Germinal Center Function in the Spleen
during Simian HIV Infection in Rhesus
Monkeys
This information is current as
of June 17, 2017.
David H. Margolin, Erika H. Saunders, Benjamin Bronfin,
Nicole de Rosa, Michael K. Axthelm, Olga G. Goloubeva,
Sara Eapen, Rebecca S. Gelman and Norman L. Letvin
J Immunol 2006; 177:1108-1119; ;
doi: 10.4049/jimmunol.177.2.1108
http://www.jimmunol.org/content/177/2/1108
Subscription
Permissions
Email Alerts
This article cites 74 articles, 32 of which you can access for free at:
http://www.jimmunol.org/content/177/2/1108.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2006 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
References
The Journal of Immunology
Germinal Center Function in the Spleen during Simian HIV
Infection in Rhesus Monkeys1
David H. Margolin,2* Erika H. Saunders,3* Benjamin Bronfin,* Nicole de Rosa,4*
Michael K. Axthelm,† Olga G. Goloubeva,‡ Sara Eapen,‡ Rebecca S. Gelman,‡ and
Norman L. Letvin5*
S
triking alterations in B lymphocyte populations occur in
secondary lymphoid tissues of HIV-1-infected humans (1)
and SIV-infected monkeys (2). B cells in lymph nodes and
spleens become activated early in the course of infection, resulting
in increases in the size and number of secondary lymphoid follicles
*Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA
02215; †Oregon National Primate Research Center, Oregon Health & Science University, Beaverton, OR 97006; and ‡Dana-Farber Cancer Institute, Harvard Medical
School, Boston, MA 02115
Received for publication July 18, 2005. Accepted for publication April 19, 2006.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
D.H.M. was supported by Public Health Service (PHS) Grants AI-01587 and AI45370 from the National Institute of Allergy and Infectious Diseases (NIAID). E.H.S.
participated in these studies as a Medical Student Fellow of the Howard Hughes
Medical Institute. M.K.A. was supported by Grant AI-054292 from the NIAID, Grant
CA-75922 from the National Cancer Institute, Grants RR-016025 and RR018107
from the National Center for Research Resources, and a PHS institutional grant from
the National Center for Research Resources supporting the Oregon National Primate
Research Center, Grant RR-000163. N.L.L. was supported by PHS Grant AI-067854
from the NIAID Center for HIV/AIDS Vaccine Immunology and Grant AI-20729
from the NIAID. O.G.G. and R.S.G. were supported by PHS Grant AI-28691 to the
Dana-Farber Cancer Institute Center for AIDS Research from the NIAID.
2
Current address: Massachusetts General Hospital, Wang Ambulatory Care Center835, Boston, MA 02114.
3
Current address: University of Michigan Hospital Psychiatry 9d9812 University
Hospital 0120, 1500 East Medical Center Drive, Ann Arbor, MI 48109-0118.
4
Current address: Department of Surgery, Mount Sinai School of Medicine, 5 East
98th Street, New York, NY 10029.
and in hyperplasia of germinal centers (GCs)6. As immunodeficiency progresses, the GCs are reduced in size and number.
Because lymphoid follicles are a crucial site for the clonal expansion and terminal differentiation of Ag-specific B cells, virus-induced abnormalities in secondary lymphoid tissues could have important consequences for the immune responses of these cells.
Critical processes occur in lymphoid follicles that lead to the
generation of mature Ab responses. An iterative process of selection, expansion, mutation, and further selection culminates in the
generation of high-affinity memory B lymphocytes and plasma
cells. Specific features of the somatic mutations observed in expressed Igs have been well-characterized (3, 4) and are similar in
humans and mice. Some disease states are associated with atypical
patterns of somatic mutation in expressed Igs (5–9). In light of the
follicular abnormalities seen in the setting of HIV/SIV infections,
the processes that transpire in GCs may also show abnormalities in
HIV/SIV-infected individuals.
The Ab response to the envelope glycoproteins (Env) of HIV-1
is of particular importance because of the ability of some anti-Env
Abs to neutralize viral infectivity, protect against infection (10 –
14), exert selective pressure on HIV-1 and SIV following infection
in vivo (15–23), and contribute to the control of viremia (24 –26).
Importantly, neutralizing Abs effective against a broad range of
HIV-1 or SIV isolates are produced upon virus exposure only after
a substantial delay, months or years following infection (16, 27–
32), suggesting that maturation of the immune response is necessary for the development of such broadly reactive Abs. Changes in
the specificity of circulating neutralizing Abs continue to occur
throughout at least the first 5 years of HIV-1 infection (33). The
5
Address correspondence and reprint requests to Dr. Norman L. Letvin, Viral Pathogenesis Division, RE-113/Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, MA 02215. E-mail address: [email protected]
Copyright © 2006 by The American Association of Immunologists, Inc.
6
Abbreviations used in this paper: GC, germinal center; SHIV, simian HIV; p.i.d.,
postinfection day; FR, framework.
0022-1767/06/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Infection with HIV-1, SIV, or simian HIV is associated with abnormalities in the number, size, and structure of germinal centers
(GCs). To determine whether these histopathologic abnormalities are associated with abnormalities in Ab development, we analyzed nucleotide sequences of Igs from splenic GCs of simian HIV-infected macaques. Virus-specific GCs were identified in frozen
splenic tissue sections by inverse immunohistochemistry using rHIV-1 gp120 as a probe. B cells from envelope-specific GCs were
isolated from these sections using laser capture microdissection. Their Igs were amplified from cDNA using nested PCR, then
cloned and sequenced. Nucleotide sequences were recovered from nine multimember clonal lineages. Within each lineage, sequences had similar V-D-J or V-J junctions but differed by somatic mutations distributed throughout the variable domain. The
clones were highly mutated, similar to that previously reported for HIV-1-specific human IgG Abs. The average clone had 37
mutations in the V region, for a frequency of 0.11 mutations/base. The mutational pattern was strikingly nonrandom, with somatic
mutations occurring preferentially at RGYW/WRCY hotspots. Transition mutations were favored over transversions, with C3 T
and G3 A replacements together accounting for almost one-third of all mutations. Analysis of replacement and silent mutations
in the framework and CDRs suggests that the Igs were subjected to affinity selection. These data demonstrate that the process of
Ab maturation is not seriously disrupted in GCs during the early stages of immunodeficiency virus infection, and that Env-specific
Igs developing in GCs are subject to extensive somatic mutation and profound selection pressures. The Journal of Immunology,
2006, 177: 1108 –1119.
The Journal of Immunology
molecular mechanisms that underlie this evolution in virus-specific
Abs have not been identified, but it has been suggested that GC
processes may be critical for development and maintenance of virus-neutralizing Abs (34).
