Cleveland State University
EngagedScholarship@CSU
ETD Archive
2014
Magnesium as a Regulator of Hepatic Nadph in the
Hepatocyte :;Prospective Roles of Magnesium in
Diabetes and Obesity Onset
Chesinta B. Voma
Cleveland State University
How does access to this work benefit you? Let us know!
Follow this and additional works at: http://engagedscholarship.csuohio.edu/etdarchive
Part of the Chemistry Commons
Recommended Citation
Voma, Chesinta B., "Magnesium as a Regulator of Hepatic Nadph in the Hepatocyte :;Prospective Roles of Magnesium in Diabetes
and Obesity Onset" (2014). ETD Archive. Paper 297.
This Dissertation is brought to you for free and open access by EngagedScholarship@CSU. It has been accepted for inclusion in ETD Archive by an
authorized administrator of EngagedScholarship@CSU. For more information, please contact [email protected].
MAGNESIUM AS A REGULATOR OF HEPATIC NADPH IN THE HEPATOCYTE:
PROSPECTIVE ROLES OF MAGNESIUM IN DIABETES AND OBESITY ONSET
CHESINTA B. VOMA, B.S.MT (ASCP)CM
Bachelor of Science in Microbiology
University of Buea, Republic of Cameroon, Africa
June 2001
Bachelor of Science in Medical Laboratory Science
University of Texas Medical Branch
July 2009
Submitted In partial fulfillment of the requirement for the Degree
DOCTOR OF PHILOSOPHY IN CLINICAL AND BIOANALYTICAL CHEMISTRY
at the
CLEVELAND STATE UNIVERSITY
APRIL 2014
We hereby approve this dissertation
For
Chesinta B. Voma
Candidate for the Doctorate degree in Bioanalytical and Clinical Chemistry
For the Department of
CHEMISTRY
and
CLEVELAND STATE UNIVERSITY’S
College of Graduate Studies by
Co-Chair: Dr. David Anderson, PhD
04/25/2014
Department & Date
Co-Chair: Dr. Andrea Romani, MD, PhD
04/25/2014
Department & Date
Dr. Anthony Berdis, PhD
04/25/2014
Department & Date
Dr. Su Bin, PhD
04/25/2014
Department & Date
Dr. Andrew Resnick, PhD
04/25/2014
Department & Date
April, 25th, 2014
Date of Defense
DEDICATED TO:
I dedicate this thesis to my parents, Mr. Philip Voma and Mrs. Agnes Voma (R.I.P). Daddy
your continuous support and encouragement gave me the courage to pursue my dream and make
it come true. There could not have been a better Dad than you. You are irreplaceable and I
remain forever grateful.
ACKNOWLEDGEMENTS
I must begin my acknowledgements with my mentor, Dr. Andrea Romani, without his
flexibility and open-mindedness, his challenges, and his willingness to foster and cultivate my
independence, this work would not have been possible. He has lent his knowledge, insight, and
moral character to every facet of this work.
Next, I would like to thank the members of my committee for their advice, input,
criticism, availability, and support. Dr. Anderson was a great co-mentor. His special skills in
making me think like an analytical clinical chemist was invaluable, Dr. Berdis for always
providing an open door and providing an encyclopedic knowledge of biochemistry that thought
me to think beyond the scope of my work. Dr. Bin, whose emphasis on my research
interpretation skills kept me constantly thinking and thriving to be better at it with each
subsequent oral presentation, and Dr. Resnick, whose background from the physics department
thought me the skill on how to convincingly sell my innovation to a neutral crowd with ease, and
prepared me to be able to present my work regardless of the type of audience I had.
There are a number of contributors I must also mention. Dr. Croniger, who has always been there
from when I introduced myself and my work to her. She always made me feel welcome,
providing me with the knowledge I needed to interpret my research data and plan my
experiments. She was an indispensable reference regarding my work on obesity. Dr. Domenick
Prosdocimo, thank you for introducing me to RT-PCR technique which was very vital for
collecting my research data. Dr. Bernstein, whose checking on the progress of my work, and
reassurance made me see the light at the end of the tunnel. Dr. Dubyak, whose generosity in
enabling me use his laboratory analyzer and technical support on using this analyzer, made me
collect some of the valuable preliminary data I needed for presentation of my thesis proposal and
also for providing me with HL-60 cells used in validation of my preliminary results.
Dr. Kanuth, Michelle (R.I.P), whose academic support in the medical technology program at
UTMB Galveston, her encouragement and guidance using her life experiences, made me believe
I could do it.
My colleagues who introduced me to the basics in cell culture, and in so doing, were responsible
for my basic abilities to begin my work. My friends Titilope Ishola, MD and Etem Chu, MD, you
both have been an inspiration to my success. This would not be possible without your moral
support and prayers.
My wonderful co-workers Kristen and Cheryl, and Supervisor Jackie, thank you so much for
your friendliness and the memorable times we shared. Your limitless support and understanding
through all these years have been very vital for my success.
My last thanks to members of my family who have been very supportive of me from birth, and
because they believed in my abilities even when I was in doubt, I fearlessly took the next step,
knowing they will lift me up if I fell. My Aunts, Theresa Gwanfogbe, PhD and Philomina
Gwanfogbe, PhD, and Sister Dorothy Voma, PharmD, who related so well with my experiences
from their Déjà vu stories and helped me to stay focused. They always understood when I could
not make trips to visit nor join them in celebrating milestones in the family. Thank you for being
there for me.
My Daddy (who has played mother and father since my mother passed), without his relentless
effort this journey would not have been possible. Thank you for your unending support, moral
guidance and work ethics. Thank you for telling me that nothing was beyond my ability, and
even more thanks for not just telling me that, but making me believe in it.
MAGNESIUM AS A REGULATOR OF RETICULAR NADPH IN THE HEPATOCYTE:
PROSPECTIVE ROLE OF MAGNESIUM IN DIABETES AND OBESITY ONSET
CHESINTA B. VOMA
ABSTRACT
Clinically quantifiable liver functions take place within the hepatocytes (80% of liver cells).
Magnesium (Mg2+) deficiency has been correlated with the onset and progression of diabetes, and
obesity yet, no cause-effect relationship has been identified. The current western diet is approximately
35% deficient in Mg2+. The effect of Mg2+ deficiency on hormonal physiological control has not been fully
elucidated. The principal reservoir of Mg2+ (i.e., the bone) is not readily exchangeable with circulating
extracellular Mg2+ , thus in Mg2+ deficiency, initial losses come from the extracellular space since
equilibrium with bone stores does not begin for several weeks.
Mg2+ is highly concentrated within the endoplasmic reticulum, 15-20 mmol/L [Mg2+] Total . H6PD, the
reticular counterpart of the cytosolic G6PD, is the main NADPH generating enzyme within the
endoplasmic reticulum of the hepatocyte and an ancillary enzyme in pre-receptor glucocorticoid
activation. NADPH-dependent 11β-HSD1 generates cortisol from its inactive form cortisone, thus
eliciting high intra-hepatic active glucocorticoid concentrations, which in turn affects hepatocyte
metabolism and response to insulin. Previous research has focused on the sensing of carbon
(mostly glucose) and nitrogen sources (mostly amino acids). This study tests the hypothesis that
Mg2+ depletion alters hepatic metabolism and hormonal response via an increased cortisol production,
leading to the onset of obesity, insulin resistance, and diabetes.
HepG2 cells were grown in the presence of 0.6 (deficient) or 1.0 mmol/L (physiological) [Mg2+ ]o
and analyzed for NADPH and 11β-HSD1-mediated cortisol production. Additionally, H6PD, and 11βHSD1 expression levels were analyzed by RT-PCR and Western Blot analysis together with other
downstream products regulated by cortisol. Gluconeogenic genes also upregulated, include FOXO1,
vii
PEPCK, F16BP. Our results indicate that NADPH production increased by ~60% in Mg2+ deficient cells,
and resulted in approximately two fold increase in cortisol production. Also, Mg2+ deficient cells showed
3 to 4 fold increase in H6PD and 11β-HSD1 mRNA and protein expression.
Overall, our results support the hypothesis that Mg2+ deficiency increases H6PD activity and
expression, setting the conditions for increased production of cortisol, decreased insulin responsiveness,
and increased gluconeogenesis within the hepatocytes.
viii
TABLE OF CONTENTS
Page
ABSTRACT --------------------------------------------------------------------------------------------vii
LIST OF TABLES-------------------------------------------------------------------------------------xiii
LIST OF FIGURES------------------------------------------------------------------------------------xiv
LIST OF ABREVIATIONS--------------------------------------------------------------------------xvi
APPENDIX ------------------------------------------------------------------------------------------113
CHAPTER I
I.I Background & Significance of Magnesium -----------------------------------------------1
1.2. Magnesium Homeostasis and Transport--------------------------------------------------5
1.3. Transport Mechanisms of Magnesium----------------------------------------------------6
1.4. Liver and Glucose Metabolism-------------------------------------------------------------7
1.5. Magnesium Distribution and Physiology in Membranes & Organelles Other ------9
1.6. Magnesium in cellular metabolism -------------------------------------------------------11
1.7. Bioavailability of Magnesium--------------------------------------------------------------13
1.8. Magnesium Stability in Processed and Unprocessed Foods ---------------------------15
1.9. Hepatic Gluconeogenesis-------------------------------------------------------------------15
1.10. Other functions of Magnesium -----------------------------------------------------------18
ix
1.11. Magnesium Deficiency----------------------------------------------------------------------19
1.12. Causes of Magnesium Deficiency ---------------------------------------------------------20
1.13. Magnesium Deficiency and Metabolic Diseases ----------------------------------------22
1.14. Low Magnesium levels and altered Glucose Metabolism------------------------------24
CHAPTER II
REDUCED CELLULAR MAGNESIUM CONTENT ENHANCES HEXOSE-6PHOSPHATE DEHYDROGENASE ACTIVITY AND EXPRESSION IN HEPG2 AND
HL-60 CELLS.
MATERIALS ---------------------------------------------------------------------------------------29
METHODS ------------------------------------------------------------------------------------------29
Cell Cultures ---------------------------------------------------------------------------------29
Cellular Magnesium Content---------------------------------------------------------------30
Animals o Magnesium Deficient Diet ----------------------------------------------------30
Liver Microsomal Purification -------------------------------------------------------------31
Magnesium Determination in Total Liver Microsomes---------------------------------31
Hexose 6-Phosphate Dehydrogenase Activity--------------------------------------------32
Hexose 6-Phosphate Dehydrogenase Gene Expression ---------------------------------33
Hexose 6-Phosphate Dehydrogenase Protein Expression ------------------------------35
Other Experimental Procedures-------------------------------------------------------------35
STATISTICAL ANALYSIS-----------------------------------------------------------------------35
RESULTS---------------------------------------------------------------------------------------------36
Intracellular Mg2+ Distribution-------------------------------------------------------------37
x
Glucose 6-Phosphate Hydrolysis in HepG2 Cells --------------------------------------38
Hexose 6-Phosphate Dehydrogenase Activity in HepG2 cells-------------------------40
Inhibitory Effect of Exogenous Mg2+ Addition of NADPH Production--------------42
Effect of β-Mercaptoethanol on Enzyme Conformation--------------------------------47
Hexose 6-Phosphate Dehydrogenase Gene Expression in HepG2 Cells--------------49
Hexose 6-Phosphate Dehydrogenase Protein Expression in HepG2 Cells-----------51
Effect of MgCl2 , KCl, MgSO 4 and MnCl2 on H6PD activity -------------------------53
Effect of CaCl2 on H6PD activity ---------------------------------------------------------54
H6PD activity in Microsomal Vesicles -------------------------------------------------- 56
Total and Compartmentalized Mg2+ in HL-60 cells -------------------------------------58
H6PD-coupled NADPH production in HL-60 cells -------------------------------------59
Inhibitory Effect of Increasing Concentration of exogenous Mg2+ on NADPH
production in HL-60 cells-------------------------------------------------------------------59
H6PD Gene and Protein Expression in HL-60 cells-------------------------------------60
2.7. Discussion--------------------------------------------------------------------------------------------61
CHAPTER III
REDUCED CELLULAR AND RETICULAR MAGNESIUM CONTENT ENHANCES
CONVERSION OF CORTISONE TO CORTISOL: IMPLICATIONS IN THE ONSET/
PROGRESSION OF OBESITY AND INSULIN RESISTANCE
MATERIALS ---------------------------------------------------------------------------------------72
xi
METHODS ------------------------------------------------------------------------------------------72
HepG2 C34 Cell culture --------------------------------------------------------------------72
Cortisol Production Measurement---------------------------------------------------------72
Assessment of Cortisol Response for Gluconeogenesis and Insulin------------------73
Magnesium Recovery Analysis------------------------------------------------------------74
RNA isolation---------------------------------------------------------------------------------74
Quantitative RT-PCR of Cortisol & Insulin Responsive Genes-----------------------74
Western Blot of Cortisol & Insulin Responsive Genes---------------------------------77
STATISTICAL ANALYSIS
--------------------------------------------------------------------77
RESULTS
Increased Cortisol Production with Mg2+ Deficiency------------------------------------79
Effect of Magnesium Deficiency on Cortisol Responsive Genes; CBG & 11βHSD1-------------------------------------------------------------------------------------------79
Effect of Magnesium Deficiency on protein expression of CBG, 11β-HSD1, and
Albumin----------------------------------------------------------------------------------------79
Effect of Magnesium Deficiency on genes involved in Gluconeogenesis -----------81
Total Magnesium and potassium concentrations recovered with supplementation -83
Recovery of H6PD, CBG, PEPCK and F16BPase gene expressions with Magnesium
supplementation ------------------------------------------------------------------------------85
DISCUSSION ----------------------------------------------------------------------------------------86
CHAPTER IV:
CONCLUSIONS and FUTURE DIRECTIONS-------------------------------------------------83
xii
LIST OF TABLES
Page
TABLE I: Magnesium-regulated enzymes by cellular compartments. -------------------------------4
TABLE II: Primer sequences of the selected genes involved in key pathways of G6P utilization
in the pentose phosphate pathway.----------------------------------------------------------34
TABLE III: Inhibitory effect of exogenous magnesium addition of NADPH production --------45
TABLE IV: Primers sequences of selected genes involved in key pathways of hepatic
gluconeogenesis -------------------------------------------------------------------------------76
xiii
LIST OF FIGURES
Page
FIGURE 1: Magnesium distribution in intracellular compartments-------------------------------2
FIGURE 2: Role of Magnesium in Glycolysis------------------------------------------------------- 12
FIGURE 3: Magnesium percent content of oral supplements--------------------------------------14
FIGURE 4: Total cellular Mg2+ content and intracellular Mg2+ distribution in HepG2 cells
grown in the presence of different extracellular Mg2+ concentrations.------------37
FIGURE 5: Hexose 6 Phosphate hydrolysis in HepG2 cells---------------------------------------39
FIGURE 6A: Hexose 6 Phosphate Dehydrogenase activity in HepG2 cells. -------------------41
FIGURE 6B: Hexose 6 Phosphate Dehydrogenase activity in HepG2 cells with increasing
[Mg2+] 0. ------------------------------------------------------------------------------------43
FIGURE 7A: Effect of reducing agent (β-ME) on H6PD activity in 1.0 mM cells. ------------47
FIGURE 7B: Effect of reducing agent (β-ME) on H6PD activity in 0.6 mM cells. ------------47
FIGURE 8A: Hexose 6 Phosphate Dehydrogenase gene expression in HepG2 cells -----------49
FIGURE 8B: Hexose 6 Phosphate Dehydrogenase protein expression in HepG2 cells---------51
FIGURE 9A: Effect of MgCl2 vs. MgSO 4 on H6PD activity in 0.6mM cells. -------------------53
FIGURE 9B: Effect of MgCl2 vs. KCl on H6PD activity in 0.6mM cells. -----------------------53
FIGURE 9C: Effect of MnCl2 on H6PD activity in 0.6mM cells. ---------------------------------53
FIGURE 9D: Effect of CaCl2 on H6PD activity in 0.6mM cells. ----------------------------------54
FIGURE 10A: Hexose 6 Phosphate Dehydrogenase activity in microsomal vesicles-----------56
FIGURE 10B: Hexose 6 Phosphate Dehydrogenase protein expression in microsomal
vesicles-------------------------------------------------------------------------------------56
FIGURE 11A: Total and compartmentalized Mg2+ content in HL-60 cells------------------------58
xiv
FIGURE 11B: Hexose 6 Phosphate Dehydrogenase –coupled NADPH production in HL-60
cells. ----------------------------------------------------------------------------------------59
FIGURE 11C: Inhibitory effect of increasing concentrations of exogenous Mg2+ on NADPH
production in HL-60 cells grown in the presence of 0.6mmol/L.-------------------60
FIGURE 11D: Hexose 6 Phosphate Dehydrogenase expression in HL-60 cells grown in 0.6
or 1.0 mmol/L Mg2+.----------------------------------------------------------------------79
FIGURE 12A: Increased Cortisol Production with Mg2+ Deficiency -------------------------------79
FIGURE 12B: Effect of Magnesium Deficiency on Cortisol-responsive genes CBG and 11βHSD1---------------------------------------------------------------------------------------79
FIGURE 12C: Effect of Magnesium Deficiency on protein expression of CBG and 11βHSD1, Albumin---------------------------------------------------------------------------79
FIGURE 13: Effect of Magnesium Deficiency on genes involved in gluconeogenesis------------81
FIGURE 14A: Total intracellular Magnesium concentration recovered ----------------------------83
FIGURE 14B: Total intracellular potassium concentration recovered ------------------------------83
FIGURE 14C: Reversing the effect of Magnesium Deficiency on H6PD & CBG gene
Expressions --------------------------------------------------------------------------------85
FIGURE 14D: Reversing the effect of Magnesium Deficiency on PEPCK & F1,6BP gene
Expressions --------------------------------------------------------------------------------85
FIGURE 15: The role of thiazolidinedione’s in the regulation of hepatic glucose metabolism
correlates with the observed effects of Magnesium deficiency in HepG2 cells.----91
FIGURE 16: Proposed mechanism of the effect of Magnesium deficiency on glucose metabolism
in liver hepatocytes ------------------------------------------------------------------------93
xv
LIST OF ABBREVIATIONS
ATP – Adenosine Triphosphate
11β-HSD1 – 11β-Hydroxysteroid Dehydrogenase type 1
C – Degrees Celcius
Ca2+ - free Calcium
CBG – Corticosteroid Binding Globulin
CVD – Cardiovascular Disease
F1, 6BPase – Fructose-1, 6-bisphosphatase
FOXO1 – Forkhead box 0 1
GC – Glucocorticoids
H6PD – Hexose 6- Phosphate Dehydrogenase
K+ - Free potassium
[Mg2+] o –Extracellular magnesium
Mg2+ – Free magnesium
PEPCK – Phosphoenolpyruvate Carboxykinase
PKC – Protein Kinase C
xvi
SDS-PAGE – Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis
T2DM – Type II Diabetes Mellitus
µg – microgram
µl – microliter
µm - micromole
xvii
CHAPTER I
INTRODUCTION:
I.I
BACKGROUND AND SIGNIFICANCE OF MAGNESIUM
Minerals are an important component of our body’s biological set-up as they are essential
for the proper activity of numerous enzymes. Our body, however cannot manufacture a single
mineral and all minerals must be taken in with the food and drink consumed daily. Yet, the
changes in modern food production and processing reduce the dietary intake and absorption of
minerals including magnesium, making dietary supplement necessary.
