kinases 1/2; p-HDAC6, phospho-histone
deacetylase 6; and p-p38MAPK, phospho-p38 mitogen-activated protein kinase.
VSMC proliferation. In vitro, the specific inhibition of CatS or
HDAC6 attenuated VSMC migratory and proliferative abilities.
We also observed that CatS regulates HDAC6 phosphorylation through the p38MAPK/Akt signaling pathway in cultured
VSMCs. Moreover, TLR2 silencing mitigated the phosphorylations of HDAC6, p38MAPK, and Akt and VSMC functions.
To the best of our knowledge, this is the first study to report
that CatS controls injury-related vascular repair in mice via the
TLR2-mediated p38MAPK/Akt-HDAC6 signaling pathway
(Figure XII in the online-only Data Supplement).
Cathepsin cysteine proteases can degrade the basement
membrane and surrounding extracellular matrix of artery
walls.23 Cathepsin family members, such as CatS and CatK,
have been demonstrated to play an important role in atherosclerosis-based proliferative diseases.10,24 Our research and
previous studies by other groups have demonstrated increased
expression and activity of CatS in balloon-injured arteries
of rat12 or rabbit.4 In the present study, we also observed an
increased expression of CatS in ligation-injured arteries of mice
(Figure IA in the online-only Data Supplement). Interestingly,
we observed that neointimal formation was reduced markedly in CatS−/− mice compared with wild-type mice. Intimal
hyperplasia is believed to be the consequence of VSMC proliferation and migration from the media into the intima. In our
present work, we observed that cell proliferative activity in
the intima and media of injured arteries was decreased in the
absence of CatS in vivo (Figure 1), and the pharmacological
inhibition of CatS prevented the mitogen-induced VSMC proliferation and migration in vitro (Figure VI in the online-only
Data Supplement). Moreover, the impaired VSMC migration
from the arterial explants of CatS−/− reflects that the intrinsic
ability of cells to migrate and degrade the local extracellular
matrix proteins is controlled by CatS activity (Figure VII in
the online-only Data Supplement). Collectively, these observations demonstrated that CatS controls injury-related vascular
repair in mice by affecting VSMC migration and proliferation.
Recent evidence has shown that HDACs play a crucial role
in the development of proliferative vascular diseases, including atherosclerosis and in-stent restenosis.13 Our present findings revealed that the level of phospho-HDAC6 protein was
increased in injured arteries of CatS+/+ mice compared with
noninjured arteries (Figure 2). The pharmacological inhibition
of HDAC6 with tubastatin A markedly reduced the neointimal
formation and neointimal VSMC proliferation in the ligationinjured arteries of CatS+/+ mice (Figure 4). Our in vitro study
showed that tubastatin A reduced the mitogen-induced proliferation and migration of VSMCs and that the overexpression
of HDAC6 exerted the opposite effect (Figure 3; Figure X in
the online-only Data Supplement). These observations indicate that HDAC6 activity plays an important role in the process of intimal hyperplasia after vascular injury via the control
of VSMC proliferation and migration. We further observed
that the increased expression of p-HDAC6 protein in injured
arteries was ablated in CatS−/− mice, and both the genetic
1556 Arterioscler Thromb Vasc Biol August 2016
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
ablation and pharmaceutical inhibition of CatS significantly
suppressed the PDGF-induced HDAC6 phosphorylation and
activities in cultured VSMCs (Figures 2 and 5). Thus, the present data suggest that CatS may control injury-related vascular
repair via HDAC6-mediated VSMC migration and proliferation. It should be noted that the levels of p-HDAC6 but not
the total HDAC6 expression changed in the injured lesions
of CatS+/+ mice because neither HDAC6 mRNA nor protein
changed from day 1 to day 4 after ligation in wild-type mice
(Figure IIIB in the online-only Data Supplement), suggesting
that HDAC6 activity plays the key role in vascular remodeling.
The engagement of TLRs on the cell surface by specific ligands leads to an increase in the expressions of proinflammatory cytokines and chemokines, such as MCP-1
(monocyte chemoattractant protein-1).10,22 Several lines
of investigation demonstrated that TLR2 and TLR4 are
required in the vascular SMC proliferation via MAPK activation.10,25 Previous studies reported that p38MAPK, Akt,
and Erk1/2 signaling have critical roles in SMC proliferation and migration and in the process of neointimal formation.26 Our present observations show that CatS deletion
reduced the levels of TLR2, p-p38MAPK, and p-Akt in the
arterial lesions (Figure 2A, 2C, and 2D; Figure IIA and IIF
in the online-only Data Supplement). Furthermore, both the
genetic ablation and pharmaceutical inhibition of CatS significantly decreased the PDGF-BB–stimulated phosphorylation of p38MAPK and Akt but not that of Erk1/2 in cultured
VSMCs (Figure 5A, 5B, 5D, and 5E), indicating that CatS
controls vascular repair and that neointimal formation may
act through p38MAPK and Akt signaling pathways. In addition, our present findings demonstrated that the inhibition
of p38MAPK and Akt blocked the PDGF-induced phosphorylation of HDAC6 (Figure VIIIC–VIIIE in the onlineonly Data Supplement). HDAC6 inhibition has been shown
to disrupt STAT3-related anti-inflammatory response in the
antigen-presenting cells.27 A recent single study reported
that PDGF regulated vascular SMC proliferation via STAT3
signaling pathway activation.28 Here, we have observed
that TLR2 silencing mitigated VSMC proliferation and
migration accompanied with the reduction of p-HDAC6,
p-p38MAPK, and p-Akt levels (Figure XI in the online-only
Data Supplement). Taken together, these results indicate that
CatS controls injury-related vascular repair in mice via the
TLR2-medated p38MAPK/Akt-HDAC6 signaling pathway.
PDGF-BB has been known to be a key player in vascular
remodeling and restenosis in response to mechanical stress.
