Molecular Human Reproduction, Vol.22, No.7 pp. 457–464, 2016
Advanced Access publication on May 1, 2016 doi:10.1093/molehr/gaw030
ORIGINAL ARTICLES
Production of offspring from a germline
stem cell line derived from prepubertal
ovaries of germline reporter mice
Chen Zhang 1 and Ji Wu1,2,3,*
1
Renji Hospital Shanghai Jiaotong University School of Medicine, Key Laboratory for the Genetics of Developmental & Neuropsychiatric Disorders
(Ministry of Education), Bio-X Institutes, Shanghai Jiao Tong University, Shanghai 200240, China 2Key Laboratory of Fertility Preservation and
Maintenance of Ministry of Education, Ningxia Medical University, Yinchuan 750004, China 3Shanghai Key Laboratory of Reproductive Medicine,
Shanghai 200025, China
*Correspondence address. Bio-X Institutes, Shanghai Jiao Tong University, No. 800 Dongchuan Road, Minhang District, Shanghai 200240, China.
Tel: +86-21-34207263; Fax: +86-21-34204051; E-mail: [email protected]
Submitted on December 5, 2015; resubmitted on March 31, 2016; accepted on April 22, 2016
study hypothesis: We investigated whether DEAD-box polypeptide 4 (DDX4) positive cells from post-natal ovaries of germline lineage
reporter mice can be isolated based on endogenously expressed fluorescent proteins and used to establish a cell line for producing offspring.
study finding: DDX4-positive cells from post-natal ovaries of germline lineage reporter mice can be isolated and used to establish a cell line
for producing offspring.
what is known already: In recent years, female germline stem cells (FGSCs) have been isolated from the ovaries of post-natal mice by
magnetic-activated cell sorting or fluorescence-activated cell sorting (FACS) relying on an antibody against DDX4. However, whether DDX4positive cells from post-natal ovaries of germline lineage reporter mice can be established without using an antibody, as well as a cell line established
for producing offspring, remains unknown.
study design, samples/materials, methods: To obtain the expected offspring (Ddx4-Cre;mT/mG mice), Ddx4-Cre mice were
crossed with mT/mG mice. In the ovaries of Ddx4-Cre;mT/mG mice, germ cells were destined to express enhanced green fluorescent protein (EGFP)
while somatic cells still express tandem dimer Tomato (tdTomato). Therefore, the germ cells could be clearly distinguished from somatic cells by
fluorescent proteins. Then, we investigated the pattern of fluorescent cells in the ovaries of 21-day-old Ddx4-Cre;mT/mG mice under a fluorescent
microscope. Germ cells were sorted by FACS without using antibody and used to establish a FGSC line. The FGSC line was analyzed by DDX4 immunostaining, Edu (5-ethynyl-2′ -deoxyuridine) labeling, and RT–PCR for germ cell markers. Finally, the physiological function of the FGSC line was
examined by transplanting FGSCs into the ovaries of sterilized recipients and subsequent mating.
main results and the role of chance: Firstly, we have successfully isolated FGSCs from the ovaries of 21-day-old Ddx4Cre;mT/mG mice based on endogenously expressed fluorescent proteins. FACS was used to separate the cells and 2.3% of all viable cells was
EGFP-positive germ cells. Subsequently, a FGSC line was established that was doubly positive for DDX4 immunostaining and Edu labeling. The
mRNA expression of several germ cell markers in this cell line, such as Ddx4, Deleted in azoospermia-like (Dazl), B lymphocyte-induced maturation
protein-1 (Blimp1), Stella and Fragilis, was detected. Lastly, the FGSC line was proven to be functional under physiological conditions, as offspring were
produced after transplanting FGSCs into ovaries of sterilized recipients and a subsequent mating.
limitations, reasons for caution: The molecular mechanisms of proliferation and differentiation of FGSCs in vivo and in vitro still
need to be elucidated.
wider implications of the findings: Our results confirm that DDX4-positive cells can be separated from post-natal mouse
ovaries and used to establish cell lines that are functional in producing offspring, and provide further evidence for the existence of post-natal
FGSCs in mammals. The Ddx4-Cre;mT/mG mouse strain is an ideal model for the isolation, characterization and propagation of FGSCs and is
a useful tool for fully elucidating the molecular mechanisms of proliferation and differentiation of FGSCs in vivo and in vitro.
large scale data: none.
study funding and competing interest(s): This work was supported by National Basic Research Program of China (2013CB967401)
and the National Nature Science Foundation of China (81370675, 81200472 and 81421061). The authors declare no competing interests.
Key words: female germline / stem cells / Ddx4 / Cre / reporter mice / transplantation
& The Author 2016. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved.
