Subcellular localization of V-ATPase
subunits
Unnur Guðnadóttir
Líf- og umhverfisvísindadeild
Háskóli Íslands
2016
Subcellular localization of V-ATPase
subunits
Unnur Guðnadóttir
10 eininga ritgerð sem er hluti af
Baccalaureus Scientiarum gráðu í Sameindalíffræði
Leiðbeinandi
Eiríkur Steingrímsson
Sara Sigurbjörnsdóttir
Líf- og umhverfisvísindadeild
Verkfræði- og náttúruvísindasvið
Háskóli Íslands
Reykjavík, maí 2016
Subcellular localization of V-ATPase subunits
10 eininga ritgerð sem er hluti af Baccalaureus Scientiarum gráðu í Sameindalíffræði
Höfundarréttur © 2016 Unnur Guðnadóttir
Öll réttindi áskilin
Líf- og umhverfisvísindadeild
Verkfræði- og náttúruvísindasvið
Háskóli Íslands
Askja, Sturlugata 7
101 Reykjavík
Sími: 525 4000
Skráningarupplýsingar:
Unnur Guðnadóttir, 2016, Subcellular localization of V-ATPase subunits, BS ritgerð, Líf- og
umhverfisvísindadeild, Háskóli Íslands, 27 bls.
Reykjavík, maí 2016
Útdráttur
V-ATPasinn er próteinflóki sem situr á himnu frumu eða frumulíffæris og stjórnar sýrustigi
með því að dæla prótónum yfir himnuna. V-ATPasinn skiptist í 14 undireiningar sem raðast í
tvö hneppi, V0 og V1 hneppið. V0 hneppið dælir prótónum og situr í himnunni en V1 hneppið
hvatar vatnsrof ATP. Í V0 hneppinu er „a“ undireiningin en hún hefur fjögur ísóform; a1, a2,
a3 og a4. Þessi undireining er talin ákvarða staðsetningu V-ATPasans innan frumunnar.
Mismunandi ísóform einkenna mismunandi vefi, til dæmis er a2 að finna í milta og nýrum en
a3 í beinátsfrumum (e. osteoclasts). Eina frávikið frá þessu er a1 undireiningin, en hún virðist
vera tjáð í öllum frumum.
Í þessari tilraun var tjáning a2, a3 og a4 ísóformanna og staðsetning þeirra í frumunni skoðuð
í sortuæxlis-frumulínum. Það var gert með því að setja a2, a3 og a4 genin inn í pEGFP-N2
plasmíðið og tjá það í Skmel28 og 501Mel frumulínum. Einnig var sértækni mótefna fyrir a2,
a3 og a4 skoðuð á western blotti en í ljós kom að þessi mótefni voru ekki nógu sértæk og virtust
lita fleira en undireiningarnar þrjár. Frumurnar með plasmíðunum voru svo skoðaðar í lagsjá
til þess að ákvarða staðsetningu ísóformanna. Þar sást að a2 og a3 ísóformin voru mest í klasa
rétt fyrir utan kjarnann en a4 ísóformið virtist dreifðari um frumuna. Þar að auki virtist a4
ísóformið minna tjáð í frumunum en a2 og a3 ísóformin miðað við lagsjármyndir. Ekki voru
gerðar magnmælingar.
Abstract
The V-ATPase is a proteincomplex which localizes to the plasma membrane or the membrane
of a cellular organ and regulates acidity by pumping protons. The V-ATPase consists of 14
subunits and two domains, the V0 and V1 domains. The V0 domain spans the membrane and
is a proton-translocation domain while the V1 is an ATP hydrolytic domain. The largest
subunit of the V0 domain is the “a” subunit which has four isoforms; a1, a2, a3 and a4. This
subunit is thought to be responsible for determining the localization of the V-ATPase inside
the cell and the different isoforms are characteristic for different tissues. For example, the a2
isoform can be found in the spleen and kidneys while the a3 is in osteoclasts. The only
exception from this rule is the a1 isoform which is expressed ubiquitously.
In this study the expression of the a2, a3 and a4 isoforms and their localization was examined
in melanoma cell lines. That was done by inserting the a2, a3 and a4 genes into pEGFP-N2
plasmids and transfecting Skmel28 and 501Mel cell lines with the plasmids. Antibody
specificity was also observed using western blots but it turned out the antibodies were not
specific enough and seemed to stain more than the isoforms of the a subunit. The cells
transfected with the plasmids were also examined using confocal microscopy to determine the
localization of the isoforms within the cell. It was observed that the a2 and a3 isoforms were
located close to the nucleus of the cells in a bundle while the a4 isoform seemed to be more
dispersed in the cell. From the images generated, the a4 isoform also seemed to be less
expressed in the cells than the a2 and a3 isoforms from the images, however no quantification
measurements were made.