It should be noted that here the plasma PDGF-BB concentrations were lower in the CatS−/− mice than in the CatS+/+
mice at an early stage (day 4) after vascular injury, indicating
that CatS deficiency–mediated vascular benefits may also be
attributable, at least in part, to an attenuation of circulating
PDGF-BB levels in a mouse carotid artery–injury model.
Recent studies have supported the existence of hypoxia
in human and murine intima plaques, which augments plaque
progression by stimulating plaque angiogenesis, altering
glucose metabolism, promoting plaque proteolysis, inciting plaque inflammation, and increasing lipid accumulation in macrophage foam cells.29,30 In the present study,
we observed that HIF-1α mRNA increased in the injured
arteries, suggesting that ligation injury contributes to vascular local hypoxia (Figure IIG in the online-only Data
Supplement). CatS deficiency had decreased levels of HIF1α mRNA in injured arteries (Figure IIH in the online-only
Data Supplement). The results of our in vitro study showed
that hypoxia increased the levels of p-HDAC6, p-p38MAPK,
and p-Akt in the PDGF-BB group (Figure 6A and 6B),
indicating that hypoxia enhances the CatS/p38MAPK/Akt/
HDAC6 signaling pathway in VSMCs. We also observed that
hypoxia increased the proliferation and migration of VSMCs
induced by PDGF-BB in vitro (Figure 6D–6F). These observations indicate that hypoxia may be involved in and may
enhance the role of CatS in vascular repair. On the other
hand, CatS ablation mitigates the levels of p-p38MAPK and
p-HDAC6 (Figure 2C) as compared with the corresponding control, whereas it had increased levels of p-p38MAPK
and p-HDAC6 proteins in cultured VSMCs in response
to PDGF (Figure 5A and 5B). As known, it is too hard to
completely reproduce in vivo conditions in one experiment.
Although we have no direct evidence, this discrepancy might
be because of the differences in the experimental conditions
(in vivo and in vitro) and protein extractions (whole vessels
or SMCs lysates).
In conclusion, our study demonstrated that CatS controls
injury-related vascular repair via TLR2-mediated p38MAPK/
Akt signaling activation and HDAC6-mediated VSMC migration and proliferation. Moreover, our present findings suggest
that targeting CatS and HDAC6 represent an attractive therapeutic approach to treat vasculopathies that are involved in
neointima formation and intima–media thickening.
Sources of Funding
This work was supported, in part, by grants from the Ministry of
Education, Culture, Sports, Science, and Technology of Japan
(no. 21590952) and The Scientific Research Fund of the Chinese
Ministry of Education (no. 82160068 and 81560240).
Disclosures
None.
References
1. Owens GK, Kumar MS, Wamhoff BR. Molecular regulation of vascular
smooth muscle cell differentiation in development and disease. Physiol
Rev. 2004;84:767–801. doi: 10.1152/physrev.00041.2003.
2.Duran-Prado M, Morell M, Delgado-Maroto V, Castaño JP, AneirosFernandez J, de Lecea L, Culler MD, Hernandez-Cortes P, O’Valle F,
Delgado M. Cortistatin inhibits migration and proliferation of human
vascular smooth muscle cells and decreases neointimal formation on
carotid artery ligation. Circ Res. 2013;112:1444–1455. doi: 10.1161/
CIRCRESAHA.112.300695.
3. Lin SJ, Yen HT, Chen YH, Ku HH, Lin FY, Chen YL. Expression of interleukin-1 beta and interleukin-1 receptor antagonist in oxLDL-treated human
aortic smooth muscle cells and in the neointima of cholesterol-fed endotheliadenuded rabbits. J Cell Biochem. 2003;88:836–847. doi: 10.1002/jcb.10431.
4. Burns-Kurtis CL, Olzinski AR, Needle S, Fox JH, Capper EA, Kelly FM,
McQueney MS, Romanic AM. Cathepsin S expression is up-regulated following balloon angioplasty in the hypercholesterolemic rabbit. Cardiovasc
Res. 2004;62:610–620. doi: 10.1016/j.cardiores.2004.02.002.
5. Turk V, Turk B, Guncar G, Turk D, Kos J. Lysosomal cathepsins: structure, role in antigen processing and presentation, and cancer. Adv Enzyme
Regul. 2002;42:285–303.
6. Reiser J, Adair B, Reinheckel T. Specialized roles for cysteine cathepsins
in health and disease. J Clin Invest. 2010;120:3421–3431. doi: 10.1172/
JCI42918.
Wu et al CatS and HDAC6 on Intimal Hyperplasia 1557
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
7. Cheng XW, Shi GP, Kuzuya M, Sasaki T, Okumura K, Murohara T. Role
for cysteine protease cathepsins in heart disease: focus on biology and
mechanisms with clinical implication. Circulation. 2012;125:1551–1562.
doi: 10.1161/CIRCULATIONAHA.111.066712.
8. Yang M, Zhang Y, Pan J, Sun J, Liu J, Libby P, Sukhova GK, Doria A,
Katunuma N, Peroni OD, Guerre-Millo M, Kahn BB, Clement K, Shi GP.
Cathepsin L activity controls adipogenesis and glucose tolerance. Nat Cell
Biol. 2007;9:970–977. doi: 10.1038/ncb1623.
9. Jiang H, Cheng XW, Shi GP, et al. Cathepsin K-mediated Notch1 activation contributes to neovascularization in response to hypoxia. Nat
Commun. 2014;5:3838. doi: 10.1038/ncomms4838.
10. Hu L, Cheng XW, Song H, Inoue A, Jiang H, Li X, Shi GP, Kozawa E,
Okumura K, Kuzuya M. Cathepsin K activity controls injury-related
vascular repair in mice. Hypertension. 2014;63:607–615. doi: 10.1161/
HYPERTENSIONAHA.113.02141.