For Permissions, please email: [email protected]
458
Introduction
It has been considered that female mammals are born with a finite and
non-renewing germ cell reserve (Borum, 1961; Peters, 1970; McLaren,
1984; Anderson and Hirshfield, 1992). However, several studies have
challenged this doctrine in recent years (Johnson et al., 2004; Zou
et al., 2009, 2011; Pacchiarotti et al., 2010; Zhang et al., 2011; Hu
et al., 2012; White et al., 2012; Zhou et al., 2014). Johnson et al.
(2004) used ovarian histology and follicle counting and reported
ovarian regenerative activity that could sustain post-natal oocyte and
follicle production in mammals. Subsequently, they claimed that bone
marrow and peripheral blood are potential sources of germ cells for
sustaining oocyte production in adulthood (Johnson et al., 2005).
Zou et al. (2009) isolated female germline stem cells (FGSCs) from
post-natal mouse ovaries by magnetic-activated cell sorting using an antibody against DDX4 (DEAD box polypeptide 4; also known as mouse
vasa homolog) and produced offspring from a FGSC line derived from
neonatal mice, or from long-term cultured FGSCs obtained from adult
mice. White et al. (2012) verified this result and isolated FGSCs or
oogonial stem cells (OSCs) from reproductive age women using
fluorescence-activated cell sorting (FACS).
The Ddx4-Cre mouse line has been reported as a powerful tool for
germ cell studies (Gallardo et al., 2007; John et al., 2008; Hobbs et al.,
2012; Lin et al., 2013; Yu et al., 2013; Vanorny et al., 2014; Yuan et al.,
2014). In the Ddx4-Cre mouse line, the endogenous Ddx4 promoter
drives the expression of CRE recombinase in germline lineage cells. By
crossing with a reporter mouse containing a loxp-flanked cassette, recombination will be induced at the loxp site in the germ cells of recombined offspring (Gallardo et al., 2007; John et al., 2008). Liu and
colleagues (Zhang et al., 2012) have tried to use a germline cell reporter
mouse line (Rosa26rbw/+;Ddx4-Cre) for the isolation of FGSCs. In this
model mouse, CRE recombinase is expressed in germline lineage cells
and induces recombination which leads to a random switch in the expression from enhanced green fluorescent protein (EGFP) to red fluorescent
protein (RFP), orange fluorescent protein (OFP), or cyan fluorescent
protein (CFP) at the rainbow cassette (Zhang et al., 2012). However,
they did not isolate mitotically active germ cells from the ovaries and
claimed that no mitotically active DDX4-expressing female germline progenitors can be found in post-natal mouse ovaries. There were at least
two reasons for their failure in this experiment. First, they did not use
the protocols as described previously for isolating FGSCs (Zou et al.,
2009; White et al., 2012). Second, they monitored only a portion of
the fluorescent germ cells from ovaries, the cells with red fluorescent
proteins.
To reassess the work on FGSC isolation done by Zhang et al., Tilly and
colleagues made an effort to identify and isolate FGSCs by using the
Ddx4-cre;Rosa 26 tdTm/+ reporter mouse line (Park and Tilly, 2015). In
this model mouse strain, CRE recombinase was designed to induce the
expression of tdTomato in germ cells. They successfully isolated
tdTomato-positive OSCs relying on an antibody against DDX4 and
demonstrated that crude dispersion of ovaries was not a reliable approach for OSCs identification. In addition, they also reported that a
large population of reporter-positive somatic cells could be detected
in the ovaries of germline reporter mice, which is due to the leakiness
of the promoter in the Ddx4-Cre cassette (Park and Tilly, 2015).
If the leakiness of the germline reporter mouse described (Park and
Tilly, 2015) could be avoided, this germline reporter mouse could be
Zhang and Wu
designed to isolate germ cells using specific fluorescent proteins. Therefore, it is necessary to try to isolate FGSCs from a germline reporter
mouse based on endogenously expressed fluorescent proteins. Here,
we used a germline lineage reporter mouse line, Ddx4-Cre;mT/mG
mouse line, for the isolation of FGSCs. The Ddx4-Cre;mT/mG mouse
line was generated by crossing the Ddx4-Cre males with the female
mT/mG mice harboring reporter cassettes at the Rosa26 locus. In the
germ cells of Ddx4-Cre;mT/mG mice, the Ddx4 promoter activates the
expression of CRE which then induces the switch in expression from
tdTomato to EGFP. Using this mouse model, we could clearly distinguish
the germ cells (EGFP positive) from the somatic cells (tdTomato positive)
in the ovaries and sort the EGFP-positive cells from the ovaries by FACS,
dependent of the fluorescent protein. Our study showed that the
Ddx4-Cre;mT/mG mouse strain is an ideal model for the isolation and
characterization of FGSCs. Furthermore, offspring were produced
after transplanting this FGSC line into ovaries of sterilized recipients
and a subsequent mating. These results provided further evidence for
the existence of post-natal FGSCs in mammals.