Table of contents
Figures ..................................................................................................................................... iii
Tables ....................................................................................................................................... iv
Abbreviations ........................................................................................................................... v
Acknowledgements ................................................................................................................. vi
1 Introduction ........................................................................................................................... 1
1.1 Melanoma ......................................................................................................................... 1
1.2 Acidic microenvironment ................................................................................................. 2
1.3 The V-ATPase and its subunits ........................................................................................ 3
1.4 The V-ATPase and cancer................................................................................................ 4
2 Project aim............................................................................................................................. 6
3 Materials and methods ......................................................................................................... 7
3.1 Plasmid construction ........................................................................................................ 7
3.1.1 Amplification of V-ATPase genes ............................................................................ 7
3.1.2 Cloning V-ATPase into pEGFP-N2 .......................................................................... 7
3.2 Cell culture ....................................................................................................................... 9
3.3 Western blotting ............................................................................................................. 10
3.4 Fluorescent immunostaining and confocal imaging....................................................... 11
4 Results .................................................................................................................................. 12
4.1 Protein expression in plasmids and antibody specificity ............................................... 12
4.2 Comparison of GFP staining and GFP signal ................................................................ 13
4.3 Comparison of exogenous and endogenous V-ATPase ................................................. 14
4.4 Localization of the a2, a3 and a4 subunits in melanoma cells ....................................... 15
References ............................................................................................................................... 19
Appendix 1 – Protocols .......................................................................................................... 20
Appendix 2 – Primers for PCRs ........................................................................................... 26
Appendix 3 – Plasmids........................................................................................................... 27
ii
Figures
Figure 1: Melanoma incidences and mortality rates in the world……………………………....1
Figure 2: Cell invasion in malignant tumors…………………………………………………...2
Figure 3: The V-ATPase controls acidity……………………………………………………...3
Figure 4: The V-ATPase and its subunits………………………………………………………4
Figure 5: Flowchart describing the making of the plasmids……………………………………9
Figure 6: Western blot for protein expression………………………………………………...12
Figure 7: Western blot for antibody specificity……………………………………………….13
Figure 8: Comparison of GFP staining and GFP signal…………………………………….....14
Figure 9: Comparison of exogenous and endogenous V-ATPase…………………………….15
Figure 10: Localization of a2, a3 and a4 subunits……………………………………………..16
Figure 11: The p-EFGP-N2 plasmid………………………………………………………….27
Figure 12: The p-EFGP-N2 plasmid with the ATP6VA02 gene inserted……………………..27
Figure 13: The p-EFGP-N2 plasmid with the TCIRG1 gene inserted………………………...27
Figure 14: The p-EFGP-N2 plasmid with the ATP6V0A4 gene inserted……………………..27
iii
Tables
Table 1: Sticky end ligation solutions………………………………………………………..22
Table 2: Primers for PCR on HumanRef cDNA……………………………………………..26
Table 3: Primers for colony PCR…………………………………………………………….26
iv
Abbreviations
ATP
Adenosine Triphosphate
BRAF
Rapidly Accelerated Fibro Sarcoma B
CDKN2A
Cyclin-Dependent Kinase Inhibitor 2A
cDNA
Complementary DNA
EV
Empty Vector
FBS
Fetal Bovine Serum
GFP
Green Fluorescent Protein
GNA11
Guanine Nucleotide Binding Protein Alpha 11
GNAQ
Guanine Nucleotide Binding Protein Q
KIT
V-Kit Hardy-Zuckerman 4 Feline Sarcoma Viral
Oncogene Homolog
MITF
Microphthalmia-associated Transcription Factor
MSC
Mesenchymal Stem Cells
NRAS
Neuroblastoma RAS Viral (V-Ras) Oncogene
Homolog
ORF
Open Reading Frame
PCR
Polymerase Chain Reaction
RPMI
Roswell Park Memorial Institute medium
RT
Room Temperature
TGFß
Transforming Growth Factor Beta
UV
Ultra Violet
V-ATPase
Vacuolar-type H+-adenosine Triphosphatase
v
Acknowledgements
I would like to thank Eiríkur Steingrímsson for giving me the opportunity to work at his lab
and thereby gain invaluable experience and education. I would also like to thank Sara
Sigurbjörnsdóttir for all her help, advice, patience and for always having answers to all my
questions. Lastly I would like to thank everybody else in the lab for helping me when needed
and making this semester so wonderful.
vi
1 Introduction
1.1 Melanoma
Approximately 20% of the population gets cancer in their lifetime. The most common type of
cancer is cancer in the epithelial cells, or carcinomas [2, 3]. The largest epithelia of the human
body, the skin, consists of a neuroectodermal layer with pigment-producing cells called
melanocytes. Melanocytes are derived from the neural crest and are responsible for hair- and
eye color by producing melanin [1]. The lifecycle of melanocytes begins by differentiations
of melanocyte lineages from neural crest, then migration and proliferation of melanoblasts
which differentiate into melanocytes which then mature at target places. At their target places
they for example synthesize melanin in the epidermis, hair and iris of the eye, but melanocytes
can also be found in the inner hear, nervous system, heart amongst other places [4].
Excess UV radiation from the sun or tanning beds has been shown to be harmful to cells and
be able to cause mutations. The skin is
very exposed to the sun which can cause
mutations in melanocytes and cause skin
cancer called melanoma.
Contrary to
popular belief, sunburn alone is not
responsible for
exposure
in
individuals
melanoma, but
genetically
during
sun
susceptible
childhood
and
adolescence can induce moles.
The
number of moles present on an individual
is associated with increased risk for
melanoma and irregular, larger and
asymmetric moles are also an additional
risk factor [1].
Figure 1: Melanoma incidences and mortality rates in
Globally there are 15 – 25 incidences of the world [1].
melanoma per 100,000 individuals, most often in individuals between ages of 40 – 60 years
which is young considering other cancers. At the same time, melanoma is the most common
cancer in young adults aged 20 – 29 years. Survival rates vary between countries, being lowest
in Eastern Europe (<50%) but highest in northern and central Europe (>90%) for 5 year survival
1
after primary diagnosis. Melanoma occurrence also vary between populations depending on
for example, skin color and race, with the lowest rates in Africa and Asia (Figure 1) [1].
In addition to sun exposure, genetic mutations are known to predispose to melanoma. For
example the CDKN2A and MITF germline mutations lead to increased risk of melanoma.
Somatic mutations are frequently found in the in the BRAF, NRAS, KIT, GNAQ and GNA11
genes in melanoma tumors [1].
The best way to prevent melanoma is to apply sunscreen, avoid sunburn and tanning beds and
check moles regularly with a dermatologist if an individual has a lot of moles or family history.
However, it is not recommended to avoid the sun altogether since vitamin D from the sunlight
is essential [1].
1.2 Acidic microenvironment
When a tumor becomes malignant the tumor cells gain the ability to invade the surrounding
tissue and disperse. For the tumor cell to be able to spread it has to, among other things, create
an acidic microenvironment [5]. This microenvironment is made up of the extracellular matrix,
blood vessels and immune cells among others [6]. This low pH in the microenvironment can
also be caused by a side product from glycolysis (Warburg effect) which produces acidic
metabolites which are secreted out of the tumor cells [7]. By creating an acidic
microenvironment the cell promotes chemo resistance, invasiveness and proliferation (Figure
2).
Figure 2: In a malignant tumor the cells are able to invade its surroundings by disintegrating
their extracellular matrix. One method of doing that is by creating acidic microenvironments
[2].
Melanoma shows low extracellular pH in vivo.
It has been demonstrated in vitro that
mesenchymal stem cells (MSCs), which participate in tumor stroma development, grown in a
2
low pH medium stimulated melanoma xenografts more than in a standard pH medium [7].
MSCs grown in low pH medium also expressed higher levels of the growth factor TGFß which
plays a key role in epithelial-to-mesenchymal transition-like induction in melanoma cells [7].
Recent studies have shown that vacuolar ATP-ases, or V-ATPases are key players in changing
the pH levels and are highly expressed in metastatic cancer cells. Additionally, it has been
shown that inhibiting V-ATPase function suppresses cancer growth in a number of tumor cell
types [5]. This makes the V-ATPase a feasible target for cancer therapy.
1.3 The V-ATPase and its subunits
V-ATPases are evolutionary conserved holoenzymes which control the acidity of cells, their
organelles and surroundings by pumping protons across membranes, induced by ATP (Figure
3) [8]. The V-ATPase was first discovered in 1981 in the membrane of Saccharomyces
cerevisiae [6]. It consists of 14 subunits, which are divided into two functional domains, the
ATP-hydrolytic domain V1 and the proton-translocation domain V0. Together V1 and V0
operate as a rotary machine which pumps protons [9].