11. Sukhova GK, Shi GP, Simon DI, Chapman HA, Libby P. Expression of the
elastolytic cathepsins S and K in human atheroma and regulation of their
production in smooth muscle cells. J Clin Invest. 1998;102:576–583. doi:
10.1172/JCI181.
12. Cheng XW, Kuzuya M, Sasaki T, Arakawa K, Kanda S, Sumi D, Koike T,
Maeda K, Tamaya-Mori N, Shi GP, Saito N, Iguchi A. Increased expression of elastolytic cysteine proteases, cathepsins S and K, in the neointima
of balloon-injured rat carotid arteries. Am J Pathol. 2004;164:243–251.
doi: 10.1016/S0002-9440(10)63114-8.
13. Findeisen HM, Gizard F, Zhao Y, Qing H, Heywood EB, Jones KL, Cohn
D, Bruemmer D. Epigenetic regulation of vascular smooth muscle cell
proliferation and neointima formation by histone deacetylase inhibition. Arterioscler Thromb Vasc Biol. 2011;31:851–860. doi: 10.1161/
ATVBAHA.110.221952.
14. Zhou B, Margariti A, Zeng L, Xu Q. Role of histone deacetylases in vascular cell homeostasis and arteriosclerosis. Cardiovasc Res. 2011;90:413–
420. doi: 10.1093/cvr/cvr003.
15.Natarajan R. Drugs targeting epigenetic histone acetylation in vascular
smooth muscle cells for restenosis and atherosclerosis. Arterioscler Thromb
Vasc Biol. 2011;31:725–727. doi: 10.1161/ATVBAHA.111.222976.
16. Yan ZQ, Yao QP, Zhang ML, Qi YX, Guo ZY, Shen BR, Jiang ZL. Histone
deacetylases modulate vascular smooth muscle cell migration induced by
cyclic mechanical strain. J Biomech. 2009;42:945–948. doi: 10.1016/j.
jbiomech.2009.01.012.
17. Usui T, Morita T, Okada M, Yamawaki H. Histone deacetylase 4 controls
neointimal hyperplasia via stimulating proliferation and migration of vascular smooth muscle cells. Hypertension. 2014;63:397–403. doi: 10.1161/
HYPERTENSIONAHA.113.01843.
18. Kaliszczak M, Trousil S, Åberg O, Perumal M, Nguyen QD, Aboagye EO.
A novel small molecule hydroxamate preferentially inhibits HDAC6 activity and tumour growth. Br J Cancer. 2013;108:342–350. doi: 10.1038/
bjc.2012.576.
19.Valenzuela-Fernández A, Cabrero JR, Serrador JM, Sánchez-Madrid
F. HDAC6: a key regulator of cytoskeleton, cell migration and cellcell interactions. Trends Cell Biol. 2008;18:291–297. doi: 10.1016/j.
tcb.2008.04.003.
20.Li X, Cheng XW, Hu L, et al. Cathepsin S activity controls ischemiainduced neovascularization in mice. Int J Cardiol. 2015;183:198–208. doi:
10.1016/j.ijcard.2015.01.058.
21. Adams-Cioaba MA, Krupa JC, Xu C, Mort JS, Min J. Structural basis for
the recognition and cleavage of histone H3 by cathepsin L. Nat Commun.
2011;2:197. doi: 10.1038/ncomms1204.
22.Cheng XW, Song H, Sasaki T, Hu L, Inoue A, Bando YK, Shi GP,
Kuzuya M, Okumura K, Murohara T. Angiotensin type 1 receptor blocker
reduces intimal neovascularization and plaque growth in apolipoprotein E-deficient mice. Hypertension. 2011;57:981–989. doi: 10.1161/
HYPERTENSIONAHA.110.168385.
23.Cheng XW, Huang Z, Kuzuya M, Okumura K, Murohara T. Cysteine
protease cathepsins in atherosclerosis-based vascular disease and
its complications. Hypertension. 2011;58:978–986. doi: 10.1161/
HYPERTENSIONAHA.111.180935.
24.Wu H, Cheng XW, Hu L, Hao CN, Hayashi M, Takeshita K, Hamrah
MS, Shi GP, Kuzuya M, Murohara T. Renin inhibition reduces atherosclerotic plaque neovessel formation and regresses advanced atherosclerotic plaques. Atherosclerosis. 2014;237:739–747. doi: 10.1016/j.
atherosclerosis.2014.10.098.
25.Sasu S, LaVerda D, Qureshi N, Golenbock DT, Beasley D. Chlamydia
pneumoniae and chlamydial heat shock protein 60 stimulate proliferation
of human vascular smooth muscle cells via toll-like receptor 4 and p44/p42
mitogen-activated protein kinase activation. Circ Res. 2001;89:244–250.
26. Muto A, Fitzgerald TN, Pimiento JM, Maloney SP, Teso D, Paszkowiak
JJ, Westvik TS, Kudo FA, Nishibe T, Dardik A. Smooth muscle cell signal transduction: implications of vascular biology for vascular surgeons. J
Vasc Surg. 2007;45 Suppl A:A15–A24. doi: 10.1016/j.jvs.2007.02.061.
27. Cheng F, Lienlaf M, Wang HW, et al. A novel role for histone deacetylase
6 in the regulation of the tolerogenic STAT3/IL-10 pathway in APCs. J
Immunol. 2014;193:2850–2862. doi: 10.4049/jimmunol.1302778.
28.Wu Q, Wang W, Li S, Nagarkatti P, Nagarkatti M, Windust A, Wang
XL, Tang D, Cui T. American ginseng inhibits vascular smooth muscle
cell proliferation via suppressing Jak/Stat pathway. J Ethnopharmacol.
2012;144:782–785. doi: 10.1016/j.jep.2012.09.046.
