THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 35, pp. 24005–24018, August 29, 2014
© 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.
GPR107, a G-protein-coupled Receptor Essential for
Intoxication by Pseudomonas aeruginosa Exotoxin A,
Localizes to the Golgi and Is Cleaved by Furin*
⽧
Received for publication, June 12, 2014, and in revised form, July 8, 2014 Published, JBC Papers in Press, July 16, 2014, DOI 10.1074/jbc.M114.589275
Fikadu G. Tafesse‡, Carla P. Guimaraes‡, Takeshi Maruyama‡, Jan E. Carette§, Stephen Lory¶,
Thijn R. Brummelkamp储, and Hidde L. Ploegh‡1
From the ‡Whitehead Institute for Biomedical Research and Massachusetts Institute of Technology, Cambridge, Massachusetts
02142, the §Stanford School of Medicine, Stanford, California 94305, the ¶Harvard Medical School, Boston, Massachusetts 02115,
and the 储Netherlands Cancer Institute, Postbus 90203, 1006 BE Amsterdam, The Netherlands
Background: Bacterial toxins, including P. aeruginosa exotoxin A (PE), are valuable tools to dissect biological processes.
Results: A genome-wide genetic screen identifies several novel host factors used by PE, including GPR107.
Conclusion: Bacterial toxins can help identify novel host components involved in key intracellular trafficking steps.
Significance: GPR107 may be a receptor that associates with G-proteins at the Golgi to regulate membrane transport.
Several bacterial pathogens cause disease through the activities of secreted toxin proteins with targets located within the
eukaryotic cells. Although cellular receptors and the biochemical reactions leading to cell death have been elucidated for a
number of such toxins, the precise steps of their transport from
the cell surface to the target sites of action have not been well
defined. In eukaryotic cells, transport of proteins between the
various membranous compartments is mediated by cargo vesicles that bud off from the donor organelle and fuse with the
appropriate acceptor organelle (1). These processes serve not
only to maintain cellular homeostasis but also allow cells to
communicate with the outside environment (2). Bacterial tox-
ins exploit these very same pathways where they rely on receptor-mediated endocytosis and vesicular trafficking to reach
their final destinations (3). Consequently, such toxins are useful
probes to explore the cell biology that underlies membrane
trafficking.
Pseudomonas aeruginosa exotoxin A (PE)2 is a polypeptide of
66 kDa that contains three structural subdomains (4, 5). After
entering host cells via receptor-mediated endocytosis, PE is
processed by furin and exerts its cytotoxicity by virtue of its
ADP-ribosyltransferase activity; it ADP-ribosylates the diphthamide residue of eukaryotic translation elongation factor 2
(eEF2). This causes a block in protein synthesis and leads to cell
death (6). Although PE must cross a biological membrane to
reach the cytosol and its substrates (7, 8), only a partial list of the
host proteins involved in this process is known.
Vesicular transport is a process that involves several classes
of proteins such as SNAREs, the GARP complex, cytoskeletal
proteins, and GTPases (9). Members of the small GTPases of
the Rab superfamily localize to various intracellular compartments and regulate many aspects of membrane trafficking (10,
11). The other class of GTPases are the heterotrimeric G-proteins, which also contribute to vesicular trafficking (12). Membrane vesiculation (13, 14) and cargo trafficking (15) at the
TGN are regulated by G␤␥ subunits through activation of the
serine/threonine protein kinase D (PKD) (16). Intracellular
transport and secretion of heparan sulfate proteoglycan by epithelial cells involve the pertussis toxin-sensitive G␣i3, localized
to the Golgi apparatus (17). No Golgi-resident GPCRs associated with these G-proteins have been identified.
A haploid genetic screen was performed in KBM7 cells, a
myeloid leukemia cell line with a haploid karyotype except for
chromosome 8, to identify host factors required for entry and
trafficking of PE. Several host factors not previously implicated
* This work was supported, in whole or in part, by National Institutes of Health
Grant AI087879 (to H. L. P.). This work was also supported by the Netherlands Organization for Scientific Research (to F. G. T.) and New England
Regional Center of Excellence Harvard Medical School (to C. P. G.).
⽧
This article was selected as a Paper of the Week.
1
To whom correspondence should be addressed. Tel.: 617-324-2031; Fax:
617-452-3566; E-mail: [email protected].
AUGUST 29, 2014 • VOLUME 289 • NUMBER 35
2
The abbreviations used are: PE, P. aeruginosa exotoxin A; GPCR, G-proteincoupled receptor; GARP, Golgi-associated retrograde protein; PNGase,
peptide:N-glycosidase; Endo H, endoglycosidase H; CDT, cytolethal distending toxin; TGN, trans-Golgi network; ER, endoplasmic reticulum; BFA,
brefeldin A; CTx, cholera toxin; OSTC, oligosaccharyltransferase complex.
JOURNAL OF BIOLOGICAL CHEMISTRY
24005
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
A number of toxins, including exotoxin A (PE) of Pseudomonas aeruginosa, kill cells by inhibiting protein synthesis. PE kills
by ADP-ribosylation of the translation elongation factor 2, but
many of the host factors required for entry, membrane translocation, and intracellular transport remain to be elucidated. A
genome-wide genetic screen in human KBM7 cells was performed to uncover host factors used by PE, several of which were
confirmed by CRISPR/Cas9-gene editing in a different cell type.
Several proteins not previously implicated in the PE intoxication pathway were identified, including GPR107, an orphan
G-protein-coupled receptor. GPR107 localizes to the transGolgi network and is essential for retrograde transport. It is
cleaved by the endoprotease furin, and a disulfide bond connects the two cleaved fragments. Compromising this association
affects the function of GPR107. The N-terminal region of
GPR107 is critical for its biological function. GPR107 might be
one of the long-sought receptors that associates with G-proteins
to regulate intracellular vesicular transport.
GPR107 Localizes to the TGN and Is Cleaved by Furin
in intoxication by PE were identified, including GPR107, an
orphan GPCR. GPR107 localizes to the TGN and is cleaved by
furin, also identified as a hit in the screen. GPR107 is involved in
retrograde protein transport and may be a long-sought receptor
that associates with G-proteins to regulate intracellular membrane trafficking.
24006 JOURNAL OF BIOLOGICAL CHEMISTRY
Gene
Target sequence
GPR107
FURIN
VPS53
KDELR1
TMEM110
AP1M1
SCFD1
OSTC
GGTGCCATCCTCTTCCCAG
CGAGCCCAACCACATCACT
GTAAGAGGTCAGACGAACG
AGTTCAAAGCTACTTACGA
TCTTCCTGCAGGGGCTGCT
CGGAACTACCGTGGCGACG
TAGTTGATTTCGAAGATCC
CCGACGGCATGTGCAACCA
general screening approach were done as described previously
(23). Briefly, about 100 million mutagenized KBM7 cells were
exposed to 50 ng/ml PE for 10 days. The survivors were pooled
and expanded for a few days. Genomic DNA was isolated, and
inverse PCR was performed using primer sequences flanking
the retroviral insertion sites followed by Illumina sequencing.
The statistical significance of insertions at a given gene in the
PE-treated population was calculated by comparing the number of inactivating insertions to those in the untreated control
data set. To isolate the GPR107GT clone, cells were FACSsorted in 96-well dishes and grown until confluent. Genomic
DNA from the individual clones was extracted using a genomic
DNA isolation kit (Qiagen). Genomic insertions were identified
by inverse PCR using a forward primer located within the genetrap (5⬘-CTCGGTGGAACCTCCAAAT-3⬘) and a reverse
primer designed to target the GPR107 gene. The gene-trap
insertions were mapped by sequencing of the PCR product
using the forward primer. RT-PCR analysis was performed to
determine the absence of the GPR107 transcript in the isolated
mutant cell line using SuperScriptTM III first-strand synthesis
kit (Invitrogen). The following primers were used: 5⬘-ATGGCCGCTCTGGCGCCCGTCGGCT-3 and (5⬘-GGCCTTCTTGGTCATCAGTGC-3⬘). As a positive control, RT-PCR analysis
of the GAPDH gene was performed.
Cell Culture and Virus Transduction—KBM7 and HeLa cells
were grown in Iscove’s modified Dulbecco’s medium or DMEM
supplemented with 10% heat-inactivated fetal serum, respectively, at 37 °C and 5% CO2. Cell lines stably overexpressing
various versions of GPR107 constructs were generated by
infecting with retroviruses expressing the corresponding
cDNAs and were selected for G418 (0.8 mg/ml for HeLa and 1.2
mg/ml for GPR107GT cells). Of the three reported splice variants of GPR107 (24), we detected only the expression of isoform
2 (UniProt accession number Q5VW38-2).
Designing CRISPR Target Sequence and Prediction of Off-target Effects—Target sequences for CRISPR interference were
designed as detailed in Ref. 25. The target sequence preceding
the PAM motif was obtained from the region of the exon of the
indicated genes (Table 1). Potential off-target effects of the target sequence were confirmed using the NCBI Homo sapiens
Nucleotide BLAST.
Procedure for Generating CRISPR RNA Lentivirus Vector—
CRISPR gBlock was designed to incorporate into the restriction
enzymatic site NheI/BamHI of CMV promoter-deleted pCDHEF1-Hygro (SBI; CD515B-1) as follows: cacagtcagacagtgactcaGTGTCACAgctagcTTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAVOLUME 289 • NUMBER 35 • AUGUST 29, 2014
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
EXPERIMENTAL PROCEDURES
Antibodies—Rabbit anti-TGN46 and rabbit anti-Giantin
were from Abcam. Rabbit anti-furin was from Santa Cruz Biotechnology. The rat monoclonal anti-HA-coupled beads were
from Roche Applied Science, and anti-HA-Alexa488 was from
MBL. Streptavidin-HRP was from Fisher. Fluorophore-conjugated secondary antibodies were from Invitrogen.
Cloning, Expression, and Purification of Exotoxin A—The
coding sequence for PE (GenBankTM accession number
AAB59097) was amplified by PCR from P. aeruginosa genomic
DNA (18) and cloned into pMMB67H vector using HindIII and
EcoRI restriction sites. Alternatively, PE that carries a sortase
recognition motif, LPETG, near its C terminus followed by His6
was cloned into pMMB67H vector using the same restriction
enzymes. The plasmids were then introduced into PA103-EA, a
nonvirulent P. aeruginosa strain that is deficient in endogenous
PE production. PA103-EA carrying the plasmids were grown at
37 °C in LB media supplemented with 1% glycerol and 200
␮g/ml ampicillin until the A600 reached 0.6. Protein expression
was induced with 1 mM isopropyl 1-thio-␤-D-galactopyranoside for 18 h at 37 °C, and cells were pelleted by centrifugation.