Macaques infected with recombinant viruses that express HIV-1
Env on an SIV backbone (simian HIVs (SHIVs)) have proven
valuable for studying humoral immunity to HIV-1 (11, 12, 24, 35).
A high degree of conservation of Ig sequences between humans
and these monkeys increases their value as animal models for
studying human Ab responses. Studies have shown that homologous human and macaque H (36 – 40) and L chain (41) V regions
typically have ⬎90% nucleotide identity, and even ⬎95% identity
for some V region genes.
In previous studies of SHIV-infected rhesus monkeys, we have
shown that lymphoid GCs formed during primary and chronic immunodeficiency virus infection include a high frequency of Envspecific B cells (42). In the present report, we extend those studies
with an analysis of Ig sequences from Env-binding GCs.
Abs and recombinant proteins
Recombinant HIV-1 89.6 gp120 (rgp120-89.6) was prepared by Dr. R.
Doms (University of Pennsylvania, Philadelphia, PA) as previously described (43, 44) from supernatants of cells infected with recombinant vaccinia viruses expressing HIV envelope glycoproteins, and purified by lectin
affinity chromatography. The rgp120-89.6 was biotinylated in 100-␮g
batches using the FluoReporter Minibiotin-XX protein labeling kit (Molecular Probes) according to the manufacturer’s instructions. Unreacted
biotin was removed by filtration over a ChromaSpin LC-30 column (BD
Clontech). Preservation of conformation-dependent epitopes in the biotinylated Env was documented as described (42).
SHIV clones, animal infections, and sample handling
The SHIVs used for this study are described elsewhere (45). In brief, the
env, tat, and rev genes of HIV-1 HXBc2 were introduced into an infectious
molecular clone of SIVmac239. The env gene of the resulting virus was
replaced with the env gene of the HIV-1 clone 89.6 to generate SHIV-89.6
(46). Serial passage of SHIV-89.6 in monkeys generated the highly pathogenic SHIV-89.6P quasispecies, from which SHIV-KB9 was cloned.
SHIV-KB9ct and SHIV-KB9(⫺305) are hybrid viruses that combine aspects of the parental ⫺89.6 and more pathogenic ⫺KB9 clones. These
viruses were selected for the present study because they expressed a gp120
identical with or cross-reactive with that of the rgp120-89.6 used as an
inverse immunohistochemical probe and show increased pathogenicity
compared with the parental SHIV-89.6 (45, 47).
The rhesus monkeys used in this study were maintained at the Oregon
National Primate Research Center in accordance with the guidelines of the
committee on Animals for the Harvard Medical School and the Guide for
the Care and Use of Laboratory Animals (48). Healthy rhesus monkeys
were inoculated i.v. with cell-free SHIV. Subject Mm18284 was infected
with SHIV-KB9ct, and subject Mm19941 was infected with SHIVKB9(⫺305). Some immunologic and virologic data from these monkeys
have been previously reported (42, 45, 47). Infection of both animals was
confirmed by serologic and virologic assays (45, 47). Before infection,
subject Mm18284 had a CD4⫹ cell count of 1200/␮l. Following infection
the CD4⫹ cell count fell to a nadir of 350 on postinfection day (p.i.d.) 17
before stabilizing at ⬃500 by p.i.d. 28. Plasma viral load as measured by
ELISA detection of the SHIV Gag protein p27 peaked at 1.4 ng/ml on p.i.d.
14, and declined to below the limit of detection by p.i.d. 21 (47). Mm19941
had a baseline CD4⫹ cell count of 2000/␮l. Following infection the CD4⫹
count fell to 831 by p.i.d. 21 and rose gradually to stabilize at ⬃950 on
p.i.d. 78. Cumulative p27 antigenemia in this animal through p.i.d. 21 was
0.95 ng/ml; viral p27 was below the limit of detection beyond that date
(45). The sustained ⬎50% decrease in absolute CD4 counts in the blood of
both animals following infection is evidence of the pathogenicity of the
SHIV types used in these studies
Monkeys were anesthetized with ketamine-HCl 5 mg/kg, i.m. for all
blood sampling, and were euthanized by an overdose of sodium pentobarbital administered i.v. at 3 mo (Mm19941) and 9 mo (Mm18284) after
SHIV infection. These time point were chosen to assess GC functions
during the early stages of chronic infection, at a time when Env-specific
GCs are plentiful (42). Pieces of spleen were frozen in Tissue-Tek cryo-
embedding medium (Fisher Scientific) immediately upon removal, and
stored at ⫺80oC until use. Frozen sections were cut at 10-␮m thickness,
thaw-mounted onto Superfrost Plus slides (Fisher Scientific), immediately
refrozen, and then stored at ⫺80oC.
Inverse immunohistochemistry
Slide-mounted tissue sections of spleen from SHIV-infected monkeys were
fixed in cold acetone for 10 min, air dried, and rehydrated in TBS (pH 8).
Slides were then processed using the Sequenza immunostaining workstation (Shandon Lipshaw). Inverse immunostaining was enhanced using catalyzed signal amplification with the Renaissance TSA-Indirect kit
(PerkinElmer). Each slide was first treated with Tris-NaCl buffer with a
proprietary blocking reagent (Renaissance kit) to reduce nonspecific staining, and then incubated for 1 h at room temperature with biotinylated
rHIV-1 envelope gp120-89.6 at a concentration of 0.2 mcg/ml (1.67 nM).
Slides were rinsed three times with TBS containing 0.05% Tween 20
(TBST) after each subsequent staining step. To catalyze amplification of
the biotin signal, the slides were incubated with streptavidin-HRP (1/100
dilution, Renaissance kit) for 30 min at room temperature and subsequently
incubated with biotinyl tyramide (1/50 dilution) for 10 min. The amplified
biotin signal, indicating bound biotinylated rgp120, was detected histochemically using alkaline phosphatase-conjugated streptavidin-biotin complex (DakoCytomation) and Vector Blue chromogenic substrate (Vector
Laboratories) together with levamisole (DakoCytomation) to suppress endogenous alkaline phosphatase activity. After counterstaining with either
nuclear fast red (Vector Laboratories) or Gill’s hematoxylin (Fisher Scientific), slides were covered with Crystal/Mount permanent mounting medium (Fisher Scientific) and air dried.
Microdissection of Env-binding GCs
Slide-mounted splenic frozen sections stored at ⫺80°C were fixed in cold
acetone for 10 min and air dried. Sections were rehydrated in nuclease-free
water, stained in nuclear fast red (Vector Laboratories), dehydrated through
graded alcohols and xylenes, and air dried. The targeted GCs were microdissected using an Arcturus PixCell II laser microdissecting workstation
(Arcturus Engineering) and the following method. After Env-binding GCs
were identified by inverse immunohistochemical staining, the same GCs
were located on adjacent tissue sections using landmarks such as position
within the section, orientation relative to other GCs, and distinctive features such as GC contour or the presence of vessels within the structure.