Magnesium is considered a macro nutrient in the human body. Magnesium is
predominantly an intracellular ion distributed between the nucleus, endoplasmic or sarcoplasmic
reticulum, mitochondria and cytoplasm (1). Of the 21-28g of magnesium present in the adult
human body, 99% is localized within cells and intracellular compartments, leaving 1% in the
extracellular fluid (2). Total body magnesium is found mostly in the bones (60-65%) where it is
adsorbed to the surface of hydroxyapatite (3) and, or inside cells of the body tissues and organs
(approximately 35-40%). Only 1% of total body magnesium is found in the extracellular fluid,
thus making serum magnesium level a poor indicator of the total magnesium content and
availability in the body. Of the 1% extracellular magnesium content, about sixty percent (60%) is
free, approximately thirty-three percent (33%) is bound to proteins, and less than 7% is bound to
citrate, bicarbonate, ATP and phosphate (1). There is no simple, rapid, and accurate laboratory
test to determine total body magnesium status in humans (1, 4). Approximately 5-10% of total
intracellular magnesium is free ([Mg2+]i), the remaining being localized in various cell
compartments and bound to negatively charged ligands such as ATP, ADP, other
1
phosphonucleotides, citrate, proteins, RNA and DNA (5-7). Depending on the compartment and
cell type, free and bound magnesium ions (Mg2+) are completely or partly exchangeable (Figure
1).
Figure 1: Magnesium distribution in intracellular compartments in the hepatocyte
2
Intracellular free and bound Mg2+ contents in the cytoplasm and cellular compartments
are dynamic pools. An equilibrium between the intracellular Mg2+ pools is maintained via net
Mg2+ influx or net Mg2+ efflux across the plasma membrane (5). The different cellular
compartments (i.e. nucleus, mitochondria, rough endoplasmic reticulum, sarcoplasmic reticulum
and cytoplasm), show different sensitivities to Mg2+ depletion and replenishment possibly due to
the modalities of Mg2+ transport in-and-out of the various cellular compartments, the nature of
the ligands present therein, and/or to the differences in Mg2+ dependency of the various
metabolic functions located within the compartments.
Normal Mg2+ intake is approximately 12-15 mmol/L per day. Approximately one-third of
the orally taken Mg2+ is absorbed by the small intestines (5). Approximately one-third of the
circulating Mg2+ is bound to albumin thus leaving free Mg2+ in the serum to 0.7-0.8mmol/L (5).
The kidneys contribute to whole body magnesium homeostasis by reabsorbing approximately
95% of the Mg2+ filtered by the glomerulus: 25-30% of the reabsorption occurs in the proximal
tubules, 50-60% in the ascending limb of Henle’s loop, and 2-5% in the distal convolute tubule
(5, 8).
Due to its high charge density, intracellular Mg2+ exists predominantly in its bound form.
The intracellular distribution of Mg2+ between free and bound forms regulates the activity of
many Mg2+ activated enzymes (Table 1) involved in protein synthesis, ion transport, glycolysis,
muscle contraction, and mitochondrial respiration (5).
3
Compartments
Enzymes
Plasma / Cell Membrane
Adenylyl Cyclase, Aquaphorin 3, ATPase, Ca2+ channels, K+
channels, PKCε,
G- proteins, 5’-Nucleotidase, PKCε, ERK1/2, Glycogen
Cytoplasm
phosphorylase, Phosphorylase Kinase, Phosphogluco-mutase,
AcetylCoA Synthetase, RNase, Cyclin D, Cyclin E.
Endoplasmic Reticulum
Phosphorylase Kinase, Glucose 6-Phosphatase, cADPR-induced
Ca2+ release, IP3-induced Ca2+ release, SERCA pump.
Mitochondria
AcetylCoA Synthetase, α-ketoglutarate Dehydrogenase, Isocitrate
Dehydrogenase carrier, F0.F1 mitochondrial ATP synthase.
Nucleus
ERK1/2, Glycogen Phosphorylase, RNase, Cyclin D, Cyclin E
Table 1: Magnesium-regulated Enzymes by Compartments
4
All tissue and internal fluids contain varying quantities of magnesium. Magnesium is an
important constituent of bones, teeth, soft tissue, muscle, blood, and nerve cells. Magnesium in
the bone is readily exchangeable with serum and therefore represents a moderately accessible
magnesium store which can be drawn on in times of deficiency. However, the proportion of
exchangeable magnesium in bones declines significantly with aging (9). This decline does not
reflect in the plasma of these individuals, indicating that the fall in bone magnesium results from
the reduction in size of the hydroxyapatite surface-bound magnesium pool which becomes
smaller in older compared to younger animals due to a change in bone crystal size with age (10).
Robinson and Watson have also shown that newly formed bone has a smaller crystal size, larger
surface area, and probably larger hydration shell than older bones (10).
The tolerable upper limit of daily magnesium intake has been set by the National Academy
of Sciences at 350 mg per day for individuals in the age group of 9 years and older. However,
this limit was restricted to magnesium obtained from dietary supplements, whereas no upper
limit was set for uptake of magnesium from food sources (3). The daily value (D.V.) for
magnesium according to the Food and Drug Administration (FDA) is 400mg (4).
Several lines of evidence suggest that in the last 35 years the actual magnesium content in
the western diet has decreased by 35-40% (11-13), raising the thought that a large section of the
population may actually be magnesium deficient to some extent (11). The problem is
multifaceted in that, under Mg2+ deficient conditions, the Mg2+ -dependent processes with the
lowest affinity to Mg2+ are the first to be reduced, and if these processes are rate limiting steps,
all the subsequent metabolic or cellular processes become limited by default (7, 14).
1.2. MAGNESIUM HOMEOSTASIS AND TRANSPORT
5
As mentioned previously, cellular Mg2+ is more or less evenly distributed among cellular
compartments (Figure 1). In addition, the cytoplasm represents a dynamic “go-in-between”
compartment that contributes to cellular Mg2+ distribution within cellular compartments. The fact
that cytoplasmic Mg2+ is below its electrochemical equilibrium (15) suggest that specialized
Mg2+ transport systems must operate at the level of the cell membrane as well as in the
membrane of cellular compartments. Romani et al., reported that mammalian cells including
hepatocytes and cardiac myocytes can take up Mg2+ from media containing low [Mg2+] and high
[Ca2+] when protein kinase C is activated by carbachol or other agonist (16, 17). Overall, these
observations imply that high affinity Mg2+ transporters are present in eukaryotic cells and subject
to regulation by ATP, second messengers and hormones (18).
1.3 TRANSPORT MECHANISMS OF MAGNESIUM.
Apically, specific and saturable Mg2+ accumulation mechanisms have been observed in
brush border cells of the ileum (19), duodenum and jejunum (20, 21). Although not fully
characterized, these entry mechanisms are consistent with the operation of TRPM7, the channel
most commonly associated with Mg2+ entry (22). The total cellular Mg2+ concentration of 15-20
mM (23-25) and cytoplasmic free Mg2+ concentration of ~0.5 to 1.0 mM (23-25) suggest that as
Mg2+ enters the cell, it is rapidly buffered by ATP, phosphonucleotides, and proteins.
Cytoplasmic proteins are hypothesized to bind Mg2+ and contribute to its buffering within this
cellular compartment and transport it to the basolateral side for dismissal into the circulation.
Once at the basolateral domain of intestinal cells, Mg2+ is extruded into the blood stream through
a Na+ -dependent Mg2+ extrusion mechanism termed Na+/Mg2+ exchanger (26, 27). Under
conditions in which a less than optimal concentration of extracellular Na+ is available, Mg2+ is
extruded from the cell into the blood stream through the operation of a subsidiary, and not fully
6
characterized Na+ -independent Mg2+ extrusion mechanism (28), which utilizes both anions and
cations to promote Mg2+ transport (29).
A significant amount of information is available about Mg2+ as a nutrient and its role as a
natural activator or co-enzyme for a wide range of enzymes. More than 300 enzymes in the body
that require magnesium to function, makes the roles of magnesium quite diverse (3). These
enzymes include those involved in cellular metabolism and cell cycle as well as those using
Mg2+ as a cofactor including ATPases and adenyl cyclase (1). Mg2+ is required either as a
structural component (i.e. binding at specific sites on enzymes that function as magnesiumprotein complexes) or as an active site component of many enzymes, which constitutes the most
common method of activation. In some cases magnesium can act both ways in the same enzyme
(7). Magnesium has a particular function in all reactions requiring ATP, including
phosphorylation or involving phosphonucleotides such as GTP. The active structure of ATP (and
other trinucleotides) favors the formation of a complex with magnesium (5). This implies that
Mg2+ is an essential element in virtually all the major biological processes: DNA and RNA
synthesis; protein synthesis; nerve conduction; muscle contraction; membrane transport; cell
division; and oxidative phosphorylation (5).
1.4. LIVER AND GLUCOSE METABOLISM
The liver is comprised of six different main cell types, namely:hepatocytes, kupffer cells,
biliary epithelial cells, stellate cells, sinusoid endothelial cells, and pit cells (30, 31). Most of the
clinically quantifiable liver functions such as metabolic processes and protein synthesis take
place within the hepatocytes (80% of the liver), while non-hepatocyte cells are responsible for
other functions such as inflammatory response and orientation(30, 32-34). Hepatocytes
7
dynamically transport Mg2+ in concomitance with glucose transport (35) both processes being
activated upon exogenous addition or endogenous release (36) of glucagon or catecholamines.
Conditions that limit the amplitude of Mg2+ extrusion decrease the amount of glucose output
from liver cells and vice versa (37). This is further supported by several pieces of observation
(37). Overnight starvation, which depletes the liver of its glycogen content, decreases total
hepatic Mg2+ content by 10-15% (38) rendering liver cells unresponsive to any subsequent
adrenergic stimulation (38). Both type-1 and type-2 diabetes present with a marked decrease in
hepatic Mg2+ content (39). Treatment with the anti-diabetic drug metformin (which operates
predominantly on liver metabolism), and improves hepatic glucose utilization, increases intrahepatic Mg2+ content (40).
The functional association between Mg2+ and glucose is also observed for Mg2+
accumulation. Insulin, one of the hormones involved in Mg2+ accumulation, is also responsible
for glucose accumulation and conversion to glycogen (38). Following insulin administration,
Mg2+ accumulation is directly proportional to the amount of glucose present in the system (41).
Conversely, decreasing Mg2+ content in the extracellular system diminishes the accumulation of
glucose within the cells (37, 41).
Compared to the muscles, the liver plays a systematically more important role in the
controlling of glucose homeostasis (42). Alterations observed in hepatic glucose metabolism in
type II diabetes include increased post-absorptive glucose production and impaired suppression
of glucose production coupled with diminished glucose uptake following carbohydrate ingestion
(42). The hepatic glucose over production further stimulates insulin secretion by the pancreatic
beta cells, while the increased hepatic fatty acid synthesis enhances peripheral insulin resistance
(42).
8
1.5. MAGNESIUM DISTRIBUTION AND PHYSIOLOGY IN MEMBRANES &
ORGANELLES
Membranes
The various cellular membranes consist of phospholipids and proteins with a different protein:
phospholipid ratio (7). Based upon the local enrichment of Mg2+ ions, the specific distribution of
phospholipids and proteins within the various biological membranes is also different. Mg2+ is
bound to negatively charged groups and the binding is stronger to the more negatively charged
phosphatidyl serine (PS) than to other phospholipids (PL) (7).
Mitochondria and Sarco / Endoplasmic Reticulum:
Total Mg2+ content in sarcoplasmic reticulum is higher than cytoplasm (7). Mitochondrial and
total cellular [Mg2+] may be altered rapidly and reversibly in response to hormone signals (23,
43, 44). Over 90% of mitochondrial ATP appears to be bound to Mg2+ (45). Both cytosol and
matrix [Mg2+] range between 0.5 and 1 mmol/L in most cells with little concentration gradient
existing between the two compartments across the organelle membrane. These levels of Mg2+ are
in the appropriate range to regulate many enzymes and transporters both in the cytoplasm and the
mitochondria.
To state that matrix [Mg2+] regulates matrix enzymes or membrane components on the
matrix side of the inner mitochondrial membrane, one must show that the reactions or
processes are sensitive to [Mg2+], that [Mg2+] varies in agreement with the sensitive range of
the enzyme due to specific transport mechanisms, and that changes in [Mg2+] and the Mg2+sensitive process occur in a sequential and integrated way (43). Evidence for the presence
9
and function of Mg2+ in the inner mitochondrial membrane is provided by the fact that the matrix
[Mg2+] appears to equilibrate quite rapidly with the cytosolic [Mg2+]. The presence of Mrs2 a
Mg2+ - specific channel, in the inner mitochondrial membrane and its importance for complex I
activity (46, 47) provides additional support to the role of Mg2+ for the functioning of
mitochondrial dehydrogenase (48, 49).
When compared to the high total concentrations (i.e. 16-18 mM), the free [Mg2+] in the
cytoplasm and the mitochondrial matrix represents only a small fraction. This is the result of
high buffering by a variety of binding sites, which suggest that [Mg2+] would be nearly constant
in both matrix and cytosol unless total Mg2+ changed (50). Jung et al.(51) showed that
mitochondria contains 8-10 nmol Mg2+ /mg protein. This Mg2+ is tightly bound and does not
appear to contribute to matrix [Mg2+]. Mg2+ binds tightly to high affinity sites in the
membrane (52), the FoF1 ATPase (53), and the cytochrome oxidase (54). Partial uncoupling of
oxidative phosphorylation during Mg2+ deficiency had been indicated in several metabolic
studies (55-57). Any disturbance in energy metabolism within the mitochondria can be explained
by the reduced protein synthesis and other changes in mitochondrial substrate utilization that
occur with magnesium deficiency.
Rutter (58) pointed out that matrix [Mg2+] in the 1 mmol/L range can be expected
to decrease the inhibition of pyrophosphatase by [Ca2+]. The K0.5 for inhibition increases
from less than 1 mM to 10 mM [Ca2+] in the presence of l mM [Mg2+]. Matrix [Mg2+]
near 1 mM has also been shown to prevent activation of NAD+-isocitrate dehydrogenase at
[Ca2+] levels that affect the pyruvate dehydrogenase complex and alpha-ketoglutarate
dehydrogenase. At the same time, the presence of [Ca2+] brings the K0.5 for activation of
isolated pyruvate dehydrogenase phosphatase down to the 1 mM range for Mg2+ (58).
10
Although several experiments show that [Mg2+] plays a major role in the regulation of
cellular and mitochondrial reactions, evidence that it functions as a primary on/off signal,
as does [Ca2+], is still unavailable. Although [Mg2+] cannot be shown to function in such a
role, it seems likely that it may act as a static or chronic regulator of cellular and
mitochondrial function, establishing the "set point" of many Mg2+-dependent reactions (51).
Nutrient availability is sensed by highly conserved signaling cascades such as protein
kinase A (PKA) and AMP-activated kinase (AMPK) which have widespread roles to adjust
cellular physiology to nutrient supply, especially during development and survival (59). For
example a defective glucose sensing in pancreatic beta-cells leads to impaired insulin secretion
and consequently the development of diabetes. Consequently, cellular metabolism regulation by
signaling network should be considered as part of a highly interconnected cellular network
linking nutrient availability, cellular metabolism, and signaling (59). Because of its role in
regulating various enzymes in these metabolic and signaling processes, discussed previously,
maintenance of proper cellular Mg2+ homeostasis is essential for these processes to occur in a
regulated and comprehensive fashion.
1.6. MAGNESIUM IN CELLULAR METABOLISM
As mentioned previously, numerous cellular functions are controlled by Mg2+. In the case
of the hepatocyte, magnesium homeostasis and transport are closely related to glucose transport
and utilization (60). Of the 10 enzymes involved in the catabolism of glucose or glycogen to
pyruvate by the glycolytic pathway, seven are activated by magnesium (Figure 2), including
phosphofructokinase and pyruvate kinase, which are the two main regulatory points in the
pathway (7).
11
Figure 2: Role of Magnesium in Glycolysis
12
1.7. BIOAVAILABILITY OF MAGNESIUM:
Bioavailability refers to the amount of magnesium in food, medications and supplements that is
absorbed in the intestines and ultimately available for biological activity in cells and tissues.
Enteric coating of a magnesium compound can reduce bioavailability. Both the content of a
magnesium dietary supplement (i.e. the amount of elemental magnesium in a compound) and its
bioavailability, influence the effectiveness of a magnesium supplement towards restoring
deficient levels of magnesium. Results from a previous study (Fig. 3) comparing seven forms of
magnesium preparations, suggested that Mg2+ supplements vary widely in Mg2+ content and
found magnesium in the aspartate, citrate, lactate, and chloride forms to be more completely
absorbed and more bioavailable than magnesium oxide (4), meanwhile, the bioavailability of
magnesium oxide with highest magnesium content according to the study cited above, was
indicated in another study to have relatively poor bioavailability compared to magnesium
chloride, magnesium lactate and magnesium aspartate with significantly higher and equivalent
bioavailability (61).
13
Figure 3: Magnesium percent content of oral supplements
Reproduced with permission
14
1.8. MAGNESIUM STABILITY IN PROCESSED AND UNPROCESSED FOODS:
Common food sources for magnesium includes raw nuts, soy beans, spinach, tomatoes, halibut,
beans, ginger, cumin, cloves. Cooking and food processing can affect to a varying degree the
bioavailability of magnesium from the different food sources. For example in foods where the
greater percent of magnesium is found in water soluble form (e.g. spinach), steaming or boiling
of these foods can result in a substantial loss of magnesium. In contrast, roasting and other forms
of processing utilized in the preparation of other magnesium-rich foods (e.g. peanuts and
almonds), leads to very little loss of magnesium (3).
1.9. HEPATIC GLUCONEOGENESIS
Gluconeogenesis is the process of glucose synthesis from non-carbohydrate precursors and
involves four key enzymes that catalyze thermodynamically irreversible reactions: pyruvate
carboxylase (PC, EC 6.4.1.1), phosphoenol pyruvate carboxykinase (PEPCK, EC 4.4.4.32),
fructose1, 6-bisphosphatase (FBPase, EC 3.1.3.11), and glucose 6-phosphatase (G6Pase, EC
3.1.3.9).
During short-term fasting, approximately 50% of the glucose produced in the liver originates
from gluconeogenesis while the other 50% comes from glycogenolysis. Long-term production of
glucose by the liver, instead it’s almost entirely accomplished via gluconeogenesis, (i.e.
production of glucose from non-carbohydrate precursors) (62). The principal precursors are
lactate, glycerol, and the gluconeogenic amino acids serine, threonine, alanine, glycine,
glutamine and glutamate. The precise substrate used by the gluconeogenic pathway varies in a
complex fashion with the hormonal and dietary status of the animal or the individual (62). A
certain percentage of gluconeogenic activities occurs directly as a result of substrate delivery to
15
the liver, and can be viewed as constitutive gluconeogenesis because it’s not directly regulated
by hormones (e.g. insulin) (62). The conditions in favoring gluconeogenesis (the combination of
high plasma glucagon, catecholamine, and glucocorticoid levels with a low plasma insulin level)
result in increased activity of PEPCK, fructose-1, 6-biphosphatase and glucose-6-phosphatase
(G6Pase) with a coordinate decrease in pyruvate kinase, 6-phosphofructo-1-kinase, and
glucokinase (62). The relative activity of the glycolytic enzymes, established by interaction of
several hormones, determines whether the hepatocyte is a consumer or producer of glucose (62).
Magnesium is also required in the gluconeogenic pathway, particularly by the fructose
bis-phosphatase and pyruvate carboxylase, which are the anabolic regulatory equivalent of the
catabolic enzymes (7). Furthermore, in the oxidation of pyruvate by the tricarboxylic acid cycle,
magnesium activates four of the enzymes involved, including pyruvate dehydrogenase and
isocitrate dehydrogenase which are the two main regulatory enzymes in the cycle (7). It has to be
noted that the tricarboxylic acid cycle is at the very center of cellular metabolism in all aerobic
organisms, being involved in the metabolism of protein and lipid as well as carbohydrate (7).
Relative to other enzymes in the gluconeogenic pathway, the four key enzymes mentioned
above have lower activities and therefore are considered to be rate limiting for glucose synthesis
(63). Magnesium is required in three of these enzymatic reactions, namely in pyruvate
carboxylase, phosphoenol pyruvate carboxykinase and fructose 1, 6-bisphosphate reactions (63).
Although a decrease in the activities of these enzymes may occur in magnesium deficiency, due
to the lack of Mg2+ at the enzyme site, a number of hormones influence the activities of these key
gluconeogenic enzymes including glucocorticoids, epinephrine, glucagon, and insulin.