29.Parathath S, Mick SL, Feig JE, Joaquin V, Grauer L, Habiel DM,
Gassmann M, Gardner LB, Fisher EA. Hypoxia is present in murine
atherosclerotic plaques and has multiple adverse effects on macrophage lipid metabolism. Circ Res. 2011;109:1141–1152. doi: 10.1161/
CIRCRESAHA.111.246363.
30.Libby P, Folco E. Tension in the plaque: hypoxia modulates metabolism in atheroma. Circ Res. 2011;109:1100–1102. doi: 10.1161/
RES.0b013e31823bdb84.
Highlights
• Cathepsin S gene and protein levels increased in mouse carotid vasculature to injuries.
• Cathepsin S deficiency attenuated injury-related inflammatory actions and medial smooth muscle cellular events (including proliferation and
migration) and mitigated vascular remodeling.
• There is cross-interaction between toll-like receptor 2–mediated cathepsin S and histone deacetylase 6 signaling pathways during injuryrelated vascular repair.
• Targeting the cross talk between cathepsin S and histone deacetylase 6 could provide a potential therapeutic route for the clinical treatment
of proliferative vascular diseases that are involved in vascular remodeling and neointima hyperplasia.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Cathepsin S Activity Controls Injury-Related Vascular Repair in Mice via the
TLR2-Mediated p38MAPK and PI3K−Akt/p-HDAC6 Signaling Pathway
Hongxian Wu, Xian Wu Cheng, Lina Hu, Kyosuke Takeshita, Chen Hu, Qiuna Du, Xiang Li,
Enbo Zhu, Zhe Huang, Maimaiti Yisireyili, Guangxian Zhao, Limei Piao, Aiko Inoue, Haiying
Jiang, Yanna Lei, Xiaohong Zhang, Shaowen Liu, Qiuyan Dai, Masafumi Kuzuya, Guo-Ping
Shi and Toyoaki Murohara
Arterioscler Thromb Vasc Biol. 2016;36:1549-1557; originally published online June 30, 2016;
doi: 10.1161/ATVBAHA.115.307110
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2016 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/36/8/1549
Free via Open Access
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2016/07/07/ATVBAHA.115.307110.DC1
http://atvb.ahajournals.org/content/suppl/2016/07/07/ATVBAHA.115.307110.DC2
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Cathepsin S Activity Controls Injury-Related Vascular Repair in Mice via
the TLR2-mediated p38MAPK and PI3K−Akt/p-HDAC6 Signaling Pathway
Hongxian Wu, Xian Wu Cheng, Lina Hu, Kyosuke Takeshita, Chen Hu, Qiuna Du,
Xiang Li, Enbo Zhu, Zhe Huang, Maimaiti Yisireyili, Guangxian Zhao, Limei Piao,
Aiko Inoue, Haiying Jiang, Yanna Lei, Xiaohong Zhang, Shaowen Liu, Qiuyan Dai,
Masafumi Kuzuya, Guo-Ping Shi, Toyoaki Murohara
Materials and Methods
Mice
The male CatS knockout mice (KO, CatS−/−)1 and wild-type (WT, CatS+/+) littermates
used in this study were 8 weeks old and weighed between 22 and 25 g. We use PCR and
western blotting assay to evaluate the expression of CatS gene and protein in CatS+/+
and CatS−/− mice (Sup. Fig.1C). All of the animal studies were performed in accord with
the animal care guidelines of the Nagoya University Graduate School of Medicine.
Models of the carotid artery injuries and tissue collection
The mouse was anesthetized with an intraperitoneal injection of pentobarbital sodium
(50 mg/kg; Dainippon Pharmaceutical, Osaka, Japan). For the ligation injury model, the
right common carotid artery of each 10-wk-old mouse was ligated just proximal to its
bifurcations as described2. In the specific experiments, the specific HDAC6 inhibitor
tubastatin A (10 mg/kg/day; #SML0044, Sigma-Aldrich, St. Louis, MO), dissolved in
saline (tubastatin A group) or vehicle alone (control group) was injected into the
abdomen of each CatS+/+ mouse every day from 2 days before the surgery to 14 days
after the ligation surgery. For the negative control experiments, CatS−/− mice that had
undergone the ligation injury were injected subcutaneously with either vehicle or
tubastatin A (10 mg/kg/day) as indicated. In addition, CatS−/− mice that also had
undergone the ligation injury were injected subcutaneously with either vehicle or CatS-I
(5 mg/kg/day) as indicated. At the indicated time points after the injury, the mice were
euthanized by an overdose of sodium pentobarbital. For the biological analysis, the
mice were perfused with saline, and then the carotid artery was isolated and kept in
RNAlater® Stabilization solution (#AM7020, Life Technologies, Carlsbad, CA) (for the
genes assay) or liquid nitrogen (for the proteins assay). For the morphometry, after
being immersed in fixative for 24 h (4°C), the arteries were embedded in paraffin or in
1
optimal cutting temperature (OCT) compound (Sakura Finetechnical, Tokyo) and stored
at −30°C.
Morphometric and immunohistological analyses
The praffin-sections (5 μm) of the mouse carotid arteries were prepared at 2 mm
proximal to the ligated site. Corresponding sections were stained with hematoxylin and
eosin (H&E) and Van Gieson staining. In all immunohistologic and morphometric
analyses, six cross-sections (two sections each from the proximal, middle, and distal
regions) of vessels in each artery were measured for internal elastin length, media, and
neointima, and then the results were averaged as described. The internal elastic lamina
(IEL) and the external elastic lamina (EEL) were obtained by tracing the contours on
digitized images. The medial areas were calculated by subtracting the area defined by
the IEL from the area defined by the EEL, and the neointimal areas were determined by
subtracting the lumen area from the area defined by the IEL. In addition, carotid arterial
slices on separate slides were processed for the immunohistochemical analysis of TLR2.