Figure 3: The V-ATPase can be located in various membranes within the cell. They keep one
side of the membrane acidic, and the other basic. [6]
Recently, it was shown that MITF is a master regulator of the V-ATPase and controls
transcription of various V-ATPase’s subunits in fly and mammals [8]. MITF, the master
regulator of pigmentation, is a known melanocytic transcription factor but has additional roles
in melanocytes and plays an important role in melanoma. Recently MITF upregulation has
been linked to reversible drug-tolerance against targeted interference with MAPK signaling
[10]. Different MITF levels are important at different times, because MITF reduction at the
3
right time can cause a tumor reduction by cell death, but at the wrong time its reduction can
cause drug resistance and tumor progression [10].
Subunit “a” of the V-ATPase is a part of the V0 domain. The domain is embedded in the
membrane where the V-ATPase is located and causes the active translocation of protons
(Figure 4). Subunit a is thought to be responsible for
determining the tissue specific and intercellular
location of the V-ATPase, but mammalian cells
contain four isoforms of subunit a (a1 – a4). The a1
isoform is ubiquitously expressed [9], whereas the
other isoforms are found in specific tissues.
For
example, a2 is found in kidney, lung and spleen, a3 in
mature osteoclasts and a4 in the apical and basolateral
plasma membrane of cortical intercalated cells and is
important for renal acid/base homeostasis [5]. These
distinct expression patterns are associated with various
Figure 4: The V-ATPase has 14
human diseases. Mutations in a3 cause osteopetrosis subunits. Subunit a forms an axis,
in humans and mice, while mutations in a4 cause connecting the V1 to the V0. The a
subunit controls the tissue-specific
recessive distal renal tubular acidosis, and in some localization of the V-ATPase, as well
cases hearing loss in humans. Phenotypes associated as intracellular localization. [8]
with mutations in mammalian a1 are still unknown [11]. As for intracellular localization the
positions appear to be flexible and each cell can have multiple isoforms [9].
1.4 The V-ATPase and cancer
Overexpression of V-ATPase at the plasma membrane has been linked to cancer by creating
an acidic microenvironment and thus making it easier for cells to invade the surrounding tissue
and the extracellular matrix [12]. It has been shown that a2 expression is elevated in ovarian
cancer tissues and cell lines, where the V-ATPase is localized in the plasma membrane as well
as in endosomal compartments, which are sites for modulations of several signaling pathways
in cancer. The a2 isoform is also highly expressed in breast cancer and melanoma [12]. The
V-ATPase acidifies the lumen of melanosomes and it has been show that the a3 isoform is
present in these cells. By knocking out the a3 isoforms expression of the a2 isoform is elevated
and seems to make up for the loss in the a3 isoform [13].
4
The acidic microenvironment created by the V-ATPase have already been targeted by cancer
drugs, using pH-sensitive nanocarriers which exploit low extracellular pH or endosomal pH
[14]. These more precise drugs are promising, as it can be difficult to target tumor cells
exclusively by chemotherapy and multidrug resistance development might be a dangerous side
effect [14]. One element that has been connected to drug resistance is overexpression of the
V-ATPase. That is because the V-ATPase can trap basic drugs in acidic vesicles, but this drug
resistance can be battled with inhibition of the V-ATPase [6].
Information on which isoform subunit is characteristic for melanoma cells, or any other cancer
cells, might be useful for drug development by inhibiting specific isoforms, for examples using
nanocarriers, and could be a great input in the battle against cancer [9].
5
2 Project aim
The V-ATPase is a regulator of acidity in the cell and its compartments and plays a key role in
creating acidic microenvironment for cancer cells to help invasion into the extracellular matrix.
The “a” subunit of the V-ATPase has four isoforms; a1, a2, a3 and a4. The a subunit controls
the localization of the V-ATPase both regarding tissue-type and where in the cell it is found.
The aim of this project was to study the subcellular localization of three of these isoforms; a2,
a3 and a4 in melanoma cells (Skmel28 and 501Mel). The a1 isoform was not inspected since
it seems to be expressed ubiquitously. This was achieved by generating plasmids containing
the genes for these three isoforms tagged with GFP. Expression of these plasmids were then
studied using western blots and confocal imaging. Using western blots the specificity of
antibodies for the isoforms was inspected, as well as difference in antibody staining and GFP
staining. Finally, the subcellular localization of the three subunits was examined using
confocal microscopy.
6
3 Materials and methods
3.1 Plasmid construction
Expression and visualization of the ATP6V0A2 (a2), TCIRG1 (a3) and ATP6V0A4 (a4)
proteins in melanoma cell lines was achieved by cloning the corresponding ORFs into the
mammalian expression vector pEGFP-N2. A flowchart of this process can be seen on page 9,
Figure 5.
3.1.1 Amplification of V-ATPase genes
The human ATP6V0A2 (a2), TCIRG1 (a3) and ATP6V0A4 (a4) genes were PCR amplified
from cDNA of commercially available Universal Human Reference RNA from Stratagene,
which is comprised of RNA from 10 different cell lines. The cDNA was synthesized by Sara
Sigurlaugsdóttir. The PCR amplification (see Appendix 1 for method) was carried out using
Q5 High-Fidelity DNA polymerase from New England Biolabs using the primers listed in
Appendix 2. The primers were designed with sites for restriction enzymes (HindIII and KpnI)
on each end to simplify insertion into the pEGFP-N2 vector.
The PCR products were examined by gel electrophoresis (see Appendix 1 for method) on 1%
agarose-TAE gels including 0.5 µg/mL ethidium bromide. Band sizes were estimated using
GeneRuler 1kb DNA ladder from Fermentas. All PCR products produced bands of correct size
(~2500 kb) so the bands were extracted using DNA Clean Up Micro Kit from Thermo
Scientific.
In order to TOPO-TA clone the PCR products, adenines were added to the 3’-ends of the
purified PCR products using Taq DNA polymerase from New England Biolabs. The fragments
were then cloned into the pCR4-TOPO vector using the TOPO-TA cloning kit (see Appendix
1 for method). The ligated DNA was transformed into DH5α cells and plated onto LB media
containing ampicillin. The plates were incubated overnight at 37 °C. Several colonies were
grown in the same selection medium and plasmids extracted using the alkaline lysis method
(see Appendix 1 for method).
3.1.2 Cloning V-ATPase into pEGFP-N2
To transfer the V-ATPase genes from the pCR4-TOPO vector the PCR fragments were
digested using HindIII and KpnI-HF (for 2 hours at 37 °C) for a2 and KpnI-HF and EcoRI-HF
(one hour at 37 °C) for a4. The DNA fragments were examined on 1% agarose gel and bands
of the expected size extracted.