Magnesium plays a role in the secretion of all four of these hormones (63). Hence, in Mg2+
deficiency, enzyme activities may change as a result of altered circulating levels of one or more
16
of these hormones. Discrepancy in previously reported findings about the effective impact of
Mg2+ deficiency in the process (63) may be due to duration of magnesium deficient diet, stress
induced by sacrificing the animals, and variables inherent in magnesium absorption or excretion.
For example, several studies have associated magnesium deficiency with increased PEPCK
activity, decreased insulin:glucagon ration, inhibited insulin release by the pancreatic beta cells
following omission of magnesium from the medium perfusing the rat pancreas and a nonsignificant increase in glucagon from rat pancreas pieces (63). Furthermore hypomagnesaemia
has been reported in both prediabetic and diabetic human and animal in vivo studies, implying
that the effect of magnesium deficiency on gluconeogenic enzymes may be important in the
onset of insulin resistance (64, 65). A significant amount of gluconeogenesis still occurs even in
the presence of elevated blood glucose levels and hyperinsulinemia does not completely inhibit
net gluconeogenic flux especially when associated with hepatic magnesium deficiency (66).
Hepatic gluconeogenesis during the postprandial state has important implications for converting
gluconeogenic precursors such as lactate, fructose, and amino acids delivered from the
gastrointestinal tract and other tissues, into glucose that can be released as much into the
bloodstream or stored into the liver as glycogen. Gluconeogenesis is essential for hepatic
glycogen synthesis. Insulin increases glycogen synthase (GS) activity through the activation of
protein kinase B (Akt), which subsequently leads to phosphorylation and deactivation of
glycogen synthase kinase-3. The phosphorylation of GS by glycogen synthase kinase 3 at a
cluster of COOH-terminal serine residues inhibits GS enzymatic activity. Conversely, glucose-6phosphate plays a key role in regulating GS activity and is able to negate the inactivation of GS
due to phosphorylation and fully restore enzymatic activity (66). The increase in hepatic glucose6-phosphate concentration leading to an elevation in glycogen synthesis has been observed in
17
prolonged (72 h) fasted mice. The effects of insulin action lead to suppression (~ 60%) of
glucose release and storage of glucose as glycogen (66). Reports from previous studies have
suggested that the gluconeogenic pathway accounted for 50% - 70% of newly synthesized
glycogen. The same results have been confirmed from studies done in rats, mouse, dog and
human (66).
Glucose homeostasis depends on the ability of the skeletal muscles and adipocytes to
respond to insulin by accumulating glucose excess from the blood stream and the utilization of
circulating glucose by the brain for energetic purposes (67). As glycemia decreases upon
consumption, an integrated neuronal response that uses the sympathetic system as efferent
branch promotes the release of catecholamine and glucagon to restore euglycemia. The liver
plays a central role in glucose homeostasis, utilizing or producing glucose according to feeding
and fasting episodes and hormonal stimuli. In the post-absorptive or fasting states, the liver
produces glucose (67). The last step of glucose production from either glycogenolysis or
gluconeogenesis, is the hydrolysis of glucose 6-phosphate to glucose, which is then released into
the blood through GLUT2. In the absorptive state, when plasma glucose and insulin levels rise,
the liver stores glucose in the form of glycogen or metabolizes it into lipids. Endogenous glucose
production is stopped by the inhibitory effect of insulin on gluconeogenic enzymes (67).
1.10. OTHER FUNCTIONS OF MAGNESIUM:
Mg2+ is important in the synthesis of Adenosine Triphosphate (ATP) in the mitochondria,
necessary for calcium and vitamin C metabolism, conversion of blood sugars into energy,
regulation of cardiac activity, dilation of coronary arteries, maintenance of normal heart rhythm,
bone formation and strengthening of tooth enamel, fat burning, prevention of vascular
calcifications, and kidney and gall stones formation. Magnesium is an important cofactor for
18
potassium and calcium channels and therefore plays a role in regulating action potentials as well
as calcium signaling in a wide range of tissues (68). Magnesium is involved in the metabolism
of proteins, carbohydrates and fats. By regulating specific endonuclease, Mg2+ favors proper
gene function. It has a structural function in cellular cytoskeleton, proteins and membranes (5).
Due to magnesium’s wide variety of roles in the body, the symptoms of magnesium
deficiency can also vary widely. Some symptoms of magnesium deficiency include; imbalanced
blood sugar levels, elevated blood pressure, elevated fats in the blood stream, arrhythmia,
calcium depletion, heart spasms, irregular contraction, increased heart rate, nervousness,
muscular excitability, confusion and kidney stones (3).
1.11. MAGNESIUM DEFICIENCY:
Mg2+ deficiency is usually detected because of a resultant hypomagnesaemia. However, it may
also be revealed by the development of clinical symptoms or associated processes such as
hypokalaemia or hypocalcaemia (69). Calcium competes with magnesium for uptake in the loop
of Henle, and an increase in filtered calcium load can impair magnesium reabsorption (70). Also,
hypokalaemia is commonly observed in patients with hypomagnesemia, partly because the
underlying pathology can produce both these ionic disturbances and partly because
hypomagnesemia can lead to increased renal potassium wasting (68).
Patients with abnormalities of magnesium homeostasis typically fall into 1 of 3 groups:
1- Patients with magnesium deficiency (low total body magnesium content) and a resultant
hypomagnesaemia (i.e. low serum magnesium concentration).
19
2- Patients with hypomagnesaemia (low serum magnesium concentration) in the absence of
magnesium deficiency (i.e. normal total body magnesium content)
3- Patients with magnesium deficiency (low total body magnesium content) but no evidence of
hypomagnesemia (i.e. normal serum magnesium concentration).
Because of this possible disconnect between tissue magnesium deficiency and
hypomagnesemia, total serum Mg2+ level cannot be used as a reliable indicator of Mg2+ content
and homeostasis within tissues.
1.12 CAUSES OF MAGNESIUM DEFICIENCY:
Problems in the digestive tract are the most common cause of magnesium deficiency. These
include chronic malabsorption, diarrhea, and ulcerative cholitis. Additional causes of Mg2+
deficiency include poor dietary intake, physical trauma, surgery, kidney disease and alcoholism.
Some medicines (e.g. diuretics, proton pump inhibitors and some anti-neoplastic agents) promote
urinary Mg2+ loss or impair intestinal magnesium absorption, thus resulting in Mg2+ deficiency in
these patients (68).
20
1.13. MAGNESIUM DEFICIENCY AND METABOLIC DISEASES:
Hypomagnesaemia and cellular magnesium depletion may represent the most frequently
unrecognized electrolyte abnormality in clinical practice today (71), with as much as 85-90
percent shortfall in clinical recognition of abnormal serum magnesium. Because of this
limitation, the role of Mg2+ in cellular function, both in health and disease, remains largely
unknown to clinicians (5).
Hypomagnesemia and chronically low Mg2+ levels have been associated with diabetes (70) and
metabolic syndrome (72). Ionized Mg2+, and total Mg2+ are decreased extracellularly and
intracellularly under both conditions (73). Despite the importance of proper Mg2+ levels for
numerous systemic physiologic functions the cause-effect mechanism of Mg2+ loss under
diabetic conditions or under metabolic syndrome has not been studied in detail nor the possible
implication of Mg2+ loss in the development of diabetes-related complications has received due
consideration.
Studies utilizing routine laboratory determination of serum Mg2+ (74) in hospitalized patients
have indicated electrolyte abnormalities associated with clinical hypomagnesemia including
hypokalaemia (42%), hyponatraemia (27%), hypophosphatemia (29%) and hypocalcaemia
(22%).
Magnesium is essential in the mechanism of glucose transport across cell membranes in
addition to playing an important role in carbohydrate metabolism. Insulin promotes Mg2+ uptake
by the cells (75-77). In turn, cellular Mg2+ can influence the release and activity of insulin (4). A
low blood Mg2+ level is common among individuals with type II diabetes, and high blood
glucose has been shown to cause a depletion of intracellular Mg2+ (77). The kidneys possibly
lose their ability to retain Mg2+ under severe hyperglycemic conditions (78, 79). This increased
22
loss of Mg2+ in the urine may then result in lower blood levels of magnesium (4). Magnesium
administration has been shown to increase plasma glucose uptake by promoting insulin
sensitivity.
Hypermagnesaemia can inhibit insulin secretion while enhancing insulin sensitivity by
increasing in the binding affinity of insulin for its receptors (80). In contrast, hypomagnesaemia
can increase insulin resistance but can also be a consequence of insulin resistance (4).
Correcting Mg2+ depletion in older adults may improve insulin response and action (4). In 1999
the American Diabetes Association (ADA) issued nutrition recommendation requiring routine
evaluation of blood magnesium level in diabetics at high risk for magnesium deficiency. The
ADA stated that the levels of magnesium be restored if hypomagnesaemia was observed (81).
Several clinical studies have examined the potential benefit of supplemental Mg2+ in controlling
type II diabetes (64, 82).
Accumulating evidence suggests that adequate Mg2+ intake is important in maintaining glucose
and insulin homeostasis and thus in protecting against the development of type II diabetes.
Circumstantial evidence from cross-sectional studies has shown that low dietary magnesium
intake is inversely related to glucose intolerance and/or insulin resistance (83).
Consistent results have been obtained from prospective studies on magnesium intake and
the risk of incident type II diabetes. In a study conducted by the Nurses’s Health Study (NHS)
and the Health Professionals Follow-up Study (HFS) which followed more than 170,000 health
professionals through questionnaires the participants completed every two years. The risk for
developing type II diabetes was greater in men and women with a lower magnesium intake (4,
84). Similar results were obtained by The Iowa Women’s Health Study (4, 85). The consensus,
however, is not unanimous as other studies do not support similar conclusions (4, 82, 86).
23
Because of the contrasting results, the consensus from clinical case studies and crosssectional studies is largely inconclusive in testing the hypothesis that magnesium promotes better
glycemic control. Inconsistencies in results may be confounded by aspects of diet, physical
activity, obesity, socioeconomic status and drug therapies (87). Additionally, the number of
participants, duration of study, differences in study population, duration of diabetes, glycemic
treatment, intervention periods, coupled with different doses of magnesium and formulations
have contributed to the difficulties in interpreting the potential benefits of oral magnesium
supplementation for type II diabetic patients (87).
1.14. LOW MAGNESIUM LEVELS AND ALTERED GLUCOSE METABOLISM
Like calcium, whose metabolism is hormonally regulated, several hormones are involved
in regulating Mg2+ metabolism. Catecholamines, glucagon, insulin and vasopressin are known to
affect intracellular Mg2+ distribution and transport across the hepatocyte cell membrane.
Following the work of Lostroh and Krahl who demonstrated that insulin added in vitro promotes
an accumulation of Mg2+ and potassium in uterine smooth muscle cells, insulin was proposed as
a regulatory hormone of Mg2+ balance (88). The relationship is reciprocal: Besides the prereceptorial effect of Mg2+ deficiency reported by Hwang and Dribi (89, 90) mentioned, in vitro
and in vivo studies have also provided support to the role of intracellular Mg2+ in the regulation
of insulin action, and suggested that post-receptorial defect may be responsible for the impaired
insulin-mediated transport of Mg2+ in type II diabetes patients. That is, the lower the basal Mg2+
level, the greater the amount of insulin required to metabolize the same glucose load, indicating a
decreased in insulin sensitivity (91). This includes the work of Suarez et al, that depended at least
in part Mg2+ depletion induced a severe insulin resistance that was shown to be dependent, at
least in part, upon a defective tyrosine kinase activity of the insulin receptors (92). This
24
observation is in agreement with other studies, suggesting that Mg2+ depletion causes insulin
resistance (IR) and decreased insulin secretion (2). Several in vivo and in vitro data have
supported and confirmed a role for insulin on Mg transport (39). While epidemiological studies
have reported an inverse relationship between cellular Mg2+ content and serum and ionized Mg2+
and type II diabetes mellitus (73, 82, 93-96) other studies, suggesting that Mg2+ depletion causes
insulin resistance (IR) and decreased insulin secretion (2). The implication of Mg2+ deficiency in
the development of type II diabetes has been supported by other studies conducted by
administering Mg2+ supplements, for example the Nurses’ Health Study which showed an
increased Mg intake to be associated with a significant decline in the incidence of NIDDM (97).
In addition, large epidemiological studies in adults have indicated that lower dietary Mg2+ levels
are associated with an increased risk for type 2 diabetes mellitus. Meanwhile, the study by Nagai
conducted on OLETF rats (2), showed that under conditions of excessive food intake and Mg2+
supplementation, the inhibition of insulin resistance by Mg2+ may cause insulin secretion and
excessive production of TG, resulting in obesity. Studies performed on 98 healthy non-diabetic
subjects, have shown relatively low plasma Mg2+ concentrations have a relatively modest but
significant effect on insulin-mediated glucose disposal, with lower plasma Mg2+ concentrations
being associated with increased insulin resistance (98). In this study, the 24-hour urinary
excretion of Mg2+ was significantly lower in study subjects with the lowest plasma Mg2+
concentration, suggesting that the decrease in plasma Mg2+ was secondary to a decrease in the
dietary intake of Mg2+ and not secondary to renal loss. This correlation of Mg2+ deficiency to
insulin resistance has been shown to be independent of the race studied (99) supporting the
concept of the pathophysiological relationship between insulin resistance and poor intracellular
Mg2+ content.
25
Even though Mg2+ has received considerable attention for its potential in improving insulin
sensitivity and preventing diabetes, the results among different studies are inconsistent, possibly
due to differences in the population studied but also to measurements (65). In the past 3 decades
there has been an increase in the number of biochemical assays for magnesium that are available
for diagnostic purposes. However, each of them has limitations for use in clinical laboratories,
ranging from technical difficulty to tedious, not automated, inaccurate, not reproducible,
presenting interferences by drug or bilirubin, expensive equipment requirement or instability of
reagents (100). In addition, Mg absorption depends on a great number of variables including
dietary Mg2+ content, and is hindered by an excess of fat (101).
Due to these many variables involved in Mg2+ metabolism, coupled with the challenges in
properly assessing changes in cellular Mg2+ content and its effects on various biochemical
functions evaluation of Mg2+ in metabolic syndrome, diabetes or other diseases is mostly done
indirectly via Mg2+ supplementation. In fact, clinical symptoms, where present, are not specific,
which further contributes to the difficulty diagnosing Mg2+ deficiency.
26
CHAPTER 2
REDUCED CELLULAR MAGNESIUM CONTENT ENHANCES HEXOSE-6-PHOSPHATE
DEHYDROGENASE ACTIVITY AND EXPRESSION IN HEPG2 AND HL-60 CELLS.
Magnesium is abundantly present within cellular compartments in the hepatocyte. Limited
information is available about the role of Mg2+ in regulating specific enzymes therein.
Recently, Dr. Romani’s laboratory has provided evidence that Mg2+ regulates the entry of
glucose 6- phosphate (G6P) in the endoplasmic reticulum of liver cells (102, 103). This entry is
the limiting step for the utilization of G6P by glucose -6-phosphatase (G6Pase) the final event in
the gluconeogenic process.
Utilization of G6P by the G6Pase is one of the destinies of G6P within the ER. The other
destiny involves its oxidation by the hexose 6-phosphate dehydrogenase (H6PD), the reticular
variant of the cytosolic glucose 6-phosphate dehydrogenase (G6PD). The low Km value of
H6PD (1.5±0.19 µM) for G6P compared to that of G6PD (approx. 2 mM) suggest that H6PD is
catalytically active even in the presence of the competing glucose -6-phosphatase (104).
H6PD is the main NADPH generating enzyme in the lumen of the hepatic endoplasmic
reticulum (105, 106). It catalyzes the first two reactions leading to the oxidation of G6P to 6phosphogluonolactone (104). H6PD has a role in regulating the redox state of the endoplasmic
reticulum (ER) pool of pyridine nucleotides (107). The enzyme is located in the luminal side of
the endoplasmic reticulum where it physically interacts with 11β-hydroxysteroid dehydrogenase
type 1 (11β-HSD1) and through its reduction of oxidized nicotinamide adenine dinucleotide
phosphate (NADP+), generates NADPH required for the NADPH-dependent 11β-HSD1 to pre-
27
receptorially activate the conversion of inactive cortisone to active cortisol (105). H6PD in
addition to liver is present in human adipose tissue and neutrophils (107).
H6PD differs from G6PD in that it utilizes other hexose-6-phosphates besides glucose-6phosphate (105). It is regarded as an ancillary enzyme in the pre-receptorial glucocorticoid
activation and probably acts as a nutrient sensor and as a pro-survival factor. The ER membrane
is impermeable to pyridine nucleotides, thus H6PD in the ER utilizes NADP+ produced by
luminal reductase (108). H6PD activity has been determined in human liver, neutrophils and
adipose tissue, and a variety of rat tissues by mRNA and protein levels, and by measuring its
dehydrogenase and lactonase activity (105, 106). Positive correlations were found between the
dehydrogenase activity and protein or mRNA levels (105). G6P substrate supply for H6PD is
ensured by the ER membrane protein, the glucose-6-phosphate transporter (G6PT).
Previous work in our lab has shown that G6P transport and hydrolysis by G6Pase increases
under Mg2+ - deficient conditions. Thus in the present study we tested the hypothesis that under
these conditions oxidation of G6P by H6PD is also increased. This metabolic process will be
important for generation of high levels of reticular NADPH to be utilized for fatty acid synthesis,
cholesterol synthesis and other reticular metabolic functions.
28
Materials and Methods:
Materials: HepG2 cells were a kind gift from Dr. Cederbaum (Mt. Sinai Hospital, New York).
Human promyelocytic leukemia HL-60 cells were a kind gift of Dr. Dubyak (Case Western
Reserve University, Cleveland). 3H-2-deoxyglucose was from Amersham (GE, Pittsburgh, PA).
Culture medium and bovine calf serum were from Gibco (Life Science, Grand Island, NY). All
other reagents were of analytical grade (Sigma, St Louis, MO).
Methods
Cell Cultures: HepG2 cells were maintained in MEM medium (M2279, Sigma) containing 0.8
mmol/L MgSO4 and 5.5 mmol/L glucose in the presence of 5% CO 2 until 85% confluent. HL60 cells were maintained in RPMI-1640 medium (Gibco) containing 0.4 mmol/L MgSO4 and 5.5
mmol/L glucose (as per vendor) in the presence of 5% CO 2 until 85% confluent. At confluence,
each cell line was divided into three groups and cultured in the presence of physiological (0.8
mmol/L) [Mg2+]o or under Mg2+ deficient conditions (0.4, and 0.2 mmol/L [Mg2+]o). The
presence of 10% bovine calf serum (BCS) increased extracellular Mg2+ content to 1, 0.6, and
0.4mmol/L, respectively (measured by atomic absorbance spectrophotometry). Hence, for the
remainder of this study the cells will be identified by these adjusted Mg2+concentrations.
Both HepG2 and HL-60 cells were cultured until 85% confluent (~5-6 days) in the presence of
1.0, 0.6 or 0.4 mmol/L [Mg2+]o. Cells were then harvested by trypsin digestion (2 min at 37oC).
Trypsin was neutralized by addition of medium containing BCS and the appropriate amount of
[Mg2+]o. Cells were sedimented at 800 rpm x 2 min, and washed twice in BCS/Mg2+ -medium to
remove dead cells and debris. After the second sedimentation cells were used to measure Mg2+
content and the activity of reticular hexose 6-phosphate dehydrogenase (H6PD).
29
Cellular Mg2+content: To measure total cellular Mg2+content, normal or Mg2+ deficient HepG2
and HL-60 cells were harvested at confluence, washed in PBS and sedimented again (500 rpm x
1 min) in microfuge tubes. The supernatants were removed and the cell pellets dissolved in 10%
HNO 3 . The acid mixture was sonicated for 10 min in a sonicating bath at room temperature, and
acid-digested overnight at 40C. The following morning, the acid mixtures were sonicated again,
vortexed, and sedimented (5000 rpm x 3 min) in microfuge tubes. The supernatants were
removed and assessed for Mg2+ content in a Varian 210 atomic absorbance spectrophotometer
(AAS) calibrated with Mg2+ standards.