Materials and Methods
Animals
All procedures involving animals were approved by the Institutional Animal
Care and Use Committee of Shanghai, and were conducted in accordance
with the National Research Council Guide for Care and Use of Laboratory
Animals. Ddx4-Cre mice (FVB-Tg(Ddx4-Cre)1Dcas/J; Stock number, 006954)
and mT/mG mice (B6.129(Cg)-Gt(Rosa)26Sortm4(ACTB-tdTomato,2EGFP)Luo/J;
Stock number, 007676) were purchased from the Model Animal Research
Center of Nanjing University, P. R. China, and bred as instructions from
the Jackson laboratory. Briefly, male Ddx4-Cre mice breed with wild type
females. Homozygous mT/mG mice were bred together. The mT/mG mice
harbor genes for two cell membrane-targeted fluorescent proteins at the
Rosa26 locus: tdTomato and EGFP. The membrane-targeted tdTomato
(mT) cassette with loxP sites on either side expresses strong red fluorescence
in all tissues. When crossed with CRE-expressing mice, the tdTomato
cassette is removed by CRE-mediated recombination and the immediately
downstream membrane-targeted EGFP (mG) cassette will begin to be
expressed in the CRE-expressing cells of the offspring (Muzumdar et al.,
2007). To produce the Ddx4-Cre; mT/mG mice, male Ddx4-Cre mice
younger than 63 days old were crossed with female mT/mG mice.
The Ddx4-driven CRE was expressed in the germline lineage and resulted
in a change of expression from tdTomato to EGFP in the germ cells of
this strain.
Wild type C57BL/6 mice were purchased from Shanghai SLAC Laboratory Animal CO., LTD.
Tissue preparation and histology
For cryo-section preparation, ovaries from 21-day-old Ddx4-Cre; mT/mG
mice were isolated, washed twice for 3 min with 0.01 M phosphate-buffered
saline (PBS), fixed for 4 h in 4% paraformaldehyde (PFA) in PBS (Sigma)
at 48C, cryoprotected in 30% sucrose overnight at 48C, embedded in
tissue optimum cutting temperature compound and frozen in liquid nitrogen.
Ten micrometer sections were obtained using a Leica cryostat (Leica
CM1950). Slides were counterstained with Hoechst 33342 (Life Technologies, Carlsbad, CA, USA, 5 mg/mL) and images were taken with a fluorescence microscope (Leica DM2500) equipped with a charge-coupled
device camera (Leica DFC550). Wave Range of Excitation/Emission (nm):
Blue channel for Hoechst 33342, 340-380/LP425; Green channel for
EGFP, 460-500/510-560; Red channel for tdTomato, 515-560/LP 590.
459
Functional germline stem cells from 21-day mouse ovaries
Isolation and culture of FGSCs
Ovaries from 21-day-old Ddx4-Cre;mT/mG mice were collected, washed
with ice-cold PBS, and then minced into small pieces. Two-step enzymatic
tissue dissociation was performed as described previously (Zou et al.,
2009; Wang et al., 2014). The cell suspension was first passed through a
100-mm filter to remove tissue clumps, and then passed through a 35-mm
filter to obtain the final fraction of cells for FACS. These isolated cells were
cultured as described previously (Zou et al., 2009). The culture medium
for FGSCs was minimum essential medium alpha (Invitrogen Life Sciences,
Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Life Technologies), 30 mg/ml pyruvate (Amresco, VWR International, LLC, Lardner,
PA, USA), 2 mM L-glutamine (Amresco), 50 mM b-mercaptoethanol (Sigma
Chemical Co., St. Louis, MO, USA), 6 mg/ml penicillin (Amresco), 1 mM
nonessential amino acids (Invitrogen), 20 ng/ml mouse epidermal growth
factor (PeproTech, Rocky Hill, NJ, USA), 10 ng/ml mouse basic fibroblast
growth factor (PeproTech), 10 ng/ml mouse glial cell line-derived neurotrophic factor (PeproTech), and 10 ng/ml mouse leukemia inhibitory
factor (Santa Cruz Biotechnology, CA, USA). The feeder for FGSC culturing
is the SIM-6-thiogunanie-oualiain (STO) cell line (ATCC, Manassas, VA,
USA). The STO cell line was derived from the SIM fibroblast (mouse)
which is resistant to 6-thioguanine and ouabain and is HGPRT- (HPRT-)
and HAT sensitive.
RNA isolation and RT– PCR
Total RNA was extracted using Trizol reagent (Qiagen, Valencia, CA, USA)
according to the manufacturer’s instructions and the RT reaction was performed with Moloney murine leukemia virus (TaKaRa Bio Inc., Japan)
reverse transcriptase. PCR analyses were generated with Taq DNA polymerase (TaKaRa Bio Inc.). Forward and reverse primers of the corresponding
genes were as reported previously (Zou et al., 2009).