The supernatants that contain the toxin were centrifuged again
at 10,000 rpm for 2 h, filtered to further remove any remaining
debris, and concentrated using the 30K Amicon concentrator
(Millipore). For the toxin that carries the sortase recognition
motif (PE-LPETG-His6) (19, 20), the concentrate was applied to
a nickel-nitrilotriacetic acid column equilibrated with 50 mM
Tris-HCl, 150 mM NaCl, and 10 mM imidazole, pH 8.0. The
column was washed with 10 column volumes of buffer, and the
protein was eluted with 50 mM Tris-HCl, 150 mM NaCl, and 500
mM imidazole, pH 8.0. The proteins were further purified by
size exclusion chromatography on a Superdex 200 column (GE
Healthcare) and eluted with 50 mM Tris-HCl, 150 mM NaCl,
and 10% glycerol, pH 7.4. Fractions containing the correct toxin
were pooled, concentrated, and stored at ⫺80 °C.
Sortase-mediated Labeling of PE—Sortase A was expressed
and purified as described previously (19, 20). Synthesis of the
nucleophiles G3K(Atto647)-RDELK, G3K-(biotin)-RDELK,
and G3K-biotin were done as described previously (21). Sortase-labeling reaction mix was prepared as follows: 25 ␮M PELPETG-His6, 50 ␮M sortase A, and 1 mM nucleophile in 50 mM
Tris-HCl, 150 mM NaCl, and 10 mM CaCl2. The reaction was
incubated at 37 °C for 16 h. The whole reaction mix was then
loaded onto a nickel-nitrilotriacetic acid column to remove
unreacted toxin and the enzyme (sortase A carries His6 at its C
terminus). The flow-through that contains the PE conjugated
with the nucleophile was then concentrated and stored at 4 °C
for short term storage or at ⫺80 °C for long term storage.
Haploid Genetic Screen and Isolation of the Mutant Clone—
The construction of gene-trap (22) viral vectors, generation of
mutant KBM7 libraries, mapping of GT integration sites, and
TABLE 1
CRISPR target sequences
GPR107 Localizes to the TGN and Is Cleaved by Furin
TABLE 2
Primers used for the Surveyor assay
Gene
Forward primer
Reverse primer
GPR107
FURIN
VPS53
KDELR1
TMEM110
AP1M1
SCFD1
OSTC
AGCACGTGGGACTGGAAAGAATGC
TGCATCATCGACATCCTCACCGAGC
CAACAAGGCGATGCATCAGCCTGC
TCTGGACTCCTGCGTCTGAGGG
TACCGGCTCAGGCTTGGGATCC
ATTCACACTGGGAGATGCTCTTCTCC
CAGAACAGTTGAAGATCGTGTCTGCC
ACCTCCGAGCTTTACGGATCTGCG
TTAGAACTCTGTTAAATGCCAGCTCATGGTG
ATTCCTGCAACATGGGACAGTCCC
TGAGCGGTGCCACAGTTCACGG
GCAGAAGGAAGCCTGTGAGAGGGT
TCACTCCTGTCTGGAGGCCACAG
TCGTGCATTGTCTGCCTGTCTCCG
AACAATTCTGTTGTTCTGGTCATCTGTC
TGAGAACACGAATTCTCTTAAGACAGGGC
AUGUST 29, 2014 • VOLUME 289 • NUMBER 35
alized with autoradiography using DMSO/2,5-diphenyloxazole
and exposed to Kodak XAR-5 film.
Microscopy—HeLa cells grown on coverslips were fixed with
4% paraformaldehyde in PBS for 30 min. Fixation was stopped
by incubating the coverslips with 50 mM NH4Cl for 10 min.
Samples were then blocked with binding buffer (0.1% saponin
and 0.2% BSA in PBS) for 30 min and incubated with the first
antibodies followed by secondary antibodies conjugated with
Alexa Fluor. Images were captured using a confocal microscope
with a 63⫻ 1.40 N.A. of the Carl Zeiss Plan Apo oil objective
and processed using Velocity and Adobe Photoshop software.
Generation of GPR107-depleted HeLa Cells—Lentiviral plasmids containing the shRNA against human GPR107 and the
control (shGFP) were purchased from Open Biosystems. To
generate lentiviruses, low passage HEK293T cells were transfected with these plasmids using Lipofectamine 2000 following
the manufacturer’s protocol. GPR107-knockdown HeLa cell
lines were generated by infecting the cells with the lentiviruses
and then selecting them in the presence of puromycin (1 ␮g/ml)
for 1 week. In parallel, we transduced HeLa cells that overexpress HA-tagged GPR107 with the same viruses. Because there
are no good antibodies, we determined the efficiency of the
knockdown by Western blot analysis using anti-HA HRP.
Cell Viability Assay and Flow Cytometry—About 25 ⫻ 103
cells per well were seeded in 96-well dishes with clear flat bottoms (Costar) and treated with different concentrations of PE
for 18 h in the case of HeLa cells or 48 h for KBM7 cells. Cell
viability assay was performed using the CellTiter-Glo威 luminescent cell viability assay kit (Promega) according to the manufacturer’s protocol. This method determines cell viability
based on quantitation of the ATP present, an indicator of metabolically active cells. ATP-based bioluminescence levels were
measured using an EnVision plate reader (PerkinElmer Life
Sciences).
For flow cytometry, cells were treated for 18 h with CDTs of
different bacterial origin. The cells were harvested, washed with
cold PBS, fixed with ethanol, stained with propidium iodide,
and subjected to cytofluorometry (FACSCalibur, BD Biosciences). FlowJo was used to analyze the data. Intensity of fluorescence was measured, and the percent maximum was presented in the overlaid histograms.
Cholera Toxin Glycosylation Assay—Expression, purification, and generation of cholera toxin conjugated with the glycosylation motif (GGG-K(biotin)-NNSTG) was done as described previously (21). For the glycosylation assay, a similar
number (about 20 ⫻ 106) of KBM7WT, GPR107GT, and
GPR107GT ⫹ GPR107 cells were washed once in PBS and resusJOURNAL OF BIOLOGICAL CHEMISTRY
24007
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
ATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGnnnnnnnnnnnnnnnnnnnGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTggatccTGTGCACAgtcagtcacagtcagtctac (where n is CRISPR target sequence).
The gBlock was digested by NheI and BamHI restriction enzymes and incorporated into the pCDH vector linearized with
the same restriction enzyme.
Genotyping of the CRISPR/Cas9-generated Mutant Cell Populations Using Surveyor Assay—Surveyor assay was performed
as described previously (26, 27). Genomic DNA from treated
and control crude HeLa cells was extracted. PCR was performed using specific primers (Table 2) under the following
conditions: 94 °C for 2 min; 35⫻ (98 °C for 10 s, 60 °C for 30 s,
and 68 °C for 30 s); 68 °C for 2 min; hold at 4 °C. PCR product
was loaded onto an ethidium bromide-stained agarose gel (3%)
and purified. 500 ng of the purified PCR product were treated
with Surveyor nuclease (Transgenomic) for 30 min and
resolved using 3% agarose gel.
Pulse-Chase Experiments, Furin, and Glycosidase Digestion—
Pulse-chase experiments were performed as described previously (28). Briefly, HeLa cells stably expressing C-terminally
HA-tagged GPR107WT, GPR107R182A, GPR107C109A/C228A, or
GPR107⌬40 –182 were grown in 10-cm culture dishes. For a
given time point, 1 ⫻ 10-cm dish was used in all experiments.
Cells were starved in methionine- and cysteine-free DMEM for
45 min, pulse-labeled with [35S]methionine/cysteine at 0.77
mCi/ml for 30 min, and chased for different time points in
complete media containing 1 mM cold methionine/cysteine.
Where indicated, cells were treated with 100 ␮g/ml brefeldin A
(BFA) or 100 nM concanamycin A for 1 h prior to labeling and
chased in the continuous presence of the drugs. At different
time points during the chase, cells were harvested, lysed in Tris
buffer (150 mM NaCl, 5 mM MgCl2, 25 mM Tris-HCl, pH 7.4)
containing 0.5% Nonidet P-40 followed by immunoprecipitation with anti-HA-coupled beads. Typically, the immunoprecipitates were eluted with 100 ␮l of PBS containing 1% SDS.
Another 900 ␮l of Tris buffer was added to get a 0.1% final
concentration of SDS. Samples were then re-immunoprecipitated using anti-HA-coupled beads. Where indicated, immunoprecipitates were subjected to Endo H, PNGase F, or furin
digestion according to the manufacturer’s instructions (New
England Biolabs). Immunoprecipitates were eluted with SDS
sample buffer and resolved by SDS/-PAGE. Samples were visu-
GPR107 Localizes to the TGN and Is Cleaved by Furin
pended in 300 ␮l of Opti-MEM containing a final concentration of 20 nM of CTx-GGGK(biotin)-NNSTG. Cells were incubated for 30 min at room temperature, and the medium
containing the toxin was removed after a gentle centrifugation.
The cells were resuspended in 3 ml of Iscove’s modified Dulbecco’s medium supplemented with 10% heat-inactivated fetal
serum and chased for different time points at 37 °C and 5% CO2.
At the indicated time points during the chase, cells were collected and lysed in Tris buffer (150 mM NaCl, 5 mM MgCl2, 25
mM Tris-HCl, pH 7.4) containing 0.5% Nonidet P-40. Because
the CTx also carries biotin probe, we recovered it from the
lysate using NeutrAvidin beads. The toxin was eluted from the
beads by boiling for 5 min in 1% SDS sample buffer. The glycosylation of CTx was detected by Western blotting using
streptavidin-HRP and ECL substrate. The film was scanned,
and the bands were quantified using ImageQuant software
(GE Healthcare).
RESULTS
24008 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 289 • NUMBER 35 • AUGUST 29, 2014
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
Haploid Genetic Screen Identifies Host Factors Required for
PE Intoxication—To identify host proteins important for PE
intoxication, we performed a genetic screen that exploits
KBM7 cells, haploid except for chromosome 8 (23, 29). We
mutagenized KBM7 cells using a gene-trap vector to obtain a
collection of ⬃100 ⫻ 106 mutants. We then intoxicated these
mutant cells with 50 ng/ml PE, a concentration that kills the
majority of wild type KBM7 cells. To identify genes that render
cells resistant to PE, massively parallel sequence analysis was
performed on genomic DNA isolated from the pooled clones.
Gene-trap insertions in genes identified in the selected cell population were compared with gene-trap insertion events in
a nonselected control population, and genes significantly
enriched for mutations were thus identified. Among these, nine
genes had already been implicated in PE intoxication, whereas
the other eight genes were not previously known to be involved
in the PE pathway (Fig. 1, A and B).