To measure intracellular Mg2+ distribution, HepG2 and HL-60 cells were harvested and
washed as described above. The cell pellets were then resuspended in a cytosol-like, Mg2+ free
medium containing (mmol/L) 100 KCl, 20 MOPS, 20 NaCl, 1 KH2PO4, pH 7.2 (8), prewarmed
at 370C, at the final concentration of 0.5 mg protein/ml. Digitonin (50 µg/ml), FCCP (2 µg/ml),
and A23187 (1 µg/ml) were sequentially added to the cell mixture at 5 min intervals to measure
cytoplasmic, mitochondrial, and post mitochondrial Mg2+ content, respectively (109).
Aliquots of the cell mixture were withdrawn in duplicate prior to the addition of any of these
agents, and sedimented in microfuge tubes (5000 rpm x 3 min). The supernatants were removed
and assessed for Mg2+ content by AAS. The pellets were digested in 10% HNO 3 and assessed
for Mg2+ content as reported above. Although indirect, this approach has been successfully used
in our laboratory, with results equivalent to those reported by others with different techniques
(109).
Animals on Mg2+Deficient Diet: Male Sprague–Dawley rats (230–250 g body weight) were
maintained for 2 weeks on a Mg2+-deficient diet (Dyets, Bethlehem, PA) containing 380 mg
Mg2+ per kg of pellet food whereas pared-age control rats received a ‘normal’ Mg2+ diet
30
containing 507 mg Mg2+ per kg of pellet food (109). All other minerals in the diet were at the
same concentration. After 2 weeks, control and Mg2+ deficient rats were euthanized by i.p.
administration of saturated sodium pentobarbital solution (60 mg/ml). The rat’s abdomen was
opened and the liver excised for microsomal vesicle isolation. This and the subsequent protocol
were in agreement with the NIH directives for the use and maintenance of experimental animals.
The protocols were approved by the Institutional Animal Care and Utilization Committee
(IACUC) at Case Western Reserve University.
Liver Microsomes Purification: The liver was rapidly rinsed in 250 mmol/L ice-cold sucrose,
blotted on absorbing paper, and weighted. Microsomes were isolated according to the procedure
of Henne and Soling (109), modified as follows. Livers were homogenized (10% w/v) in
(mmol/L): 250 sucrose, 20 K-HEPES (pH 7.2) in a Thomas C potter by 4 passes with a tight
fitting Teflon pestle. Homogenate was sequentially centrifuged in a JA-20 Beckman rotor at
2,500g x 10 min to remove nuclei and cellular debris, and at 10,000g x 10 min to remove
mitochondria. The post-mitochondria supernatant was sedimented at 80,000g x 45 min in a Ti 90
Beckman rotor. The glycogen pellet was discarded. The microsomal pellet was washed once
with cytosol-like, Mg2+ free medium (incubation medium) previously described, and centrifuged
at 80,000g x 45 min. The final pellet was resuspended in the described incubation medium at a
concentration of 15 mg/ml, and stored in liquid nitrogen until used.
Mg2+ determination in Total Liver and in Microsomes: After explant, 0.5 g of liver tissue were
homogenized in 250 mmol/L sucrose (10% w/v) in a Thomas C potter by 4 passes with a
tightfitting Teflon pestle, acidified by addition of HNO 3 (10% final concentration and digested
overnight at 40C. For the microsomes, after isolation, aliquots of microsomal vesicles (0.5 mg
protein) were digested overnight in 10% HNO 3 (final concentration). The next day, total liver
31
homogenate and microsomes denatured protein were sedimented (14,000 rpm x 5 min) in
microfuge tubes, and the Mg2+ content of the acid extracts assessed by AAS as previously
described (109).
Hexose 6-Phosphate Dehydrogenase Activity: Hexose 6-phosphate dehydrogenase activity was
measured as reported by Senesi et al. (109). Briefly, HepG2 and HL-60 cells at confluence were
harvested and washed as previously reported. The cells were then resuspended in the cytosollike
medium described previously, and permeabilized by the addition of 50 µg/ml digitonin.
Permeabilization was assessed by Trypan Blue exclusion test (109). Cells were resuspended at
the final protein concentration of ~10 mg/ml (~4*106 cells.ml). Aliquots of the cells were diluted
20-fold in a final volume of 2 ml cytosol-like incubation medium, and transferred to a Perkin
Elmer 3 fluorimeter (Perkin Elmer, 3) equipped with data acquisition software, with setting at
340nm excitation wavelength and 490 nm emission wavelength (109). Aliquots of microsomes
(were also diluted 20-fold in a final volume of 2 ml/ incubation medium previously indicated
(~0.5 mg protein/ml, final concentration). For all experimental samples, the reaction was started
by the addition of 1.0 mmol/L G6P, and the production of NADPH recorded for 10-15 min at
room temperature. For comparison purposes, in separate sets of experiments, NADPH
production was fluorimetrically recorded for a similar period of time at 370C, or measured in an
Agilent 8453 spectrophotometer as reported (109). Calibration was carried out by adding known
amounts of NADPH standards to aliquots of heat-inactivated permeabilized cells under similar
experimental conditions. It has to be noted that no NADP+ needed to be added to the reaction as
this pyridine nucleotide is retained within the endoplasmic reticulum of the cells (109). For the
microsomes, the vesicles were mildly permeabilized by addition of alamethicin (0.1 mg/mg
protein) as reported by Banhegyi et al. (109) in the presence of 100 µM NADP+ to guarantee an
32
appropriate level of coenzyme for the H6PD reaction and avoid unwarranted microsomes
isolation-related intrareticular (endo-microsomal) NADP+ depletion.
Hexose 6-Phosphate Dehydrogenase Gene Expression: Hexose 6-phosphate dehydrogenase
expression was assessed in HepG2 and HL-60 cells by qRT-PCR. Cells were digested in Trizol
(Life Technologies, Grand Island, NY), and mRNA extracted according to the producer
indications. Two different sets of primers (Table 4) were used. Gene expression was normalized
against β-actin and GAPDH expression, using HotStart-IT SYBR Green One-Step qRT-PCR
Master Mix Kit (Affymetrix, Santa Clara, CA).
33
Table II: Primer sequences of the selected genes involved in key pathways of G6P utilization in
the pentose phosphate pathway.
Genes
Primers (forward)
Primers (backward)
H6PD
CAACTGGGGACCTGGCTAAGAAGT
GTTGATGAGAGGCAGGCTAAGGCT
H6PD
ATGAAAGAGACCGTGGATGCTGAA
CTCCATGGCCACGAGGGTGAG
β-actin
AGAAAATCTGGCACCACACC
AGAGGCGTACAGGGATA-GCA
GAPDH
ACCATCTTCCAGGAGCGAGATC
GAGCCCCAGCCTTCTCCATGGT
The abbreviations of genes and corresponding 5’ to 3’ nucleotide sequences of the sense and
antisense primers are presented.
34
Hexose 6-Phosphate Dehydrogenase Protein Expression: The expression of reticular H6PD was
assessed by Western blot analysis. Equal amounts of microsomal protein (20 µg/lane) were
loaded onto 12% poly-acrylamide gradient gel, separated by SDS–PAGE, and transferred onto
PVDF immobilization membrane (Schleicher & Schuell Inc.). Commassie Blue and Rouge
Ponceau S staining were used to confirm equal protein loading and transfer, respectively. The
membranes were extensively washed with PBS, and the binding of primary antibodies against
H6PD (Cell Signaling, Boston, MA) was visualized using peroxidase conjugated secondary
antibodies and ECL western blotting detection reagents (Amersham). Protein expression was
evaluated by densitometry using Scion Image program (NIH), as previously reported (109).
Other Experimental Procedures: Protein content was assessed according to Lowry et al. (109),
using bovine serum albumin as a standard. Contaminant Mg2+ present in the cytosol-like
incubation buffer used for microsomes resuspension and for H6PD determination was measured
by AAS (ranging between 2 and 5 µmol/L) and subtracted accordingly.
Statistical Analysis: Data are reported as means + S.E. of at least four different preparations for
each experimental condition, each tested in duplicate. Data were analyzed by Student T- test set
at p < 0.05 for significance. For experiments evaluating multiple experimental samples, data
were first analyzed by one-way ANOVA. Multiple means were then compared by Tukey’s
multiple comparison test performed with a q value established for statistical significance of p <
0.05.
35
2.3. Results
HepG2 cells cultured in the presence of 0.6 mmol/L and 0.4 mmol/L [Mg2+] o presented ~15%
and ~35% less total cellular Mg2+, respectively, than HepG2 cells maintained in the presence of
physiological 1 mmol/L [Mg2+] o (Fig.4).
36
Figure 4: Total cellular Mg2+ content and intracellular Mg2+ distribution in HepG2 cells
grown in the presence of different extracellular Mg2+ concentrations ([Mg2+]o).
The data are means + S.E. of 4 different cell preparations, each assessed in duplicate. *Statistical
significant (p<0.05) versus the corresponding value in HepG2 cells grown in the presence of 1
mmol/L. #Statistical significant (p<0.02) versus the corresponding value in HepG2 cells grown
in the presence of 1 mmol/L. Figure 1 onset reports the time points at which Mg2+ content was
assessed and the various agents added to the cells. A typical experiment is reported.
37
Assessment of the intracellular Mg2+ distribution as reported under Materials and Methods
confirmed that Mg2+ content decreased in the cytoplasm (~34% and ~51%, respectively),
mitochondria (~12% and ~26%, respectively), and post mitochondrial pools (~24% and ~55%
respectively) in HepG2 cells grown in 0.6mmol/L and 0.4 mmol/L (Fig. 4).
We have previously reported that a decrease in cytoplasmic Mg2+ content enhances the rate
of G6P transport into the hepatic endoplasmic reticulum and its hydrolysis by glucose 6phosphatase (102, 103). These results were obtained in both freshly isolated hepatocytes (103)
and in microsomal vesicles from livers of Mg2+ deficient animals (102). Consistent with this
observation, Figure 5 shows Figure 7 above shows a similar increase in G6P transport and
hydrolysis in HepG2 cells cultured in the presence of different extracellular Mg2+ concentrations,
and permeabilized with digitonin as previously reported (103). Overall, these data confirmed the
inverse relationship between cellular Mg2+ content and G6P transport and hydrolysis previously
observed (102, 103, 110).
38
Figure 5: Hexose 6-phosphate hydrolysis in HepG2 cells.
Data are means + S.E. of 4 different cell preparations, each carried out in duplicate, for all the
experimental conditions reported. *Statistical significant versus the corresponding values in
HepG2 cells maintained in the presence of 0.6 or 0.4 mmol/L [Mg2+]o.
39
Once transported within the endoplasmic reticulum, G6P can also be oxidized to 6phosphogluconolactone by the reticular hexose 6-phosphate dehydrogenase, in a reaction
associated with the production of endo-luminal NADPH (104, 105, 111-113). This observation
also supports the presence of a segregated intra-luminal pyridine nucleotide pool within the
endoplasmic reticulum of the HepG2 cells (104). It has to be noted that NADPH formation was
observed only when G6P was added to the incubation system, and that the large molecular size
of NADP+ prevents its movement across the endoplasmic reticular membrane. Hence, we
investigated whether oxidation of G6P via H6PD was also enhanced in Mg2+ deficient cells
following the increased entry of the substrate into the endoplasmic reticulum. The production of
NADPH coupled to the H6PD activity was measured in HepG2 cells in the presence of various
amounts of exogenous G6P (Figure 6A).
40
Figure 6A: Hexose 6-phosphate dehydrogenase activity in HepG2 cells.
*Statistical significant versus the corresponding value in HepG2 cells grown in 1
mmol/L [Mg2+] o. # Statistical significant versus the corresponding value in HepG2 cells
grown in 0.6 or 1 mmol/L [Mg2+] o . Data are means + S.E. of 3 different cell preparations
for each of the experimental conditions reported.
41
The results reported in Fig. 6A indicate that HepG2 cells grown in the presence of 0.4 and 0.6
mmol/L [Mg2+] o produced almost three-times and two-times, respectively, the amount of
NADPH generated by HepG2 cells maintained in 1 mmol/L [Mg2+] o . To further validate that
NADPH generation strictly depended on the amount of G6P entering the ER through a Mg2+
-controlled entry mechanism, permeabilized HepG2 cells grown in 0.6 mmol/L [Mg2+] o were
exposed to1 mmol/L G6P in the presence of progressively increasing extra-reticular Mg2+
concentrations (Figure 6B).
42
5
0.6mM (Basal)
0.7mM Mg2+
1.0mM Mg2+
1.75mM Mg2+
3.5mM Mg2+
7mM Mg2+
NADPH Production
(A.U./mg protein)
4
3
2
.
Mg2+ Add.
1
0
0
2
4
6
8
10
Incubation Time (Min)
Figure 6B: Hexose 6-phosphate dehydrogenase activity in HepG2 cells.
All the data points for the progressively increasing Mg2+ concentrations are
statistical significant (ANOVA) vs. the corresponding values for basal 0.6
mmol/L Mg2+. Labeling is omitted for simplicity
43
As Fig. 6B shows, increasing extra-reticular Mg2+ concentration resulted in a progressive
reduced NADPH generation. Qualitatively similar results were observed for HepG2 cells
cultured in the presence of 0.4 and 1 mmol/L [Mg2+]o (not shown). This effect is similar to that
reported on the amount of P i and glucose generated by the hydrolytic activity of the G6Pase
(102, 103, 110). Consistent with what reported previously for the G6Pase (102, 103), the effect
of Mg2+ was specific in that no significant modulatory effect on NADPH production was
observed when Mg2+ was replaced with an equimolar concentration of another divalent (e.g. Ca2+
or Mn2+) or monovalent (Na+or K+) cations (not shown). The modulatory effect of Mg2+,
however, was observed only when the cation was added prior to, or together with G6P (Table 3).
Once the H6PD catalyzed reaction was fully activated by G6P addition, exogenous Mg2+ failed
to exert its inhibitory effect (Table 3).
44
Table 3. Inhibitory effect of exogenous Mg2+ addition of NADPH production.
t = 0 min
t = 2 min
t=5 min#
t=10 min
1 mM HepG2 cells
No Mg2+
1 mM Mg2+ together
with G6P
1 mM Mg2+ 5 min after
G6P
0.126 ± 0.014
0.874 ± 0.061
1.560 ± 0.187
2.666 ± 0.098
0.131 ± 0.021
0.582 ± 0.043*
0.954 ± 0.105*
1.753 ± 0.151*
0.130 ± 0.009
1.034 ± 0.077
1.579 ± 0.081
2.769 ± 0.112
0.189 ± 0.028
1.783 ± 0.080
2.912 ± 0.106
3.569 ± 0.073
0.179 ± 0.036
1.017 ± 0.112*
2.361 ± 0.081*
2.871 ± 0.113*
0.195 ± 0.026
1.791 ± 0.113
2.871 ± 0.076
3.803 ± 0.088
0.145 ± 0.017
2.055 ± 0.056
3.177 ± 0.064
4.524 ± 0.104
0.151 ± 0.019
1.369 ± 0.097*
2.835 ± 0.076*
3.728 ± 0.102*
0.158 ± 0.029
2.067 ± 0.088
3.262 ± 0.091
4.482 ± 0.083
0.6 mM HepG2 cells
No Mg2+
1 mM Mg2+ together
with G6P
1 mM Mg2+ 5 min after
G6P
0.4 mM HepG2 cells
No Mg2+
1 mM Mg2+ together
with G6P
1 mM Mg2+ 5 min# after
G6P
Data are expressed as A.U. NADPH production/mg protein, and are mean + S.E. of 3
different cell preparations.*Statistical significant versus the No Mg2+ and the 1 mmol/L
Mg2+ added 5 min after G6P. # Time after Mg2+ addition.
45
At variance of the cytoplasmic glucose 6 phosphate dehydrogenase, which can assemble as a
tetramer in the presence of MgSO 4 (3), the hexose 6-phosphate dehydrogenase is functionally
active as a dimer (3). To exclude the possibility that variations in endogenous or exogenous
Mg2+concentrations affected the dimeric conformation of the enzyme, NADPH production was
measured for each extracellular Mg2+ concentration in the presence of β-mercaptoethanol, which
fully stabilizes the dimeric structure of the enzyme. The treatment did not affect the amplitude of
NADPH production irrespective of the [Mg2+] o utilized for the cell growth (Figure 7A, 7B).
Although more detailed experiments need to be carried out on the purified H6PD protein, these
preliminary results suggest that Mg2+ is not changing the conformational state of the protein in
our experimental model.
46
FIGURE 7A: Effect of reducing agent (β-ME) on H6PD activity in 1.0 mM cells.
FIGURE 7B: Effect of reducing agent (β-ME) on H6PD activity in 0.6 mM cells.
47
Next, we assessed whether culturing HepG2 cells in the presence of low extracellular Mg2+
concentration changed H6PD expression. The qRT-PCR determination attested that the
enzyme expression increased by ~4-fold (~3-fold with a second set of primers, not shown) in
cells cultured in 0.6 mmol/L [Mg2+] o compared to 1.0 mmol/L (Fig.8A).
48
5
*
Ct
mRNA Fold Increase (2-∆∆ )
4
3
2
1
0
0.6mM
1mM
2+
Extracellular [Mg ]
FIGURE 8A: Hexose 6-phosphate dehydrogenase gene expression in HepG2 cells
Results, normalized for β-actin and GAPDH expression, are reported as 2-∆∆CT Data
are means + S.E. of 3 different cell preparations for each experimental condition, each
carried out in duplicate. *Statistical significant versus the corresponding value in
HepG2 cells grown in the presence of 1 mmol/L [Mg2+] o .
49
A larger increase in expression was observed in cells cultured in the presence of 0.4 mmol/L
[Mg2+] o. These results were confirmed by Western Blot analysis, which indicated a 3-fold
increase in H6PD protein expression (Fig. 8B).
50
*
β-actin
FIGURE 8B: Hexose 6-phosphate dehydrogenase protein expression in HepG2 cells.
Band intensity was normalized to β-actin protein expression. Data are means + S.E. of 4
different cell preparations for each experimental condition, each carried out in duplicate.
*Statistical significant versus the corresponding value in HepG2 cells grown in the
presence of 1 mmol/L [Mg2+] o .
51
Replacement of MgCl2 with equimolar concentration of MgSO 4 elicited an approximately
50% lower production of NADPH (Fig 9A) suggesting that the observed H6PD activity was
Mg2+-specific but the anionic moiety had some modulatory effect as well. The role of anions on
H6PD activity was not investigated further. Substituting MgCl2 with equimolar concentrations of
KCl did not elicit detectable NADPH production (Figure 9B).
Substituting Mg2+ with equimolar concentrations of Mn2+ which is very similar to Mg2+ in
size and preferred coordination geometry (114, 115), and would potentially compensate for a
deficiency in enzymatic reactions, showed no NADPH production by H6PD (Figure 9C),
implying that the observed activity and expression of H6PD is magnesium-specific. Conversely,
substituting Mg2+ with equimolar concentrations of Ca2+, a classical signaling divalent cation
showed that Ca2+ could act as a substitute for Mg2+, but at much higher concentrations (Figure
9D).
52
4
NADPH Formation / 150ug
protein
3
2
MgCl2
1
0
MgS04
0
200
400
600
800
Time (Secs)
Figure 9A: Effect of MgCl2 vs. MgSO 4 on H6PD activity on Mg2+-deficient cells
(0.6mmol/L) n=4
NADPH Formation / 150ug
protein
4
+ MgCl or KCl
2
3
2
MgCl2
KCl
1
0
0
200
400
600
800
Time (secs)
Figure 9B: Effect of MgCl2 vs. KCl on H6PD activity in 0.6mmol/L Mg2+ deficient cells. n=4
NADPH / 500ug protein
0.12
0.1
0.2mM media
0.08
0.4mM media
0.06
0.04
0.8mM media
0.02
0
0
200
400
600
800
Time (secs)
FIGURE 9C: Effect of MnCl2 ions on H6PD activity in 0.6mmol/L Mg2+deficient cells.