7
Then the pEGFP-N2 plasmid was digested (see Appendix 3) for insertion of our a2, a3 and a4
ORFs. The plasmid was obtained from Ingibjörg Sigvaldadóttir, isolated 23rd of July 2015.
For insertion of a2 and a3 the digestion was performed using HindIII and KpnI-HF and was
incubated overnight at 37°C. For a4 KpnI-HF and EcoRI-HF were used and incubated for one
hour at 37 °C. The digested plasmids were run on agarose gel and the bands extracted from
the gel using DNA Clean Up Micro Kit from Thermo Scientific. Two separate gel extraction
kits were used for the plasmids. The plasmid digested with HindIII and KpnI-HF was extracted
using NucleoSpin Gel and PCR Clean-Up from Macherey-Nagel but the plasmid digested with
KpnI-HF and EcoRI-HF with DNA Clean Up Micro Kit from Thermo Scientific. Separate kits
were used because the plasmids were extracted at different times and the DNA Clean Up Micro
Kit from Thermo Scientific was used up when the a2 and a3 plasmids were extracted.
The a2 and a3 clones
The pEGFP-N2 plasmid was then dephosphorylated using Antarctic phosphatase and then
ligated to the digested a2 and a3 DNA fragments using Sticky-end ligation (see Appendix 1 for
method). The ligated vector was then transformed into DH5α cells and plated on LB plates
containing kanamycin.
Several colonies were grown in LB medium with kanamycin. The plasmids were isolated using
GeneJET Plasmid Miniprep Kit from Thermo Scientific. The colonies were screened by
colony PCR where several colonies were chosen, grown and then digested to see if the ligation
had worked. The DNA from positive clones was isolated and sequenced (see Appendix 1 for
method and primers in Appendix 2). The DNA from the positive colonies was also digested
using PstI for a2 and BamHI for a3, both incubated overnight at 37 °C, to make sure our DNA
was inserted into the vector. Four samples were sent to Beckman Coulter Genomics for
sequencing to verify that no mutations were introduced during the cloning. Two samples, one
for a2 and another for a3 were chosen and used for western blots and confocal imaging (see
Appendix 3 for figures of the plasmids).
The a4 clones
A colony PCR from the TOPO a4 plate (see section 3.1.1) was performed in order to screen
for mutations using the same protocol as before, with the exception that in step 2, the samples
were incubated at 68 °C for 40 sec instead of 150 sec. The plasmid DNA was isolated from
three TOPO a4 colonies and sequenced. The three isolated samples were digested with KpnI8
HF and EcoRI at 37 °C for 4 hours. Gel electrophoresis showed expected (~2500 kB) bands
and they were extracted using Thermo Scientific GeneJET Gel Extraction Kit. The digested
DNA fragments were then ligated into the pEGFP-N2 vector which had been digested with the
same restriction enzymes using sticky-end ligation. The ligation reaction was transformed into
DH5α cells and plated on LB plates containing kanamycin. Three colonies were picked from
each plate and their DNA was isolated. The samples were then digested with HindIII overnight
at 37 °C to see if our gene was inserted. Samples with correct band pattern were sequenced
and two samples, called the a4-1 vector and the a4-2 vector (see Appendix 3 for figure of the
plasmid) were then further used for western blots and confocal imaging.
PCR on
Human
Ref
cDNA
ATP6V0A2,
TCIRG1
and
ATP6V0A3
gelpurified
and TOPO
cloned
a2
&
a3
a4
Digestion
and
sticky-end
ligation
Colony
PCR
Colony
PCR
Digestion
and
sticky-end
ligation
Digestion
to verify
insertion
of
desired
gene
Sequence
Figure 5: Flowchart describing the making of the plasmids. When making the a4 plasmids a
colony PCR was performed to screen for mutations and then colonies without mutations were
chosen and ligated into the pEGFP-N2 vector.
3.2 Cell culture
Two melanoma cell lines, Skmel28 and 501Mel, were cultured in RPMI containing 10% FBS
at 37 °C and 5% CO2.
Cells were seeded for three western blots and three chamber slides for confocal imaging. The
Skmel28 cells were seeded for one western blot and one confocal chamber slide but the 501Mel
cells were used for the rest. For the western blots 100.000 cells were seeded in a 6 well plate
and 7500 cells in the chamber slides. Transfection was performed 24 hours after seeding using
FuGENE HD Protocol for SK MEL-28 cells using a FuGENE HD:DNA ratio of 3.0:1. Empty
vector (pEGFP-N2), a2, a3 and a4 vectors were used for transfection. The same protocols was
used for the 501Mel cells.
9
3.3 Western blotting
24 hours after transfections the confluency of the cells was 60 – 80% and the proteins from the
cells were isolated (see Appendix 1 for method).
For the first western blot a 1 mm thick 10% SDS-PAGE gel was made and samples loaded and
run for 20 minutes at 90 V and then for 70 minutes at 120 V. Samples were then transferred
onto a PVDF membrane. The membrane was immunostained with rabbit anti-GFP (1:10.000)
and rabbit anti-actin (1:10.000) as primary antibodies and anti-rabbit (1:15.000) as secondary
antibody.
Another western blot was made using the same method but using different antibodies. The
membrane was immunostained with mouse anti-actin (1:10.000), rabbit anti-GFP (1:2000),
goat anti-ATPV0A2 (1:200), goat anti-TCIRG1 (1:200) and goat anti-ATPV0A4 (1:200) as
primary antibodies. For secondary antibodies anti-goat (1:15.000) was applied for one hour
and then anti-rabbit (1:15.000) and anti-mouse (1:15.000) for one hour.
In the last western blot a 1.5 mm thick 8% SDS-PAGE gel was made and samples loaded and
run for 2 hours at 90 V. The samples were then transferred to a PVDF membrane and the
membrane stained with rabbit anti-GFP (1:2000), mouse anti-actin (1:10.000), rabbit anti-actin
(1:2000) and goat anti-ATPV0A4 (1:500) as primary antibodies. For secondary antibodies
anti-goat (1:15.000) was applied for one hour and the anti-rabbit (1:15.000) and anti-mouse
(1:15.000) for one hour.
The rabbit anti-GFP antibody used was from Abcam (ab290), the anti-V-ATPase A2 from
Santa Cruz (Y-20, SC-69095), the anti-TCIRG1 from Santa Cruz (N-13, SC-162300), the antiV-ATPase A4 from Santa Cruz (D-15, SC-69096), the mouse anti-actin from EMD Millipore
(Clone C4, MAB1501) and rabbit anti-actin from Cell Signaling (beta-Actin, 13E5, REF:
4970S).