Cell proliferation assay and
immunohistochemistry
FGSCs were seeded in triplicate experiments at 2 × 103 cells per well in
24-well plates in FGSC culture medium. The third day after passage, cells
were incubated with FGSC culture medium including 10 mM Edu
(5-ethynyl-2′ -deoxyuridine, Invitrogen Life Sciences) for 3 h at 378C. Edu is
a nucleoside analog of thymidine and is incorporated into DNA during
active DNA synthesis (Salic and Mitchison, 2008). Then, Edu staining was
Figure 1 Distribution of fluorescent cells in the ovaries of Ddx4-Cre;mT/mG mice (21 days old). (A) Illustration of germ cells labeling by enhanced green
fluorescent protein (EGFP) in Ddx4-Cre;mT/mG mice ovaries. (B) Gross view of intact ovary of this mouse strain. Fluorescence with EGFP (green), tandem
dimer Tomato (tdTomato) (red) and bright field images are shown. All scale bars ¼ 500 mm. (C) Fluorescence microscopy image for the section of the
model mouse ovary. The follicle contains an EGFP-positive oocyte (arrowhead, green) at the center and tdTomato-positive somatic cells (red) surrounding
it. Germ cells of smaller size were rare but could be found at the cortical surface of the ovary (arrows, green). Cells were counterstained with Hoechst 33342
(blue). All scale bars ¼ 50 mm. (D–G) Cells were freshly isolated from ovaries of the model mice by two-step enzymatic digestion as described in the
methodology. Rare green germ cells (arrows) are visible in the cell fraction. Different sizes of germ cells, c.10, 11, 15, and 44 mm, are shown in (D), (E),
(F) and (G), respectively. All scale bars ¼ 50 mm. The experiments were conducted three times and the total number of Ddx4-Cre;mT/mG mice used is six.
460
performed according to the instructions of the Click-iTw Plus Edu Alexa
Fluorw 555 Imaging kits (Invitrogen Life Sciences). In brief, cells were fixed
with 3.7% PFA for 15 min at room temperature, washed twice with 3%
bovine serum albumin (BSA), permeated by 0.5% Triton X-100 for 20 min
at room temperature, washed twice with 3% BSA, incubated with the ClickiTw Plus reaction cocktail for 30 min at room temperature and washed once
more with 3% BSA. Then, immunohistochemistry was performed as follows:
cells were blocked with 10% goat serum in PBS for 10 min at 378C and then
incubated with an anti-DDX4 antibody in PBS (1:500; ab13840, Abcam,
Cambridge, MA, USA) at 48C overnight. After incubation, the cells were
washed twice with PBST (PBS with 0.1% Tween 20) for 5 min and then incubated with secondary antibodies conjugated with Alexa 647 in PBS for 30 min
at 378C (1:500; ab150087, Abcam). After washing with PBST twice, the cells
were incubated with Hoechst 33342 for 30 min at room temperature. For
imaging, a confocal laser-scanning microscope (Leica, TSP8) was used (wavelength ranges of excitation/emission (nm): Hoechst 33342, 405/427– 490;
EGFP, 488/495 –544; Edu labeled by Alexa 555 552/564– 620; Ddx4
labeled by Alexa 647, 638/653 –736).
FGSC transplantation
Six-week-old female C57BL/6 mice were sterilized by i.p. injection of busulfan (30 mg/kg body weight) and cyclophosphamide (120 mg/kg body
weight) that were dissolved in dimethylsulfoxide. For transplantation of
FGSCs, the FGSCs in culture were collected, washed twice with PBS, and
then resuspended in PBS. Recipients were anesthetized by i.p. injection of
sodium pentobarbitone (16 mg/kg body weight,). A single-cell suspension
of 6 ml, containing 1 × 104 cells, was injected into each ovary of the recipients. For the control group, 6 ml PBS was injected into each ovary of the recipients. Microinjection of each ovary was performed using a glass pipette with
a 45-mm tip.
For offspring identification, genotype was detected by PCR as for the
identification of the mT/mG mouse line. Primer sequences provided by the
Jackson laboratory were (5′ to 3′ ) (Forward) CTCTGCTGCCTCCTGGC
TTCT, (Reverse for wild type) CGAGGCGGATCACAAGCAATA and
(Reverse for mutant) TCAATGGGCGGGGGTCGTT. Bands of 330 bp
and 250 bp observed on gel electrophoresis correspond to the wild type
and transgenic gene, respectively.
Zhang and Wu
Fig. 1C). All the somatic cells in the ovary were tdTomato positive.
Then, by dispersing the ovarian tissues enzymatically, many tdTomatopositive cells and a few EGFP-positive cells including oocytes and cells
of smaller size were found (Fig. 1D–G). These results imply that only
germ cells from the ovaries of this mouse strain were EGFP-positive.