Validation of the Haploid Genetic Screen Using CRISPR/
Cas9-gene Editing System—Because the screen was performed
in the haploid KBM7 cell line, we extended these observations
to another cell line to exclude cell type-specific effects. We performed PE intoxication assays on mutant HeLa cell populations, generated using CRISPR/Cas9 genome editing (25), for
eight hits identified in the KBM7 screen. The introduction of
mutations in the gene of interest was assessed by Surveyor assay
that relies on digestion of amplified genomic DNA by an endonuclease that specifically cleaves at the site of the newly generated substitution. Accordingly, the region that flanks the sequence
targeted by the sgRNA was amplified by PCR. The amplicons
were then subjected to digestion and monitored by agarose
electrophoresis. Unique cleavage products were observed in the
mutant cell lines but not in the wild type control (Fig. 1D) showing the enrichment of gene knock-outs in these cell lines. As
expected, these mutant cell populations showed increased
resistance to PE as compared with the wild type control (Fig.
1E). Genes identified in the KBM7 screen as hits were thus
confirmed by an independent genome editing approach in a
different cell type.
In the following sections we describe the categories of mutations observed in our haploid genetic screen performed in
KBM7 cells.
Mutations in the Diphthamide Biosynthetic Pathway Leads to
PE Resistance—PE transfers an ADP-ribose group from NAD⫹
to diphthamide, a conserved, post-translationally modified histidine residue unique to eEF2 resulting in inhibition of protein
synthesis (30). In eukaryotic cells, several genes are known to be
involved in the biosynthesis of diphthamide (31). We observed
a significant enrichment of mutations in DPH1, DPH2, DPH4,
and DPH7 (WDR85) (Fig. 1A), indicating good coverage of the
screen.
PE Trafficking in the Endocytic Pathway—PE enters cells via
receptor-mediated endocytosis and reaches its final destination, the cytosol, via vesicular transport and translocation
across an intracellular membrane (Fig. 8D). Prior to cytosolic
delivery of its catalytic domain, PE undergoes proteolytic cleavage by furin, a protease localized in the TGN and in late endocytic compartments (32). The identification of furin in our
screen is therefore consistent with the known requirement of
PE for a proteolytic conversion. Moreover, LRP1, one of the
known receptors for PE, undergoes a furin-mediated cleavage
to generate the active form of the receptor (33). As we will show
below, furin acts on yet other components essential for PE
intoxication. The closely related proteins LRP1 and LRP1B are
the known receptor(s) for PE (7, 8). However, these proteins
were not found in our screen. This might be because of the
redundancy of their role as a receptor of PE or these proteins are
essential for the survival of KBM7 cells.
A heterotetrameric tethering factor named the Golgi-associated retrograde protein (GARP) complex that comprises vacuolar protein sorting 51 (VPS51), VPS52, VPS53, and VPS54,
promotes fusion of endosome-derived retrograde transport
carriers with the TGN (34). In our screen, we identified VPS52,
VPS53, and VPS54 of the GARP complex. HeLa cells lacking
VPS53, resulting from CRISPR/Cas9-mediated inactivation of
the corresponding gene, acquire resistance to PE (Fig. 1E), demonstrating that the GARP complex is essential for PE transport
from endosomes to the TGN.
Trafficking of membrane proteins is also involves adaptor
protein complexes (35). AP-1 mediates protein sorting between
the TGN and early endosomes and is composed of four subunits, including AP1M1 (36). We identified AP1M1 as a novel
host factor essential for PE intoxication (Fig. 1A); HeLa cells
with mutations in AP1M1 become resistant to PE (Fig. 1E).
Retrograde Transport of PE from Golgi-to-ER—To modify
eEF2, PE must cross a membrane barrier(s), but it is unclear
whether PE travels through the Golgi to reach the ER as a point
of escape. To address this, we performed microscopy studies in
HeLa cells using PE conjugated with Atto647 (Fig. 2, A and B).
We found that PE partially co-localizes with GPR107 (Fig. 2D),
a protein that is localized at the TGN (see below). In our screen,
we also implicated proteins involved in retrograde Golgi-to-ER
transport, including the KDEL receptor 1 (KDELR1), which
retrieves proteins from the Golgi for delivery to the ER through
recognition of a C-terminal KDEL motif (Fig. 1A). To test
whether PE reaches the ER, we installed a 3⫻Gly-Lys-(biotin or
Atto647) extended with the RDEL sequence or 3⫻Gly-Lys-bi-
GPR107 Localizes to the TGN and Is Cleaved by Furin
A
B
GPR107 (44)
significance (-log of p-value)
200
DPH7/WDR85 (23)
KDELR1 (16)
DPH1 (12)
20
DPH2 (11)
Furin (9)
JTB (6)
AP1M1 (4) DPH4 (5)
ETV6 (18)
2
TMEM110 (9)
VPS52 (6)
SCFD1 (6)
OSTC (3)
VPS54 (4) VPS53 (5)
GCC1 (2)
HSP90B (2)
Endosome-to-Golgi
trafficking
Golgi-to-ER
trafficking
GARP complex
(VPS52, VPS53, VPS54)
AP1M1
Furin
KDELR1
SCFD1
OSTC
Diphthamide biosynthesis
Unknown function
DPH1
DPH2
DPH4
DPH7 (WDR85)
GPR107
TMEM110
GCC1
JTB
0.2
0
200
400
600
800
1000
Genes (Alphabetical order)
C
PAM
D
RF
TMEM110
crTarget
WT
Genotype
zyme
S enzyme
_
OSTC
Mut
+
_
WT
+
500400300-
200(bp)
Expected
d size
FL [FF/RF]
F] (bp)
E
_
465 [241/224]
KDELR1
WT
Mut
+
_
200-
Mut
+
_
+
300-
200-
100(bp)
471[191/280]
80
cell viability (% rel to untreated cells)
_
+
500400300-
(bp)
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
FF
350 [175/175]
crControl (GFP)
crGPR107
crFurin
crVPS53
crTMEM110
crAP1M1
crKDELR1
crSCFD1
crOSTC
60
40
20
0
0.025
0.064
0.16
PE (μg/ml)
FIGURE 1. Loss-of-function genome-wide genetic screen in KBM7 cells identifies host factors used by PE, as confirmed by CRISPR/Cas9-gene editing
system in HeLa cells. A, bubble plot showing the genes identified in the haploid genetic screen using PE. The size of the bubble is correlated with the number
of independent insertions (shown in brackets). On the x axis, genes are ranked based on their alphabetic order. The y axis shows the ⫺log of the p value of the
enrichment of gene-trap insertions in the PE-selected cell population as compared with the mutagenized control cells. B, host factors identified in the screen
are presented according to their possible function in the PE pathway. Novel genes identified in our screen are marked in red. C, schematic representation of the
DNA amplicon used for genotyping of mutants generated using CRISPR/Cas9-gene editing strategy. D, surveyor assay for Cas9-mediated cleavage of the
indicated genes in HeLa cells. Accordingly, genomic DNA was extracted, and the region that flanks the sequence targeted by the sgRNA was amplified by PCR.
The amplicons were then subjected to endonuclease digestion that specifically cleaves at the site of the newly generated substitution and monitored by
agarose electrophoresis. Note that unique cleavage products were observed in the mutant cell lines but not in the control. E, PE intoxication assay of mutant
HeLa cells generated using CRISPR/Cas9-gene editing system. Cell viability was determined and shown as percent relative to nonintoxicated cells. Error bars
represent S.D. of three independent experiments performed in duplicate.
otin without the RDEL sequence at the C terminus of PE via a
sortase-mediated transacylation reaction (Fig. 2, A and B) (19,
20). Both biotinylated and fluorescently labeled PE that carry
AUGUST 29, 2014 • VOLUME 289 • NUMBER 35
the RDEL motif are toxic, whereas PE lacking the RDEL motif is
not (Fig. 2C). The RDEL sequence immediately adjacent to the
C terminus is thus required for PE intoxication. This is consisJOURNAL OF BIOLOGICAL CHEMISTRY
24009
GPR107 Localizes to the TGN and Is Cleaved by Furin
A
C
catalytic domain
PE-WT
PE-K-[Atto647]-RDELK
PE-K-[Biotin]-RDELK
PE-K-biotin
PE-LPETG-His6
Biotin
(Atto647)
membrane
targeting
domain
cell viability (% rel to
non-intoxicated cells)
100
LPETGGG-K-RDELK
50
Receptor
binding
domain
0
0.01
N
0.02
0.05
PE (μg/ml)
B
4h 16h
4h 16h
4h 16h
-
+
+
+
+
-
+
+
+
+
-
+
+
+
+
+
-
+
+
+
+
-
+
+
+
+
-
+
+
G3-Biotin/G3-Atto647-RDELK +
-
+
+
+
+
-
+
+
+
+
-
+
+
+
SrtA
PE-LPETG
+
- 100
Acyl intermediate PE-LPETG/ PE-Biotin-RDELK/ PE-Atto647-RDELK
- 75
SrtA -
- 25
- 50
D
GPR107-GFP
PE-Atto647-RDEL
streptavidin-HRP
Merge
typhoon
E
WT
KBM7
GT
GPR107
PE
GAPDH
FIGURE 2. PE is transported through the Golgi to reach the ER. A, crystal structure of PE depicting its three domains and the C-terminal site where biotin or
fluorophore is conjugated using sortase-mediated labeling strategy. B, sortase-catalyzed attachment of biotin or Atto647 dye to PE. Reactions were analyzed
by SDS-PAGE with visualization by Coomassie gel, streptavidin-HRP blot, and typhoon image showing PE was successfully labeled with biotin or Atto647
bearing RDEL at the C terminus. See “Experimental Procedures” for details. C, HeLa cells were intoxicated with different concentrations of PE-WT, PE-without
RDEL motif (PE-LPETG or PE-LPETG-K-biotin) or labeled PE carrying RDEL motif at the C-terminal (PE-(biotin)-RDEL or PE-(Atto647)-RDEL), and cell viability was
determined and shown as percent relative to nonintoxicated cells. Error bars represent S.D. of three experiments performed in duplicate. D, confocal images of
HeLa cells expressing C-terminally GFP-tagged GPR107 that were intoxicated with PE-(Atto647)-RDEL. Note that PE partially colocalizes with GPR107. E, similar
number (1 ⫻ 106) of GPR107 null and wild type KBM7 cells were intoxicated with 50 ng/ml PE for 30 min, and the cell lysates (⬃20 ␮g) were analyzed by
immunoblots using PE and GAPDH antibodies.
tent with a previous report suggesting that the KDEL receptor
plays a role in the retrieval of PE to the ER (37).
In addition to KDELR1, we also identified Sec1 family
domain-containing protein 1 (SCFD1) and an oligosaccharyltransferase complex subunit (OSTC) as host factors used by PE,
and neither of these proteins had previously been implicated in
PE intoxication. Consistent with our KBM7 screen, pools of
HeLa cells mutated for either SCFD1 or OSTC show increased
resistance to intoxication (Fig. 1E). SCFD1 (also called rsly1)
regulates Golgi-to-ER retrograde protein transport, possibly
through its association with syntaxin 5 (38, 39). OSTC is predicted to form stable complexes with the Sec61 complex, a protein-conducting channel that translocates nascent polypeptides across the ER membrane (40).