The secondary antibodies were anti-mouse (DyLight800 conjugate, 5257, Cell
Signaling), anti-rabbit (DyLight 680 conjugate, 5366, Cell Signaling) and anti-goat (IRDye
800CW Donkey-anti-Goat Antibody, LI-COR).
Images were taken with Odyssey LiCor CLx and analyzed using the Fiji software. The
PageRuler pre-stained marker was used as a ladder.
10
3.4 Fluorescent immunostaining and confocal
imaging
In order to visualize the proteins expressed in cells, the transfected cells were immunostained.
First they were fixed with 4% formaldehyde for 2 minutes and then again with 4%
formaldehyde for 15 minutes. The wells were then washed with PBS and permeabilized with
0.1% Triton in PBS. The cells were blocked with 0.25% BSA, 0.05% Triton and 5% Goat
serum in 1x PBS.
For the immunostaining (see Appendix 1 for method) the primary antibodies used were rabbit
anti-GFP (ab290, Abcam, 1:1000), anti-ATPV0A2 (Y-20, SC-69095, 1:100) for a2, antiTCIRG1 (N-13, SC-162300, 1:100) for a3 and anti-ATPV0A4 (D-15, SC-69096, 1:100) for
a4. The secondary antibodies were anti-goat (546 nm, 1:15.000) and anti-rabbit (488 nm,
1:15.000), from Life Technologies. The slides were then stained with DAPI (1:1000) and
phalloidin (647 nm from Thermo Fisher, A22287, 1:100).
All images were taken on FV1200 Olympus confocal microscope, 1024x1024 pixels with a
60X lens. Images that are zoomed in were taken with 4X zoom. The Fiji software was used
to analyze the images.
11
4 Results
4.1 Protein expression in plasmids and antibody
specificity
Constructs for expressing and visualizing three different isoforms of the “a” subunit a2, a3 and
a4 were generated. Sequencing results showed that the a2 and a3 vectors contained no
mutations when compared to cDNA from the NCBI Reference Sequence while the a4 vectors
had one mutation which was silent (no amino acid change). To verify that the vectors produced
proteins of the expected size in melanoma cells, the constructs were transfected into Skmel28
cells and the protein lysate was analyzed on western blot using antibodies against GFP (Figure
6). The western blot showed the expected actin bands (45 kDa) for all samples. This was used
as a baseline and indicated that the western blot method worked. The GFP bands were also of
the size expected except for a2 which seems a little bit bigger than expected. Expected bands
were 97 kDa for a2 (27 + 70 kDa), 120 kDa for a3 (27 + 93 kDa) and 142 kDa for a4 (27 + 116
kDa). This indicates that our plasmids were expressed in the cells cultured.
Size
Anti-GFP
EV
a2
a3
a4
~140 kDa
~120 kDa
Anti-actin ~40 kDa
Figure 6: Western blot on proteins extracted from Skmel28 cells transfected with empty
pEGFP-N2 plasmid (EV) or the a2, a3, a4 plasmids. Anti-actin was used control and antiGFP for the GFP connected proteins. The western blot showed expected GFP bands except
for a2 which shows a bigger band than expected, indicating the transfection was successful
and the proteins were expressed in the Skmel28 cells.
However, when western blots using 501Mel cells were stained with antibodies for the a2, a3
and a4 proteins the expected bands (70 kDa for A2, 93 kDa for A3 and 116 kDa for A4) were
not observed (Figure 7). The only bands visible were actin bands and two bands for A3 at
~120 kDa which is too big for the a3 protein. Therefore, the quality of the commercial
antibodies against a2, a3 and a4 is doubted. This was repeated three times, always with the
same results. The actin bands were slightly larger than they were supposed to be and no actin
band was visible for a4, most likely due to mistakes in immunostaining.
12
EV
a2
EV
a3
EV
a4
ATPV0A2/4 and TCIRG1 ~100 kDa
Anti-actin
~45 kDa
Figure 7: Western blot on proteins isolated from 501Mel cells transfected with an empty
pEGFP-N2 plasmid (EV) or the a2, a3 or a4 plasmid. Anti-actin was used as control and
antibodies for the a2, a3 and a4 proteins to determine antibody quality. No actin bands were
visible for A4 which is most likely due to human error while immunostaining. The antibodies
did not show expected bands which indicates that they are unspecific for these a isoforms.
4.2 Comparison of GFP staining and GFP signal
Melanoma cells transfected with the plasmids expressing the three different isoforms were
stained with either antibody against the corresponding a isoform or GFP, along with DAPI
staining to visualize the nucleus and phalloidin to visualize the cell boundaries. The signals
from staining with anti-GFB antibodies and the GFP signal from the plasmids were compared.
Cells transfected with a2 are used as an example (Figure 8). The GFP signal of the tagged
isoforms was sufficient for imaging but GFP staining using anti-GFP antibodies resulted in
clearer images where the localization of the isoforms could be more easily detected. Therefore,
the following analysis were all performed by staining against GFP using the anti-GFP antibody.
13
Figure 8: Comparison of GFP staining and GFP signal for a2 in transfected 501Mel cells.
GFP staining shows a stronger signal than the GFP signal by itself and will therefore be
used for further analysis of the a isoforms.
4.3 Comparison of exogenous and endogenous VATPase
When using the antibodies against each of the three isoforms to detect protein location, it must
be noted that the antibodies detect both exogenous (GFP tagged proteins expressed from the
vectors introduced) and endogenous proteins normally expressed by the cells. However, antiGFP staining will only detect exogenous proteins. Therefore, the signal from the a isoform
antibody staining was compared with that of the anti-GFP staining (Figure 9). The antibodies
against the a isoform seem to stain more proteins inside the nucleus than the anti-GFP does
while the anti-GFP staining produces more signal just outside the nucleus.
14
The nuclear staining using the a isoform antibodies is most likely unspecific signal and not
representative of the localization of the a isoform.
Figure 9: Comparison of exogenous and endogenous V-ATPase in 501Mel cells transfected
with the three a isoforms. The antibodies against the isoforms showed more staining inside the
nucleus of the a2 and a3 transfected cell than the anti-GFP staining did. Very little staining
was visible in the nucleus of the a4 transfected cells. This, along with the western blot in Figure
7, indicates that the antibodies are unspecific for the isoforms and anti-GFP will therefore be
used to determine the localization of these isoforms.
4.4 Localization of the a2, a3 and a4 subunits in
melanoma cells
When trying to determine the subcellular localization of the V-ATPase subunits in cells we
used immunostaining with anti-GFP rather than antibodies against the factors since the western
analysis showed that the antibody quality is limited. Also, cells immunostained with anti-GFP
15
were used rather than the GFP-signals since the immunostained ones showed clearer images
and stronger GFP signals.