Cells from each targeted GC were isolated from the surrounding tissue
using laser capture microdissection (49) with CapSure HS membranes
(Arcturus Engineering). Multiple overlapping laser pulses of 30-␮m diameter spot size were used to capture substantial portions of each GC from the
slide. Care was taken to avoid capturing cells from the surrounding mantle
zones and other regions outside the targeted zone. Digitized images of
immunostained tissue sections and the microdissection process were prepared using the Arcturus Engineering workstation and formatted using
Adobe Photoshop version 4 software.
Cloning and sequence analysis of Ig genes from Env-binding
GCs
mRNA present in the captured cells was purified using the RNeasy kit
(Qiagen) according to the manufacturer’s instructions. cDNA was prepared
using the AMV Reverse Transcription System (Promega). The resulting
cDNA (1 ␮l/reaction) was amplified using nested or seminested PCR catalyzed by a proofreading enzyme, PfuTurbo DNA Polymerase (Stratagene)
to provide high copying fidelity and optimal yield from the minute samples
obtained using microdissection. Each round of the PCR was performed in
50 ␮l using oligonucleotide primers designed to selectively amplify rearranged Ig H or L chains (Table I) for 30 cycles using the following parameters: 20 s at 94°C, 30 s at 55°C, 120 s at 72°C. Each PCR was concluded with an extension step at 72°C for 10 min. Products of the secondround PCRs were size selected by electrophoresis in 1.5% agarose,
visualized by ethidium bromide staining and cut from the gel. The PCR
products were purified using the Qiaex II Gel Extraction System (Qiagen),
and cloned into Escherichia coli using the TopoBlunt cloning kit (Invitrogen Life Technologies). Plasmids containing inserts were isolated from
expanded cultures using QIAprep Spin Miniprep kit (Qiagen), and sequenced on both strands using an Applied Biosystems Prism 377XL Automated DNA Sequencer and primers that bound outside the insert.
Nucleotide sequence data from both strands were reconciled using the
Seqman module of the Lasergene2000 software package (DNAstar). Sequences of all clones were submitted to GenBank (accession numbers
AY452535-AY452600). The set of individual sequences was analyzed to
identify clusters of sequences with similar overall length, CDR3 length,
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Materials and Methods
1109
1110
GC FUNCTION DURING SHIV INFECTION
Table I. Oligonucleotide primers for amplification of macaque Ig H and L chain V regionsa
V Region
Primer Sequence
C Region
Primer Sequence
H chain, outer
VH1 LDR
VH2 LDR
VH3 LDR
VH4 LDR
VH5 LDR
VH6 LDR
VH1, 3, 5 FR1
VH2 FR1
VH4 FR1
VH6 FR1
ATGGACTGGACCTGGAGGATC
AATGGACATACTTTGTTCCACG
ATGGAGTTTGGGCTGAGCTGGG
ACACCTGTGGTTCTTCC
GTGAAAAAGCCCGGGGAG
ATGTCTGTCTCCTTCCTCAT
SAGGTGCAGCTGGTGSAGTCTG
CAGGTCACCTTCAAGGAGTCTG
CAGGTGCAGCTGCAGSAGTSG
ATGCCGTATTCACAGCAGCATT
C␥ outer
C␮ outer
C␦ outer
C␧ outer
C␣ outer
CACCGTCACCGGTTCGG
CGGGTGCTGCTGATGTCAGC
CGGGATCCACGGACGTTGGGTGGTACCC
TGTCCCGTTGAGGGAGCCTGT
CAGAGTACTAGTTGGGCAGGGCACAGTCACAT
V␭1 LDRa
V␭2 LDR
V␭5 LDR
V␭6 LDR
V␭7 LDR
V␭8 LDR
V␭9/10 LDR
V␭1a FR1
V␭1b FR1
V␭1c FR1
V␭3a FR1
V␭3b FR1
V␭4 FR1
V␭5 FR1
V␭7/8 FR1
Vk1, 2 LDRc
Vk3 LDR
Vk4 LDR
Vk5 LDR
Vk6 LDR
Vk1ac FR1
Vk2ab FR1
Vk3b FR1
Vk3c FR1
Vk4a FR1
Vk5a FR1
Vk6 LDR
YCCTCTCYTCCTCACYCT
ATGGCCTGGGCTCTGCTSCTCCTC
TCTCTCACTGCACAGGTTC
ATGGCCTGGGCTCCACTACTTCTC
ATGGCCTGGACTCCTCTC
ATGGCCTGGATGATGCTTCTC
ATGGCCTGGGCTCYKCTSCTCC
CAGTCTGTGCTGACTCAG
CAGTCTGTGYTGACGCAG
CAGTCTGTCGTGACGCAG
TCCTATGWGCTGACTCAG
TCCTATGAGCTGACACAG
CAGCYTGTGCTGACTCAA
CAGSCTGTGCTGACTCAG
CAGRCTGTGGTGACYCAG
TCCCYGCTCAGCTCCTGG
CTTCTCTTCCTCCTGCTACTC
ACCCAGGTCTTCATTTCTC
GTTCACCTCCTCAGCTTCCTCC
CTCGGGGTTCCAGCCTCC
CATCCRGWTGACCCAGTC
GATRTTGTGATGACYCAG
GAAATAGTGATGACGCAG
GAAATTGTAATGACACAG
GACATCGTGATGACCCAG
GAAACGACACTCACGCAG
CTCGGGGTTCCAGCCTCC
C␥ inner
C␮ inner
C␦ inner
C␧ inner
C␣ inner
C␭ outer
GTAGTCCTTGACCAGGCAG
TGGGGCGGATGCACTCCC
CGGGATCCTGCACCCTGATATGATGGGG
GGGTCGACAGTCACGGAGGTGGCATT
CAGAGTACTAGTTGGGCAGGGCACAGTCACAT
CTTGACGGGGCTGCCATCTG
C␭ inner
TGTGGCCTTGTTGGCTTGAAG
C␬ outer
TAACACTCTCCCCTGTTGAA
C␬ inner
CTGTCCTGCTCTGTGACACTCTCCT
H chain, inner
␭ chain, outer
␭ chain, inner
␬ chain, outer
␬ chain, inner
a
Oligonucleotide primers used in PCR. LDR, Leader sequence.
and junctional nucleotide sequence; each cluster might represent descendants of a common ancestor clone.
Somatic mutations in expressed Ig V regions are usually identified with
reference to the sequence of their probable precursor in the germline. Because the macaque Ig loci have not been comprehensively catalogued, macaque Ig cDNA sequences were compared with their nearest homologs
among the human germline variable (V), diversity (D), and joining (J)
region minigenes, which are closely related to those of macaques (36 –39,
41). The nearest homolog minigenes were identified from the complete
dataset of human germline Ig sequences based on sequence similarity (50).