The primary rabbit polyclonal antibody against TLR2 (1:50; sc-10739, Santa Cruz
Biotechnology, Santa Cruz, CA) was applied to the sections, which were then left
overnight at 4°C. Then, the sections were sequentially treated with appropriate
secondary antibodies (1:200, Vector Laboratories, Burlingame, CA) for 2 h at 4°C, and
were then visualized with a corresponding substrate kit (Vector Laboratories).
Detection of cell proliferation in vivo
In vivo bromodeoxyuridine (BrdU) labeling was performed to identify proliferating
cells in ligation-injured arteries by the detection of DNA synthesis with the BrdU
Immunohistochemistry Kit (ab125306, Abcam, Cambridge, MA). BrdU (40 μg/g mouse)
was injected intraperitoneally 12 h before the preparation of the artery. We counted the
BrdU-labeled and unlabeled cells in the neointima at ×400. A quantitative analysis was
performed in five independent sections for each mouse. The BrdU labeling index was
determined by dividing the number of BrdU-labeled cells by the number of total cells,
as described3. We also performed proliferating cell nuclear antigen (PCNA)
immunostaining by using an anti-PCNA mouse mAb (Cat NA03, Merck Millipore,
Darmstadt, Germany) and the M.O.M.TM detection kit (BMK-2202, Vector Laboratories,
Burlingame, CA). The quantitative analysis was conducted by dividing the number of
PCNA immunopositive cells by the intima and media areas of injured arteries.
Western blot analysis
2
Protein samples were obtained from homogenized arteries and from cultured cells, and
the protein concentration of each sample was determined. Protein samples were western
blotted against antibodies for p-Akts473 (4060), t-Akt (2967), p-Erk1/2t1202/t1204 (4377),
t-Erk1/2 (9107), p-p38MAPKt180/t182 (2331), t-p38MAPK (9212), p-eEF2t56 (2331),
t-eEF (2332), t-HDAC6 (2162) (from Cell Signaling Technology, Beverly, MA), CatS
(6686-100, BioVision, Milpitas, CA), β-actin (sc-47778, Santa Cruz Biotechnology,
Santa Cruz, CA), and p-HDAC6s1035 (from Dr Zhang as co-author).4 The band intensity
was analyzed by densitometry using Image J software. Quantification of western blots is
normalized to total protein levels.
Quantitative real-time polymerase chain reaction
Total RNA was harvested from tissues with the use of the RNeasy® Micro kit (74004,
Qiagen, Valencia, CA) and subjected to reverse transcription5. The resulting cDNA was
subjected to a quantitative real-time polymerase chain reaction (RT-PCR) analysis with
the use of a Bio-Rad CFX96™ Real-Time PCR Detection System and Power SYBR®
Green PCR Master Mix (4367659, Applied Biosystems, Foster City, CA). All
experiments were performed in triplicate. The sequences of the primers for the targeted
genes are provided in supplemental Table II. We calculated the changes in gene
transcription by the 2–ΔΔCt method and normalized the values to the levels of
glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
Plasma platelet-derived growth factor BB detection
The plasma platelet-derived growth factor BB (PDGF-BB) concentrations were
measured using the Mouse/Rat PDGF-BB Quantikine ELISA Kit (MBB00, R&D
Systems, Minneapolis, MN) following the manufacturer’s instructions.
HDAC6 activity assay
Protein samples were obtained from homogenized arteries and from cultured cells, and
the protein concentration of each sample was determined. 5 μl of protein samples and
plasma was used to dectect HDAC6 activity by using the Fluorogenic HDAC6 Assay
Kit (50076, BPS Bioscience, San Diego, CA) following the manufacturer’s instructions
with a small modification. Briefly, constructed a standard curve by using a series of
diluted HDAC6 human recombinant enzyme. 5 μl of tubastatin A (20μM) was added to
the samples as an inhibitor control.
Cell culture
3
We obtained VSMCs from the media of mouse aortas of both genotypes (CatS+/+ and
CatS−/−) by the tissue explant method and cultured them in Dulbecco's modified Eagle's
medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics2.
Briefly, the thoracic aortas of 8-wk-old mice were removed, and turned "inside out" in
DMEM with the use of a unique catheter under a microscope. After the aortas were cut
into 1×1-mm explants, the explants were individually plated into a 10 cm culture dish
and cultured in 8 mL of DMEM containing 20% FBS for 7 days before the next change
of medium. The obtained cells retained SMC characteristics (purity > 90%). we used
western blotting assay to detect the protein expression of CatS (Sup. Fig.).
Cell proliferation assay
We assessed the VSMC proliferation with the Cell Titer 96®AQ Assay kit (G5430,
Promega, Madison, WI) in vitro2. Cells were plated on plates at 5,000 cells in 100μL of
DMEM per well and incubated in the presence of PDGF-BB (10 ng/mL) for 48 h. Then,
20 μL of a mixture of tetrazolium compound and phenazine methosulfate was added for
an MTS assay, and the absorbance was detected at 492 nm. Experiments were
performed five separate times for each group in triplicate. In the specific experiments,
cells were plated on plates at 500 cells in 50μL of DMEM per well and incubated in the
presence of PDGF-BB (10 ng/mL) for 48 h. Cell numbers were counted for each well.
Wound-induced migration assay
A wound-induced migration assay was performed as described6. Briefly, VSMCs were
seeded into a 6-well plate at 8,000 cells/well and cultured in DMEM supplemented with
10% FBS and antibiotics until they reached 70% confluence. The cell monolayer was
then scraped in a straight line with a p1000 pipet tip to create a ‘‘scratch’’. The debris
was removed and the edge of the scratch was smoothed out by washing the cells twice
with 1 ml of the growth medium. The medium was then replaced with 1.5 ml of medium
specific for the in vitro scratch assay. The dish was placed in a culture incubator in
DMEM containing PDGF-BB (20 ng/mL or 50 ng/mL or 2% FBS, respectively) at 37°C
for 24–36 h. The images for wound healing were pictured in 50 fields. The numbers of
cells migrated into the scratched area were calculated.