From Figure 10, the assumptions can be made that the a2 subunit is outside of the cell’s nucleus
in a cluster. The same can be said for subunit a3. Subunit a4 seems to be more dispersed
within the cell in a punctate pattern, but a stronger signal can be detected in a thin layer just
outside of the nucleus. It was interesting to observe that a2 and a3 always showed a much
stronger signal than a4, which could give a clue about the relative quantities of the subunits
within melanoma cells.
Figure 10: Localization of the a2, a3 and a4 subunits in 501Mel cells transfected with the a2,
a3 and a4 plasmids observed using anti-GFP antibody staining. The a2 and a3 transfected
cells showed the strongest signal in a cluster outside of the nucleus. The a4 transfected cells
showed a more dispersed punctate pattern and not as strong a signal.
16
5 Discussion
The aim of this study was to determine the subcellular localization of three out of four isoforms
of the “a” subunit in the V-ATPase. The V-ATPase is a regulator of acidity in the cell and the
a subunit controls the localization of the V-ATPase, both with respect to tissue- and cell-type
specificity.
The first part of the project was to generate plasmids that could be used to visualize and express
the three a isoforms in melanoma cells. Upon expression in melanoma cells we were able to
detect the GFP tagged a isoforms on western blot using anti-GFP antibody. However, we were
not able to detect them using the a isoform specific antibodies. Possible reasons for this might
be that the western blot needs to be optimized for these antibodies e.g. by varying antibody
concentration. Alternatively, the antibodies simply did not work on western or they do not
recognize the proteins they are supposed to. These antibodies have been used previously to
describe the subcellular localization of the a isoforms with immunostaining [5]. To see if the
antibodies recognize the a isoforms using immunostaining we compared the exogenous (GFP
tagged isoforms) and endogenous (both GFP tagged and non-tagged proteins expressed by the
cell line) proteins. The antibodies seem to stain more proteins inside the nucleus than the antiGFP antibodies, which given the western analysis is most likely due to unspecific staining. The
only exception from this is the a4 subunit which has almost no staining inside of its nucleus.
This further suggests that the antibodies might not be specific for our a isoform proteins. To
investigate the specificity of the antibodies further cells could be prepared which lack the genes
for these subunits. If the subunits are not present and the cells stained with the antibodies no
staining should show up in the images. Since the quality and specificity of the “a” isoform
antibody is doubted they were not used to determine the localization of the a subunits in
melanoma cells. Instead we used GFP.
The difference in signals detected from GFP antibody staining on one hand and GFP signals
on the other was compared. The GFP antibody stained cells gave a clearer image and the
localization of the proteins stained was easier to detect. For that reason, when determining the
localization of the a subunits, GFP antibody stained cells were used rather than cells only
showing the GFP signal.
17
When looking at the subcellular distribution the anti-GFP stained proteins, they seem to be
gathered just outside of the nucleus for the a2 and a3 subunit whereas the a4 subunit seems to
be more evenly dispersed throughout the cell but still showing higher concentration in a thin
layer around the nucleus. The localization could be more accurately described if the cells were
stained for different cellular organs, for example the Golgi apparatus. Alternatively, electron
microscopy following immunogold staining mighty reveal which cell organelles contain these
subunits.
The localization of these subunits could indicate their function in melanoma cells, the a2 and
a3 subunits might be controlling the acidity of the Golgi apparatus, which has and acidic lumen
that is required for its function during exocytosis. The V-ATPase can create a proton gradient
which is a driving force for transporting neurotransmitters into vesicles [15]. The a2 and a3
subunits have been shown to localize in the Golgi and early endosomes in neurosecretory PC12
cells [11]. The punctate pattern of the a4 subunit could on the other hand be connected to some
intracellular vesicles, for examples lysosomes or secretory vesicles, which are more dispersed
around the cell than the Golgi apparatus which lies close to the nucleus.
Through this experiment the concentration of the a4 subunits was always considerably lower
than the a2 and a3 subunits, both regarding exogenous and endogenous signals. A4 also has
different expression pattern. The lower strength of endogenous signal could be because there
might not be a lot of the a4 subunit naturally in melanoma cells and more of the a2 and a3
subunits. Different levels expressed from the GFP construct could also be the cause of
difference in signal strength or the stability of the proteins.
This project succeeded in cloning the three “a” subunits into a GFP-tagged expression vector.
Also, the project succeeded in using these clones to determine the subcellular location of the
subunits in melanoma cells. Further investigation will determine the role of these subunits in
melanoma cells and confirm their subcellular location.
18
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Schadendorf, D., et al., Melanoma. Nature Reviews: Disease Primers, 2015.
Alberts, B., Molecular Biology of the Cell. 5th ed. 2008: Garland Science.
Mader, S.S., Inquiry into Life. 14th ed. 2014, McGraw-Hill.
Cichorek, M., et al., Skin melanocytes: biology and development. Postepy Dermatol
Alergol, 2013. 30(1): p. 30-41.
Nishisho, T., et al., The a3 isoform vacuolar type H(+)-ATPase promotes distant
metastasis in the mouse B16 melanoma cells. Mol Cancer Res, 2011. 9(7): p. 845-55.
Alfarouk, K.O., Tumor metabolism, cancer cell transporters, and microenvironmental
resistance. J Enzyme Inhib Med Chem, 2016: p. 1-8.
Peppicelli, S., et al., Extracellular acidity strengthens mesenchymal stem cells to
promote melanoma progression. Cell Cycle, 2015. 14(19): p. 3088-100.
Zhang, T., et al., Mitf is a master regulator of the v-ATPase, forming a control module
for cellular homeostasis with v-ATPase and TORC1. J Cell Sci, 2015. 128(15): p.
2938-50.
Forgac, M., Vacuolar ATPases: rotary proton pumps in physiology and
pathophysiology. Nat Rev Mol Cell Biol, 2007. 8(11): p. 917-29.
Kemper, K., O. Krijgsman, and D.S. Peeper, MITF: More Interesting Traits, Folks!
Pigment Cell Melanoma Res, 2016.
Saw, N.M., et al., Vacuolar H(+)-ATPase subunits Voa1 and Voa2 cooperatively
regulate secretory vesicle acidification, transmitter uptake, and storage. Mol Biol
Cell, 2011. 22(18): p. 3394-409.
Kulshrestha, A., et al., Vacuolar ATPase 'a2' isoform exhibits distinct cell surface
accumulation and modulates matrix metalloproteinase activity in ovarian cancer.
Oncotarget, 2015. 6(6): p. 3797-810.
Tabata, H., et al., Vacuolar-type H(+)-ATPase with the a3 isoform is the proton pump
on premature melanosomes. Cell Tissue Res, 2008. 332(3): p. 447-60.