Together, these results demonstrate that the Ddx4-Cre;mT/mG
mouse strain is a useful model for germ cell studies in the ovaries. Consistent with previous studies (Gallardo et al., 2007; Hobbs et al., 2012; Yu
et al., 2013), the expression of CRE recombination was strictly confined
to germ cells of Ddx4-Cre mice. This implies that EGFP-positive cells from
this germline reporter strain should be a reliable source for the establishment of FGSCs.
Use of the Ddx4-Cre;mT/mG mice for the
isolation of FGSCs by FACS based on
endogenously expressed fluorescent proteins
To test whether DDX4-positive cells from post-natal ovaries can be
separated without DDX4 antibody and used to establish a germline
stem cell line, we used the Ddx4-Cre;mT/mG mice for isolating FGSCs
by FACS. The results showed that the yield of EGFP-positive cells from
the total viable cell population was 2.3% (Fig. 2A and B), which is a
little more than in previous studies (White et al., 2012; Park and Tilly,
2015). Because the germ cells were EGFP-positive, we could isolate
them using FACS without antibody labeling, which made the process
of isolation simple and efficient.
Results
Validation of EGFP expression pattern for germ
cells in the ovaries of Ddx4-Cre;mT/mG mice
The Ddx4-Cre mouse has been reported as a powerful tool for germ cell
studies. In this model, the endogenous Ddx4 promoter drives the expression of CRE recombinase in DDX4-positive germline cells. To distinguish
the germ cells from somatic cells in the ovaries, we crossed male
Ddx4-Cre mice with female mT/mG reporter mice. By doing this, Ddx4
driven CRE mediated recombination led to a change from the expression
of tdTomato to EGFP in the germ cells of the offspring, as illustrated in
Fig. 1A.
Then, intact ovaries of the Ddx4-Cre;mT/mG mice were examined
under a fluorescent microscope. EGFP-positive cells were scattered
throughout the entire ovary (Fig. 1B). To our knowledge, this pattern
of EGFP-positive cells is consistent with the general distribution of
oocytes in post-natal ovaries. To confirm this result, histology of the
ovaries from these mice was evaluated. Primary follicles were easily
observed with EGFP-positive oocytes (arrowhead) at their centers
enclosed by somatic cells expressing tdTomato (Fig. 1C). Germ cells of
a smaller size also could be found at the cortical surface (arrows,
Figure 2 Isolating the EGFP-positive germ cells from the ovaries of
the Ddx4-Cre;mT/mG mice by FACS. (A) Representative plot shows
the sorting of female germline stem cells (FGSCs) from the ovaries.
EGFP-positive cells (cells inside the black circle) were harvested from
the separated cell samples. (B) EGFP-positive cells freshly sorted by
FACS. Both scale bars ¼ 50 mm. The experiments were conducted
three times and the total number of Ddx4-Cre;mT/mG mice used is 30.
Functional germline stem cells from 21-day mouse ovaries
Establishment and characterization of FGSC
line derived from the Ddx4-Cre;mT/mG mice
After FACS, EGFP-positive germ cells were collected and cultured for cell
line establishment as in previous studies (Zou et al., 2009; Wang et al.,
2014; Zhou et al., 2014) (Fig. 3A). The feeder for FGSC culturing is the
SIM-6-thiogunanie-oualiain (STO) cell line. To determine whether this
EGFP-positive FGSC line had the same phenotypic characteristics as
those reported previously (Zou et al., 2009), it was tested for the expression of the germ cell markers Ddx4, Oct4, Dazl, Blimp1, Stella and Fragilis
by RT –PCR, as in previous studies (Zou et al., 2009; White et al., 2012;
Park and Tilly, 2015). All the markers listed here could be detected at the
mRNA level (Fig. 3B). Thus, the characteristics of this EGFP-positive cell
line were identical to the FGSCs reported previously (Zou et al., 2009;
White et al., 2012).
The EGFP-positive FGSC line established was confirmed by immunostaining for DDX4 and Edu labeling. Edu is a novel alternative for BrdU
(5-bromo-2′ -deoxyuridine) for the detection of cell proliferation (Salic
and Mitchison, 2008; Guo et al., 2009; Zeng et al., 2010). Most of the
cells were triple positive for EGFP (green), Ddx4 staining (blue) and
Edu labeling (red; see Fig. 3C). This suggests that the EGFP-positive
cells were mitotically active germ cells.
Together, these results showed that FGSCs could be successfully isolated based on endogenously expressed fluorescent proteins and
461
established as a cell line from the prepubertal ovaries of Ddx4-Cre;mT/
mG mice, which should be an ideal model for the isolation of FGSCs
and studies of other germ cells.
Production of offspring from the FGSC line
derived from Ddx4-Cre;mT/mG mice
To examine whether this FGSC line is functional under physiological conditions in vivo, EGFP positive FGSCs passaged for more than 30 times were
transplanted into the ovaries of sterile mice (see Materials and Methods).