53
NADPH / 500ug protein
0.5
0.4
0.3
0.6 mM w/ MgCl2
0.2
1.0 mM w/ MgCl2
0.6 mM w/ CaCl2
0.1
1.0 mM w/ CaCl2
0
0
100
200
300
400
500
600
700
Time (secs)
FIGURE 9D: Effect of CaCl2 compared to MgCl2 on H6PD activity in
0.6mmol/L Mg2+- deficient cells. n=3
54
To exclude that the increased oxidation of G6P and associated production of NADPH could
be attributed to the neoplastic origin of our HepG2 cells, similar experiments were carried out in
microsomal vesicles from rats maintained on a regular or a 35% deficient Mg2+ diet, using our
previously published protocol (8). No significant differences in body and liver weights and in
protein content per g of liver between the two experimental groups were observed (8).
Microsomal yield and RNA content were also not statistically different between the two
experimental groups. Total homogenate Mg2+ content and microsome Mg2+ content, however,
were statistically lower ( minus 23% and minus 27%, respectively) in the Mg2+ - deficient diet
group as compared to the normal Mg2+ diet group (8). As for the H6PD activity, the results
reported in Figure 10A were qualitatively similar to those reported for HepG2 cells, supporting
the notion that the observed effect of Mg2+ on G6P entry and utilization via H6PD was
independent of the neoplastic origin of the HepG2 cells. Figure 10B indicates that also in
microsomes from Mg2+ deficient animals H6PD expression was ~2-fold increased as compared
to microsomes from normal Mg2+ animals.
55
1mM
0.6mM
90KDa
H6PD
A
5
B
NMM
MDM
3
4
2.5
3
Fold Increase
NADPH Production
(A.U./mg protein)
40KDa
G6Pase
2
1
2
1.5
1
0.5
0
0
1
2
3
4
5
6
7
8
9
0
10
Incubation Time (Min)
MDM
NMM
Figure 10: Hexose 6-phosphate dehydrogenase activity (A) in microsomal vesicles.
Data are means + S.E. of 4 different cell preparations for each experimental condition,
each carried out in duplicate. Figure 10B: H6PD expression in liver microsomes from
Mg2+-deficient rats. Densitometry reports Means ± S.E of 4 distinct preparations.
*Statistical significant versus the corresponding value in HepG2 cells grown in the
presence of 1 mmol/L [Mg2+] o . MDM (i.e. Mg2+ deficient microsomes), NMM (i.e.
Normal Mg2+ microsomes).
56
Reticular H6PD is reported to be expressed in neutrophils (8) and adipose tissue (8). To exclude
that our observation was hepatocyte-specific, HL-60 promyelocitic leukemia cells were tested as
neutrophils representative. The results reported in Figure 11A indicate that in these cells,
reducing [Mg2+] o resulted in a decrease in total and compartmentalized Mg2+ content, and in an
increased production of NADPH via H6PD (Fig. 11B), whereas addition of exogenous Mg2+
inhibited NADPH production in a dose-dependent manner (Fig. 11C). H6PD protein expression
(Fig. 11D) was ~2-3 fold increased in HL-60 cultured in 0.6 mmol/L [Mg2+] o as compared to
those culture in physiological 1 mmol/L [Mg2+] o .
57
30
Cellular Mg2+ Content
(nmol/mg protein)
25
1 mM
0.6mM
*
*
20
15
*
10
**
5
*
0
Total
Cytoplasm
Mitochondria
ExtraMitochondria
FIGURE 11A: Total and compartmentalized Mg2+ content in HL-60 cells
*Statistical significant versus the corresponding value in HL-60 cells grown in 1.0
mmol/L [Mg2+] o.
58
0.6 mM
Mg2+
0.7
0.6
NADPH Production
(A.U./mg protein)
0.5
0.4
0.3
0.2
0.1
0
0
100
200
300
400
500
600
Incubation time (Seconds)
FIGURE 11B: H6PD-coupled NADPH production in HL-60 cells
*Statistical significant versus the corresponding value in HL-60 cells grown in 1
mmol/L [Mg2+] o.
0.8
0.6 mM
(Basal)
0.7mM Mg2+
NADPH Production
(A.U./mg Protein)
0.7
1.0 mM Mg2+
0.6
0.5
0.4
0.3
0.2
0.1
0
0
1
2
3
4
Incubation Time (Min)
5
6
FIGURE 11C: inhibitory effect of increasing concentrations of exogenous Mg2+on
NADPH-production in HL-60 cells grown in the presence of 0.6 mmol/L [Mg2+] o.
All the data points for the progressively increasing Mg2+ concentrations are
statistical significant (ANOVA) vs. the corresponding values for basal 0.6 mmol/L
Mg2+. Labeling is omitted for simplicity.
59
1mM 0.6mM 1mM 0.6mM
Markers
90 KDa
H6PD
36 kDa
β-actin
mRNA fold increase of H6PD
3
2
1
0
1.0 mM Mg2+
0.6 Mm Mg2+
Concentration of Mg2+ in cell culture media
FIGURE 11D: H6PD gene and protein expression in HL-60 cells grown in 0.6 or 1
mmol/L [Mg2+] o *Statistical significant versus the corresponding value in HL-60
cells grown in the presence of 1 mmol/L [Mg2+] o . Data are means + S.E. of 4
different cell preparations for each experimental condition, each carried out in
duplicate.
60
DISCUSSION
The endoplasmic reticulum has been identified as one of the most abundant pool of magnesium
within mammalian cells including hepatocytes (116, 117). Total Mg2+ concentrations ranging
between 16 to 18 mmol/L have been estimated within the organelle using a variety of
methodological approaches including electron probe X-ray microanalysis (EPXMA) (116, 117).
Unfortunately, no current approach has been able to determine the free Mg2+ concentration
within the organelle due to the fact that the commercially available Mg2+ -specific fluorescent
indicators retain a higher affinity for Ca2+, the concentration of which is approximately 2-3
mmol/L within the ER (116, 117). As a consequence, this methodological limit has hampered
our ability to measure the free intra-reticular Mg2+ concentration and its role in regulating
specific reticular functions.
Recently, we have reported that in vivo and in vitro changes in cellular and cytoplasmic
Mg2+ content modulate in an inverse manner glucose 6-phosphate transport and hydrolysis
within liver cells (1, 2). This is in line with reports by other laboratories (10). Currently, two
different hypotheses are available to explain the transport of G6P across the E.R. membrane and
its delivery to the catalytic site of the G6Pase. According to the substrate–transport model, G6P
enters the ER lumen via a specific transport mechanism (T1) distinct from the hydrolase (118).
According to the conformational flexibility substrate transport model, instead, G6P binds the
hydrophilic region of G6Pase facing the cytoplasm, which changes in conformation and
promotes the delivery of the substrate to the intra-luminal catalytic site (119). In this model, the
substrate-binding site and the hydrolytic site are two parts of the same protein (119). Because of
the dynamic nature of the changes in Mg2+ content, and the influence of chelating agents such as
EDTA, we have proposed that Mg2+ exerts its regulatory effect at the level of the G6P entry
61
mechanism, which represent the limiting step for G6Pase hydrolysis rate, irrespective of the
model considered (1, 2).
Hydrolysis of G6P to glucose and P i (inorganic phosphate) by the G6Pase is one of the
two metabolic processes G6P undergoes within the endoplasmic reticulum. The other one is the
oxidation of G6P to 6-phosphogluconolactone via H6PD, the reticular version of glucose 6
phosphate dehydrogenase (4,120).
Consistent with our hypothesis that Mg2+ regulates the G6P entry rate, liver cells cultured
in the presence of low extracellular Mg2+ show a marked increase in H6PD activity, measured as
NADPH production, for a given G6P concentration. The presence of an inverse relationship
between Mg2+ content and G6PD activity is further supported by the results in cells
cultured in 0.6 mmol/L [Mg2+]o showing that the addition of progressively increasing
concentrations of exogenous Mg2+ in the millimolar range progressively down regulate NADPH
production. This effect is Mg2+ specific as it is not reproduced by the addition of equimolar
concentrations of monovalent or other divalent cations, as already reported for the hydrolysis of
G6P by the G6Pase enzyme (1, 2). Arguably, some of the Mg2+ concentrations tested in our
study are significantly higher than the oscillations in Mg2+ concentrations observed under a
variety of physiological conditions. In this respect, variations in cytoplasmic Mg2+
concentrations between 0.4 and 1.0 mmol/L (i.e. the concentrations used in our cell culture
system) have been reported to occur in hepatocytes (116, 117, 121) and provide a more
physiological correlation for our study. Irrespective of the Mg2+ concentration tested, the
dynamic regulation exerted by Mg2+ show the specificity of its effect on G6P entry into the E.R.
lumen as other cations are incapable to reduplicate it (1, 2). Furthermore, these concentrations
emphasize that the dynamic Mg2+ regulation is independent of, and in addition to the
62
cytoplasmic level present under the various culturing conditions (i.e. 0.4 vs. 0.6 vs. 1 mmol/L
[Mg2+]o). As this effect is observed only when exogenous Mg2+ is added at the beginning of the
reaction and not when the reaction is already in full motion, it argues against the possibility that
the inhibition is due to the equilibration of the cation across the E.R. membrane. Presently, it is
not clear why Mg2+ inhibitory effect is observed only when the cation is added together or prior
to G6P. The most likely explanation is that NADPH, which represents the read-out of the
reaction in our system, can only be dissipated by other reactions utilizing it (e.g. fatty acid or
cholesterol synthesis) that are not taking place in our digitonin permeabilized cells as the
necessary enzymes and/or substrates are not available. Interestingly, in both HepG2 and HL-60
cells a decrease in cellular Mg2+ content increases H6PD expression. A qualitatively similar
increase in protein expression is also observed in microsomes from rats exposed to Mg2+
deficient diet for 2 weeks. Presently, it is undefined whether this effect is the results of changes
in Mg2+ content at the nuclear level (which we cannot technically assess) or an adaptive response
following a persistent substrate availability (i.e. elevated G6P entry into the reticular lumen).
By comparing the information obtained on G6Pase with the results reported here, a picture
emerges whereby cellular (cytoplasmic) Mg2+ operates as a key regulator of glucose
utilization within the hepatocyte. Under conditions in which external and internal Mg2+ is plenty
(e.g. fed state, adequate nutrition state, or functional circulating insulin levels) Mg2+enters the
cells and promotes optimal conversion of glucose to glucose 6-phosphate via glucokinase. This
substrate can then be used for immediate energetic purposes (glycolysis) or stored as glycogen
upon proper metabolic conversion while its hydrolysis via G6Pase and oxidation by H6PD
within the endoplasmic reticulum are limited by the regulatory effect of Mg2+ on G6P entry rate
into the organelle. Conversely, under conditions in which external or internal Mg2+ is low (e.g.
63
fasted state, nutritional defect, hypomagnesaemia, or diabetes), utilization or storage of external
glucose is limited, and the hepatocyte put in place alternative NADPH-supported metabolic
processes (i.e. pentose shunt, fatty acid synthesis, or cholesterol synthesis) to guarantee glucose
output and energy production. Additional studies are needed to investigate in detail these aspects
of liver metabolism and to validate the extent to which these processes occur in other tissues (e.g.
adipose tissue), which share with the liver similar metabolic processes (H6PD expression and
fatty acid synthesis) (122). The validation of the main Mg2+ effects in HL-60 cells as
representative of neutrophils, another cell type in which the presence of the H6PD machinery has
been observed (6, 123) suggests that the regulatory role of Mg2+ occurs in other cell types
possessing the same basic biochemical machinery besides the hepatocyte. In the case of HL-60
(and neutrophils), the observed increase in H6PD expression and activity and the associated
production of NADPH could be linked to the maintenance of luminal NADPH necessary for
neutrophils’ survival, oxidative burst, or other immune-related responses specific for these cells
(6). Additional studies are required to further validate this hypothesis.
In the case of the hepatocytes, for which more information is available, our results are
consistent with several published observations, and are suggestive of major changes in hepatic
and perhaps whole body metabolism. Animals exposed to magnesium deficient diet for 2 weeks
or more show increased levels of circulating triglycerides and low density lipoproteins (LDL)
(124). Similar abnormal levels of circulating triglycerides and LDL are observed in severe cases
of type-1 and type 2 diabetes (39, 116), conditions that are also associated with
hypomagnesaemia and/or decreased hepatic Mg2+ content (36, 116). Noteworthy, experimental
and clinical evidence associates increased G6PD expression and activity with insulin resistance
and obesity (125), two conditions often linked to non-alcoholic fatty liver disease (NAFLD),
64
diabetes, and metabolic syndrome (126, 127). Reduced glucose utilization is also observed
following exposure of hepatocytes to ethanol (20), the administration of which results in Mg2+
loss from liver cells in a dose-dependent manner (22, 229). In all these conditions, the ultimate
challenge remains to discern to which extent the observed dysmetabolisms depend on the
occurring pathology or on the concomitant Mg2+ loss.
Despite the widespread action of magnesium on enzymes, relatively few disturbances in
enzyme activity have been established during Mg2+ deficiency in animals, and this has been
attributed to the well retained levels of intracellular Mg2+ in most tissues during Mg2+ deficiency
(7). This is the first time that changes in expression and activity of one enzyme, H6PD, the
endoplasmic reticulum isoform of cytosolic G6PD, are being attributed to Mg2+ deficiency.
As the intracellular concentration of free Mg2+ is relatively high (0.5-1.0 mmol/L), it is
unlikely that Mg2+ is acting as a second messenger, like Ca2+, by rapidly changing the cytosolic
concentration (130), consistent with what was proposed by Grubbs and Maguire, changes in
cytosolic Mg2+ appear to have a profound long-term effect on cellular metabolism and
bioenergetics. At the same time, changes in cellular concentration of Mg2+ can modify key
enzymes activity in various metabolic pathways, mitochondrial ion transport, Ca2+ channel
activities in the plasma membrane and intracellular organelles, ATP-requiring reactions, and
structural properties of cells and nucleic acids (130).
The increase in activity of G6Pase in gluconeogenesis and production of NADPH (i.e.
gluconeogenesis in the pentose phosphate pathway), may imply a vicious cycle if the conditions
of magnesium deficiency persist or are not corrected, whereby fructose-6-phosphate is
regenerated from ribulose-5-phosphate in the pentose phosphate shunt pathway regenerating
more glucose-6-phosphate to feed into the cycle in the absence of adequate cytosolic Mg2+ levels
65
required by the glycolytic enzymes (131). Fructose 6-phosphate may also support H6PD activity
directly (123) further enhancing NADPH production.
The influence of various anions in increasing the Km of H6PD for Glucose-6-phosphate
decreases from phosphate > sulphate > chloride (132), implying that like glucokinase with a Km
for glucose 100 times higher than of hexokinase - G6P can only support H6PD when the
substrate concentration is high enough. Overall, these results further indicate a functional switch
for G6P utilization within the hepatocytes under conditions in which cellular Mg2+ is decreased.
The importance of restoring proper Mg2+ levels within hepatocytes to renormalize the
activity and expression of H6PD remains to be investigated.
66
CHAPTER III
ENHANCED CORTISONE TO CORTISOL CONVERSION IN HEPATIC MAGNESIUM
DEFICIENCY IMPLICATED IN THE ONSET OF INSULIN RESISTANCE AND OBESITY
We have previously reported that reduction of cellular Mg2+ content increases the
oxidation rate of G6P by the reticular hexose 6-phosphate dehydrogenase (H6PD), the process
being associated with increased NADPH production within the ER lumen.
At variance of the cytosolic glucose 6-phosphate dehydrogenase which operates as a
tetramer (133) and constitutes the limiting step in the pentose shunt pathway, the H6PD operates
as a dimer and is mainly coupled to the activity of the 11-beta-hydroxy steroid dehydrogenase-1
(11βHSD1), which converts inactive cortisone into cortisol (134).
Cortisol is a steroid hormone released in response to stress and stimulation of the
hypothalamic pituitary-adrenal gland produced in the adrenal cortex under the control of the
hypothalamic-pituitary-adrenal axis (135), cortisol is also generated from inactive cortisone
within adipose tissue by the enzyme 11β-HSD1 (136). Evidence suggests that glucocorticoid
levels in specific tissues may be quite different than those circulating in the plasma (137, 138).
Cortisol has potent effects in adipose tissue influencing insulin sensitivity, fatty acid
metabolism and adipocyte distribution (25). The enzyme 11β-HSD1 has been identified as a key
determinant of intra-adipose cortisol concentrations, and it has been shown to be insufficient to
increase portal vein cortisol concentrations and consequently influence intrahepatic
glucocorticoid signaling (136).
67
Recent work by our lab with a human hepatoma cell line (HepG2) and neutrophils has
shown an increase in NADPH production within the ER under magnesium deficient conditions
following an increase of hexose-6-phosphate dehydrogenase (H6PD) activity and expression.
Particular importance has been attributed to the circulating cortisol levels of cortisol and to the
activity of 11BHSD1 in regard to the pathogenesis of obesity and metabolic syndrome. When
released in high amounts under stress conditions, cortisol acts as a proglycemic hormone
promoting gluconeogenesis, lipolysis and proteolysis, among other functions (139). In addition,
cortisol promotes abnormal deposition of adipose tissue and obesity (138, 140). The effect of
glucocorticoids on lipid metabolism occur through a number of different mechanisms, some of
which are well defined while others remain to be elucidated.
In the liver, glucocorticoids stimulate gluconeogenesis in the liver and inhibit insulin
sensitivity. The later effect also occurs in skeletal muscles, significantly impacting glucose
metabolism and homeostasis (18). When in excess, glucocorticoids stimulates the expression of
several key enzymes involved in gluconeogenesis, with a consequent increase in glucose
production, and impair insulin sensitivity, either directly by interfering with the insulin receptor
signaling pathway or indirectly, through the stimulation of lipolysis and proteolysis and the
consequent increase in fatty acids and amino acids which contribute to the development of
insulin resistant (18).
Studies in human and rodents suggest a role for tissue rather than plasma glucocorticoid
excess in the development of idiopathic obesity and the metabolic syndrome via intracellular
conversion of inactive cortisone into cortisol by 11β-HSD1, highly expressed in liver and
adipose tissue (18). Glucocorticoids can mediate their effects in target tissues through genomic
and non-genomic mechansims that result in the activation or repression of gene transcription, and
68
the modulation of gene product expression. Although these genomic effects are slow in
developing, they last for long time and persist after the hormone is no longer present (138).
Owing to the role of cortisone in obesity and insulin resistance, significant attention has
been placed on the possible role of 11β-HSD1 in favoring the production of active cortisol (134).
The highest expression of 11β-HSD1 is in the liver, and the hepatic 11β-HSD1 mRNA levels are
regulated by diet, hormones and gender (18). While the type 2 isoform (i.e. 11β-HSD2) is
largely expressed in the kidney and placenta, and is responsible for inactivating cortisol, the type
1 isoform is a bidirectional, NADP(H)-dependent microsomal enzyme that acts predominantly as
a NADPH-dependent reductase to generate the active cortisol from inactive cortisone, thereby
amplifying local glucocorticoid availability to glucocorticoid receptor in key target tissues such
as the liver and adipose tissue(141). Enhanced activity of 11B-HSD1 enzyme results in the
production of excess tissue glucocorticoids and the induction of local glucocorticoid receptor
activation and eventually hepatic gluconeogenesis and adipocyte differentiation. Both these
metabolic processes have been associated with type II diabetes and obesity (141).
The availability of glucocorticoids to glucocorticoid receptors can be regulated at the prereceptor level by the 11Beta-hydroxysteroid dehydrogenase (11-B-HSD) type 1 and 2 (141).
This has been supported by 3D-structures suggesting that lipophilic substrates such as steroid
hormones which are enriched in the membrane enter the catalytic site of the enzyme from the
hydrophobic bilayer, which may explain why low concentrations of cortisone are efficiently
converted to cortisol in preparations containing membranes despite the rather high Km values
reported for the enzyme (142).