Kanamala, M., et al., Mechanisms and biomaterials in pH-responsive tumour targeted
drug delivery: A review. Biomaterials, 2016. 85: p. 152-67.
Futai, M., et al., Luminal acidification of diverse organelles by V-ATPase in animal
cells. J Exp Biol, 2000. 203(Pt 1): p. 107-16.
19
Appendix 1 – Protocols
PCR





10 µL 5x Q5 reaction buffer
1 µL 10 mM dNTPs
2.5 µL 10 mM forward primer
2.5 µL 10 mM reverse primer
0.5 µL Template DNA (cDNA
U20S, osteoclast cancer cells)
Mixed and incubated:
1. 98 °C for 30 sec
2. 98 °C for 10 sec
64 °C for 20 sec
72 °C for 90 sec
3. 72 °C for 2 min
Step number 2 repeated for 35 cycles
Gel electrophoresis
First, 1.1 grams agarose added to 110 mL TAE buffer. This solution was brought to boil in a
microwave and cooled slightly. Then 5.5 µL EtBr were added (5 µL per 100 mL) and the flask
swirled to blend. The solution was poured into a mold and combs put in. The gel was left for
~30 minutes to cool. Then the gel was put in a TAE filled electrophoresis chamber, combs
taken out and samples loaded. Electrical field was the applied (90 V) until the samples had
separated as much as desired.
Adding hanging A by using taq polymerase
17 µL DNA, 0.5 µL taq polymerase, 0.5 µL dATP and 2 µL Thermo Pol Buffer left in 72 °C
for 20 minutes.
TOPO-TA cloning
Mastermix made for 4 different PCR products (we had 3): 4 µL salt solution, 0.7 µL TOPO
vector and 3.5 µL H2O
2.5 µL of the solution placed in a 1.5 µL PCR tube
1. Add 4 µL of PCR product (10 – 20 ng of 1 kb) into each tube and mix gently
o Note: A4 only had 7.81 ng/µL so 5 µL were used
2. Incubate for 5 minutes at RT and then placed on ice
3. Take 1 tube of chemically competent E. coli (DH5α cells) and place 15 µL of cells into
TOPO-PCR tube
4. Incubate for 20 minutes on ice
5. Heat shock at 42 °C for 45 sec, without shaking
6. Transfer to ice and add 0.75 mL of LB
7. Shake at 37 °C for 1 hour
8. Spin down cells for 1 minute at 8000 rpm in Eppendorf Mini Spin
20
9. Pour of liquid (leave approximately 100 µL) and resuspend
10. Plate on correct selection medium
o LB plates with ampicillin
11. Incubate overnight (approximately 16 hours) at 37 °C
Alkaline lysis
Solution I (store at 4 °C)




50 mM Glucose
25 mM Tris HCl, pH 8.0
10 mM EDTA, ph 8.0
Autoclaved
Solution II (RT) – make fresh


0.2 M NaOH
1% SDS (w/v)
Solution III (store at 4 °C)


3 M KOAc
5M Glacial acetic acid
Elution buffer


5 mM Tris HCl, pH 8.5
20 µg/mL RNase
1. Inoculate 2 mL of LB with appropriate antibiotic selection (ampicilline) with a single
colony. Incubate overnight (16 hours) at 37 °C, 250 rpm
2. Pellet the bacteria by centrifugation at maximum speed for 1 minute
3. Remove the LB thoroughly
4. Resuspend in 100 µL Solution I
5. Add 200 µL of fresh Solution II and invert 6 – 8 times
6. Add 150 µL ice-cold Solution III and invert 6 – 8 times
7. Incubate on ice for 5 minutes
8. Spin at maximum speed for 5 minutes at 4 °C
9. Transfer the supernatant (~ 400 µL) to a fresh 1.5 mL tube
10. Precipitate the DNA by adding 2 volumes (800 µL) 96% EtOH
11. Vortex and incubate for 2 min at RT
12. Spin at max speed for 5 minutes at 4 °C
13. Aspirate the supernatant and wash pellet with 500 µL 70% EtOH
14. Air dry the pellet for 5 – 10 minutes and resuspend in elution buffer w/RNase A (50
µL)
Dephosphorylating




15 µL DNA
1 µL Antarctic phosphatase
2 µL 10x Antarctic Phos reaction buffer
2 µL H2O
Incubated at 37 °C for 15 minutes and then at 70 °C for 5 minutes
21
Ligation Protocol for Cloning with Instant Sticky-end Ligase Master Mix
1. Transfer master mix to ice prior to reaction set up. Mix tube by finger flicking before
use
2. Combine 20-100 ng of vector with a 3-fold molar excess of insert and adjust volume to
5 µL with H2O (see table 1)
 50 ng of plasmid used
3. Add 5 µL of Instant Sticky-end Ligase Master Mix, mix thoroughly by pipetting up and
down 7 – 10 times, and place on ice.
Table 1 Sticky end ligation solutions
Sample
a2-1
a2-2
a3-1
a3-2
a4-1
Sticky end
ligase
H2O
2.5 µL
0.5 µL
1.16 µL
0 µL
0.5 µL
0.17 µL
Plasmid
0.66 µL
0.33 µL
DNA
Total
volume
1.33 µL
0.66 µL
1.83 µL
1.33 µL
2 µL
5 µL
Colony PCR
Two new kanamycin plates were marked from 1-10 x2, one plate for a2-1 and a2-2, and the
other for a3-1 and a3-2. Two colonies from a2-TOPO and a3-TOPO plates were used as
positive control.
In a PCR tube:



1 µL 10x ThermoPol buffer
0.2 µL 10 mM dNTP
0.2 µL Forward primer



0.2 µL Reverse primer
0.05 µL Taq DNA polymerase
8.35 µL H2O
Pipette tip dipped in selected colonies and tapped on the new plates and then dipped in a PCR
tube, mixed by pipetting.
PCR, step 2 repeated 35 times:
1. 95 °C for 30 sec
2. 95 °C for 25 sec
60 °C for 30 sec
68 °C for 150 sec
3. 68 °C for 5 minutes
22
Protein isolation
First mixed:




100 µL RIPA buffer
1:100 Protease inhibitor solution
1 mM PMSF
1:100 Phosphate inhibitor solution
Medium removed off cells and washed with 1 mL ice-cold PBS. Tray put on ice and all PBS
removed. Add to each hole the first mixture and incubate for 10 minutes on ice. Cells scraped
using a reversed 1 mL pipette tip and solution with cells gathered and put in a 2 mL Eppendorf
tube. Cell solution sonicated for 5 minutes, 30 sec/30 sec. Cells spun down at 16000 g for 10
minutes at 4 °C. Liquid collected and put in a new 2 mL Eppendorf tube and 20 µL of 6x
Sample buffer added to each sample. Stored at – 20 °C.