Cell cycle analysis
A cell cycle analysis was conducted by using a modified propidium iodine-based flow
cytometry protocol7. Briefly, cells were cultured in DMEM containing 10% FBS until
70% confluence. After starvation for 12 h, the cells were subjected to different
4
treatments in DMEM containing 10% FBS for 24–36 h in a normoxic or hypoxic box.
Subconfluent cells were trypsinized and fixed in 70% ethanol at 4°C overnight. Fixed
cells were washed once with phosphate-buffered saline (PBS) followed by incubation
with KRISHIAN buffer (0.1% sodium citrate, 0.02 mg/mL RNAse A [Sigma-Aldrich],
0.3% NP-40 [Sigma-Aldrich], and 0.05 mg/mL propidium iodide [#P1304MP,
ThermoFisher Scientific]) for 30 min at room temperature in the dark. Cell suspensions
were analyzed for the propidium iodide labeling of DNA by flow cytometry. Cell-cycle
progression was measured as the percent of cells in the G2/S/M stage.
HDAC6 plasmid transfection
Flag-tagged HDAC6 (pBJ-HDAC6F) and vector plasmids (kanamycin resistance) were
made and amplified as described8. Seeded VSMCs were brought to 70%–90%
confluence at transfection, and then HDAC6 and vector plasmids were transfected into
the cells for 48–72 days by using Lipofectamine® LTX & PLUS™ Reagent (15338030,
Life Technologies).
Preparation of explants and the migration assay
The aortic explants were prepared as described2. Briefly, we removed and opened out
thoracic aortas of mice, and removed the endothelium gently by abrasion. After the
aortas were cut into 1×1-mm explants, we plated the explants individually into collagen
type 1-coated 24-well plates with the lumen side down and cultured them in 500 μL of
DMEM containing 0.1% bovine serum albumin (BSA), transferrin, insulin, and
PDGF-BB (50 ng/mL, #315-18, PeproTech, London). At the indicated time points, the
VSMC sprouts at the edge of the explants were analyzed by Beta 4.0.3 Scion Image
software. The VSMC migratory ability is expressed as sprouted total cell numbers and
areas (average of seven explants for each animal). We fixed and stained the cells for
smooth muscle α-actin to characterize the cell migration from explants.
Short interfering RNA (siRNA) transfection
Specific siRNAs against TLR2 (Mm_mTlr_5214-s, Mm_Tlr_5124-as; F#806) and
HDAC6 (Mm_Hdac61178_s, Mm_Hdac61178_as, F#838), and non-targeting control
siRNA (Mission_SIC-001_s and Mission_SIC-001_as as the negative control) were
purchased from Sigma-Aldrich. SMCs were grown on 60-mm dishes until 50%
confluence. The siRNA solution mixed with serum-free and antibiotic-free DMEM-2
medium containing Lipofectamine RNAiMAX reagent (Invitrogen) was supplied to
each well to achieve a final siRNA concentration of 100 pM. The cells were treated at
5
37°C for 48 h, and the levels of targeted gene were analyzed by PCR. Transfected cells
were also used for cell proliferation experiments. Silamin A/C (D0010500105,
Dharmacon, Brébières, France) was used as a positive control.
Statistical analysis
All measurements were conducted by two observers. Data are expressed as means ±
standard error of the mean (SEM). Student’s t-test (for comparisons between two groups)
and a one-way analysis of variance (ANOVA; for comparisons of three or more groups)
followed by the Bonferroni post-hoc test were used for the statistical analyses. SPSS
software version 17.0 (SPSS, Chicago, IL) was used. P-values <0.05 were considered
significant.
References:
1.
Sukhova GK, Zhang Y, Pan JH, Wada Y, Yamamoto T, Naito M, Kodama T,
Tsimikas S, Witztum JL, Lu ML, Sakara Y, Chin MT, Libby P, Shi GP.
Deficiency of cathepsin S reduces atherosclerosis in LDL receptor-deficient
mice. J Clin Invest. 2003;111:897-906.
2.
Hu LN, Cheng XW, Song HZ, Inoue A, Jiang HY, Li X, Shi GP, Kozawa E,
Okumura K, Kuzuya M. Cathepsin K Activity Controls Injury-Related Vascular
Repair in Mice. Hypertension. 2014;63:607-615.
3.
Uemura Y, Shibata R, Ohashi K, Enomoto T, Kambara T, Yamamoto T, Ogura
Y, Yuasa D, Joki Y, Matsuo K, Miyabe M, Kataoka Y, Murohara T, Ouchi N.
Adipose-derived factor CTRP9 attenuates vascular smooth muscle cell
proliferation and neointimal formation. Faseb J. 2013;27:25-33.
4.
Williams KA, Zhang M, Xiang SY, et al. Extracellular Signal-regulated Kinase
(ERK) Phosphorylates Histone Deacetylase 6 (HDAC6) at Serine 1035 to
Stimulate Cell Migration. J Biol Chem. 2013;288:33156-33170.
5.
Cheng XW, Kuzuya M, Kim W, Song HZ, Hu LN, Inoue A, Nakamura K, Di Q,
Sasaki T, Tsuzuki M, Shi GP, Okumura K, Murohara T. Exercise Training
Stimulates Ischemia-Induced Neovascularization via Phosphatidylinositol
3-Kinase/Akt-Dependent Hypoxia-Induced Factor-1 alpha Reactivation in Mice
of Advanced Age. Circulation. 2010;122:707-716.
6.
Liang CC, Park AY, Guan JL. In vitro scratch assay: a convenient and
inexpensive method for analysis of cell migration in vitro. Nat Protoc.
2007;2:329-333.
7.