Clearly, the effects of 11B-HSD1 in the development of obesity and type II diabetes are
dependent on its reductase activity, which requires NADPH as cofactor. NADPH is regenerated
69
by H6PDH located in the endoplasmic reticulum and principally expressed in hepatocytes and
adipocytes, two cell types that express 11B-HSD1 and glucocorticoid receptor. In target tissues
H6PD oxidizes G6P in an NADPH-coupled reaction. The increased level of reduced pyridine
nucleotides can then ‘drive’ the activity of the 11B-HSD1amplifying the production of cortisol,
in a process that might lead to the development of type II diabetes and obesity (141).
Diabetes mellitus, redistribution of body fat in a Cushing’s-like syndrome and increased body
weight (obesity) are among some of the cortisol-induced undesirable metabolic effects.
However, it has to be noticed that the degree of obesity varies greatly among individuals.
Although obesity is a known risk factor for type II diabetes, not all Type II diabetic patients are
overweight or obese. Conversely, not everyone who is overweight or obese will necessarily
develop type II diabetes, suggesting the involvement of several mechanisms in addition to, or in
alternative to 11-β-OHSD1 hyperactivity.
The possible importance of 11-β-OHSD1 in promoting obesity and /or insulin resistance is
supported by the observation that pharmacological inhibition of 11β-HSD1 improves both
insulin intolerance and obesity. In a study by Liu (11), diet-induced obese and insulin resistant
mice treated with carbenoxolone (inhibitor of 11β-HSD1), had a marked decrease in hepatic
glucocorticoid receptor mRNA levels, and reduced weight gain, hyperglycemia and insulin
resistance. The observed hepatic glucocorticoid receptor gene Carbenoxolone also inhibited
hepatic 11β-HSD1 and H6PDH activity and mRNA expression. Treatment with the inhibitor also
suppressed the mRNA expression of gluconeogenic genes such as phosphoenolpyruvate
carboxykinse (PEPCK) and glucose-6-phosphatase enzyme (G6Pase).
Because of the increased expression and activity of H6PD in Mg2+ deficient cells
previously reported, the second specific aim of this study aimed at providing a cause-effect
70
relationship between Mg2+ deficiency, increased H6PD and ultimately cortisol production, which
could ultimately explain the obesity and insulin insensitivity often observed under Mg2+ deficient
conditions (143, 144).
71
Materials and Methods
Materials: HepG2 cells were a kind gift from Dr. Cederbaum (Mt. Sinai Hospital, New York).
Culture medium and bovine calf serum were from Gibco (Life Science, Grand Island, NY). All
other reagents were of analytical grade (Sigma, St Louis, MO).
Methods:
HepG2 C34 Cell Culture (Effect of Insulin on CBG in Magnesium deficiency): Cell culture
conditions were same as stated above. Approximately 5 x 106, hepatocellular carcinoma (Hep
G2-C34) cells were plated in 75ml flasks, grown to 80% confluency in MEM containing 10%
BCS (Bovine Calf Serum), 1% Pen-Strep, 1% L- glutamine, and 0.5% Geneticin in a humidified
atmosphere in 5% CO2 at 370C. Cells were grown in MEM in the presence of either 0.6 mM or
1.0 mM [Mg2+]o, respectively, for 5 days prior to performing analysis. Fresh media was added to
cells in culture every 48 hours to replenish glucose and nutrients necessary for.
Cells were serum starved for 24 hours, prior to the beginning of the experiment. No serum
was present during the experimental protocol. Where indicated, cortisone (5 µM) was added to
the cell medium for 3 hours or overnight. Insulin was added for 20 minutes to cells pretreated or
not with cortisone at a final concentration of 5 nM, 10 nM or 50 nM.
Lowry protein assay: Protein analysis was done according to Lowry et. al (145).
Cortisol Production Measurement: Cortisol production from cells grown in 0.4 mM, 0.6 mM and
1.0 mM [Mg2+] o was analyzed. Digitonin permeabilised cells and cells with all membranes
eliminated to directly access G6PD and assess maximum activity (see protocols under Aim 1)
was analyzed using a Bio-Rad Gradient module HPLC analyzer. The method of Senesi et al. (11)
was adopted. Briefly, reduction of cortisone to cortisol was measured by incubating 0.5 mg/ml of
permeabilized hepatocyte HepG2 cells in KCl-MOPS buffer pH 7.2 at 370C for 20 minutes in
72
the presence of 5 μM cortisone and 50 μM G6P. The reaction was stopped with 150 μL ice-cold
methanol, and the samples were stored at 20oC until analysis. After centrifugation at 20,000g for
10 minutes at 40 oC, cortisol and cortisone contents in the supernatant were measured by
injecting 100 μL aliquots into HPLC (BioRad Gradient module, BioRad, USA) using a nucleosil
100 C18 column (5 μm, 25 x 0.46) (5 μm, LiChrospher 100, Merck). The mobile phase was
isocratic methanol-water (58:42, v/v) at 0.7 ml/min flow rate, and absorbance was detected at
254 nm wavelength. Retention times of cortisone and cortisol were determined by injecting
known standard concentrations (see above) under the same procedural conditions. The enzyme
activity was assessed by the percentage of the formed product, cortisol.
For good reproducibility of migration time and to avoid solute adsorption on the column wall
the following wash procedure was performed. The column was rinsed with 0.1M NaOH
(regeneration solution), deionized water, and finally with sample buffer for 10 minutes. To
prevent interference from adsorbed sample components on the column surface, which changes
the effective charge on the wall, the capillary was flushed with methanol (0.5 min) after each
injection. The column was reconditioned between runs with regeneration solution (1 min) and
deionized water (1 min). Peak identification was conducted by spiking the sample with the
analytic compound to be identified.
Assessment of cortisol response for gluconeogenesis: To validate the effect of cortisol
conversion on glucocorticoid responsive genes under experimental conditions, HepG2 cells
incubated in MEM media with 1.0 mM or 0.6 mM [Mg2+] o were exposed to 5 µM cortisone for 3
hours in serum-free medium. At the end of the incubation period the medium was aspirated and
cellular mRNA was extracted with trizol according to manufacturer protocol. Gene expression
and protein expression were assessed by qRT-PCR and Western blot analysis as indicated
73
below. Magnesium Recovery: Cells incubated in MEM media with 1.0 mM [Mg2+]o were
incubated in duplicate for 6 days (phase 1). The [Mg2+]o was then changed to 0.6 mM Mg2+ and
cells were incubated for 6 more days (phase 2). For an additional 6 days (phase 3), the [Mg2+]o
was changed back to 1.0 mmol/L. Cells at the end of each incubation phase were harvested for
mRNA isolation to analyze expression levels of gene products of interest. Cellular Mg2+ and
K+ content were assessed by atomic absorbance spectrophotometry upon acid digestion of a
separate set of cells.
RNA isolation: Total RNA was isolated from cells in 0.4 mM, 0.6 mM, and 1.0 mM [Mg2+]o.
Cells in culture were washed with cold PBS. 1 mL Triazol/100 mL cultures dish were used to
dissolve the pellet. After 5 minutes extraction, 200 μL chloroform /ml Triazol was added.
Following vigorous mixing, the solution was maintained at room temperature for 2 minutes
before undergoing centrifugation at 12,000g for 15 minutes at 40oC. Next, 0.5 ml of
isopropanol/1 ml Trizol was added to the extracted RNA, and the mixture was incubated at room
temperature for 10 minutes before being sedimented at 12,000g for 10 minutes at 40 oC. The
supernatant was discarded and the pellet washed with ice-cold 75% ethyl alcohol, and spun at
12,000g for 5 minutes at 40oC. The supernatant was decanted and the pellet air-dried, and
dissolved in RNase/DNase free water for 10 minutes at 55 oC. Isolated RNA was quantitated by
ultraviolet absorbance at 260 nm. The intergrity of RNA was checked using 1% agarose gels
stained with ethidium bromide.
Quantitative RT-PCR: RT-PCR assays were used to study expression of various proteins in
magnesium deficient medium of cultured cells. Genes of interest analyzed include CBG, 11betaHSD1, Glucokinase, PEPCK, H6PD, and AKT. 1.0μg RNA was used to synthesize the first
strand of cDNA. The reverse transcription reaction was carried out by incubating RNA with 0.5
74
μg oligo dT primer (Sigma) and 100 units of Maloney murine leukemia virus reverse
transcriptase (Gibco, Gaithersburg, MD, USA). A final extension will be carried out at 70 oC for
70 minutes. Amount of RNA and the annealing temperature for different genes was standardized
for linearity.
Specific primers for each gene (Table 4) were obtained from publications or designed using
Primer Express software (Applied Biosystems). Each real time reaction contained, in final
volume of 14 µl, 14 ng of reverse transcribed total RNA, 2.33 pmol forward and reverse primers
and 7ul of 2x SYBR Green PCR Master Mix (catalogue number 4309155, Applied Biosystems).
RT-PCR conditions were: 95 oC for 10minutes, followed by 40 cycles of 95 oC for 30 minutes,
and 60 oC for 1 minute. The relative amount of all mRNA’s was calculated using the
comparative C T method. A negative control without cDNA was run for all studies.
75
Table 4: Primer sequences of selected genes involved in key pathways of hepatic
gluconeogenesis.
Genes
Primer (sense)
Primer (antisense)
11β-HSD1
GAACATCAATAAAAAGAAGTCAGA
CATTATTATTACATTTCCATTTTG
CBG
CCATGGCCTTAGCTATGCTG
TTAGGTCGGATTCACAACCTTT
FOXO1
GAGATAAGCAATCCCGAAAACA
TGGCGCAAACGAGTAGCA
H6PD
CAACTGGGGACCTGGCTAAGAAGT GTTGATGAGAGGCAGGCTAAGGCT
PEPCK
(Mouse)
F16BPase
AAGTGCCTGCACTCTGTGG
CAGGCCCAGTTGTTGACC
CTGATGGGTGGATGGGTTTTC
GCAGTCACCCCTCCTCCAGA
β-actin
AGAAAATCTGGCACCACACC
AGAGGCGTACAGGGATAGCA
The abbreviations of genes and the 5’ to 3’ nucleotide sequences of the sense and antisense
primers are presented.
76
SDS-PAGE & Western Blot Analysis: Proteins from HepG2 cell line were loaded on 12%
polyacrylamide gels and blotted on nitrocellulose. Immunoblots were probed with a rabbit
polyclonal antiserum against human H6PDH, 11 beta-HSD1, albumin, glucokinase, FOXO1,
FOXO-phospho, PEPCK, CBG, AKt AKt-phospho and GSK3β. After reacting with the
secondary antibodies, blots were analyzed by enhanced chemiluminescence (Amersham, UK).
Β-actin gene was used as an internal control. Proteins of interest will be detected by
chemiluminescence (ECL kit, Amersham). Experiments were run in triplicate for result
reproducibility.
Statistical Analysis: Data are reported as means + S.E. of at least four different preparations for
each experimental condition, each tested in duplicate. Data were analyzed by student T-test set at
p < 0.05 for significance.
77
Results
There was approximately a two-fold increase in cortisol production. An increased gene and
protein expression of 11B-HSD1 and decrease in CBG protein and gene expression was attained
with hepatic Mg2+ deficiency (Figure 12A, B, C).
Consistent with an increased activity and expression of H6PD and associated production of
NADPH, HepG2 cells grown under Mg2+ deficient conditions (i.e. 0.4mM or 0.6mM ) exposed
to 5 µM cortisone exhibited a marked increase in cortisol production (Figure 12A). This
increased production was associated with an enhanced expression of 11β-HSD1 and a decreased
expression of CBG, the most common cortisol binding protein within the hepatocyte (146-148).
The increased expression was observed both at the level of mRNA (Figure 12B) and protein
(Figure 12C).
78
FIGURE 12A: Increased Cortisol Production with Mg2+ deficiency
*P<0.001, n=4
mRNA fold change vs.
1.0mM Mg2+ cells
2.5
2
*
1.5
11β-HSD1
1
0.5
CBG
*
0
0.6mM Mg2+
1.0mM Mg2+
FIGURE 12B: Effect of Mg2+ deficiency on cortisol-responsive genes, CBG
and 11β-HSD. (*P<0.001), n=3
FIGURE 12C: Effect of Mg2+ deficiency on protein expression of CBG, 11βHSD1, Albumin.
79
Prolonged exposure to cortisone (3 hour) resulted in 8 fold increase expression of
F1,6Bpase and almost 3 fold increase in PEPCK expression ( Figure 13), all gene mRNA
involved in controlling specific steps of a gluconeogenesis.
80
FIGURE 13: Effect of Mg2+ Deficiency on genes involved in gluconeogenesis
(*p< 0.001 compared to cells in 1.0mM Mg2+ media, n=4).
81
Magnesium Recovery
Next, we investigated the effect of restoring cellular Mg2+ content on H6PD and 11BHSD1
expression and activity, and on genes involved gluconeogenesis. To this end, we used the
experimental protocol described in details under materials and methods.
Returning the Mg2+ deficient cells to a physiological extracellular Mg2+ concentration (i.e.
1.0mM) for 5 days resulted in a significant increase in total cellular Mg2+ (Figure 14A) and K+
(Figure 14B) content. The recovery was not total but accounted for approximately 35% increase
over the content measured under Mg2+ deficient conditions for both Mg2+ and K+ (Fig 14A & B).
This result is consistent with the recovery observed in liver cells following exposure to 6%
ethanol (149). Consistent with previously published date (149), the recovery of Mg2+ and K+ was
associated with a decrease in cellular Na+ and Ca2+ content (data not shown).
82
FIGURE 14A: Total intracellular [Mg2+] is recovered when Mg2+ is replenished
from its depleted state. (*p<0.001, compared to cells in 1.0mM media & #p<0.001
compared to cells in 0.6mM media, n=3)
FIGURE 14B: Total intracellular [K+] is recovered when K+ is replenished from its
depleted state. (*p<0.001 compared to cells in 1.0mM Mg2+ media & #p<0.001
compared to cells in 0.6mM Mg2+ media, n=3).
83
Re-introduction of physiological [Mg2+] o also resulted in a trend towards normalization for
reversal of the gene products elevated under Mg2+ deficient conditions. As Figure 14C shows,
CBG expression resulted to normal levels (or slightly below them) after 5 day of exposure to
1mM [Mg2+] o . On the other hand, H6PD expression, which had increased by approximately 5.5
fold in low Mg2+, decreased by approximately 35% (to approximately 3.5 fold) upon exposure to
physiological [Mg2+] o .
A varying degree of recovery was also observed for other genes. Expression of PEPCK
and F16BPase also returned towards normal levels (Figure 14D). The recovery was more
pronounced for PEPCK while F16BPase gene expression still remained about 3-fold elevated as
compared to cells grown in physiological [Mg2+] o . (Figure 14 D).
84
Figure 14C: Reversing the effect of Mg2+ deficiency on H6PD & CBG gene
expressions. (*p<0.001 compared to cells from 1.0Mm to 0.6mM Mg2+ media,
#
p<0.001 compared to cells originally in 1.0mM x 5days, &p<0.001 compared to
cells originally in 1.0mM x 5 days, and n=3).
FIGURE 14D: Reversing the effect of Mg2+ Deficiency on PEPCK and F16BP
gene expressions. (*p<0.001 compared to cells originally in 1.0mM Mg2+ media,
n=3)
85
Discussion
The term Metabolic Syndrome covers a variety of dysmetabolic conditions including
obesity, hypertension, insulin resistance, hyperlipoproteinemia, and hepatic steatosis. Because
these pathologic conditions present themselves in various possible combinations in patients, the
exact sequence of events and progression remains controversial. Hypomagnesemia has also been
observed under metabolic syndrome conditions, but it has remained undefined how Mg2+
deficiency is achieved and whether it precedes or follows the onset of metabolic syndrome. In
recent years, attention has been paid to the possible involvement of the 11β-HSD1 in the onset
and progression of the metabolic syndrome and associated insulin-resistance (150-152). This
enzyme is highly represented in liver and adipose tissue (153-155), and is responsible for the
conversion of inactive cortisone to active cortisol, increasing the concentration of active
hormones in these tissues, where it can modulate specific metabolic processes such as
gluconeogenesis in liver and glycolysis in adipocytes (153, 155, 156).
11β-HSD1 enzyme is an integral membrane protein of the endoplasmic reticulum (ER)
with a luminal active site. It has a wide tissue distribution with its highest capacity observed in
the liver (3, 157). It catalyzes the interconversion between cortisone and cortisol using NADPH
or NADP+ coenzyme. The enzyme activity depends on the [NADPH]/ [NADP+] ratio in the ER
lumen. The origin, exact composition, and redox state of luminal pyridine nucleotides are
unknown, yet several indirect observations show that they are separated from the cytosolic pool
by the membrane barrier (2). The functional cooperativity of H6PD and 11β-HSD1 in sharing a
common pyridine nucleotide pool makes an excellent metabolic sensor of the ER. Minor changes
in the [NADPH]/ [NADP+] ratio in a small compartment can lead to significant alterations in
glucocorticoid activation. The concentration of cytosolic glucose-6-phosphate defines the redox
86
state of luminal NADPH/NADP+ system (2). As opposed to non-gluconeogenic tissues such as
the adipose tissues and the skeletal muscles, in gluconeogenic tissues such as the liver
intracellular G6P concentration is less fluctuating, but can be elevated by intense
gluconeogenesis during starvation (2). Increased expression / activity of 11β-HSD1 has been
associated with the onset of insulin resistance and obesity, even though expression levels and
distribution of 11β-HSD1 in obese and lean animal models of type II diabetes has been shown to
differ and suggested as a possible reason for the obese and lean phenotypes in type II diabetes
(158). Though results are conflicting, most results show that 11β-HSD1 expression and activity
in the liver is down-regulated in obesity. This down-regulation is defective in insulin resistant
individuals and may contribute to insulin resistance and eventually exacerbate dyslipidemia from
glucocorticoid stimulated lipid production (18).
The results provided in this dissertation are consistent with the hypothesis that reduced
Mg2+ levels may actually precede the onset of metabolic syndrome, or at least some of its
dysmetabolic implications.
Our laboratory has provided evidence that under low Mg2+ conditions, there is an
increased routing of G6P to the endoplasmic reticulum where G6P is either dephosphorylated to
glucose plus inorganic phosphate by the reticular glucose 6-phosphatase (1), or oxidized by the
H6PD (14). Several reports in the U.S, the U.K, and other industrialized countries (13,159,160)
indicate that the average western diet has decreased by 35% - 40% in Mg2+ content, suggesting
that an undetermined percentage of the population in the U.S and other countries may actually be
Mg2+ deficient to some extent.
87
The Mg2+ concentrations used in this thesis are consistent with the physiological levels
present in humans (161) and within tissues of individuals exposed to a Magnesium-deficient diet
as indicated above.
The H6PD is a reticular NADP+-dependent oxidase that generates high levels of reduced
pyridine nucleotides within the E.R. This pyridine nucleotide pool can then be utilized to support
various enzymatic reactions including fatty acid synthesis, cholesterol synthesis, gluthatione
reductase activity and 11BHSD1 activity.
Consistent with the later process, we have provided evidence that under Mg2+- deficient
conditions, cortisone is converted to active cortisol at a higher rate. In addition, the mRNA and
the protein expression of 11BHSD1 are significantly increased under these conditions.The
increased production of cortisol is further validated by its genomic effect on gluconeogenic
genes such as PEPCK and F1,6BPase.
The effect of cortisol is in addition to the enhancement of these gene expression induced
by the reduced cellular Mg2+ level. To the best of our knowledge, the culture media used in our
experiments do not contain cortisone or cortisol. Hence, the reported results are the consequence
of the cortisone added to our experimental model.
It would appear that the increase in gene expression observed in the absence of
glucocorticoid is due directly or indirectly to the changes observed in cellular Mg2+ content.
More specific studies are required to address this point and determine the underlying
mechanism(s) responsible for the increased gene and protein expression. It has to be noted that
low Mg2+ results per se in an increase genomic and functional expression of H6PD, thus setting
ideal conditions to promote enhanced substrate (G6P) oxidation and NADPH production to
support a higher 11βHSD1 activity.