GPR107 Is Required for PE and Campylobacter jejuni CDT
Intoxication—We identified GPR107 (synonyms are KIAA1624
and LUSTR1) as one of the hits with the highest enrichment of
gene-trap insertions in the surviving cells (Fig. 3A). GPR107
was likewise identified in a screen performed with cytolethal
distending toxin (cjCDT) secreted by C. jejuni (23). GPR107 is
also required for intoxication of mouse cells by ricin, as identi-
24010 JOURNAL OF BIOLOGICAL CHEMISTRY
fied in a genetic screen performed in haploid mouse embryonic
stem cells (41). Beyond its assignment to the family of GPCRs,
nothing is known about GPR107 (42, 43). CDTs produced by
Escherichia coli, Aggregatibacter actinomycetemcomitans, and
Haemophilus ducreyi retain the capacity to kill GPR107 null
cells, whereas cjCDT no longer does so (23). CDTs are believed
to exert their toxicity in the nucleus by triggering the cell cycle
checkpoint, causing G2 arrest, which eventually leads to cell
death (44). Even though their mechanisms of intoxication are
different, identification of GPR107 in the PE and cjCDT screens
suggests that they share a common host factor at some stage en
route to their final destination. Because GPR107-deficient and
wild type KBM7 cells bind PE equally well (Fig. 2E), we can
reasonably exclude a surface receptor function. The sensitivity
of intra-Golgi trafficking to pertussis toxin (17) indicates
involvement of a G-protein, and presumably this implies the
existence of coupled GPCR(s) and effector(s). GPR107 may be a
candidate for such a GPCR.
Ectopic Expression of GPR107 Restores Sensitivity to PE and
cjCDT in GPR107-null Cells—To validate the conclusion that
GPR107 is necessary for PE and cjCDT intoxication, a PE-reVOLUME 289 • NUMBER 35 • AUGUST 29, 2014
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
kkDa
coomassie
GPR107 Localizes to the TGN and Is Cleaved by Furin
A
GPR107
sense anti-sense
B
WT
KBM7
D
KBM7WT
C. jejuni
GPR107GT
GPR107GT + GPR107
G2/M
G2/M
GT
GPR107
G2/M
GPR107
GAPDH
A. actinomyce
temcomitans
cell viability (% rel to untreated)
C
KBM7WT
GPR107GT
GPR107GT+ GPR107WT
100
50
E. coli
0
0.001
0.01
PE (ug/ml)
1
non-intoxicated
intoxicated
sistant mutant clone (GPR107GT) that carried a defined genetrap insertion was isolated (Fig. 3B). Treatment of these cells
with cjCDT showed resistance of GPR107GT cells to intoxication (Fig. 3D). Introduction of HA-tagged GPR107 into
GPR107-deficient cells fully restored sensitivity to both PE and
cjCDT, confirming that GPR107 is indeed required for intoxication (Fig. 3, C and D). As expected, GPR107 null cells are
sensitive to CDTs from other species (Fig. 3D) (23). A pool of
HeLa cells exposed to the appropriate CRISPR/Cas9 construct
to target the GPR107 gene shows increased resistance to PE
(Fig. 1E).
GPR107 Is Localized in the Trans-Golgi Network—To determine the subcellular localization of GPR107, we established a
HeLa cell line that stably expresses GPR107 with an HA tag at
its C terminus. Confocal microscopy showed that GPR107
colocalizes with TGN46, a marker for the TGN, but not with
the cis/medial Golgi marker, Giantin (Fig. 4, A and C). Upon
addition of BFA, GPR107 redistributed over small vesicles as
did TGN46, but GPR107 and TGN46 did not completely colocalize, placing GPR107 in a distinct Golgi sub-compartment
(Fig. 4B). GPR107 also partially colocalizes with the endoprotease furin (Fig. 4D). We were unable to detect GPR107 at the
cell surface (Fig. 4E), where we employed the palmitoylated/
myristoylated-tagged red fluorescent protein as a plasma membrane marker(45).
GPR107 Undergoes Proteolytic Cleavage—GPR107 contains
seven transmembrane segments with a combined molecular
mass of ⬃52 kDa for the protein backbone, which carries three
predicted N-linked glycosylation sites (Fig. 5A). To assess maturation and turnover of GPR107, we performed pulse-chase
analysis in HeLa cells that stably express C-terminally
HA-tagged GPR107. We observed that GPR107 undergoes a
proteolytic cleavage to yield two fragments of 17 and 35 kDa
(molecular mass estimates made after complete deglycosylaAUGUST 29, 2014 • VOLUME 289 • NUMBER 35
A GPR107-HA
TGN46
Merge
B GPR107-HA
TGN46
Merge
C GPR107-HA
Giantin
Merge
D GPR107-HA
Furin
Merge
E GPR107-HA
pm-RFP
Merge
+BFA
FIGURE 4. GPR107 is localized in the trans-Golgi network. A, confocal
images of HeLa cells expressing C-terminally HA-tagged GPR107. Cells were costained for HA and for the trans-Golgi network marker TGN46. B, cells were
treated with BFA for 3 h and co-stained as described in A. C–E, cells were
costained with HA and the cis/medial-Golgi marker Giantin, furin, or cell surface marker palmitoylated/myristoylated-tagged red fluorescent protein
(pm-RFP). In all images the nuclei were stained with DAPI (blue). Note that
GPR107 colocalizes with TGN46 but not with Giantin, and the presence of
both red and green vesicular structures in the BFA-treated cells is indicative of
at least partial segregation of GPR107 and TGN46.
tion of immunoprecipitated material with PNGase F) (Fig. 5C).
A single cleavage is therefore likely responsible for the generation of the two fragments. The larger fragment bears the HA
JOURNAL OF BIOLOGICAL CHEMISTRY
24011
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
FIGURE 3. GPR107-deficient KBM7 cells are resistant to PE and C. jejuni CDT but sensitive to the other CDTs. A, map of unique insertion sites in the GPR107
gene in the surviving KBM7 cell population. Boxes denote transmembrane domains. B, RT-PCR analysis showing the absence of GPR107 transcript in the clonal
cell line carrying gene-trap insertions in the GPR107 gene. C, KBM7WT, GPR107GT, and GPR107GT cells reconstituted with GPR107 cDNA were intoxicated with
PE; cell viability was determined and shown as percent relative to nonintoxicated cells. Error bars represent S.D. of three experiments performed in duplicate.
D, cells were intoxicated for 18 h with CDTs of different bacterial origin, stained with propidium iodide, and subjected to FACS analysis to assess the G2/M cell
cycle arrest. Intensity of fluorescence was measured, and the percent maximum was presented in the overlaid histograms.
GPR107 Localizes to the TGN and Is Cleaved by Furin
A
N
B
Proposed furin cleavage site
R182
SS
Cytosol
C
C
60
D
GPR107R182A
GPR107WT
0
180
0
60
180 Chase (min)
37 -
] GPR107
(C-term)
E
75 -
60
180
0
60
180
90
BFA
180
45
90
180
37 -
] GPR107
(C-term)
kDa
Control
0
Chase (min)
Chase (min)
] GPR107
(full length)
F
GPR107C109/228A
GPR107WT
0
45
50 -
] GPR107
(full length)
kDa
---AGNQTQKTQDGGKSKRSTVDSKAMGEKS---197
---AGNQTQKTQDGGKSKRSTVDSKAMGEKS---197
---SGSQAPKEQESGKSKRSTVDSKATGEKS---200
---AGNQTQLKPDSGKSKRSTVDSKATGEKS---200
---KDSEARRTLDGFKAGRSTVDSKAITERS---195
---KDSKVQRTPDGSKAQRSTVDSKTIAEKF---195
---TETNKNTAGKDTKSKRSTTSSQSIVEQK---300
---PPNAAPKVEEAVKSEQKQEEAPAEKDET---276
---PQNKEPDDGSQSKASKSKRDAENKAEDT---292
---PVEQRGWFRNLFGRFLNPGAPQIAYDNY---189
Control
0
75 -
75 -
50 -
Proposed furin
cleavage site
H.sapiens:
P.troglodytes:
B.taurus:
C.lupus:
M.musculus:
R.norvegicus:
G.gallus
D.melanogaster
D.rerio
C.elegans
45
90
ConA
180
180
Cont
Furin
75 -
37 -
50 -
37 -
] GPR107
(C-term)
kDa
] GPR107
(full length)
] GPR107
(C-term)
kDa
non-reducing gel
WT
KBM7
GT
GPR107
GT
WT
GPR107 + GPR107
GT
R182A
GPR107 + GPR107
GT
C109/228A
GPR107 + GPR107
100
cell viability (% rel to
untreated cells)
G
50
0
0.05
0.25
PE (μg/ml)
1
FIGURE 5. GPR107 is cleaved by furin and the disulfide bond that associates the cleaved fragments is essential for its activity. A, predicted topological
structure of GPR107. N-Glycosylation sites, disulfide bond linkage, and the furin cleavage site are indicated. B, sequence alignment of the furin-like cleavage site
present at the N-terminal region of GPR107 from different eukaryotes. C, HeLa cells expressing C-terminally HA-tagged GPR107WT and GPR107R182A were
labeled with [35S]methionine/cysteine for 30 min and chased for the indicated time points. Cells were lysed and immunoprecipitated with anti-HA coupled
beads, subjected to PNGase F treatment, analyzed by SDS-PAGE, and autoradiography. D, BFA untreated and treated C-terminally HA-tagged GPR107WTexpressing HeLa cells were labeled with [35S]methionine/cysteine for 30 min and chased for different time points. Cells were lysed and immunoprecipitated
with anti-HA coupled beads, subjected to Endo H treatment, and analyzed as described in C. E, HeLa cells expressing C-terminally HA-tagged GPR107WT and
GPR107C109/228A were labeled with [35S]methionine/cysteine for 30 min, chased, and immunoprecipitated as described in C. Unless otherwise indicated,
immunoprecipitates were eluted and analyzed in reducing conditions. F, HeLa cells expressing C-terminally HA-tagged GPR107WT were labeled with [35S]methionine/cysteine for 30 min and chased in the presence or absence of the lysosomal inhibitor concanamycin A. Cells were lysed and immunoprecipitated with
anti-HA coupled beads, and samples were processed as described in C (left panel). Alternatively, immunoprecipitate at the 0-h chase time point was subjected
to furin digestion and analyzed by SDS-PAGE and autoradiography (right panel). G, KBM7WT, GPR107GT, and GPR107GT cells reconstituted with GPR107WT,
GPR107R182A, or GPR107C109A/C228A were intoxicated with PE; cell viability was determined and presented as percent relative to nonintoxicated cells. Error bars
represent S.D. of three experiments performed in duplicate.
epitope and therefore corresponds to the C terminus of
GPR107 (Fig. 5C).