Western blots
Buffers:
10x Running buffer
1x RIPA buffer
29 g Tris base
144 g Glycine
10 g SDS
1 L H2O
20 mM Tris-HCl (pH 7.5)
150 nM NaCl
1 mM Na2EDTA
1 mM EGTA
1% Np-40
1% Sodium deoxycholate
10x Transfer buffer
30.3 g Tris base
144.1 g Glycine
5 g SDS for 8% gels/1 g for 12.5% gels
1 L H2O
6x Sample buffer
40% Glycerol
240 nM Tris (pH 6.8)
8% SDS
0.04% Bromophenol blue
5% ß-mercaptoethanol
1x Transfer buffer
100 mL 10x Transfer buffer
200 mL MeOH for 8% gels/150 mL
for 12.5% gels
700 mL H2O for 8% gels/750 mL for
12% gels
TBS
10 mL 1M Tris-HCl (pH 7.4)
30 mL 5 M NaCl
in 1 L H2O
UTB (Upper transfer buffer)
1.5 M Tris-HCl (pH 8.0)
0.4% SDS
in 1 L
LTB (Lower transfer buffer)
0.5 M Tris-HCl (pH 6.8)
0.4% SDS
in 1 L
TBS-T
10 mL 1 M Tris-HCl (pH 7.4)
30 mL 5 M NaCl
10 mL 10% Tween-20
in 1 L H2O
23
Method:
Preparation of 2 gels (1 mm):
5% stacking gel 10% resolving gel
UTB
1.26 mL
LTB
2.6 mL
H2 O
3.05 mL
4.2 mL
40% Acrylamide
630 µL
3.2 mL
Add 100 µL 10% APS and 10 µL TEMED to the Resolving gel and pipette between the two
glass plates. Leave for 2 – 3 minutes and pipette 1 mL of isopropanol onto the gels to make
them straight. Leave the gels for 10 – 15 minutes or until solidified. Remove isopropanol.
Add 50 µL 10% APS and 5 µL TEMED to the stacking gel and pipette onto the resolving gel,
fill all the way up. Place the combs and leave for 15 – 20 minutes or until solidified.
Fill inner chamber with running buffer and half the outer chamber. Heat samples for 5 minutes
at 95 °C and load to gel. Run for 20 minutes at 90 V and for 70 minutes at 120 V. Remove
gels from glass plates and place in 1x transfer buffer for 20 minutes. Activate PVDF membrane
in 100% MeOH for 30 seconds and place in 1x transfer buffer for 15 minutes. Assemble
transfer unit and transfer for 1.5 hours (8% gel) or 2.5 hours (12.5% gel) at 90 V.
Block membrane with 5% BSA in TBS-T for 1 hour at RT. Stain with 1° AB overnight at 4
°C. Wash membrane 4x with TBS-T. Stain with 2° AB for 1 hour at RT. Wash membrane 3x
with TBS-T and 1x with TBS. Take picture on Odyssey.
Fluorescent immunostaining of cells
Materials:








8 well chamber slide
4% formaldehyde
1x PBS
1x PBS + 0.1% Triton
1x PBS + 0.25% BSA
Blocking buffer
o 0.25% BSA, 0.05% Triton, 5% Goat serum in 1x PBS
PBT
o 0.25% BSA, 0.05% Triton in 1x PBS
Primary and secondary antibodies
24
Day 1:
Add 250 µL of 4% formaldehyde to each well containing 250 µL medium. Incubate for 2
minutes. Take off the 2% formaldehyde and replace with 4% formaldehyde. Incubate for 15
minutes.
Remove liquid and wash 1x with 250 µL PBS for 8 minutes. Permeabilize with 250 µL of
0.1% Triton in PBS for 8 minutes. Wash 3 with 250 µL PBS for 5 minutes each.
Block with 150 µL Blocking buffer for 40 minutes at RT.
Incubate with primary antibody in 1x PBS + 0.25% BSA overnight at 4 °C (150 µL in each
well).
Day 2:
Wash 3x with PBT for 5 minutes each. Incubate with secondary antibody (250 µL) in PBT at
RT for 1 hour.
Wash 3x with PBT for 5 minutes each. Incubate with phalloidin (1:100) and DAPI (1:1000)
for minimum 15 minutes (150 µL per well)
Wash 1x with PBT for 5 minutes. Take off all fluid, remove plastic chamber and mound slides
with Fluorosheild and coverslip. Store at 4 °C in the dark until imaging.
25
Appendix 2 – Primers for PCRs
Primers for isolating the ATPV06A2, TCIRG1 and ATP6V0A4 genes from Human
Reference cDNA with PCR.
Table 2: Primers for PCR
Primer
Sequence
SS067_HindIII_ATPV0A2F
cccAAGCTTatggggtccctgttccgga
SS068_KpnI_ATPV0A2R
cggGGTACCCtgccacactgtcgtcgttat
SS069_HindIII_TCIRG1v1_F cccAAGCTTatgggctccatgttccgga
SS070_KpnI_TCIRG1v1R
cggGGTACCCgtcatctgtggcagcgaag
SS072_EcoRI_ATPV0A4v1F
ccgGAATTCatggtgtctgtgtttcgaagcg
SS073_KpnI_ATPV0A4v1R
cggGGTACCCctcctcggctgtgccatcca
Primers used for colony PCR for the ATPV06A2, TCIRG1 and ATP6V0A4 genes.
Table 3: Primers for colony PCR
Primer
Sequence
SS110_ATP6V0A2_F
GGGAGCAAAACTGGGATTTGT
SS111_ATP6V0A2_R GACCTCAGCAATGAGGCACT
SS112_TCIRG1v1_F
GCTGACCGACAGGAGGAAAA
SS113_TCIRG1v1_R
CATCACCAGCAGGATAGCCA
SS114_ATP6V0A4_F
TGACCGGAAAAGTTGGGGTTC
SS115_ATP6V0A4_R TCTGCACCTTGATGAGCCAG
26
Appendix 3 – Plasmids
The pEGFP-N2 plasmid and its enzyme cutting sites can be seen in figure 7. The plasmid
with the ATP6V0A2 (figure 8), TCIRG1 (figure 9) and ATP6V0A4 (figure 10) genes
inserted are also displayed below.
Figure 11: The pEGFP-N2 plasmid
Figure 13: The pEGFP-N2 vector with the
TCIRG1v1 gene inserted
Figure 12: The pEGFP-N2 vector with the
ATP6V02 gene inserted
Figure 14: The pEGFP-N2 vector with the
ATP6V0A4 gene inserted
27