Ovaries from control (three mice) and experimental groups (three mice)
were harvested and examined 30 days after transplantation. As expected,
primary and second follicles formed in the FGSC transplanted group
(Fig. 4A). In contrast, only atretic oocytes, stromal and interstitial cells
could be found in the ovaries of control females (Fig. 4B), illustrating that
the system for sterilization works well. Oocytes in the FGSC transplanted
group were found to be EGFP positive (Fig. 4C). This implied that EGFPpositive FGSCs could form follicles in the ovaries of recipient mice. At
the same time, the remaining females transplanted with FGSCs (six mice)
or PBS (three mice) were mated with wild type males.
About 60 days after transplantation, 83% (5/6) of FGSC recipients
gave birth to offspring (Fig. 4D) while females in the control group
were still infertile. Because the FGSCs were heterozygous for EGFP,
only half of the offspring should be EGFP positive in theory. Offspring
Figure 3 Characterization of a EGFP-positive FGSC line from the Ddx4-Cre;mT/mG mice. (A) The FGSC line was maintained on EGFP-negative
SIM-6-thiogunanie-oualiain (STO) feeder cells treated with mitomycin. The round EGFP-positive cells formed clusters. Scale bars¼50 mm. (B) Detection
of the mRNA expression of germ cell markers in FGSCs by RT– PCR (STO for feeder cells as a negative control, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) used as internal control). Results are shown for B lymphocyte-induced maturation protein-1 (Blimp1), 483 bp; Deleted in azoospermia-like
(Dazl), 328 bp; DEAD box polypeptide 4 (Ddx4), 213 bp; octamer-binding transcription factor 4 (Oct4), 198 bp; Stella, 354 bp; Fragilis, 151 bp; and GAPDH,
458 bp. (C) Evaluation of EGFP-positive FGSC (green) proliferation by dual detection of DDX4 expression (blue) and 5-ethynyl-2′ -deoxyuridine (Edu)
incorporation (red). Cells were counterstained with Hoechst 33342 (gray). All scale bars ¼ 50 mm. Representative images of FGSCs cultured for more
than 30 passages are shown in (A) –(C). The experiments were conducted three times.
462
Zhang and Wu
Figure 4 Offspring generated by transplanting EGFP positive FGSCs into recipient mice. (A) Representative image of follicles formed in the ovaries of
recipient mice (C57BL/6) 30 days after transplantation of FGSCs. (B) Representative image of ovaries from control mice (C57BL/6) after injection of PBS.
Atretic follicles (arrows) are shown. (C) Fluorescent image of a frozen section of ovary from recipient transplanted with EGFP-positive FGSCs. Follicles with
EGFP-positive oocytes (arrows) are present. Cells were counterstained with Hoechst 33342 (blue). (D) An example of offspring from a recipient transplanted with EGFP-positive FGSCs. (E) Identification of EGFP-positive offspring by PCR. M: 100 bp DNA ladder. A band of 330 bp represents the wild
type allele while a band of 250 bp represents the transgenic allele. Samples 1, 4 were EGFP positive and others were wild type. EGFP-positive offspring
were heterozygote. The PCR products were sequenced for confirmation. (F) Offspring inheriting the EGFP gene were detected by a living image under
a lumazone imaging system (Mag Biosystems, Tucson, AZ, USA). Global EGFP signals were detectable in offspring 1 and 4. Scale bars in
(A) –(C) ¼ 50 mm. For the experimental group, nine recipient mice (C57BL/6) were used. Three recipient mice were used for histological examination
and six recipient mice were used for mating. For the control group, six mice (C57BL/6) were used. Three were used for histological examination and three
were used for mating. Six male mice (C57BL/6) were used for mating. The experiments were conducted three times.
with an inherited EGFP gene were identified by PCR (Fig. 4E) and imaged
under a live-imaging machine (lumazone imaging system, Mag Biosystems, Tucson, AZ, USA) (Fig. 4F). Because the EGFP cassette under
control of the cre-loxp system has been activated in the EGFP-positive
FGSCs, offspring that inherited the EGFP cassette from FGSCs presented
a global expression pattern.
463
Functional germline stem cells from 21-day mouse ovaries
Discussion
In this study, we showed that the Ddx4-Cre;mT/mG mouse was a useful
model for the isolation of FGSCs without using antibody. To confirm
whether DDX4-positive cells from post-natal ovaries can be separated
independently of an antibody and used to establish a cell line, it is necessary to isolate FGSCs by using mouse strains endogenously expressing
fluorescent proteins only in the germ cells. For isolating such germ cells
by FACS, it is unnecessary to use an anti-DDX4 antibody for germ cell
labeling, which has been a key step in previous studies (Zou et al.,
2009; White et al., 2012; Woods and Tilly, 2013; Park and Tilly, 2015).
In our study, without using antibody, GFP positive FGSCs have been isolated and established. Indeed, the fluorescent FGSCs established in our
paper had the same phenotypic characteristics as those reported previously (Zou et al., 2009) and were demonstrated to be functional by producing offspring after transplanting into the ovaries of recipients and
subsequent mating. These results provide a novel proof of the existence
of post-natal FGSCs in mammals.