Burger D, Kwart DG, Montezano AC, Read NC, Kennedy CRJ, Thompson CS,
6
8.
Touyz RM. Microparticles Induce Cell Cycle Arrest Through Redox-Sensitive
Processes in Endothelial Cells: Implications in Vascular Senescence. J Am Heart
Assoc. 2012;1:e001842.
Zhang XH, Yuan ZG, Zhang YT, Yong S, Salas-Burgos A, Koomen J, Olashaw
N, Parsons JT, Yang XJ, Dent SR, Yao TP, Lane WS, Seto E. HDAC6
modulates cell motility by altering the acetylation level of cortactin. Molecular
Cell. 2007;27:197-213.
7
Supplemental Table I. Plasma PDGF-BB concentrations were detected in CatS+/+ and
CatS−/− mice followed ligation injury in the indicated days
Day after ligation injury
Group
Number
PDGF-BB (pg/mL)
CatS
+/+
8
45.8±2.1
CatS
−/−
8
49.9±5.6
CatS
+/+
9
128.0±7.6
CatS
−/−
9
61.6±7.4
CatS
+/+
11
81.7±20.2
CatS
−/−
9
60.7±12.1
Control
7
132.7±25.8
Tubastatin A
6
85.7±16.2
day 0
day 4
day 28
*
†
day 14
*
All of the results are presented as mean ± SEM. P <0.01 vs CatS +/+ mice group in day
0; †P <0.01 vs CatS +/+ mice group in day 4.
1
Supplemental Table II. Primer sequences used in the quantitative real-time PCR
Gene
Forward primer (5' to 3')
Reverse primer (5' to 3')
GenBank no.
MCP-1
GCCCCACTCACCTGCTGCTACT
CCTGCTGCTGGTGATCCTCTTGT
NM_011333
TLR2
AAGAAGCTGGCATTCCGAGGC
CGTCTGACTCCGAGGGGTTGA
NM_011905
TLR4
AGTGGGTCAAGGAACAGAAGCA
CTTTACCAGCTCATTTCTCACC
NM_021297
CatS
GTGGCCACTAAAGGGCCTG
ACCGCTTTTGTAGAAGAAGAAGGAG
NM_021281
CatK
AGCAGGCTGGAGGACTAAGGT
TTTGTGCATCTCAGTGGAAGACT
NM_007802
Cystatin C
AACAAGGGCAGCAACGATG
CGAGCTGCTTACGAGCTCTCAC
NM_009976
HDAC1
TCTGAATACAGCAAGCAGATGCA
ACAGAACTCAAACAAGCCATCAAAC
NM_008228
HDAC2
AGAAGATTGTCCGGTGTTTGATG
CACAGCCCCAGCAACTGAA
NM_008229
HDAC3
TCAGCCCCACCAATATGCA
GAACTCGAAAAGTCCTGGAAACA
NM_010411
HDAC4
CTGGCATCCCTGTGTCATTTG
ACACAAGACCTGTGGTGAACCTT
NM_207225
HDAC5
GCAACAAGGAGAAGAGCAAAGAG
TCCTGGAGCCTCAGCTTTACC
NM_010412
HDAC6
GCTGAGGGAGCCTGGTTAAA
AGGACTGCCCCTTTCGATCA
NM_010413
HDAC7
CCCACCTGTCAGACCCAAGT
AGTCATAGACCAGCCCTGTAGCA
NM_019572
HDAC8
AGGTACAATCACAGCTGCCC
TCTTTGCATGATGCCACCCT
NM_027382
HDAC9
TGGCAGAATCCTCGGTCAGT
CCCAGCAGGGCCATTGT
NM_024124
HIF-1α
GCAGCAGGAATTGGAACATT
GCATGCTAAATCGGAGGGTA
NM_176958
GAPDH
ATGTGTCCGTCGTGGATCTGA
ATGCCTGCTTCACCACCTTCT
NM_008084
2
Supplemental Fig. I. Ligation injuries induced CatS expression in carotid arteries.
A: The mRNA levels of CatS were increased greatly in ligated arteries over those of the
uninjured control vessels of CatS+/+ mice on day 1, day 2, day 4, day 14 and day 28 after
ligation injury (n=4–8). B: The representative image and quantitative data of CatS
protein expression on day 4 after ligation (n=5). C: PCR bands show the image of the
genotyping used CatS+/+ and CatS−/− mice tails. D: Western blots images show the levels
of CatS protein in the CatS+/+ and CatS−/− VSMCs.
Supplemental Fig. II. CatS−/− decreases inflammatory reaction in injured arteries.
The quantitative PCR revealed that the lesions in CatS−/− mice that received a ligation
injury had lower mRNA levels of TLR2 (A) as well as MCP-1 (B), whereas TLR4 (C)
exhibited no significant difference from the CatS+/+ mice. There was no significant
difference in the CatK (D) or Cystatin C (E) mRNA expressions between the CatS+/+
and CatS−/− mice. F: Representative immunostaining images and quantitative data show
TLR2+ cells in injured arterial tissues of CatS+/+ and CatS−/− mice (n=5). Triangles
indicate TLR2+ cells. G: Quantitative real-time PCR data revealed that the levels of
HIF-1α mRNA were increased in injured arterial tissues of CatS+/+ mice (n= 5). H:
Quantitative PCR revealed that the levels of HIF-1α mRNA were lower in the lesions of
CatS-/- mice compared to CatS+/+ mice. Data are mean ± SEM; Student’s unpaired t-test.
Supplemental Fig. III. HDAC6 mRNA expression on day 1 to day 4 following
ligation in wild-type mice. A: HDAC1-9 mRNA expressions on day 4 after ligation
injury. Left artery, no ligation side. Right artery, ligation side. n=7. B: HDAC6 mRNA
expression on day 0, day 1, day 2 and day 4 following ligation in wild-type mice (n=
6-8). Data are mean ± SEM, One-way ANOVA and Bonferroni post-hoc test.