GPR107 Is Cleaved by Furin and the Cleaved Fragment
Remains Associated with Disulfide Bond—Where in the cell
does cleavage occur? What is the enzyme responsible for
cleavage?
GPR107 cleavage is blocked by exposure of cells to BFA (Fig.
5D), whereas agents that compromise lysosomal function such as
concanamycin A have little effect on cleavage (Fig. 5F, left panel).
Because cleavage occurs relatively soon after synthesis and
GPR107 is localized predominantly in the TGN, we explored the
role of furin, the major processing protease of the secretory pathway, residing also in the TGN (46). GPR107 contains an extended
24012 JOURNAL OF BIOLOGICAL CHEMISTRY
furin recognition site that includes KSKR, a variant of the classical
furin cleavage motif (Arg-Xaa-(Lys/Arg)-Arg) (Fig. 5, A and B).
Although not common among furin substrates, in GPR107 the Lys
residue replaces the first conserved Arg, similar to the furin cleavage site found in the Ebola virus glycoprotein precursor (47). To
assess its possible role as a cleavage site, we generated several
mutants of GPR107 centered on the KSKR sequence and tested
their sensitivity to cleavage in HeLa cell transfectants. A single
mutation, R182A, abolished cleavage of GPR107 (Fig. 5C).
In an alternative approach, we pulse-labeled HeLa cells that
express HA-tagged GPR107 with [35S]methionine/cysteine for
30 min, immunoprecipitated GPR107, and then subjected the
immunoprecipitate to digestion with furin. Under these condiVOLUME 289 • NUMBER 35 • AUGUST 29, 2014
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
] GPR107
(full length)
50 -
GPR107 Localizes to the TGN and Is Cleaved by Furin
B
A
Δ40-182
GPR107
-HA
TGN46
Merge
N
Cytosol
C
cell viability (% rel to
untreated cells)
C
WT
KBM7
GT
GPR107
GT
Δ40-182
GPR107 + GPR107
100
75
50
25
0
0.012
0.025
PE (μg/ml)
0.25
1
tions, immunoprecipitated GPR107 was cleaved by furin and
yielded a C-terminal fragment similar in mobility to that produced in living cells (Fig. 5F, right panel). GPR107 co-localized
with furin at the TGN, consistent with furin’s proposed role in
the proteolytic conversion of GPR107 (Fig. 4D).
To determine whether the furin-processed fragments of
GPR107 remain associated after cleavage, we examined the
behavior of GPR107 by SDS-PAGE under nonreducing conditions. The predicted furin cleavage site is straddled by two cysteine residues, which could form the only possible disulfide
bond in the predicted extracellular portion of GPR107. When
analyzed under nonreducing conditions, the cleavage fragments indeed remained associated. The C109A/C228A mutation eliminates the possibility of forming this single disulfide
bond and abolished the covalent association of the two cleavage
fragments (Fig. 5E), further demonstrating that the two cleavage fragments are indeed disulfide-linked.
Is proteolytic cleavage of GPR107 important for PE and
cjCDT intoxication? We introduced the cleavage-resistant
form of GPR107 (GPR107R182A-HA) into GPR107-deficient
cells and examined its ability to restore sensitivity to PE and
cjCDT. We found that GPR107R182A-HA restored sensitivity to
both PE and cjCDT to a level similar to that of wild type GPR107
(Fig. 5G). Furin cleavage of GPR107 is thus dispensable for PE
intoxication. However, expression of the C109A/C228A
mutant in GPR107-deficient cells only partially restored sensitivity to PE (Fig. 5G), indicating that the disulfide bond that
preserves the interaction between the two cleavage products
contributes to GPR107 function.
N-terminal Region of GPR107 Is Required for Its Function—
We generated a truncation mutant (GPR107⌬40 –182) that lacks
the N-terminal fragment of GPR107 to determine the role of
this fragment in PE intoxication. This construct carries the
N-terminal GPR107 signal peptide (amino acids 1–39) to
allow proper ER insertion of the mutant GPR107 (Fig. 6A).
GPR107⌬40 –182 localized to the TGN, similar to wild type
AUGUST 29, 2014 • VOLUME 289 • NUMBER 35
GPR107 (Fig. 6B), establishing that the requisite TGN targeting
signals are contained elsewhere in the GPR107 sequence. However, expression of GPR107⌬40 –182 in GPR107GT cells failed to
restore sensitivity to PE intoxication (Fig. 6C). The N-terminal
extracellular region of GPR107 is therefore critical for its function in PE transport.
GPR107 Contributes to Retrograde Transport of Cholera
Toxin—To gain more insight into the biological function of
GPR107, we set out to test its involvement in both anterograde
and retrograde trafficking. First, we examined by pulse-chase
analysis whether or not the absence of GPR107 affects protein
secretion. Media were collected at the different chase time
points and analyzed by SDS-PAGE and autoradiography. No
obvious differences were observed between the products
released by GPR107-deficient and wild type KBM7 cells (Fig.
7A). The absence of GPR107 was also without effect on the
maturation of class I MHC products, type I membrane glycoproteins that traffic via the constitutive secretory pathway to
the cell surface. GPR107-deficient cells show maturation of
class I MHC products at a rate similar to that seen in wild type
cells (Fig. 7B), as assessed by rate and extent of acquisition of
Endo H resistance. In our haploid genetic screen, we identified
furin as one of the hits required for intoxication by PE. Furin is
a protease that cleaves not only PE (5) but also its receptor
(LRP1; Gu et al. (33)) and GPR107 (this study). Consequently,
we examined the maturation/trafficking of furin in GPR107deficient cells. Furin not only recycles within the secretory
pathway but it is also secretes (46). No difference was found
between GPR107-deficient and wild type KBM7 cells in maturation or secretion of furin (Fig. 7C). Confocal microscopy on
GPR107-depleted HeLa cells showed that the distribution of
furin was similar to that of the control cells (Fig. 7D, left panel).
GPR107 is thus dispensable for anterograde transport/secretion of furin.
Given its localization to the trans-Golgi network, does the
lack of GPR107 affect the structure of the Golgi? Analysis by
JOURNAL OF BIOLOGICAL CHEMISTRY
24013
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
FIGURE 6. N-terminal region of GPR107 is essential for its activity. A, topological structure of GPR107⌬40 –182. B, confocal images of HeLa cells expressing
C-terminally HA-tagged GPR107⌬40 –182. Cells were costained for HA and for the trans-Golgi network marker TGN46. The nuclei were stained with DAPI (blue).
C, KBM7WT, GPR107GT, and GPR107GT cells reconstituted with GPR107⌬40 –182 were intoxicated with PE, and cell viability was determined and shown as percent
relative to nonintoxicated cells. Error bars represent S.D. of three independent experiments performed in duplicate.
GPR107 Localizes to the TGN and Is Cleaved by Furin
A
C
KBM7WT
Chase (min) 0
250-
37oC
30
60
GPR107GT
4oC
60
0
37oC
30
60
4 oC
60
+
0
WT
KBM7
+
+
2
4
GPR107GT
+
0
4
+
2
+
4
4
WT
KBM7
4
2
GPR107
2
GT
4
PNGase F
Chase (h)
200 -
200 -
100 -
100 75 -
- Furin
i
- Furins
75 kDa
50 -
Cell lysate
Media
37 -
25 -
kDa
D
B
GPR107GT
0
30
90 Chase (min)
50 -
50 37 -
- MHC I + gly
- MHC I - gly
37 -
shGPR107
shGFP
#1 #2
kDa
kDa
GPR107
(anti-HA)
p97
E
TGN46
Chase (h)
-
0
Furin
0.5
2.5
shGFP
shGPR107
#1
shGPR107
#2
FIGURE 7. GPR107 is dispensable for anterograde protein transport and for maintaining the morphological structure of the trans-Golgi network. A,
equal number of wild type and GPR107-deficient KBM7 cells were labeled with [35S]methionine/cysteine for 10 min and chased at 37 °C or kept on ice.
Supernatants were collected at the indicated time points and analyzed by SDS-PAGE and autoradiography. B, wild type and cells lacking GPR107 were
pulse-labeled with [35S]methionine/cysteine as in A and chased for the indicated time points. Cells were lysed, and class I MHC molecules were recovered using
W6/32 antibody, treated with Endo H, and analyzed by SDS-PAGE and autoradiography. C, KBM7WT and GPR107GT expressing C-terminally HA-tagged furin
were labeled with [35S]methionine/cysteine for 20 min and chased for different time points. Both the cells and the supernatants were collected in parallel, lysed,
and immunoprecipitated with anti-HA-coupled beads and where indicated subjected to PNGase F treatment and then analyzed by SDS-PAGE and autoradiography. furini is intracellular furin; furins is secreted furin. D, HeLa cells expressing HA-tagged GPR107 were transduced with the control shGFP or two sets of
shRNA that targets GPR107. Cell lysates were prepared from these samples, and knockdown efficiency was examined by Western blotting using anti-HA HRP.
E, confocal images of control and GPR107-depleted HeLa cells before or at different time points after BFA treatment. Cells were stained for the trans-Golgi
network marker TGN46 or furin (left panel). In all images, the nuclei were stained with DAPI (blue).
confocal microscopy on wild type and GPR107-depleted HeLa
cells for the trans-Golgi marker TGN46 before and after BFA
treatment (Fig. 7D) showed no difference in overall structure or
in the recovery from Golgi fragmentation post-BFA treatment
(Fig. 7D). GPR107 is therefore not obviously involved in maintaining the structure of this organelle.
24014 JOURNAL OF BIOLOGICAL CHEMISTRY
To examine the role of GPR107 in retrograde transport, we
used a modified version of cholera toxin (CTx), equipped with a
glycosylation motif and biotin at the C terminus of the A1 subunit (Guimaraes et al. (21)). A similar number of KBM7WT,
GPR107GT, and GPR107GT cells reconstituted with GPR107
cDNA were intoxicated with CTx-GGGK(biotin)-NNSTG for
VOLUME 289 • NUMBER 35 • AUGUST 29, 2014
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
KBM7WT
0
30
90
GPR107 Localizes to the TGN and Is Cleaved by Furin
30 min and then chased for 1 and 3 h. Glycosylation of CTx
indicates arrival in the ER and is accompanied by an increase in
apparent molecular weight, as detected by Western blotting
using streptavidin-HRP. Cells that lack GPR107 showed a
reduced level of CTx glycosylation compared with control cells
(Fig. 8, A and B). GPR107GT cells reconstituted with GPR107
cDNA (overexpressors) showed an increased level of CTx glycosylation (Fig. 8, A and B), suggesting that GPR107 contributes
to retrograde transport of CTx and possibly of PE as well.