To facilitate analysis of the CDR3 regions, the germline segments were
trimmed and joined to create hypothetical junctional sequences; these junctions were optimally assembled to minimize the number of nucleotide differences with the macaque clones. When V, D, and J segments were insufficient to generate a CDR3 of the observed length, N and P nucleotides
were not added; these positions are shown as blanks in the alignment.
Somatic mutations were tallied twice, under different assumptions. First,
any nucleotide difference when compared with the nearest human germline
V region and hypothetical junctional sequence was assumed to result from
a somatic mutation (assumption 1). Second, it was assumed that any nucleotides present in every member of a lineage were encoded in the macaque germline, so that only intraclonal sequence differences were counted
as somatic mutations (assumption 2). Statistical software packages SAS
version 8.2 and Splus version 3.4 were used to read in the nucleotide
sequence data and determine the number of occurrences for each possible
type of substitution (e.g., from nucleotide X to nucleotide Y) for each clone
under both assumptions 1 and 2.
Because the genealogical relationships among the clones were inferred
but not known with certainty, statistical analyses were based on a population model: the incidence of mutation at each nucleotide position was tallied cumulatively for each occurrence, even when the same substitution
occurred in multiple members of the population.
Nucleotide differences between the clones were tallied for the entire V
region excluding positions that overlap the PCR primers, which correspond
with the initial 22 nt of the IgH framework region 1 (FR1) region or 18 nt
of the Ig␭ and Ig␬ FR1. FR and CDR in the cloned Igs were identified
based on standard Kabat criteria (E. A. Kabat, Kabat database of sequences
of proteins of immunological interest, National Institutes of Health, 具www.
kabatdatabase.com/典), summarized online at 具www.rubic.rdg.ac.uk/abeng典.
Nucleotide mutations that result in amino acid substitutions (replacement mutations, R) or do not change the amino acid sequence (silent mutations, S) were counted separately for FR1, 2, and 3 and CDR1, 2, and 3
of each macaque clone. Enumeration of R and S mutations was performed
using an automated algorithm that incorporates the methods of Nei (51,
52), implemented online at 具http://hiv-web.lanl.gov/content/hiv-db/SNAP/
WEBSNAP/SNAP.html典 (B. T. Korber, Synonymous Non-Synonymous
Analysis Program, Los Alamos National Laboratory, 53). The excess or
paucity of replacement mutations in the FRs or CDRs of each sequence
was compared with that expected by chance using a multinomial distribution model, implemented online at 具www-stat.stanford.edu/Ig典 (54).
For analysis of purine or pyrimidine transition or transversion mutations, the test for whether the rates of mutation from T to C, T to A, and
T to G were all equal given that T was mutated (and similarly for mutations
from C, from A, and from G) was an exact Poisson test (i.e., the multinomial test of ratios after conditioning on the sum of the three mutations).
Comparisons between pairs of mutation rates used the exact Poisson test
(i.e., the binomial test of ratios after conditioning on the sum). The tests of
differences between lineages within chain (H or L) and animal used the
exact Zelen test for homogeneity of odds ratios. An adjustment was made
for multiple comparisons using Holm’s method. That is, when there were
n relevant comparisons, the smallest of the n p values was compared with
0.05/n, the next smallest p value was compared with 0.05/(n-1), and so on
until one of the p values was not smaller than its bound (i.e., 0.05/n), in
which case that comparison and all comparisons with larger p values were
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Chain
The Journal of Immunology
declared nonsignificant. The multiple comparison adjustment was done
separately for each different initial nucleotide.
Within the motif RGYW and its reverse complement WRCY, only the
underlined G or C was considered a potential hot spot preferentially targeted for mutation (55, 56). Comparison of mutation frequency for hot spot
and non-hot spot sites was made using the Fisher exact text.
Results
Identification and microdissection of GCs containing
Env-binding cells, and cloning of their Ig sequences
Cells from each targeted GC were isolated from multiple, serial
sections using laser capture microdissection. The capture of tissue
from the Env-binding GC shown in Fig. 1B is depicted in the
panels of Fig. 1C. The upper row presents the same GC as it
appeared in several adjacent sections. The next row shows the
same tissue sections after microdissection. The bottom row shows
the GC cells isolated by microdissection.
Samples from each tissue section were processed separately.
mRNA present in the captured cells was purified, reverse transcribed into cDNA, and amplified using nested PCR with oligonucleotide primers designed to selectively amplify rearranged Ig H
or L chains (Table I). Products of the second-round PCRs were
size selected, cloned, and both strands were sequenced.
Sequence analysis of Igs cloned from microdissected GCs
The recovered nucleotide sequences from each GC could be
grouped on the basis of sequence similarity into multimember
clonal lineages (Table II). Within each lineage, all sequences have
similar V-D-J or V-J junctions but differ by somatic mutations
distributed throughout the variable domain. The V-D-J-C and VJ-C joins were all “in frame” (i.e., productive rearrangements), and
no premature termination codons were found in any of the clones.
Data from nine clonal lineages were combined to create an aggregate data set that was analyzed statistically.
Ig clones from GC2
H chain. cDNA from GC2 was amplified using oligonucleotide
primers designed to amplify Ig H chain V regions encoding IgG or
IgM Abs. The IgG-primed reactions revealed an amplicon of the
expected size only for the VH3-primed reaction. Nucleic acid sequencing of VH3-IgG clones yielded a clonal lineage, designated
2S1H3, with nine distinct members (Fig. 2A).
The IgM-primed reactions also yielded an amplicon of the expected size only for VH3-primed products. The VH3-IgM PCR
product was ligated and cloned, and 30 clones were sequenced.
They were all identical, with no intraclonal variation. This IgM
may represent a B cell resident in the mantle zone outside GC2,
inadvertently collected during laser capture microdissection.
L chain. cDNA from GC 2 was amplified using oligonucleotide
primers designed to amplify Ig L chain V regions of either ␬ or ␭
isotype. Electrophoresis of PCR products revealed an amplicon of
the expected size only among the VL5-primed reaction. Nucleic
acid sequencing of clones from GC2 yielded one multimember
clonal lineage, designated 2S2L5, with six distinct members
(Fig. 2B).
Ig clones from GC4
FIGURE 1. Localization and microdissection of HIV-1 Env-binding
GCs in splenic tissues of SHIV-infected rhesus monkeys. Frozen sections
were stained by inverse immunohistochemistry using biotinylated rgp12089.6 as an Ag probe and counterstained. The Env-binding GCs depicted in
A and B correspond to GCs 2S and 4S, respectively, in the text. C, The
microdissection of the GC shown in B from four serial sections, counterstained only. Upper row, Tissues after counterstaining; middle row, tissues
after microdissection; bottom row, tissues recovered by microdissection.