88
Despite the increase in expression under Mg2+ deficient conditions, H6PD and G6Pase activity
presents a dynamic and inversely proportional regulation by exogenous Mg2+. This effect
disappears when the permeability of the ER membrane to G6P is artificially enhanced with
taurocholate or other agents (18), suggesting that Mg2+ exerts its regulatory effect on the entry
mechanism that allows G6P into the ER lumen, where the catalytic sites of G6Pase and H6PD
are located.
Magnesium ions have an inversely proportional inhibitory effect not only on the G6P entry
rate, whereby they limit the amount of substrate hydrolyzed by the G6Pase or oxidized by the
H6PD but also on the expression of gene products involved in the key rate-limiting reactions of
gluconeogenesis. Both PEPCK and F1,6BPase mRNA are increased 2-3 fold under Mg2+
deficient conditions, and their expression is further enhanced upon cortisone to cortisol
conversion, conversely, returning extracellular Mg2+ concentration to physiological levels
reverses the trend of mRNA expression of these genes, although their sensitivity varies
remarkably.
Because restoration of Mg2+ levels affects also H6PD expression, it cannot be excluded
that the effect of Mg2+ on the expression of the mentioned gluconeogenic genes is indirect via
changes in H6PD expression of activity.
Taken together, these data support the hypothesis that hepatic Mg2+ deficiency induces a
metabolic switch within the hepatocyte whereby gluconeogenesis rather than glycolysis or
glycogen synthesis is promoted. This effect is underlined by the increased activity of G6Pase, the
ultimate enzymatic step of this pathway (Fig 15). At the same time the oxidation of G6P by
H6PD set the co-enzymatic conditions to increase cortisone to cortisol conversion, which further
promotes and sustains gluconeogenesis.
89
Several corollaries are associated with this scenario. For example, increased levels of
reticular NADPH provide ideal conditions to support fatty acids, cholesterol, and GSH
metabolism, with major implications for the hepatocytes metabolism and redox state (Fig. 15).
All these possibilities need to be investigated in detail in future studies as well as the impact of
increased cortisol production.
More pertinent to metabolic syndrome and its systematic implication is the consideration
that adipose tissue and neutrophils possess similar enzymatic machinery (i.e. H6PD and
11BHSD1). Although it remains to be proven that Mg2+ modulates cortisol production in
adipocytes and neutrophils to an extent qualitatively comparable to what we observed in the
hepatocyte cell line used in this study, the likelihood that this may indeed occur is suggested by
our published evidence that HL-60, a neutrophil-like cell line, respond to Mg2+ deficient
conditions by up-regulating H6PD expression and activity in a manner similar to HepG2 cells
(8).
The fact that the results reported here were obtained in an hepatocyte cell line of human origin
hints at the possibility that similar results may take place in patients, at least to some extent,
although this possibility remains to be experimentally assessed.
90
Figure 15: The role of Thiazolidinediones in the regulation of hepatic glucose metabolism
correlates with the observed effects of magnesium deficiency in HepG2 cells (162).
Re-used with permission. From Phielix Esther. “The role of metformin and thiazolidinediones in
the regulation of hepatic glucose metabolism and its clinical impact”. (Appendix A)
91
CHAPTER IV
CONCLUSION & FUTURE DIRECTIONS
Although with some experimental limitations, this thesis tested the hypothesis that
Mg2+ deficiency is a precursor of the metabolic changes consistent with the metabolic syndrome
and ultimately with insulin resistance and type 2 diabetes.
Our results indicate that under Mg2+ deficient conditions, liver cells and neutrophils in the
circulation up-regulate expression and activity of reticular H6PD and the enzymatically
associated 11β-HSD1. The increase in cortisone to cortisol conversion observed under our
experimental conditions and the associated up-regulation of specific gluconeogenic genes in
living cells suggest the setting of conditions that mimic “fast” state or diabetic conditions despite
the presence of glucose in the extracellular medium at physiological levels. Future studies will
have to address the implications of increased cortisol production for basal and stimulated insulin
receptor signaling and the regeneration of associated genes including those involved in glucose,
fatty acid and cholesterol metabolism (Figure 16).
92
Figure 16: Proposed mechanism of the effect of Mg2+ deficiency on glucose metabolism
in liver hepatocytes.
93
References
1) McCarthy, J. Kumar, R. Disorders of WATER, Electrolytes, and Acid-Base: Divalent Cation
Metabolism: Magnesium. Ed. Schrier Robert, Vol.1
2) Nagai, N. Ito,Y. Effect of Magnesium Ion Supplementation on Obesity and Diabetes
Mellitus in Otsuka Long-Evans Tokushima Fatty (OLETF) Rats Under Excessive Food
Intake. Source Journal of oleo science, 2013, 62, 6, 403-408
3) Institute of Medicine. Food and Nutrition Board. Dietary Reference Intakes: Calcium,
Phosphorous, Magnesium, Vitamin D and Fluoride. National Academy Press. Washington,
DC, 1999.
4) http://ods.od.nih.gov/factsheets/magnesium.
5) Birch NJ, Preface. In 'Magnesium and the cell' (ed. Birch, N. J.), pp. vii-viii. Academic
Press, London. Academic Press; 1993
6) Metal ions in biological systems; vol. 26. Magnesium and its role in biology, nutrition and
physiology Edited by H. Sigel and A. Sigel. 744pp. 1990. Dekker, New York. Comparative
Biochemistry and Physiology Part A: Physiology. 1991; 100(1):231-.
7) Sigel H, Sigel A. Compendium on magnesium and its role in biology, nutrition, and
physiology. New York: Dekker; 1990.
8) Quamme GA, Dirks JH. The physiology of renal magnesium handling. Kidney and Blood
Pressure Research. 1986; 9(5):257-69.
9) Briebart, S. Lee, JS. McCord, A. Forbes, G. Relation of age to radiomagnesium in bone.
Proc. Soc. Exp. Biol. Med., 1960: 105; 361-363.
10) Alfrey AC, Miller NL, Trow R, Effect of age and magnesium depletion on bone
magnesium pools in rats. J Clin Invest. 1974; 54(5):1074-81.
94
11) Eby, GA. Eby, KL. Rapid recovery from major depression using magnesium treatment.
Medical Hypotheses. 2006: 67 (2); 362-370.
12) Department of Health. 1991. Dietary Reference Values for Food Energy and Nutrients for
the United Kingdom. Report on Health and Social Subjects No. 41. London. HMSO.
13) Food and Nutrition Board/ National Research Council. 1989. Recommended Dietary
Allowances. 10th edition. Washington, National Academy Press.
14) Sanui H, Rubin H. Correlated effects of external magnesium on cation content and DNA
synthesis in culture chicken embryo fibroblasts. J Cell Physiol. 1977; 92(1):23-31.
15) Flatman W. In magnesium and the cell, (birch, N. J., ed.), academic press, New York,.
1993:197-216.
16) Romani A, Marfella C, Scarpa A. Regulation of magnesium uptake and release in the heart
and in isolated ventricular myocytes (1993a). Circ. Res. 72, 1139-I148.
17) Romani A, Marfella C, Scarpa A. Hormonal stimulation of Mg2+ uptake in hepatocytes.
Regulation by plasma membrane and intracellular organelles. Y. biol. chem.1993b;
268:15489-95.
18) Romani A. Cellular magnesium homeostasis. Archives of Biochemistry and Biophysics.
2011; 512:1-23.
19) Gómez-Ayala AE, Lisbona F, López-Aliaga I, Pallarés I, Barrionuevo M, Hartiti S, et al.
The absorption of iron, calcium, phosphorus, magnesium, copper and zinc in the jejunum–
ileum of control and iron-deficient rats. Laboratory Animals. 1998 January 01; 32(1):72-9.
20) Baillien M, Cogneau M. Characterisation of two mechanisms of (28)Mg uptake in rat
jejunal brush border membrane vesicles. Magnesium. 1995; 8:331-9.
95
21) Baillien H, Wang M, Cogneau M. Uptake of (28)Mg duodenal and jejunal brush border
membrane vesicles in the rat. Magnesium. 1995; 8:315-29.
22) Romani A. Magnesium homeostasis and alcohol consumption. Magnesium Res. 2008;
21:197-204.
23) Romani A, Scarpa A. Regulation of cell magnesium. Arch. Biochem. Biophys.1992; 298, 112.
24) Wolf FI, Cittadini A. Chemistry and biochemistry of magnesium. Mol Aspects Med. 2003
2/6; 24(1–3):3-9.
25) Wolf FI, Torsello A, Fasanella S, Cittadini A. Cell physiology of magnesium. Mol Aspects
Med. 2003 2/6; 24(1–3):11-26.
26) Gunther T, Vormann J, Forster R. Regulation of intracellular magnesium by Mg2+ efflux.
Biochem. Biophys. Res. Commun. 1984; 119:124-31.
27) Günther T, Vormann J. Mg2+ efflux is accomplished by an amiloride-sensitive Na+/Mg2+
antiport. Biochem Biophys Res Commun. 1985 7/31; 130(2):540-5.
28) Gunther T. Mechanisms and regulation of Mg2+ efflux and Mg2+ influx. Miner Electrolyte
Metab. 1993; 19:259-65.
29) Romani A. Cellular magnesium homeostasis in mammalian cells, in metal ions in life
science: Metallomics and the cell. (Bianci L, ed.), Sigel H and Sigel RKO series Eds. in
press. 2012; 12.
30) Halestrap A, Kerr P, Javadov S, Woodfield K. Elucidating the molecular mechanism of the
permeability transition pore and its role in reperfusion injury of the heart. Biochem.
Biophys. Acta. 1998; 1366:79-94.
96
31) Bruce S, Masafumi M, Byung P. Abnormalities in the mitochondrial permeability transition
in diabetic rats. Biochemical and Biophysical Research Communications. 1996; 222:519-23.
32) Bolden G, Shulman G. Free fatty acids in obesity and type 2 diabetes: Defining their role in
the developement of insulin resistance and beta cell dysfunction. Eur. J. Clin. Invest. 2002;
32(Suppl 3):14-23.
33) Carr M, Brunzell J. Abdominal obesity and dyslipidemia in the metabolic syndrome:
Importanc of type 2 diabetes and familial combined hyperlipidemia in coronary artery
disease risk. The Journal of Clinical Biochemistry and Metabolism. 1989; 6:2601.
34) Fredericks W, Kummerlin I, Bosch K, Vreeling-Sindelarova H, Jonka A, Van-Norden C.
NADPH production by the pentose phosphate pathway in the zona fasiculata of rat adrenal
gland. J. Histo. Chem. Cytochem. 2007; 55(9):975-80.
35) Jungermann K, Katz N. Functional hepatocellular heterogeneity. Hepatology. 1982; 2:38595.
36) Jungermann K, Katz N. Functional specialization of different hepatocyte populations.
Physiol. Rev. 1989; 69:708-64.
37) Fagan T, Romani A. Activation of Na+ - Ca2+ -dependent Mg2+ extrusion by alpha1- and
beta-adrenergic agonists in rat liver cells. Am J Physiol. 2000; 279:G1145-56.
38) Torres L, Younger J, Romani A. Role of glucose in modulating Mg2+ homeostasis in liver
cells from starved rats. Am J Physiol. 2005; 288(2):G195-206.
39) Barbagallo M, Dominguez L. Magnesium metabolism in type 2 diabetes mellitus, metabolic
syndrome and insulin resistance. Arch Biochem Biophys. 2007; 458:40-7.
97
40) Nadler J, Scott S. Evidence that poiglitazone increases intracellular free magnesium
concentration in freshly isolated rat adipocytes. Biochem. Biophys. Res. Commun. 1994;
202:416-21.
41) Romani A, Matthews V, Scarpa A. Parallel stimulation of glucose and Mg2+ accumulation
by insulin in rat hearts and cardiac ventricular myocytes. Circ Res. 2000; 86(3):326-33.
42) Postic, C, Dentin, R,Girard, J,. Role of the liver in the control of carbohydrate and lipid
homeostasis. Diabetes and Metabolism. 2004; 30(5):398-408.
43) Maguire M. (1990). Magnesium: a regulated and regulatory cation. Met. Ions BioL. Syst.
26, 135-153.
44) Romani A, Dowell E, Scarpa A. cAMP -induced Mg2+ release from rat liver hepatocytes
permeabilised hepatocytes and isolated mitochondria. J. biol. Chem. 1991; 266, 2437624384.
45) Hutson M, Berkich A, Williams D, LaNoue F, Briggs W. (1989). Biochemistry 28, 4325
4332.
46) Piskacek M, Zotova L, Zsurka G, Schweyen R. Conditional knockdown of hMRS2 results
in loss of mitochondrial Mg(2+) uptake and cell death. J Cell Mol Med. 2009; 13(4):693700.
47) Akerman K. Inhibition and stimulation of respiration-linked Mg2+ efflux in rat heart
mitochondria. J Bioenerg Biomembr. 1981; 13(3-4):133-9.
48) Panov A, Scarpa A. Independent modulation of the activity of alpha-ketoglutarate
dehydrogenase complex by Ca2+ and Mg2+. Biochemistry. 1996; 35(2):427-32.
49) Panov A, Scarpa A. Mg2+ control of respiration in isolated rat liver mitochondria.
Biochemistry. 1996; 35(12849):12856.
98
50) Corkey B, Duszynski J, Rich T, Matschinsky B, Williamson J. Regulation of free and bound
magnesium in rat hepatocytes and isolated mitochondria. J. Biol. Chem. 1986; 261:2567-74.
51) Jung DW, Brierley GP. Magnesium transport by mitochondria. J Bioenerg Biomembr. 1994;
26(5):527-35.
52) Bogucka K, Wojtczak L. (1971). Biochem. Biophys. Res. Commun.1971: 44, 1330-1338.
53) Senior E. Tightly bound magnesium in mitochondrial adenosine triphosphatase from beef
heart. J. biol. chem. 254, 11319-11322.
54) Lin J, Pan L, Chen I. The subunit location of magnesium in cytochrome c oxidase. (1993). J.
biol. chem. 268, 22210- 22214.
55) George GA HF, Effect of magnesium deficiency on energy metabolism and protein
synthesis by liver. Int J Biochem. 1978; 9(6):421-5.
56) Vitale JJ, Nakamura M, Hegsted DM, The effect of magnesium deficiency on oxidative
phosphorylation. The Journal of biological chemistry. 1957; 228(2):573-6.
57) Di Giorgio J, Vitale JJ, Hellersteinee. Sarcosomes and magnesium deficiency in ducks.
Biochem J. 1962; 82:184-7.
58) Rutter GA, Osbaldeston NJ, McCormack JG,Denton RM,. Measurement of matrix free
Mg2+ concentration in rat heart mitochondria by using entrapped fluorescent probes.
Biochem J. 1990; 271(3):627-34.
59) Saad S, Peter M, Dechant R. In scarcity and abundance: Metabolic signals regulating cell
growth. Physiology. 2013; 28:298-309.
60) Romani. A. Regulation of magnesium homeostasis and transport in mammalian cells.
Archives of Biochemistry and Biophysics. 2007; 458 (1): 90-102.
99
61) Firoz, M. Graber, M. Bioavailability of US commercial magnesium preparations. Magnes.
Res. 2001: 4; 257-262.
62) Granner D, O'Brien R. Molecular physiology and genetics of NIDDM. Importance of
metabolic staging. Diabetes Care. 1992; 15(3):369-95.
63) McNeill DA, Herbein JH, Ritchey SJ. Hepatic gluconeogenic enzymes, plasma insulin and
glucagon response to magnesium deficiency and fasting. The Journal of Nutrition. 1982
April 01; 112(4):736-43.
64) Balon T, Gu J, Tokuyama Y, Jasman A, Nadler J. Magnesium supplementation reduces
developement of diabetes in rat model of spontaneous NIDDM. Am J Physiol. 1995;
269:E745-52.
65) Xu J, Xu W, Yao H, Sun W, Zhou Q, Cai L. Associations of serum and urinary magnesium
with the pre-diabetes, diabetes and diabetic complications in the chinese northeast
population. PLoS ONE. 2013; 8(e56750).
66) He L, Cao J, Meng S, Ma A, Radovick S, Wondeisford F. Activation of basal
gluconeogenesis by coactivator p300 maintains hepatic glycogen storage. Mol Endocrinol.
2013; 27(8):1322-32.
67) Leturque A, Brot-Laroche E, Le Gall M, GLUT2 mutations, translocation, and receptor
function in diet sugar managing. American journal of physiology. Endocrinology and
metabolism. 2009; 296(5):985-92.
68) Sato, Y. Yonekura, Y. Tsukamoto, T. Kakita, H. Tateishi, Y. Komiya, T. Yonemoto, S.
Muso, E. A case of hypomagnesemia linked to refractory hypokalemia and hypocalcemia
with short bowel syndrome. Nihon Jinzo Gakkai Shi. 2012; 54(8):1197-202.
69) Zalman S. Agus. Hypomagnesemia. JASN Jul 1, 1999 10: 1616-1622.
100
70) Swaminathan, R. Magnesium Metabolism and its Disorders. Clin Biochem Rev. 2003;
24(2): 47–66.
71) Whang R, Ryder KW, Frequency of hypomagnesemia and hypermagnesemia. Requested vs.
routine. JAMA: the journal of the American Medical Association. 1990; 263(22):3063-4.
72) Guerrero-Romero, F1. Rodríguez-Morán, M. Low serum magnesium levels and metabolic
syndrome. Acta Diabetol. 2002 Dec; 39(4):209-13.
73) Resnick L, Altura B, Gupta R. Intracellular and extracellular magnesium depletion in type II
(non-insulin-dependent) diabetes mellitus. Diabetologia. 1993a; 36:767-70.
74) Whang R, Oei T, Aikawa J, Watanabe A, Vannatta J, Fryer A, et al. Predictors of clinical
hypomagnesemia. Hypokalemia, hypophosphatemia, hyponatremia, and hypocalcemia.
Arch Intern Med. 1984; 144(9):1794-6.
75) Brusco L. Magnesium homeostasis in the operating room and intensive care unit. Progress
in Anesthesiology VIII, Chapter 3, Saunders. 1994:47-56.
76) Chernow B, Bamberger S, Stoiko M,Vadnais M, Mills, S. Hoellerich V, et al.
Hypomagnesemia in patients in postoperative intensive care. Chest. 1989; 95:391-7.
77) Meludu S, Adeniyi F, Taylor G. Plasma and erythrocyte magnesium response to oral
glucose loading in healthy Nigerians. Magnesium Research 8(Suppl, June). 1995; 53.
78) Morley,John E.; Thomas,D.R. Geriatric nutrition, 2007
79) Goyal, V. Agrawal, Y. Chugh, K. Can Magnesium be an Influencing Element in Type 2
Diabetics? Research Journal of Pharmaceutical, Biological and Chemical Sciences. 2014;
5(1): 305-309.
101
80) MELUDU S C, ADENIYI F A. Effect of magnesium Supplementation on plasma Glucose
in Patients with Diabetes mellitus. African Journal of Biomedical Research. 2001; 4(3):1113.
81) Nutrition recommendations and principles for people with diabetes mellitus. Diabets Care.
1999; 22:S42-5.
82) Kao W, Linda F, Aaron R, Nieto F, Javier M, Jing-Ping M, et al. Serum and dietary
magnesium and the risk for type 2 diabetes mellitus: The atherosclerosis risk in
communities study. Arch Intern Med. 1999; 159(18):2151-9.
83) Lima M, Cruz T, Pousada J, Rodrigues L, Barbosa K, Cangucu V. The effect of magnesium
supplementation in increasing doses on the control of type 2 diabetes. Diabetes care. 1998;
21(5):682-6.
84) Lopez-Ridaura R, Willett WC, Rimm EB, Liu S, Stampfer MJ, Manson JE,Hu FB,.
Magnesium intake and risk of type 2 diabetes in men and women. Diabetes Care. 2004;
27(1):134-40.
85) Meyer KA, Kushi LH, Jacobs DR Jr, Slavin J, Sellers TA,Folsom AR,. Carbohydrates,
dietary fiber, and incident type II diabetes in older women. Am J Clin Nutr. 2000;
71(4):921-30.
86) National Academy of Clinical Biochemistry.Laboratory Analysis in the Diagnosis and
Management of Diabetes Mellitus. AACC.