We generated a similarly engineered version of PE, equipped
with a glycosylation motif extended with an ER retrieval signal
sequence and modified with a biotin residue (PE-GGGK(biotin)-NNSTGKDEL), to probe the role of GPR107 in retrograde
transport of PE. However, we were unable to detect any glycosylated PE even in the wild type or GPR107-null cells reconstituted with GPR107 cDNA overexpressors (data not shown).
This is consistent with our microscopy results, where we were
likewise unable to detect PE in compartments other than the
endocytic pathway (data not shown). This is entirely consistent
with the notion that only very few molecules of PE need to make
it to the final destination, the cytosol, to achieve intoxication.
AUGUST 29, 2014 • VOLUME 289 • NUMBER 35
DISCUSSION
Bacterial toxins are valuable tools to dissect the physiology of
mammalian cells. The coevolution of pathogens and their hosts
results in strategies in which host factors are exploited to the
advantage of the invader (48, 49). We set out to expand our
knowledge of how a bacterial toxin takes advantage of host cell
machinery by performing a genome-wide genetic screen and
molecular characterization of the hits.
Loss-of-function haploid genetic screens using human
KBM7 cells have led to the identification of host factors essential for viral (29, 50, 51) and bacterial (52) pathogenesis as well
as for other bacterial toxins (21, 29, 53). We used CRISPR/Cas9mediated gene editing in HeLa cells to support the results
obtained in the KBM7 screen. GPR107 is one of the novel genes
identified in our genetic screen in KBM7 cells as a host factor
used by PE. GPR107 is ubiquitously expressed and localizes to
the TGN. It is conserved in higher eukaryotes, including
Caenorhabditis elegans, fruit fly, zebra fish, and Arabidopsis
thaliana. GPR107 has the hallmarks of a GPCR, but if an endogenous ligand exists it remains to be identified, because GPR107
JOURNAL OF BIOLOGICAL CHEMISTRY
24015
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
FIGURE 8. GPR107 is essential for retrograde trafficking of cholera toxin. A, equal numbers of KBM7WT, GPR107GT, and reconstituted GPR107GT cells were
intoxicated with CTx-GGGK(biotin)-NNSTG for 30 min and chased for the indicated time points. Cells were lysed, and the glycosylation of CTx was analyzed by
Western blotting using streptavidin-HRP. B, quantification of experiments performed as described in A. C, schematic representation of the intracellular
pathway of PE based on the results of the genetic screen. Novel genes identified in the screen are shown in red.
GPR107 Localizes to the TGN and Is Cleaved by Furin
24016 JOURNAL OF BIOLOGICAL CHEMISTRY
pitulate the GPR107 null phenotype through shRNA-mediated
knockdown have failed, perhaps because only a few GPR107
molecules may suffice to exert its normal function. Consequently, if the cleavage-resistant version of GPR107 would
show much reduced activity compared with its cleavable counterpart, it is uncertain whether we would have been able to
accurately score such a difference.
Despite its presence in the TGN and seemingly normal localization pattern compared with intact GPR107, the mutant lacking the N-terminal region of GPR107 fails to restore sensitivity
to PE when expressed in GPR107-deficient cells. Furthermore,
compromising the disulfide bridge that links the two fragments
together affects GPR107 function. This may be due to the fact
that any modification at the N terminus affects its ability to bind
its ligand and/or interactors that are necessary for its function.
The disruption of the disulfide bond may lead to the assembly of
an unstable or improperly folded form of GPR107 with a
reduced ability to interact with its protein cargo.
Our biochemical data exclude an obvious role for GPR107 in
anterograde trafficking. However, cells that lack GPR107
showed a reduced level of glycosylation of the engineered cholera toxin reporter. Reconstitution of GPR107-null cells with
GPR107 cDNA, which presumably causes overexpression of
GPR107 to levels that exceed wild type levels, resulted in an
increased level of cholera toxin glycosylation. Combined, these
data are consistent with the involvement of GPR107 in retrograde trafficking, supported also by the fact that GPR107 is
localized at the Golgi and that PE uses the retrograde trafficking
pathway to reach its final destination, the cytosol.
In conclusion, we identify several novel cellular components
used by PE and thus provide a far more detailed map of the PE
intoxication pathway than what was known until now (Fig. 8C).
Bacterial toxins can thus help identify novel host components
involved in key intracellular trafficking steps. The exact contribution of GPR107 to normal host physiology deserves exploration in depth. Given its ubiquitous patterns of expression and
conservation among higher eukaryotes (61), GPR107 might
belong to the GPCRs that likely orchestrate G-protein-dependent events at the Golgi apparatus (14, 17).
Acknowledgments—We thank Irene Wuethrich, Malini Varadarajan, Sharvan Sehrawat, Eduardo Guillen, and Paul Koenig for technical support and valuable discussions. We also thank Tom DiCesare
for illustrations and Wendy Salmon of the Keck facility for imaging.
We thank Robin Ross of New England Regional Center of Excellence
bimolecule production core facility for large scale production of P.
aeruginosa exotoxin A.
REFERENCES
1. Bonifacino, J. S., and Glick, B. S. (2004) The mechanisms of vesicle budding and fusion. Cell 116, 153–166
2. De Matteis, M. A., and Luini, A. (2008) Exiting the Golgi complex. Nat.
Rev. Mol. Cell Biol. 9, 273–284
3. Sandvig, K., Skotland, T., van Deurs, B., and Klokk, T. I. (2013) Retrograde
transport of protein toxins through the Golgi apparatus. Histochem. Cell
Biol. 140, 317–326
4. Allured, V. S., Collier, R. J., Carroll, S. F., and McKay, D. B. (1986) Structure
of exotoxin A of Pseudomonas aeruginosa at 3.0-Angstrom resolution.
Proc. Natl. Acad. Sci. U.S.A. 83, 1320 –1324
VOLUME 289 • NUMBER 35 • AUGUST 29, 2014
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
is unlikely to have evolved to enable intoxication by ricin or by
bacterial toxin.
The GPR107 null cells obtained in our genetic screens are
resistant to CDT from C. jejuni (cjCDT), but remain sensitive to
other CDTs (E. coli and A. actinomycetemcomitans). How does
GPR107 participate in intoxication by PE and cjCDT? Our
inability to detect GPR107 at the cell surface makes it unlikely
that GPR107 serves as the receptor, although the presence of a
small number of surface-disposed GPR107 molecules would
have escaped detection by the approaches used here. We consider a role for GPR107 as a shared receptor for PE and cjCDT
less plausible also in view of the widely divergent molecular
structures of PE and cjCDT. Finally, our finding that GPR107
null cells bind PE in quantities similar to the parental KBM7 cell
line also argues against a surface receptor role for GPR107.
There is a consensus that the closely related proteins LRP1 and
LRP1B are receptors for PE (7, 8). Although GPCR signaling has
mostly been considered as confined to the cell surface, recent
evidence points to the possibility of intracellular signaling as
well (54).
Proteins involved in retrograde trafficking identified in the
PE screen (GARP complex, KDELR1, AP1M1, SCFD1, and
OSTC) did not appear as hits in the cjCDT screen (23), demonstrating that the pathways of intoxication by PE and cjCDT
overlap only in part. Interestingly, such a high degree of specificity shown by individual toxins in co-opting trafficking pathways may represent an evolutionary adaptation of these bacterial products toward optimizing their ability to reach specific
cellular targets in a fully active form.
Membrane vesiculation at the TGN requires the trimeric
G-protein G␤␥ subunits. Addition of G␤␥ subunits stimulates
Golgi vesiculation in vitro through activation of PKD (13, 55,
56). The heterotrimeric G-proteins G␣i3 and G␣s have been
localized to the Golgi apparatus (57). Overexpression of G␣i3
and the use of reagents that perturb the function of G-proteins
demonstrate the involvement of heterotrimeric G-proteins in
vesicular transport (17). PE and cjCDT might both require
G-proteins for retrograde trafficking through the Golgi. To the
best of our knowledge, the GPCR(s) associated with G-proteins
at the TGN remain(s) unknown. GPR107 is therefore a candidate for a receptor that controls certain aspects of intra-Golgi
trafficking.
GPR107 is cleaved by furin, and the cleaved fragments
remain associated, suggesting a conceptual analogy with protease-activated GPCRs such as the thrombin receptor (58, 59).
In its role as a pro-protein convertase, cleavage by furin may
activate the substrate, but proteolysis can also inactivate or
modify the activity of the furin substrate (60). If GPR107 were a
furin-activated GPCR that undergoes cleavage in the Golgi,
then this cleavage might be required for GPR107 function. Our
finding that expression of a cleavage-resistant form of GPR107
in GPR107-null cells restores sensitivity to both PE and cjCDT
shows that cleavage is dispensable for intoxication. However,
this does not rule out the possibility that cleavage is important
for other cellular processes that might involve GPR107. Furthermore, the cleavage-resistant version of GPR107 may still
allow a segment of its N-terminal domain to engage the ligandbinding pocket of GPR107 and activate it. Our attempts to reca-
GPR107 Localizes to the TGN and Is Cleaved by Furin
AUGUST 29, 2014 • VOLUME 289 • NUMBER 35
23.
24.
25.
26.
27.
28.