Care was taken to avoid capturing cells from a blood vessel passing
through GC 4S.
H chains. cDNA from GC4 was amplified using oligonucleotide
primers designed to amplify Ig H chain V regions encoding IgA,
IgD, IgE, IgG, or IgM Abs. Only IgG-specific PCRs produced an
amplicon of the expected size. Sequencing of clones from the IgGspecific PCR revealed three multimember clonal IgG lineages, designated 4S1H3, 4S2H3, and 4S3H3, whose sequences are presented in Fig. 2, C–E, respectively.
L chains. cDNA from GC4 was amplified using oligonucleotide
primers designed to amplify Ig L chain V regions of either ␬ or ␭
isotype. ␭ L chain PCRs yielded Ig sequences that belonged to
three distinct multimember clonal lineages, designated 4S4L5,
4S5L2, and 4S6L8, whose sequences are presented in Fig. 2, F–H.
␬ L chain PCRs yielded Ig sequences that could be assigned to a
single multimember clonal lineage.4S7K2, presented in Fig. 2I.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Splenic tissue frozen sections derived from two rhesus monkeys
chronically infected with moderately pathogenic variants of SHIV89.6 were stained by inverse immunohistochemistry using biotinylated recombinant HIV-1 envelope gp120 (Env) as an Ag probe.
Splenic tissues from both monkeys demonstrated numerous GCs
containing cells that bound Env. For Mm19941, 35% of ⬎1500
examined GCs contained Env-binding cells, while for Mm18284,
3% of ⬎400 evaluated GCs contained such cells. Both intensely
stained and entirely unstained GCs were frequently apparent on a
single tissue section in close proximity (data not shown), indicating that the Ag probe was bound to B cells or Abs produced locally
rather than to serum Abs nonspecifically bound to GC follicular
dendritic cells. One Env-binding GC from each animal, shown in
Fig. 1, A and B, was selected for further evaluation.
1111
1112
GC FUNCTION DURING SHIV INFECTION
Table II. Germline similarity and replacement and silent mutations in the macaque Ig H and L chain cDNA clones
FR 1 ⫹ 2 ⫹ 3
All Mutations, by Comparison with Human Germline
CDR 1 ⫹ 2 ⫹ 3
No. of
clonesb
Germlinec
%
Identityd
Avg R ⫹ Se
Avg R/S
SD R/S
Selectedf
Avg R/S
SD R/S
Selectedf
2S1H3
2S2L5
4S1H3
4S2H3
4S3H3
4S4L5
4S5L2
4S6L8
4S7K2
9
6
3
7
4
9
4
14
10
VH3-30 DH 6-19 JH4
VL5-48 JL2
VH3-33 DH3 JH4
VH3-49 DH4 JH4
VH3-72 DH4 JH4
VL5-39 JL2
VL2-11 JL1
VL8-61 JL2
VK2-40 JK3
85.6
91.0
86.8
90.8
86.3
90.7
93.3
93.4
92.3
43.7
33.0
42.0
28.7
54.5
43.1
19.3
32.0
27.7
0.75
2.21
1.03
1.98
1.80
1.21
1.23
1.02
0.52
0.04
0.22
0.05
0.24
0.12
0.62
0.31
0.29
0.2
9/9
6/6
3/3
4/7
4/4
9/9
4/4
14/14
10/10
1.37
12.56
2.34
2.76
3.04
3.96
5.67
1.63
9.41
0.10
5.87
0.18
0.42
0.18
0.98
3.97
0.20
5.2
0/9
6/6
3/3
0/7
4/4
9/9
3/4
2/14
10/10
Overall
66
Lineagea
35.7
63/66
37/66
a
Frequency and rate of somatic mutations in V regions of the Ig
clones
The somatic mutation rate was calculated based upon two different
assumptions, as described in Materials and Methods. Under assumption 1, the 66 Ig sequences cloned from microdissected GCs
of SHIV-infected monkeys have an average of 37.1 apparent somatic mutations per sequence, with a range of 24.3–56.8. This
corresponds to an average mutation frequency of 0.11 mutations/
nucleotide. No significant difference was found between H and L
chain clones in this regard. Under assumption 2, the Ig sequences
have an average of 16.5 apparent somatic mutations per sequence,
with a range of 2.0 –37.9. The corresponding mutation frequency is
0.05 mutations/nucleotide. Under assumption 2, the mutation frequency of H chains (0.015) was significantly less than that of L
chains (0.07; p ⬍ 0.02).
Bias in somatic mutation of Ig V regions
Some disease states are associated with atypical patterns of somatic mutation in expressed Igs (5– 8). We therefore analyzed the
pattern of mutations observed in GC B cells from these SHIVinfected monkeys to determine whether they are indicative of
abnormalities.
The frequency with which mutations were targeted to nucleotides within the previously described RGYW/WRCY “hot spot”
motif was statistically analyzed for the 66 Ig clones obtained from
the SHIV-infected monkey spleens. Within and across animals, for
both H and L chains, there was a higher probability of mutation at
hot spots than elsewhere ( p ⬍ 0.0001). Preferential targeting of
hot spots was also evident within each lineage (Table III), despite
the smaller sample size. Overall, the percentage of hot spot sites
that were mutated was more than twice as large as that seen in
non-hot spots.
As noted earlier, transversion mutations should be twice as common as transition mutations in a purely stochastic process. To assess the substitution pattern in the macaque Igs, the frequency of
mutation from each of the four nucleotide species to each of the
other bases was tallied by lineage. The frequency of transition and
tranversion mutations was calculated both under assumptions 1
and 2.
Under assumption 1, there were striking deviations from randomness in the mutational pattern, which was similar to that of
normal human B cells in showing a disproportionate (increased)
frequency of transition mutations. For example, tests were done
evaluating the relative likelihood of pairs of specific mutations
(e.g., from T to C vs T to A). Such comparisons were only performed for lineages where, given that a nucleotide of a particular
type (T, C, A, or G) mutates, it was not equally likely to mutate to
each of the other three nucleotides. After pairwise comparisons, it
was found that there were 28 (of a possible 93) significant differences, and 20 of these favored transition mutations. The other eight
significant differences occurred within a nucleotide group (e.g.,
from T to A vs T to G). In all comparisons between transition and
transversion mutations showing a statistically significant difference, transition mutations were favored. Overall, 58% of mutations
were transitions (Table IV), similar to the normal human pattern
but contrasting with the stochastic prediction of 33% transitions.