Ddx4-Cre mice have been reported as a powerful tool for germ cell
studies (Gallardo et al., 2007). The expression of CRE recombinase
was driven by the 5.6 kb long endogenous Ddx4 promoter, which contains canonical promoter sequences, including a TATA box at position
227 and more distant control elements, important for germ cell-specific
expression in this mouse strain. The specificity of this model mouse is
confined to germ cells, excluding two cases that exhibit global CREmediated recombination. The first case is caused by parent-of-origin
effects arising from the accumulation of CRE protein from oocyte to
zygote when a female Ddx4-Cre mouse is crossed with a male reporter
mouse bearing a loxp-flanked cassette. In this case, all the progeny—
regardless of whether they inherit Ddx4-Cre—undergo global CREmediated recombination (Gallardo et al., 2007). The second case is
that occasional progeny inheriting Ddx4-Cre (,20%) exhibit global expression of the reporter gene, even when male mice are used as carriers.
This is dependent on the inheritance of the Ddx4-Cre transgene mice
(Gallardo et al., 2007). Thus, to lower the probability of global recombination, it is recommended that the Ddx4-Cre male mice used for breeding
should be youngest available (ideally 5– 6 weeks of age, but definitely
,9 weeks). Once a male mouse has been proven to give rise to globally
recombined progeny repeatedly, he should no longer be used as a
breeder (https://www.jax.org/strain/006954). In addition, ‘leakiness’
of the Ddx4 promoter has been reported (Park and Tilly, 2015). As
in the second case discussed above, many of the somatic cells expressed
the reporter gene. Even so, in most instances the expression of Ddx4-Cre
was confined to the germ cells. Globally recombined progeny can be
identified by routine genotyping of the DNA from tail tissues or by directly observing the pattern of the fluorescent protein expressing cells in the
ovaries and other tissues using fluorescence microscopy.
In our experiments we noted the features of this model mouse strain.
Male Ddx4-Cre mice younger than 9 weeks of age were used for mating
with mT/mG female mice. Luckily, global recombination rarely occurred.
We have confirmed the pattern of the EGFP-positive cells in the ovaries
of prospective Ddx4-Cre;mT/mG mice. All those used in our experiments
were examined using fluorescence microscopy for ensuring the absence
of global recombination or the ‘leakiness’ discussed above.
Thus, for the first time we have successfully used prepubertal
Ddx4-Cre;mT/mG mice for the isolation of FGSCs based on endogenously expressed fluorescent proteins. This FGSC line was proven
to be functional in vivo by transplanting into the sterilized ovaries, with
offspring produced after mating. Our data, together with previous
studies (Zou et al., 2009; White et al., 2012; Zhou et al., 2014; Park
and Tilly, 2015), support the view that mitotically active germ cells
exist in post-natal ovaries in mammalian species. For further studies,
the Ddx4-Cre;mT/mG model mouse strain could be used for fully
elucidating the molecular mechanisms of proliferation and differentiation
of FGSCs in vivo and in vitro.
Authors’ roles
C.Z. conducted all the experiments, data analysis and wrote the
manuscript. J.W. initiated and supervised the entire project.
Funding
This work was supported by National Basic Research Program of China
(2013CB967401) and the National Nature Science Foundation of China
(81370675, 81200472 and 81421061).
Conflict of interest
None declared.
References
Anderson LD, Hirshfield AN. An overview of follicular development in
the ovary: from embryo to the fertilized ovum in vitro. Md Med J 1992;
41:614– 620.
Borum K. Oogenesis in the mouse. Exp Cell Res 1961;24:495 – 507.
Gallardo T, Shirley L, John GB, Castrillon DH. Generation of a germ
cell-specific mouse transgenic Cre line, Vasa-Cre. Genesis 2007;
45:413– 417.
Guo F, Ma J, McCauley E, Bannerman P, Pleasure D. Early postnatal
proteolipid promoter-expressing progenitors produce multilineage cells
in vivo. J Neurosci 2009;29:7256– 7270.
Hobbs RM, Fagoonee S, Papa A, Webster K, Altruda F, Nishinakamura R,
Chai L, Pandolfi PP. Functional antagonism between Sall4 and Plzf
defines germline progenitors. Cell Stem Cell 2012;10:284 – 298.
Hu Y, Bai Y, Chu Z, Wang J, Wang L, Yu M, Lian Z, Hua J. GSK3 inhibitor-BIO
regulates proliferation of female germline stem cells from the postnatal
mouse ovary. Cell Prolif 2012;45:287 – 298.
John GB, Gallardo TD, Shirley LJ, Castrillon DH. Foxo3 is a PI3K-dependent
molecular switch controlling the initiation of oocyte growth. Dev Biol
2008;321:197 – 204.