French, L., Garner, P., Garnett, J., Ghori, M. J., Gilby, L. M., Gillson, C. J.,
Glithero, R. J., Grafham, D. V., Grant, M., Gribble, S., Griffiths, C., Griffiths, M., Hall, R., Halls, K. S., Hammond, S., Harley, J. L., Hart, E. A.,
Heath, P. D., Heathcott, R., Holmes, S. J., Howden, P. J., Howe, K. L.,
Howell, G. R., Huckle, E., Humphray, S. J., Humphries, M. D., Hunt, A. R.,
Johnson, C. M., Joy, A. A., Kay, M., Keenan, S. J., Kimberley, A. M., King,
A., Laird, G. K., Langford, C., Lawlor, S., Leongamornlert, D. A., Leversha,
M., Lloyd, C. R., Lloyd, D. M., Loveland, J. E., Lovell, J., Martin, S.,
Mashreghi-Mohammadi, M., Maslen, G. L., Matthews, L., McCann, O. T.,
McLaren, S. J., McLay, K., McMurray, A., Moore, M. J., Mullikin, J. C.,
Niblett, D., Nickerson, T., Novik, K. L., Oliver, K., Overton-Larty, E. K.,
Parker, A., Patel, R., Pearce, A. V., Peck, A. I., Phillimore, B., Phillips, S.,
Plumb, R. W., Porter, K. M., Ramsey, Y., Ranby, S. A., Rice, C. M., Ross,
M. T., Searle, S. M., Sehra, H. K., Sheridan, E., Skuce, C. D., Smith, S.,
Smith, M., Spraggon, L., Squares, S. L., Steward, C. A., Sycamore, N.,
Tamlyn-Hall, G., Tester, J., Theaker, A. J., Thomas, D. W., Thorpe, A.,
Tracey, A., Tromans, A., Tubby, B., Wall, M., Wallis, J. M., West, A. P.,
White, S. S., Whitehead, S. L., Whittaker, H., Wild, A., Willey, D. J.,
Wilmer, T. E., Wood, J. M., Wray, P. W., Wyatt, J. C., Young, L., Younger,
R. M., Bentley, D. R., Coulson, A., Durbin, R., Hubbard, T., Sulston, J. E.,
Dunham, I., Rogers, J., and Beck, S. (2003) The DNA sequence and analysis
of human chromosome 6. Nature 425, 805– 811
Carette, J. E., Guimaraes, C. P., Wuethrich, I., Blomen, V. A., Varadarajan,
M., Sun, C., Bell, G., Yuan, B., Muellner, M. K., Nijman, S. M., Ploegh, H. L.,
and Brummelkamp, T. R. (2011) Global gene disruption in human cells to
assign genes to phenotypes by deep sequencing. Nat. Biotechnol. 29,
542–546
Humphray, S. J., Oliver, K., Hunt, A. R., Plumb, R. W., Loveland, J. E.,
Howe, K. L., Andrews, T. D., Searle, S., Hunt, S. E., Scott, C. E., Jones, M. C.,
Ainscough, R., Almeida, J. P., Ambrose, K. D., Ashwell, R. I., Babbage,
A. K., Babbage, S., Bagguley, C. L., Bailey, J., Banerjee, R., Barker, D. J.,
Barlow, K. F., Bates, K., Beasley, H., Beasley, O., Bird, C. P., Bray-Allen, S.,
Brown, A. J., Brown, J. Y., Burford, D., Burrill, W., Burton, J., Carder, C.,
Carter, N. P., Chapman, J. C., Chen, Y., Clarke, G., Clark, S. Y., Clee, C. M.,
Clegg, S., Collier, R. E., Corby, N., Crosier, M., Cummings, A. T., Davies, J.,
Dhami, P., Dunn, M., Dutta, I., Dyer, L. W., Earthrowl, M. E., Faulkner, L.,
Fleming, C. J., Frankish, A., Frankland, J. A., French, L., Fricker, D. G.,
Garner, P., Garnett, J., Ghori, J., Gilbert, J. G., Glison, C., Grafham, D. V.,
Gribble, S., Griffiths, C., Griffiths-Jones, S., Grocock, R., Guy, J., Hall, R. E.,
Hammond, S., Harley, J. L., Harrison, E. S., Hart, E. A., Heath, P. D., Henderson, C. D., Hopkins, B. L., Howard, P. J., Howden, P. J., Huckle, E.,
Johnson, C., Johnson, D., Joy, A. A., Kay, M., Keenan, S., Kershaw, J. K.,
Kimberley, A. M., King, A., Knights, A., Laird, G. K., Langford, C., Lawlor,
S., Leongamornlert, D. A., Leversha, M., Lloyd, C., Lloyd, D. M., Lovell, J.,
Martin, S., Mashreghi-Mohammadi, M., Matthews, L., McLaren, S.,
McLay, K. E., McMurray, A., Milne, S., Nickerson, T., Nisbett, J., Nordsiek,
G., Pearce, A. V., Peck, A. I., Porter, K. M., Pandian, R., Pelan, S., Phillimore, B., Povey, S., Ramsey, Y., Rand, V., Scharfe, M., Sehra, H. K., Shownkeen, R., Sims, S. K., Skuce, C. D., Smith, M., Steward, C. A., Swarbreck, D.,
Sycamore, N., Tester, J., Thorpe, A., Tracey, A., Tromans, A., Thomas,
D. W., Wall, M., Wallis, J. M., West, A. P., Whitehead, S. L., Willey, D. L.,
Williams, S. A., Wilming, L., Wray, P. W., Young, L., Ashurst, J. L., Coulson, A., Blöcker, H., Durbin, R., Sulston, J. E., Hubbard, T., Jackson, M. J.,
Bentley, D. R., Beck, S., Rogers, J., and Dunham, I. (2004) DNA sequence
and analysis of human chromosome 9. Nature 429, 369 –374
Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville,
J. E., and Church, G. M. (2013) RNA-guided human genome engineering
via Cas9. Science 339, 823– 826
Guschin, D. Y., Waite, A. J., Katibah, G. E., Miller, J. C., Holmes, M. C., and
Rebar, E. J. (2010) A rapid and general assay for monitoring endogenous
gene modification. Methods Mol. Biol. 649, 247–256
Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang,
F., and Jaenisch, R. (2013) One-step generation of mice carrying mutations
in multiple genes by CRISPR/Cas-mediated genome engineering. Cell
153, 910 –918
Tafesse, F. G., Sanyal, S., Ashour, J., Guimaraes, C. P., Hermansson, M.,
Somerharju, P., and Ploegh, H. L. (2013) Intact sphingomyelin biosynthetic pathway is essential for intracellular transport of influenza virus
JOURNAL OF BIOLOGICAL CHEMISTRY
24017
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
5. Wedekind, J. E., Trame, C. B., Dorywalska, M., Koehl, P., Raschke, T. M.,
McKee, M., FitzGerald, D., Collier, R. J., and McKay, D. B. (2001) Refined
crystallographic structure of Pseudomonas aeruginosa exotoxin A and its
implications for the molecular mechanism of toxicity. J. Mol. Biol. 314,
823– 837
6. Weldon, J. E., and Pastan, I. (2011) A guide to taming a toxin–recombinant
immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer. FEBS J. 278, 4683– 4700
7. Pastrana, D. V., Hanson, A. J., Knisely, J., Bu, G., and Fitzgerald, D. J. (2005)
LRP 1 B functions as a receptor for Pseudomonas exotoxin. Biochim. Biophys. Acta 1741, 234 –239
8. Kounnas, M. Z., Morris, R. E., Thompson, M. R., FitzGerald, D. J., Strickland, D. K., and Saelinger, C. B. (1992) The ␣2-macroglobulin receptor/
low density lipoprotein receptor-related protein binds and internalizes
Pseudomonas exotoxin A. J. Biol. Chem. 267, 12420 –12423
9. Cai, H., Reinisch, K., and Ferro-Novick, S. (2007) Coats, tethers, Rabs, and
SNAREs work together to mediate the intracellular destination of a transport vesicle. Dev. Cell 12, 671– 682
10. Stenmark, H. (2009) Rab GTPases as coordinators of vesicle traffic. Nat.
Rev. Mol. Cell Biol. 10, 513–525
11. Fukuda, M. (2008) Regulation of secretory vesicle traffic by Rab small
GTPases. Cell. Mol. Life Sci. 65, 2801–2813
12. Bomsel, M., and Mostov, K. (1992) Role of heterotrimeric G proteins in
membrane traffic. Mol. Biol. Cell 3, 1317–1328
13. Takizawa, P. A., Yucel, J. K., Veit, B., Faulkner, D. J., Deerinck, T., Soto, G.,
Ellisman, M., and Malhotra, V. (1993) Complete vesiculation of Golgi
membranes and inhibition of protein transport by a novel sea sponge
metabolite, ilimaquinone. Cell 73, 1079 –1090
14. Jamora, C., Takizawa, P. A., Zaarour, R. F., Denesvre, C., Faulkner, D. J.,
and Malhotra, V. (1997) Regulation of Golgi structure through heterotrimeric G proteins. Cell 91, 617– 626
15. Irannejad, R., and Wedegaertner, P. B. (2010) Regulation of constitutive
cargo transport from the trans-Golgi network to plasma membrane by
Golgi-localized G protein ␤␥ subunits. J. Biol. Chem. 285, 32393–32404
16. Jamora, C., Yamanouye, N., Van Lint, J., Laudenslager, J., Vandenheede,
J. R., Faulkner, D. J., and Malhotra, V. (1999) G␤␥-mediated regulation of
Golgi organization is through the direct activation of protein kinase D.
Cell 98, 59 – 68
17. Stow, J. L., de Almeida, J. B., Narula, N., Holtzman, E. J., Ercolani, L., and
Ausiello, D. A. (1991) A heterotrimeric G protein, G␣i-3, on Golgi membranes regulates the secretion of a heparan sulfate proteoglycan in LLCPK1 epithelial cells. J. Cell Biol. 114, 1113–1124
18. Gray, G. L., Smith, D. H., Baldridge, J. S., Harkins, R. N., Vasil, M. L., Chen,
E. Y., and Heyneker, H. L. (1984) Cloning, nucleotide sequence, and expression in Escherichia coli of the exotoxin A structural gene of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U.S.A. 81, 2645–2649
19. Popp, M. W., Antos, J. M., and Ploegh, H. L. (2009) Site-specific protein
labeling via sortase-mediated transpeptidation. Curr. Protoc. Protein Sci.
Chapter 15, Unit 15.3
20. Guimaraes, C. P., Witte, M. D., Theile, C. S., Bozkurt, G., Kundrat, L.,
Blom, A. E., and Ploegh, H. L. (2013) Site-specific C-terminal and internal
loop labeling of proteins using sortase-mediated reactions. Nat. Protoc. 8,
1787–1799
21. Guimaraes, C. P., Carette, J. E., Varadarajan, M., Antos, J., Popp, M. W.,
Spooner, E., Brummelkamp, T. R., and Ploegh, H. L. (2011) Identification
of host cell factors required for intoxication through use of modified cholera toxin. J. Cell Biol. 195, 751–764
22. Mungall, A. J., Palmer, S. A., Sims, S. K., Edwards, C. A., Ashurst, J. L.,
Wilming, L., Jones, M. C., Horton, R., Hunt, S. E., Scott, C. E., Gilbert, J. G.,
Clamp, M. E., Bethel, G., Milne, S., Ainscough, R., Almeida, J. P., Ambrose,
K. D., Andrews, T. D., Ashwell, R. I., Babbage, A. K., Bagguley, C. L., Bailey,
J., Banerjee, R., Barker, D. J., Barlow, K. F., Bates, K., Beare, D. M., Beasley,
H., Beasley, O., Bird, C. P., Blakey, S., Bray-Allen, S., Brook, J., Brown, A. J.,
Brown, J. Y., Burford, D. C., Burrill, W., Burton, J., Carder, C., Carter, N. P.,
Chapman, J. C., Clark, S. Y., Clark, G., Clee, C. M., Clegg, S., Cobley, V.,
Collier, R. E., Collins, J. E., Colman, L. K., Corby, N. R., Coville, G. J., Culley,
K. M., Dhami, P., Davies, J., Dunn, M., Earthrowl, M. E., Ellington, A. E.,
Evans, K. A., Faulkner, L., Francis, M. D., Frankish, A., Frankland, J.,
GPR107 Localizes to the TGN and Is Cleaved by Furin
24018 JOURNAL OF BIOLOGICAL CHEMISTRY
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
Maturation of the trans-Golgi network protease furin: compartmentalization of propeptide removal, substrate cleavage, and COOH-terminal truncation. J. Cell Biol. 127, 1829 –1842
Volchkov, V. E., Feldmann, H., Volchkova, V. A., and Klenk, H. D. (1998)
Processing of the Ebola virus glycoprotein by the proprotein convertase
furin. Proc. Natl. Acad. Sci. U.S.A. 95, 5762–5767
Wiertz, E. J., Jones, T. R., Sun, L., Bogyo, M., Geuze, H. J., and Ploegh, H. L.