Similarly, under the more conservative assumption 2, it was
found that there were 23 (of a possible 42) significant differences,
and transition mutations were favored for 18 of them, while the
other 5 occurred within a nucleotide group. Altogether, transition
FIGURE 2. Nucleotide sequences of Ig V regions from Env-binding macaque GC B cells. All sequences were cloned from cDNA from the microdissected GCs depicted in Fig. 1. The sequences are here aligned to the most similar human germline V and J sequences. For simplicity, the germline V and
J have been trimmed and concatenated to form CDR3 sequences that resemble those of the GC clones. Nucleotides identical with the germline are
represented by a period (“.”). Nucleotide substitutions are shown in lower case if they encode a silent mutation and upper case if they encode a replacement
mutation. The inferred amino acid sequence of the germline is presented in single letter format. The residues that form the CDRs are indicated. Each
alignment shows one lineage, corresponding to the text as follows: A, 2S1H3. B, 2S2L5. C, 4S1H3. D, 4S2H3. E, 4S3H3. F, 4S4L5. G, 4S5L2. H, 4S6L8.
I, 4S7K2.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Successive characters in the lineage name indicate the animal’s ID number; the origin of the sample (i.e., spleen); the lineage ID number; whether clones encode an Ig (H),
␭ (L) or ␬ (K) chain; and the family designation of the probable V-region germline progenitor.
b
Number of distinct clones; each may have been isolated multiple times.
c
Nearest human germline homolog based on comparison with the IMGT dataset.
d
Percent overall nucleotide homolog of the probable human germline V-, D-, and J-region homologs to the most similar clone from each lineage.
e
Replacement and silent mutations were determined by comparison with the listed germline segments using the SNAP website ([http://hiv-web.lanl.gov/SNAP/WEBSNAP/
SNAP.html]). The overall average was weighted based on the number of clones in each lineage.
f
Fraction of clones showing statistically significant ( p value ⬍ 0.05) excess or paucity of replacement mutations in the CDR or FR regions, when compared with a random
mutational process. Values of p were determined by comparing the R and S values for the CDR and FR regions using a multinomial distribution model, as implemented by the
website (具[www-stat.stanford.edu/immunoglobulin]典). An excess or paucity of replacement mutations suggests the observed mutations were influenced by selection pressures.
1113
The Journal of Immunology
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Figure 2. Continued
GC FUNCTION DURING SHIV INFECTION
1114
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Figure 2. Continued
1115
The Journal of Immunology
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Figure 2. Continued
1116
GC FUNCTION DURING SHIV INFECTION
Table III. Targeting of mutations to RGYW/WYCY hot spots
Percent of Sites Mutated
Lineage
Hot spot
Non-hot spot
Ratio Hot Spot/
Non-Hot Spot
p
⬍0.0001
0.0013
0.0017
0.0021
0.027
⬍0.0001
⬍0.0001
0.0068
⬍0.0001
2S1H3
2S2L5
4S1H3
4S2H3
4S3H3
4S4L5
4S5L2
4S6L8
4S7K2
36
19
26
16
26
25
28
16
21
11
11
12
9
17
9
14
7
9
3.3
1.7
2.2
1.8
1.5
2.8
2.0
2.3
2.3
Median
Mean
25
23.7
11
11
2.3
2.2
Selection pressures on somatic mutations in Ig V regions
To assess the influence of positive and negative selection on the Ig
sequences cloned from the Env-binding GCs of SHIV-infected
Discussion
Abnormalities in the number, size, and structure of lymphoid GCs
are common in individuals infected with HIV-1, SIV, or SHIV.
Because GCs are an important anatomic site for the maturation of
Ab responses, these abnormalities could have important consequences for the development of virus-specific Abs. To determine
whether immunodeficiency virus infection is associated with abnormalities in Ab development in GCs, we analyzed the nucleotide
sequences of Igs in B cells obtained from the HIV-1 Env-binding
splenic GCs of SHIV-infected monkeys. The types of observed
nucleotide mutations and the targeting of base substitutions in both
Table IV. Dysproportionate occurrence of transition mutations among expressed macaque Ig V regions
Substitution to. . .
T
Assumption 1
No. of mutations from
% mutations from
Assumption 2
No. of mutations from
% mutations from
T
C
A
G
Any
T
C
A
G
Any
T
C
A
G
Any
T
C
A
G
Any
392
140
114
C
A
G
299
84
97
100
162
409
117
222
12
16
6
5
5
9
106
159
69
58
51
108
9
14
6
5
5
10
365
3
4
4
6
16
15
34
72
55
90
162
161
3
6
14
5
8
14
Total
Mutations
483
651
666
701
2501
19
26
27
28
100
195
321
282
327
1125
17.33%
28.53%
25.07%
29.07%
100%
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
mutations comprised half of observed mutations, rather than onethird as predicted for a random process.
Mutational bias attributable to cytosine deaminase (57) was specifically examined. Under assumption 1, for eight of the nine lineages, the nucleotide C when mutated was most often replaced by
T. Mutational bias in mutations of C was statistically significant
for seven of nine lineages (range of p values, 0.0008-⬍0.0001).
Similarly, eight of nine lineages showed preferential replacement
of G by A, and the deviation from randomness was statistically
significant for all of these (range of p values, 0.021-⬍0.0001).
Combining the results for all lineages, the C3 T and G3 A replacements together constituted almost one-third of all mutations
(Table IV). Under assumption 2 also, the nucleotide C when mutated was most often replaced by T, and G was most often replaced
by A. Thus, calculations based on either assumption support the
conclusion that somatic mutational processes are operating normally in these GCs.
monkeys, the ratio of replacement to silent mutations was determined for the FRs and CDRs of each V(D)J region by comparison
with the nearest human germline homologs (Table II). The excess
or paucity of replacement mutations in the FRs or CDRs of each
sequence, tallied both under assumptions 1 and 2, was compared
with that expected by chance using a multinomial distribution
model (54). The fraction of clones from each lineage that showed
statistically significant evidence for a selection bias under assumption 1 is shown in Table II. Remarkably, 63 of 66 clones had a
statistically significant ( p ⬍ 0.05) paucity of R mutations in the
FRs. This indicates that nearly all the clones had survived substantial negative selection pressures in vivo. The absence of premature termination codons, out-of-frame V(D)J junctions and
other inactivating mutations among the cloned sequences provides
additional evidence of negative selection. A majority of the clones
(37 of 66) also had a statistically significant excess of R mutations
in the CDRs, reflecting positive selection pressures in vivo.
We repeated the analysis under assumption 2 (data not shown).
Although this assumption drastically reduced the total number of
apparent somatic mutations, 35 of 66 clones still showed a statistically significant paucity of R mutations in their FRs, and 27
clones had a statistically significant excess of R mutations in the
CDRs. Therefore, calculations based on either assumption support
the conclusion that positive and negative selection processes are
operating normally in these GCs.