87) Song Y, Dai Q, He K. Magnesium intake, insulin resistance, and type 2 diabetes. North
American Journal of Medicine and Science. 2013; 6(1):9-15.
88) Lostroh A, Krahl M. Accumulation in vitro of magnesium and potassium in rat uterus ion
pump activity. Biochem. Biophys. Acta. 1973; 291:260-8.
102
89) Dribi L, Seyrantepe V, Fougerat A, Pan X, Bonneil E, Thibault P, et al. Positive regulation
of insulin signaling by neuraminidase 1. Diabetes. 2013; 62:2338-46.
90) Hwang D, Yan C, Nadler J. Insulin increases intracellular magnesium transport in human
platelets. J. Clin. Endocrinol. Metabol. 1993; 76:549-53.
91) Kolterman O, Gray R, Griffin J. Receptor and postreceptor defects contributes to the insulin
resistance in non-insulin-dependent diabetes mellitus. J. Clin. Invest. 1981; 68:957-69.
92) Suárez A, Pulido N, Casla A, Casanova B, Arrieta F, Rovira A,. Impaired tyrosine-kinase
activity of muscle insulin receptors from hypomagnesaemic rats. Diabetologia. 1995;
38(11):1262-70.
93) Schnack C, Bauer I, Pregnant P. Hypomagnesaemia in type 2 (non-insulin dependent)
diabetes mellitus is not corrected by improvement of long-term metabolic control.
Diabetologia 35, 1992; 35:77-9.
94) Vanroellen W, Van-Gaal L, Van-Rooy P, De Leeuw I. Serum and erythrocyte magnesium
levels in type and type II diabetes. Acta Diabetol. 1985; 22:185-90.
95) Sjorgen A, Floren C, Nilsom A. Magnesium, potassium and zinc deficiency in subjects with
type II diabetes mellitus. Acta Med. Scand. 1988; 224:461-5.
96) Mather H, Nisbet J, Burton G. Hypomagnesaemia in diabetes. Chim. Clin. Acta. 1979;
95:235-42.
97) Colditz G, Manson J, Stampfer M. Diet and risk of clinical diabetes in women. Am. J. Clin.
Nutr. 1993; 55:1018-23.
98) Rosolová H, Mayer O, Reaven GM. Insulin-mediated glucose disposal is decreased in
normal subjects with relatively low plasma magnesium concentrations. Metab Clin Exp.
2000; 49(3):418-20.
103
99) Paolisso G, Ravussin E. Intracellular magnesium and insulin resistance: Results in pima
Indians and caucasians. J. Clin. Endocrinol. Metabol. 1995; 80:1382-5.
100) Wills M, Sunderman W, and Savory J. Methods for the estimation of serum magnesium
in clinical laboratories. Magnesium. 1986; 5:317-27.
101) Johnson S. The multifaceted and widespread pathology of magnesium deficiency.
Medical Hypotheses. 2001; 56(2):163-70.
102) Barfell A, Crumbly A, Romani A. Enhanced glucose 6-phosphatase activity in liver of
rats exposed to Mg2+ -deficient diet. Arch Biochem Biophys. 2011; 509(2):157-63.
103) Doleh L, Romani A. Biphasic effect of extra-reticular Mg2+ on hepatic G6P transport
and hydrolysis. Arch Biochem Biophys. 2007 11/15; 467(2):283-90.
104) Senesi S, Csala M, Marcolongo P, Fulceri R, Mandl J, Banhegyi G, et al. Hexose-6phosphate dehydrogenase in the endoplasmic reticulum. Biol. Chem. 2010; 391:1-8.
105) Bánhegyi G, Benedetti A, Fulceri R, Senesi S. Cooperativity between 11ß-hydroxysteroid
dehydrogenase type 1 and hexose-6-phosphate dehydrogenase in the lumen of the
endoplasmic reticulum. Journal of Biological Chemistry. 2004 June 25; 279(26):27017-21.
106) Mandula B, Srivastava SK, Beutler E. Hexose-6-phosphate dehydrogenase: Distribution
in rat tissues and effect of diet, age and steroids. Arch Biochem Biophys. 1970 11;
141(1):155-61.
107) Kardon T, Senesi S, Marcolongo P, Legeza B, Bánhegyi G, Mandl J, et al. Maintenance
of luminal NADPH in the endoplasmic reticulum promotes the survival of human neutrophil
granulocytes. FEBS Lett. 2008 6/11; 582(13):1809-15.
104
108) Marcolongo P, Senesi S, Giunti R, Csala M, Fulceri R, Bánhegyi G, et al. Expression of
hexose-6-phosphate dehydrogenase in rat tissues. J Steroid Biochem Mol Biol. 2011 9;
126(3–5):57-64.
109) Voma C, Barfell A, Croniger C, Romani A. Reduced cellular Mg2+ content enhances
hexose 6-phosphate dehydrogenase activity and expression in HepG2 and HL-60 cells.
Archives of Biochemistry and Biophysics. 2014; 548(15):11-9.
110) Doleh L, Romani A. Biphasic effect of extra-reticular Mg2+ on hepatic G6P transport
and hydrolysis. Arch Biochem Biophys. 2007 11/15; 467(2):283-90.
111) Mithieux G, Vega F, Riou J. The liver glucose-6-phosphatase of intact microsomes is
inhibited and displays sigmoid kinetics in the presence of alpha-ketoglutarate-magnesium
and oxaloacetate-magnesium chelates. Journal of biological chemistry J Biol Chem. 1990;
265:20364-8.
112) Senesi S, Legeza B, Balázs Z, Csala M, Marcolongo P, Kereszturi E, Szelényi P, Egger
C, Fulceri R, Mandl J, Giunti R, Odermatt A, Bánhegyi G,Benedetti A,. Contribution of
fructose-6-phosphate to glucocorticoid activation in the endoplasmic reticulum: Possible
implication in the metabolic syndrome. Endocrinology. 2010; 151(10):4830-9.
113) Marcolongo P, Piccirella S, Senesi S, Wunderlich L, Gerin I, Mandl J, et al. The glucose6-phosphate transporter-hexose-6-phosphate dehydrogenase-11beta-hydroxysteroid
dehydrogenase type 1 system of the adipose tissue. Endocrinology. 2007; 148:2487-95.
114) Pickett, JS. Bowers, KE. Fierke, CA. Mutagenesis Studies of Protein Farnesyltransferase
Implicate Aspartate β352 as Magnesium Ligand. The Journal of Biological Chemistry.
2003: 278; 51243-51250.
105
115) Bock, CW. Katz, AK. Markham, GD. and Glusker, JP. Manganese as a Replacement for
Magnesium and Zinc: Functional Comparison of the Divalent Ions. J. Am. Chem. Soc.
1999: 121 (32); 7360–7372.
116) Romani A. In metal ions in life science: Metallomics and the cell, (Sigel A, Sigel H, and
Sigel RKO series Eds). Basel, Switzerland. 2013; 12:69-118.
117) Bond M, Vadasz G, Somlyo AV, Somlyo AP. Subcellular calcium and magnesium
mobilization in rat liver stimulated in vivo with vasopressin and glucagon. Journal of
Biological Chemistry. 1987 November 15; 262(32):15630-6.
118) Foster J, Nordlie R. The biochemistry and molecular biology of the glucose-6phosphatase system. Exp. Biol. Med. (Maywood). 2002; 227:601-8.
119) Gerin I, Schaftingen E. Evidence for glucose-6-phosphate transport in rat liver
microsomes. FEBS Lett. 2002; 517:257-60.
120) Clarke J, Mason P. Murine hexose-6-phosphate dehydrogenase: A bifunctional enzyme
with broad substrate specificity and 6-phosphogluconolactonase activity. Arch Biochem
Biophys. 2003; 415:229-34.
121) Corkey B, Duszynski J, Rich T, Matschinsky B, Williamson J. Regulation of free and
bound magnesium in rat hepatocytes and isolated mitochondria. J. Biol. Chem. 1986;
261:2567-74.
122) Senesi S, Marcolongo P, Manini I, Fulceri R, Sorrentino V, Csala M, et al. Constant
expression of hexose-6-phosphate dehydrogenase during differentiation of human adiposederived mesenchymal stem cells. . J Mol Endocrinol. 2008; 41(3):125-33.
123) Senesi S, Legeza B, Balázs Z, Csala M, Marcolongo P, Kereszturi E, Szelényi P, Egger
C, Fulceri R, Mandl J, Giunti R, Odermatt A, Bánhegyi G,Benedetti A,. Contribution of
106
fructose-6-phosphate to glucocorticoid activation in the endoplasmic reticulum: Possible
implication in the metabolic syndrome. Endocrinology. 2010; 151(10):4830-9.
124) Mazur A, Maier J, Rock E, Gueux E, Nowacki W, Benedetti A. Magnesium and the
inflammatory response: Potential physiopathological implications. Arch Biochem Biophys
2007; 458: 48-56. 2007; 458:48-56.
125) Park J, Rho HK, Kim KH, Choe SS, Lee YS, Kim JB. Overexpression of glucose-6phosphate dehydrogenase is associated with lipid dysregulation and insulin resistance in
obesity. Molecular and Cellular Biology. 2005 June 15; 25(12):5146-57.
126) Tarantino G, Finelli C. Pathogenesis of hepatic steatosis: The link between
hypercortisolism and non-alcoholic fatty liver disease. World J Gastroenterol. 2013;
19:6735-43.
127) Rahimi R, Landaverde C. Nonalcoholic fatty liver disease and the metabolic syndrome:
Clinical implications and treatment. Nutr Clin Pract. 2013; 28:40-51.
128) Wilkes JJ, Nagy LE. Chronic ethanol feeding impairs glucose tolerance but does not
produce skeletal muscle insulin resistance in rat epitrochlearis muscle. Alcoholism: Clinical
and Experimental Research. 1996; 20(6):1016-22.
129) Tessman P, Romani A. Acute effect of EtOH on Mg2+ homeostasis in liver cells:
Evidence for the activation of an Na+/Mg2+ exchanger. Am J Physiol. 1998; 275:G110616.
130) Romani A, Scarpa A. Hormonal control of Mg2+ transport in the heart. Nature. 1990
Aug 30; 346(6287):841-4.
131) Fernández-Real J, Pugeat M, Emptoz-Bonneton A, Ricart W. Study of the effect of
changing glucose, insulin, and insulin-like growth factor-I levels on serum corticosteroid
107
binding globulin in lean, obese, and obese subjects with glucose intolerance. Metabolism.
2001; 50(10):1248-52.
132) Romani A, Scarpa A. Hormonal control of Mg2+ transport in the heart. Nature. 1990
Aug 30; 346(6287):841-4.
133) Kotaka M, Gover S, Vandeputte-Rutten L, Au SW, Lam VM, Adams, MJ. Structural
studies of glucose-6-phosphate and NADP+ binding to human glucose-6-phosphate
dehydrogenase. Acta Crystallogr D Biol Crystallogr., 2005, 61, Pt 5, 495-504.
134) Banhegyi G, Csala M, Benedetti A. Hexose-6-phosphate dehydrogenase: Linking
endocrinology and metabolism in the endoplasmic reticulum. Journal of Molecular
Endocrinology Journal of Molecular Endocrinology. 2008; 42(4):283-9.
135) Ponsuksili S, Du Y, Murani E, Schwerin M, Wimmers K. Elucidating molecular
networks that either affect or respond to plasma cortisol concentration in target tissues of
liver and muscle. Genetics. 2012 Nov; 192(3):1109-22.
136) Emptoz-Bonneton A, Crave J, LeJeune H, Brébant C, Pugeat M. Corticosteroid-binding
globulin synthesis regulation by cytokines and glucocorticoids in human hepatoblastomaderived (HepG2) cells. J Clin Endocrinol Metab. 1997 Nov; 82(11):3758-62.
137) Walker B, Andrew R. Tissue production of cortisol by 11beta-hydroxysteroid
dehydrogenase type 1 and metabolic disease. Ann N Y Acad Sci. 2006; 1083:165-84.
138) Peckett A, Wright D, Riddell C. The effects of glucocorticoids on adipos tissue lipid
metabolism. Metabolism. 2011; 60:1500-10.
139) Wiessman, C. The Metabolic Response to Stress: An Overview an Update.
Anesthesiology. 1990: 73; 308-327.
108
140) Abraham S, Rubino D, Sinaii N, Ramsey S, Nieman L. Cortisol, obesity, and the
metabolic syndrome: A cross-sectional study of obese subjects and review of the literature.
Obesity (Silver Spring). 2013 Jan; 21(1):E105-17.
141) Liu Y, Nakagawa Y, Wang Y, Liu L, Du H, Wang W, et al. Reduction of hepatic
glucocorticoid receptor and hexose-6-phosphate dehydrogenase expression ameliorates dietinduced obesity and insulin resistance in mice. J Mol Endocrinol. 2008;41(2):53-64.
142) Odermatt A, Nashev L. The glucocorticoid-activating enzyme 11B-hydroxysteroid
dehydrogenase type 1 has broad substrate specificity: Physiological and toxicological
considerations. Journal of Steroid Biochemistry and Molecular Biology. 2010; 119:1-13.
143) Sales, CH. Santos, AR. Cintra, DE. Colli, C. Magnesium-deficient high-fat diet: Effects
on adiposity, lipid profile and insulin sensitivity in growing rats. Clin Nutr., 2013, pii:
S0261-5614, 1-10.
144) Lecube, A. Baena-Fustegueras, JA. Fort, JM. Pelegri, D. Hernandez, C. Simo, R.
Diabetes is the main factor accounting for hypomagnesemia in obese subjects. PLoS One,
2012, 7, 1, e30599.
145) Lowry OH, Rosebrough NJ, Farr AL,Randall RJ,. Protein measurement with the folin
phenol reagent. The Journal of biological chemistry. 1951; 193(1):265-75.
146) Labonte, B. Azoulay, N. Yerko, V. Turecki, G. Brunet, A. Epigenetic modulation of
glucocorticoid receptors in posttraumatic stress disorder. Transl Psychiatry. 2014: 4(3);
e368.
147) Lewis, JG. Elder, AP. The reactive center loop of corticosteroid-binding globulin (CBG)
is a protease target for cortisol release. Molecular and cellular endocrinology. 2014: 384(12); 96-101.
109
148) Henley, DE. Lightman, SL. New insights into corticosteroid-binding globulin and
glucocorticoid delivery. Neuroscience. 2011: 180; 1-8.
149) Torres,Lisa M. Konopnika,Bocena. Berti-Mattera,Liliana N. Liedtke,Carole. Romani,
Andrea. Defective Translocation of PKC in EtOH-Induced Inhibition of Mg2+
Accumulation in Rat Hepatocytes. Alcoholism: Clinical and Experimental Research. 2010:
34(9); 1659-1669.
150) Joharapurkar, A. Dhanesha, N. Shah, G. Kharul, R. Jain, M. 11B-Hydroxysteroid
dehydrogenase type 1: potential therapeutic target for metabolic syndrome. Pharmacological
Reports.2012: 64; 1055-1065.
151) Prasad, SV. Prashanth, A. Kumar, CP. Reddy, SJ. Giridharan, NV. Vajreswari, A. A
novel genetically-obese rat model with elevated 11beta-hydroxysteroid dehydrogenase type
1 activity in subcutaneous adipose tissue. Lipids in Health and Disease. 2010: 9(132); 1-6.
152) Prasad, SV. Kumar, SJ. Kumar, PU. Qadri, SS. Vajreswari, A. Dietary fatty acid
composition alters 11B-hydroxysteroid dehydrogenase type 1 gene expression in rat
retroperitoneal white adipose tissue. Lipids in Health and Disease. 2010: 9(111); 1-5.
153) Mariniello, B. Ronconi, V. Rilli, S. Bernante, P. Boscaro, M. Mantero, F. Giacchetti, G.
Adipose tissue 11B-hydroxysteroid dehydrogenase type 1 expression in obesity and
Cuchings syndrome. European Journal of Endocrinology. 2006: 155; 435-441.
154) Espindola-Antunes, D.; Kater, CE. Adipose tissue expression of 11B-Hydroxysteroid
dehydrogenase type 1 in cushings syndrome and in obesity. Arq Bras Endocrinol Metab
Arquivos Brasileiros de Endocrinologia & Metabologia. 2007: 51(8); 1397-1403.
110
155) Czegle I, Csala M, Mandi J, Benedetti A, Karadi I, Banhegyi G. G6PT-H6PDH11BHSD1 triad in the liver and its implication in the pathomechanism of the metabolic
syndrome. World j Hepatol. 2012; 4(4):129-38.
156) Kerlik, J. Rovensky, J. Vogeser, M. VIcek, M. Penesova, A. Radikova, Z. Evaluation of
11beta-hydroxysteroid dehydrogenase type 1 activity in female patients with rheumatoid
arthritis. Vnitr Lek. 2010: 56 (12); 1274-1278.
157) Gomez-Sanchez, EP. Romero, DG. Rodriguez, AF. Warden, MP. Krozowski, Z. GomezSanchez, CE. Hexose-6-phosphate dehydrogenase and 11beta-hydroxysteroid
dehydrogenase-1 tissue distribution in the rat. Endocrinology. 2008: 149(2); 525-533.
158) Czegle I, Margittai E, Senesi S, Benedetti A, Banhegyi G. Different expression and
distribution of 11B-hydroxysteroid dehydrogenase 1 in obese and lean animal models of
type 2 diabetes. Acta Physiologica Hungarica. 2008; 95(4):419-24.
159) Eby, GA. Eby, KL. Rapid recovery from major depression using magnesium treatment.
Medical Hypotheses. 2006: 67 (2); 362-370.
160) Department of Health. 1991. Dietary Reference Values for Food Energy and Nutrients for
the United Kingdom. Report on Health and Social Subjects No. 41. London. HMSO.
161) Jahnen-Dechent, W. Ketteler, M. Magnesium Basics. Clin Kidney J. 2012: 5 (Suppl 1);
i3-i14.
162)
Phielix, Ester. Szendroedi, Julia, Roden, Micheal. The role of metformin and
thiazolidinediones in the regulation of hepatic glucose metabolism and its clinical impact.
Trends Pharmacol Sci. 2011; 32(10):607.
111
APPENDIX
113
Appendix A
Copyright permission from Esther Phielix in: The role of metformin and thiazolidinediones in
the regulation of hepatic glucose metabolism and its clinical impact.
ELSEVIER LICENSE
TERMS AND CONDITIONS
Mar 01, 2014
This is a License Agreement between Chesinta B Voma ("You") and Elsevier ("Elsevier")
provided by Copyright Clearance Center ("CCC"). The license consists of your order
details, the terms and conditions provided by Elsevier, and the payment terms and
conditions.
Supplier
Elsevier Limited
The Boulevard,Langford Lane
Kidlington,Oxford,OX5 1GB,UK
Registered Company
Number
1982084
Customer name
Chesinta B Voma
Customer address
4100 WESTBROOK DR
Cleveland, OH 44144
License number
3335131072041
License date
Feb 23, 2014
Licensed content publisher
Elsevier
Licensed content publication Trends in Pharmacological Sciences
Licensed content title
The role of metformin and thiazolidinediones in the regulation of
hepatic glucose metabolism and its clinical impact
Licensed content author
Esther Phielix,Julia Szendroedi,Michael Roden
Licensed content date
October 2011
Licensed content volume
number
32
Licensed content issue
number
10
Number of pages
10
114
Start Page
607
End Page
616
Type of Use
reuse in a thesis/dissertation
Portion
figures/tables/illustrations
Number of
figures/tables/illustrations
1
Format
both print and electronic
Are you the author of this
Elsevier article?
No
Will you be translating?
No
Title of your
thesis/dissertation
MAGNESIUM DEFIECIENCY IMPLICATED IN THE ONSET OF
DIABETES AND OBESITY ONSET / PROGRESSION
Expected completion date
Apr 2014
Estimated size (number of
pages)
200
Elsevier VAT number
GB 494 6272 12
Permissions price
0.00 USD
VAT/Local Sales Tax
0.00 USD / 0.00 GBP
Total
0.00 USD
115