(1996) The human cytomegalovirus US11 gene product dislocates MHC
class I heavy chains from the endoplasmic reticulum to the cytosol. Cell
84, 769 –779
Ahn, K., Gruhler, A., Galocha, B., Jones, T. R., Wiertz, E. J., Ploegh, H. L.,
Peterson, P. A., Yang, Y., and Früh, K. (1997) The ER-luminal domain of
the HCMV glycoprotein US6 inhibits peptide translocation by TAP. Immunity 6, 613– 621
Carette, J. E., Raaben, M., Wong, A. C., Herbert, A. S., Obernosterer, G.,
Mulherkar, N., Kuehne, A. I., Kranzusch, P. J., Griffin, A. M., Ruthel, G.,
Dal Cin, P., Dye, J. M., Whelan, S. P., Chandran, K., and Brummelkamp,
T. R. (2011) Ebola virus entry requires the cholesterol transporter Niemann-Pick C1. Nature 477, 340 –343
Jae, L. T., Raaben, M., Riemersma, M., van Beusekom, E., Blomen, V. A.,
Velds, A., Kerkhoven, R. M., Carette, J. E., Topaloglu, H., Meinecke, P.,
Wessels, M. W., Lefeber, D. J., Whelan, S. P., van Bokhoven, H., and Brummelkamp, T. R. (2013) Deciphering the glycosylome of dystroglycanopathies using haploid screens for lassa virus entry. Science 340, 479 – 483
Rosmarin, D. M., Carette, J. E., Olive, A. J., Starnbach, M. N., Brummelkamp, T. R., and Ploegh, H. L. (2012) Attachment of Chlamydia trachomatis L2 to host cells requires sulfation. Proc. Natl. Acad. Sci. U.S.A.
109, 10059 –10064
Papatheodorou, P., Carette, J. E., Bell, G. W., Schwan, C., Guttenberg, G.,
Brummelkamp, T. R., and Aktories, K. (2011) Lipolysis-stimulated lipoprotein receptor (LSR) is the host receptor for the binary toxin Clostridium difficile transferase (CDT). Proc. Natl. Acad. Sci. U.S.A. 108,
16422–16427
Irannejad, R., Tomshine, J. C., Tomshine, J. R., Chevalier, M., Mahoney,
J. P., Steyaert, J., Rasmussen, S. G., Sunahara, R. K., El-Samad, H., Huang,
B., and von Zastrow, M. (2013) Conformational biosensors reveal GPCR
signalling from endosomes. Nature 495, 534 –538
Baron, C. L., and Malhotra, V. (2002) Role of diacylglycerol in PKD recruitment to the TGN and protein transport to the plasma membrane. Science
295, 325–328
Campelo, F., and Malhotra, V. (2012) Membrane fission: the biogenesis of
transport carriers. Annu. Rev. Biochem. 81, 407– 427
de Almeida, J. B., Doherty, J., Ausiello, D. A., and Stow, J. L. (1993) Binding
of the cytosolic p200 protein to Golgi membranes is regulated by heterotrimeric G proteins. J. Cell Sci. 106, 1239 –1248
Coughlin, S. R. (2000) Thrombin signalling and protease-activated receptors. Nature 407, 258 –264
Vu, T. K., Hung, D. T., Wheaton, V. I., and Coughlin, S. R. (1991) Molecular cloning of a functional thrombin receptor reveals a novel proteolytic
mechanism of receptor activation. Cell 64, 1057–1068
Molloy, S. S., Anderson, E. D., Jean, F., and Thomas, G. (1999) Bi-cycling
the furin pathway: from TGN localization to pathogen activation and
embryogenesis. Trends Cell Biol. 9, 28 –35
Gorbushin, A. M., Klimovich, A. V., and Iakovleva, N. V. (2009) Himasthla
elongata: effect of infection on expression of the LUSTR-like receptor
mRNA in common periwinkle haemocytes. Exp. Parasitol. 123, 24 –30
Abi-Habib, R. J., Liu, S., Bugge, T. H., Leppla, S. H., and Frankel, A. E.
(2004) A urokinase-activated recombinant diphtheria toxin targeting the
granulocyte-macrophage colony-stimulating factor receptor is selectively
cytotoxic to human acute myeloid leukemia blasts. Blood 104, 2143–2148
VOLUME 289 • NUMBER 35 • AUGUST 29, 2014
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
glycoproteins. Proc. Natl. Acad. Sci. U.S.A. 110, 6406 – 6411
29. Carette, J. E., Guimaraes, C. P., Varadarajan, M., Park, A. S., Wuethrich, I.,
Godarova, A., Kotecki, M., Cochran, B. H., Spooner, E., Ploegh, H. L., and
Brummelkamp, T. R. (2009) Haploid genetic screens in human cells identify host factors used by pathogens. Science 326, 1231–1235
30. Jørgensen, R., Merrill, A. R., Yates, S. P., Marquez, V. E., Schwan, A. L.,
Boesen, T., and Andersen, G. R. (2005) Exotoxin A-eEF2 complex structure indicates ADP ribosylation by ribosome mimicry. Nature 436,
979 –984
31. Su, X., Lin, Z., and Lin, H. (2013) The biosynthesis and biological function
of diphthamide. Crit. Rev. Biochem. Mol. Biol. 48, 515–521
32. Thomas, G. (2002) Furin at the cutting edge: from protein traffic to embryogenesis and disease. Nat. Rev. Mol. Cell Biol. 3, 753–766
33. Gu, M., Gordon, V. M., Fitzgerald, D. J., and Leppla, S. H. (1996) Furin
regulates both the activation of Pseudomonas exotoxin A and the quantity
of the toxin receptor expressed on target cells. Infect. Immun. 64, 524 –527
34. Bonifacino, J. S., and Hierro, A. (2011) Transport according to GARP:
receiving retrograde cargo at the trans-Golgi network. Trends Cell Biol.
21, 159 –167
35. Bonifacino, J. S., and Lippincott-Schwartz, J. (2003) Coat proteins: shaping
membrane transport. Nat. Rev. Mol. Cell Biol. 4, 409 – 414
36. Mills, I. G., Praefcke, G. J., Vallis, Y., Peter, B. J., Olesen, L. E., Gallop, J. L.,
Butler, P. J., Evans, P. R., and McMahon, H. T. (2003) EpsinR: an AP1/
clathrin interacting protein involved in vesicle trafficking. J. Cell Biol. 160,
213–222
37. Jackson, M. E., Simpson, J. C., Girod, A., Pepperkok, R., Roberts, L. M., and
Lord, J. M. (1999) The KDEL retrieval system is exploited by Pseudomonas
exotoxin A, but not by Shiga-like toxin-1, during retrograde transport
from the Golgi complex to the endoplasmic reticulum. J. Cell Sci. 112,
467– 475
38. Araç, D., Dulubova, I., Pei, J., Huryeva, I., Grishin, N. V., and Rizo, J. (2005)
Three-dimensional structure of the rSly1 N-terminal domain reveals a
conformational change induced by binding to syntaxin 5. J. Mol. Biol. 346,
589 – 601
39. Williams, A. L., Ehm, S., Jacobson, N. C., Xu, D., and Hay, J. C. (2004) rsly1
binding to syntaxin 5 is required for endoplasmic reticulum-to-Golgi
transport but does not promote SNARE motif accessibility. Mol. Biol. Cell
15, 162–175
40. Shibatani, T., David, L. L., McCormack, A. L., Frueh, K., and Skach, W. R.
(2005) Proteomic analysis of mammalian oligosaccharyltransferase reveals multiple subcomplexes that contain Sec61, TRAP, and two potential
new subunits. Biochemistry 44, 5982–5992
41. Elling, U., Taubenschmid, J., Wirnsberger, G., O’Malley, R., Demers, S. P.,
Vanhaelen, Q., Shukalyuk, A. I., Schmauss, G., Schramek, D., Schnuetgen,
F., von Melchner, H., Ecker, J. R., Stanford, W. L., Zuber, J., Stark, A., and
Penninger, J. M. (2011) Forward and reverse genetics through derivation
of haploid mouse embryonic stem cells. Cell Stem Cell 9, 563–574
42. Yosten, G. L., Redlinger, L. J., and Samson, W. K. (2012) Evidence for an
interaction of neuronostatin with the orphan G protein-coupled receptor,
GPR107. Am. J. Physiol. Regul. Integr. Comp. Physiol. 303, R941–R949
43. Edgar, A. J. (2007) Human GPR107 and murine Gpr108 are members of
the LUSTR family of proteins found in both plants and animals, having
similar topology to G-protein coupled receptors. DNA Seq. 18, 235–241
44. Lara-Tejero, M., and Galán, J. E. (2001) CdtA, CdtB, and CdtC form a
tripartite complex that is required for cytolethal distending toxin activity.
Infect. Immun. 69, 4358 – 4365
45. Fairn, G. D., Ogata, K., Botelho, R. J., Stahl, P. D., Anderson, R. A., De
Camilli, P., Meyer, T., Wodak, S., and Grinstein, S. (2009) An electrostatic
switch displaces phosphatidylinositol phosphate kinases from the membrane during phagocytosis. J. Cell Biol. 187, 701–714
46. Vey, M., Schäfer, W., Berghöfer, S., Klenk, H. D., and Garten, W. (1994)
Cell Biology:
GPR107, a G-protein-coupled Receptor
Essential for Intoxication by Pseudomonas
aeruginosa Exotoxin A, Localizes to the
Golgi and Is Cleaved by Furin
Fikadu G. Tafesse, Carla P. Guimaraes,
Takeshi Maruyama, Jan E. Carette, Stephen
Lory, Thijn R. Brummelkamp and Hidde L.
Ploegh
Access the most updated version of this article at doi: 10.1074/jbc.M114.589275
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 61 references, 25 of which can be accessed free at
http://www.jbc.org/content/289/35/24005.full.html#ref-list-1
Downloaded from http://www.jbc.org/ by guest on May 28, 2015
J. Biol. Chem. 2014, 289:24005-24018.
doi: 10.1074/jbc.M114.589275 originally published online July 16, 2014