Supplemental Fig. IV. HDAC6 inhibition reduced HDAC6 phophorylation.
Representative image (A) and quantitative data (B) of the western blot show that
tubastatin A (10 μΜ) decreased the levels of pHDAC6 (n= 3). Data are mean ± SEM,
ANOVA and Bonferroni post hoc tests.
Supplemental Fig. V. HDAC6 silencing decreased VSMC proliferation and
migration. A, siHDAC6 inhibited PDGF-BB (10 ng/mL)-induced VSMC proliferation
(n=5). B, The representative image and quantitative data show siHDAC6 mitigated
PDGF-BB (50 ng/mL)-induced VSMC migration (n= 6). Data are mean ± SEM,
Student’s unpaired t-test.
3
Supplemental Fig. VI. Role of CatS in mitogen-induced
migration. CatS inhibitor (CatS-I, 10 μM, A) and CatS
inhibited the PDGF-BB (50 ng/mL)-induced VSMC
representative image and quantitative data show that CatS
VSMC proliferation and
deficiency (CatS KO, B)
proliferation (n=8). The
inhibitor (CatS-I, 10 μM)
impaired PDGF-BB (50 ng/mL, C)- or 2% FBS (D)-induced VSMC migration. Data are
mean ± SEM, Student’s unpaired t-test.
Supplemental Fig. VII. CatS−/− impaired VSMC migration ex vivo. A:
Representative figures of VSMC migration from arterial explants from day 1 to day 7 in
the two groups. The quantitative data show that the sprouting VSMC numbers (B) and
cell sprouted area (C) were markedly decreased in the CatS−/− mice (n= 7). Data are
mean ± SEM, 2-way repeated measures ANOVA ad Bonferroni post hoc tests.
Supplemental Fig. VIII. p38MAPK/Akt signaling pathway-mediated regulation of
HDAC6 activity in VSMCs. Mouse aortic VSMCs were cultured in 10% FBS/DMEM
medium and then subjected to serum-free medium for 12 h before the following
treatment. Protein samples were isolated and used for a western blotting analysis as
indicated. Representative immunoblots (A) and quantitative data (B) show the effect of
PDGF-BB (20 ng/mL) on phosphorylation of HDAC6, p38MAPK, Akt, Erk1/2 in
CatS+/+ VSMCs (n=3). CatS +/+ VSMCs were pretreated with or without p38MAPK
inhibitor (SB203580, 20 µM, C) or Akt inhibitor (10 µM, D, E) for 30 min and then
treated with or without PDGF-BB (20 ng/mL) for 10 min (n=4). Representative images
and quantitative data show that SB203580 or Akt inhibitor decreased the levels of
p-HDAC6 and/or p-eEF2 (n=4) Data are mean ± SEM, 1-way, or 2-way ANOVA and
Bonferroni post hoc tests.
Supplemental Fig. IX. The effect of HDAC6 transfection on the expression of
p-HDAC6. Mouse VSMCs were transfected with control vector or HDAC6 plasmid for
48 h and then subjected to serum-free medium for 12 h before the following treatment.
Protein samples were isolated and used for a western blotting analysis as indicated. A:
Representative immunoblots and quantitative data show that VSMCs transfected with
HDAC6 plasmid increased HDAC6 expression. B: Representative immunoblots and
quantitative data show the effect of HDAC6 transfection on the levels of p-HDAC6
protein (n=3). Data are mean±SEM; Student’s paired t-test.
4
Supplemental. Fig. X. HDAC6 plasmid transfection increased the in vitro VSMC
proliferation, migration, and cell-cycle progression. VSMCs were transfected with
control (vector) or HDAC6 plasmid (HDAC6) for 48–72 h and then used in the
following experiments: A: Cells were treated with PDGF-BB (20 ng/mL) for 48 h, and
cell proliferation was then measured by an MTS assay (n=8). B: Cells were scratched
with a 1-ml pipet tip and cultured for 24 h with PDGF-BB (20 ng/mL, n=7).
Representative immunoblots (B) and quantitative data (C) show that HDAC6 plasmid
transfection increased the in vitro VSMC migration. D,E: The transfected cells were
re-grown in a 6-well plate for 24 h and starved for 12 h before stimulation with 10%
FBS for 36 h for the cell-cycle assay (n= 4). Distribution of cells in S/G2/M expressed
as a percentage of total cells. Data are mean ± SEM, Student’s unpaired t-test.
Supplemental Fig. XI. TLR2 silencing decreased not only the levels of p-HDAC6,
p-p38MAPK and p-Akt and but also VSMC proliferation and migration.
Representative immunoblots (A) and quantitative data (B) show TLR2 silencing
inhibited the levels of p-HDAC6, p-p38MAPK and p-Akt induced by PDGF-BB (20
ng/mL) for 10 min (n= 3). C, siTLR2 reduced VSMC proliferation in response to
PDGF-BB (10 ng/mL, n= 5). D, Rresentative image and quantitative data show siTLR2
mitigated VSMC migration in response to PDGF-BB (50 ng/mL, n=6). Data are mean ±
SEM, Student’s unpaired t-test.
Supplemental Fig. XII. The proposed mechanism of ligation-induced vascular
repair in mice. TLR2, toll-like receptor 2; CatS, cathepsin S; PDGF-BB,
platelet-derived growth factor BB; HDAC6, histone deacetylase 6; VSMC, vascular
smooth muscle cell; HIF1α, hypoxia-inducible factor 1 alpha.
5
6
7
8
9
10
11
12
13
14
15
16
17
Vascular injury
TLR‐2
hy
po
xi a
CatS activation
Tubastatin A
PDGF‐BB
p‐Akt
p‐p38MAPK
p‐HDAC6
VSMC migration
proliferation
Neointimal formation