The Journal of Immunology
tical with that of the macaques (36 –39, 41). As a result, where a
difference from the human germline sequence was shared by all
clones in a macaque lineage, we could not determine whether the
differences were introduced by somatic mutation in an ancestral
clone or instead were encoded in the macaque germline.
To rule out possible bias introduced by such errors of assignment, we performed most analyses under two different assumptions. First, it was assumed that any nucleotide difference between
a macaque sequence and its nearest human germline homolog resulted from a single somatic mutation. This assumption will tend
to overestimate the frequency of somatic mutations. Second, it was
assumed that any substitutions present in every member of a lineage were encoded in the macaque germline, and were therefore
excluded from analysis. This more conservative assumption will
undercount somatic mutations, including those retained because
they contribute to the specificity of all Igs of a lineage. Importantly, the conclusion that somatic mutation and selection were
operating as they should be in the GCs of the SHIV-infected monkeys was supported under either assumption. There also is little
published information regarding the normal pattern of somatic mutation in macaques. The lack of a formal baseline or comparator
would be of greater consequence had our results suggested that
macaque GCs introduce somatic mutations according to some
novel pattern. However, because the pattern was the same in normal humans and rodents as in the SHIV-infected macaques we
studied, it is likely that the pattern in normal macaques is also
the same.
There are few published studies that address the role of GCs
during immune responses to viral infection in humans or nonhuman primates. Analyses of somatic mutations in mAbs derived
from individuals exposed to viruses suggest that the processes of
somatic mutation and Ag-affinity selection can play a major role in
shaping the Ab response to viruses, including HIV-1 (58, 59, 71–
73). The present study directly demonstrates that GCs are a major
site for somatic mutation and selection of antiviral Abs in primates.
Additional studies are needed to determine the contribution of somatic mutation outside of GCs (74 –76) to shaping the Ab response
to an infecting virus.
Acknowledgments
We thank Robert Doms (Philadelphia, PA) for providing rgp120-89.6 produced in his laboratory; and Randy Todd and David Wong (Harvard
School of Dental Medicine) for access to the laser capture microdissection
workstation.
Disclosures
The authors have no financial conflict of interest.
References
1. Racz, P., K. Tenner-Racz, F. van Vloten, H. Schmidt, M. Dietrich,
J. C. Gluckman, N. L. Letvin, and G. Janossy. 1990. Lymphatic tissue changes in
AIDS and other retrovirus infections: tools and insights. Lymphology 23: 85–91.
2. Chalifoux, L. V., N. W. King, and N. L. Letvin. 1984. Morphologic changes in
lymph nodes of macaques with an immunodeficiency syndrome. Lab. Invest. 51:
22–26.
3. Dorner, T., S. J. Foster, H. P. Brezinschek, and P. E. Lipsky. 1998. Analysis of
the targeting of the hypermutational machinery and the impact of subsequent
selection on the distribution of nucleotide changes in human VHDJH rearrangements. Immunol. Rev. 162: 161–171.
4. Neuberger, M. S., M. R. Ehrenstein, N. Klix, C. J. Jolly, J. Yelamos, C. Rada, and
C. Milstein. 1998. Monitoring and interpreting the intrinsic features of somatic
hypermutation. Immunol. Rev. 162: 107–116.
5. Levy, Y., N. Gupta, F. Le Deist, C. Garcia, A. Fischer, J. C. Weill,
C. A. Reynaud, B. Bertocci, L. Quint, F. Delbos, et al. 1998. Defect in IgV gene
somatic hypermutation in common variable immuno-deficiency syndrome. Proc.
Natl. Acad. Sci. USA 95: 13135–13140.
6. Manheimer-Lory, A. J., G. Zandman-Goddard, A. Davidson, C. Aranow, and
B. Diamond. 1997. Lupus-specific antibodies reveal an altered pattern of somatic
mutation. J. Clin. Invest. 100: 2538 –2546.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
H and L chain clones support the conclusion that the same Agdriven GC processes observed in normal humans and mice are also
operating in the GCs of SHIV-infected monkeys. The Ig sequences
from SHIV-infected monkeys had an average of 16.5–37.1 apparent somatic mutations per sequence. This is close to the mutation
frequency previously reported for human IgG Abs recognizing
HIV-1 gp120 (58 – 64), and substantially higher than the average
of 9.5 somatic mutations in IgG produced by unselected human
tonsillar GC B cells (65).
The abundance of mutations in the Igs indicates that the B cells
were subjected to a profound degree of antigenic stimulation in the
GC microenvironment. Although it was not formally demonstrated
that the studied Igs actually bind Env or another SHIV protein, the
abundance of Env-binding cells in the studied GCs provides direct
evidence that the viral envelope is a potent immunogen for B cells
in fully functional GCs.
Somatic mutation among GC B cells typically occurs at a rate of
10⫺3 mutations per base pair per cell per generation (66, 67). The
cell cycle of GC B cells has been calculated at between 6 (68) and
12 h (69). Assuming the same rate of mutation applies to the tissues from which the clones were derived, calculations show that
the average clone in our dataset underwent between 50 and 113
cycles of replication. Based on the 6 –12 hour cycling time, this
number of generations could arise in 2– 8 wk of continuous antigenic stimulation. Because the tissues were obtained at least 13 wk
after SHIV infection, it cannot be determined whether diversification of the clones we studied occurred rapidly during acute infection or accumulated more gradually over subsequent weeks.
Using the lower estimate of 50 generations, this number of cell
divisions is sufficient to produce nearly 800 trillion cells, if all
survived. However, the largest GCs contain a few million cells at
most. The difference between these values highlights the stringency of negative selection enforced during clonal expansion in
these GCs.
In the present study, we found that GC function was preserved
in two monkeys in the steady state stage of SHIV infection who
had ⬃50% reductions in CD4⫹ T cell counts. This corresponds
with the protracted lymphadenopathy stage of HIV-1 infection in
the early years following infection, although the subset of CD4⫹ T
lymphocytes lost in these monkeys differs from those targeted for
destruction in HIV-1-infected humans (70). However, GC function
likely declines with more advanced immunodeficiency. HIV-1-infected individuals with very low numbers of CD4⫹ cells often
develop follicular involution, with GCs depleted of lymphocytes
and follicular dendritic cells.
The analysis of data in this study was subject to several limitations. First, any characterization of GC B cell lineages will necessarily be incomplete because the iterative process of mutation
and selection will delete intermediate ancestors, branches, and entire lineages as an indispensable component of the process leading
to affinity maturation. Other B cells present in the GC will be
missed through sampling error or because mutations in their Ig
sequence disrupt homology with the PCR primers. In any case,
because the H and L chain lineages characterized in this study all
showed a consistent pattern of nucleotide substitution and selection, it is unlikely that any missing sequences would have altered
our conclusions.