Johnson J, Canning J, Kaneko T, Pru JK, Tilly JL. Germline stem cells and
follicular renewal in the postnatal mammalian ovary. Nature 2004;
428:145– 150.
Johnson J, Bagley J, Skaznik-Wikiel M, Lee HJ, Adams GB, Niikura Y,
Tschudy KS, Tilly JC, Cortes ML, Forkert R et al. Oocyte generation in
adult mammalian ovaries by putative germ cells in bone marrow and
peripheral blood. Cell 2005;122:303 – 315.
Lin FJ, Shen L, Jang CW, Falnes PO, Zhang Y. Ikbkap/Elp1 deficiency causes
male infertility by disrupting meiotic progression. PLoS Genet 2013;
9:e1003516.
McLaren A. Meiosis and differentiation of mouse germ cells. Symp Soc Exp Biol
1984;38:7 – 23.
Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L. A global double-fluorescent
Cre reporter mouse. Genesis 2007;45:593 – 605.
464
Pacchiarotti J, Maki C, Ramos T, Marh J, Howerton K, Wong J, Pham J,
Anorve S, Chow YC, Izadyar F. Differentiation potential of germ line
stem cells derived from the postnatal mouse ovary. Differentiation 2010;
79:159 –170.
Park E-S, Tilly JL. Use of DEAD-box polypeptide-4 (Ddx4) gene
promoter-driven fluorescent reporter mice to identify mitotically
active germ cells in post-natal mouse ovaries. Mol Hum Reprod 2015;
21:58 –65.
Peters H. Migration of gonocytes into the mammalian gonad and their
differentiation. Philos Trans R Soc Lond B Biol Sci 1970;259:91 –101.
Salic A, Mitchison TJ. A chemical method for fast and sensitive
detection of DNA synthesis in vivo. Proc Natl Acad Sci USA 2008;
105:2415–2420.
Vanorny DA, Prasasya RD, Chalpe AJ, Kilen SM, Mayo KE. Notch signaling
regulates ovarian follicle formation and coordinates follicular growth.
Mol Endocrinol 2014;28:499 –511.
Wang H, Jiang M, Bi H, Chen X, He L, Li X, Wu J. Conversion of female
germline stem cells from neonatal and prepubertal mice into pluripotent
stem cells. J Mol Cell Biol 2014;6:164 –171.
White YA, Woods DC, Takai Y, Ishihara O, Seki H, Tilly JL. Oocyte formation
by mitotically active germ cells purified from ovaries of reproductive-age
women. Nat Med 2012;18:413 –421.
Woods DC, Tilly JL. Isolation, characterization and propagation of mitotically
active germ cells from adult mouse and human ovaries. Nat Protoc 2013;
8:966 –988.
Zhang and Wu
Yu C, Zhang YL, Pan WW, Li XM, Wang ZW, Ge ZJ, Zhou JJ, Cang Y, Tong C,
Sun QY et al. CRL4 complex regulates mammalian oocyte survival and
reprogramming by activation of TET proteins. Science 2013;342:1518–1521.
Yuan S, Ortogero N, Wu Q, Zheng H, Yan W. Murine follicular development
requires oocyte DICER, but not DROSHA. Biol Reprod 2014;91:39.
Zeng C, Pan F, Jones LA, Lim MM, Griffin EA, Sheline YI, Mintun MA,
Holtzman DM, Mach RH. Evaluation of 5-ethynyl-2′ -deoxyuridine
staining as a sensitive and reliable method for studying cell proliferation
in the adult nervous system. Brain Res 2010;1319:21 – 32.
Zhang Y, Yang Z, Yang Y, Wang S, Shi L, Xie W, Sun K, Zou K, Wang L, Xiong J
et al. Production of transgenic mice by random recombination of targeted
genes in female germline stem cells. J Mol Cell Biol 2011;3:132 – 141.
Zhang H, Zheng W, Shen Y, Adhikari D, Ueno H, Liu K. Experimental
evidence showing that no mitotically active female germline progenitors
exist in postnatal mouse ovaries. Proc Natl Acad Sci USA 2012;
109:12580– 12585.
Zhou L, Wang L, Kang JX, Xie W, Li X, Wu C, Xu B, Wu J. Production of fat-1
transgenic rats using a post-natal female germline stem cell line. Mol Hum
Reprod 2014;20:271 – 281.
Zou K, Yuan Z, Yang Z, Luo H, Sun K, Zhou L, Xiang J, Shi L, Yu Q, Zhang Y
et al. Production of offspring from a germline stem cell line derived from
neonatal ovaries. Nat Cell Biol 2009;11:631 – 636.
Zou K, Hou L, Sun K, Xie W, Wu J. Improved efficiency of female germline
stem cell purification using fragilis-based magnetic bead sorting. Stem
Cells Dev 2011;20:2197 – 2204.