A more serious limitation in any analysis of macaque Ig sequence data stems from the substantial gaps in our knowledge of
macaque Ig germline sequences. These gaps preclude the use of
macaque Ig germline sequences as a basis for comparison with the
Ig clones sequenced in this study. Instead, the sequenced macaque
Ig cDNAs were compared with the human genomic Ig repertoire.
This germline repertoire is known to be very similar but not iden-
1117
1118
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
Cross-protective immune responses induced in rhesus macaques by immunization
with attenuated macrophage-tropic simian immunodeficiency virus. J. Virol. 69:
2737–2744.
Cole, K. S., J. L. Rowles, B. A. Jagerski, M. Murphey-Corb, T. Unangst,
J. E. Clements, J. Robinson, M. S. Wyand, R. C. Desrosiers, and R. C. Montelaro.
1997. Evolution of envelope-specific antibody responses in monkeys experimentally infected or immunized with simian immunodeficiency virus and its association with the development of protective immunity. J. Virol. 71: 5069 –5079.
Pilgrim, A. K., G. Pantaleo, O. J. Cohen, L. M. Fink, J. Y. Zhou, J. T. Zhou,
D. P. Bolognesi, A. S. Fauci, and D. C. Montefiori. 1997. Neutralizing antibody
responses to human immunodeficiency virus type 1 in primary infection and
long-term-nonprogressive infection. J. Infect. Dis. 176: 924 –932.
Wrin, T., L. Crawford, L. Sawyer, P. Weber, H. W. Sheppard, and C. V. Hanson.
1994. Neutralizing antibody responses to autologous and heterologous isolates of
human immunodeficiency virus. J. Acquir. Immune Defic. Syndr. 7: 211–219.
Quinnan, G. V., Jr., P. F. Zhang, D. W. Fu, M. Dong, and J. B. Margolick. 1998.
Evolution of neutralizing antibody response against HIV type 1 virions and
pseudovirions in multicenter AIDS cohort study participants. AIDS Res. Hum.
Retroviruses 14: 939 –949.
Zhang, Z. Q., W. A. Schleif, D. R. Casimiro, L. Handt, M. Chen, M. E. Davies,
X. Liang, T. M. Fu, A. Tang, K. A. Wilson, et al. 2004. The impact of early
immune destruction on the kinetics of postacute viral replication in rhesus monkey infected with the simian-human immunodeficiency virus 89.6P. Virology
320: 75– 84.
Joag, S. V. 2000. Primate models of AIDS. Microbes Infect. 2: 223–229.
Helmuth, E. F., N. L. Letvin, and D. H. Margolin. 2000. Germline repertoire of
the immunoglobulin VH3 family in rhesus monkeys. Immunogenetics 51:
519 –527.
Andris, J. S., A. B. Miller, S. R. Abraham, S. Cunningham, F. Roubinet,
A. Blancher, and J. D. Capra. 1997. Variable region gene segment utilization in
rhesus monkey hybridomas producing human red blood cell-specific antibodies:
predominance of the VH4 family but not VH4-21 (V4-34). Mol. Immunol. 34:
237–253.
Link, J. M., M. A. Hellinger, and H. W. Schroeder, Jr. 2002. The Rhesus monkey
immunoglobulin IGHD and IGHJ germline repertoire. Immunogenetics 54:
240 –250.
Meek, K., T. Eversole, and J. D. Capra. 1991. Conservation of the most JH
proximal Ig VH gene segment (VHVI) throughout primate evolution. J. Immunol.
146: 2434 –2438.
Bible, J. M., W. Howard, H. Robbins, and D. K. Dunn-Walters. 2003. IGHV1,
IGHV5 and IGHV7 subgroup genes in the rhesus macaque. Immunogenetics 54:
867– 873.
Ermert, K., H. Mitlohner, W. Schempp, and H. G. Zachau. 1995. The immunoglobulin ␬ locus of primates. Genomics 25: 623– 629.
Margolin, D. H., E. F. Helmuth Saunders, B. Bronfin, N. de Rosa,
M. K. Axthelm, X. Alvarez, and N. L. Letvin. 2002. High frequency of virusspecific B lymphocytes in germinal centers of SHIV-infected rhesus monkeys.
J. Virol. 76: 3965–3973.
Baik, S. S., R. W. Doms, and B. J. Doranz. 1999. HIV and SIV gp120 binding
does not predict coreceptor function. Virology 259: 267–273.
Broder, C. C., P. L. Earl, D. Long, S. T. Abedon, B. Moss, and R. W. Doms.
1994. Antigenic implications of human immunodeficiency virus type 1 envelope
quaternary structure: oligomer-specific and -sensitive monoclonal antibodies.
Proc. Natl. Acad. Sci. USA 91: 11699 –11703.
Etemad-Moghadam, B., D. Rhone, T. Steenbeke, Y. Sun, J. Manola, R. Gelman,
J. W. Fanton, P. Racz, K. Tenner-Racz, M. K. Axthelm, et al. 2001. Membranefusing capacity of the human immunodeficiency virus envelope proteins determines the efficiency of CD⫹ T-cell depletion in macaques infected by a simianhuman immunodeficiency virus. J. Virol. 75: 5646 –5655.
Reimann, K. A., J. T. Li, R. Veazey, M. Halloran, I.-W. Park, G. B. Karlsson,
J. Sodroski, and N. L. Letvin. 1996. A chimeric simian/human immunodeficiency
virus expressing a primary patient HIV-1 isolate env causes an AIDS-like disease
after in vivo passage in rhesus monkeys. J. Virol. 70: 6922– 6928.
Karlsson, G. B., M. Halloran, D. Schenten, J. Lee, P. Racz, K. Tenner-Racz,
J. Manola, R. Gelman, B. Etemad-Moghadam, E. Desjardins, et al. 1998. The
envelope glycoprotein ectodomains determine the efficiency of CD4⫹ T lymphocyte depletion in simian-human immunodeficiency virus-infected macaques.
J. Exp. Med. 188: 1159 –1171.
1996. Guide for the Care and Use of Laboratory Animals. National Research
Council, National Academy Press, Washington, DC.
Bonner, R. F., M. Emmert-Buck, K. Cole, T. Pohida, R. Chuaqui, S. Goldstein,
and L. A. Liotta. 1997. Laser capture microdissection: molecular analysis of
tissue. Science 278: 1481–1483.
Lefranc, M. P. 2001. IMGT, the international ImMunoGeneTics database. Nucleic Acids Res. 29: 207–209.
Nei, M., and T. Gojobori. 1986. Simple methods for estimating the numbers of
synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3:
418 – 426.
Ota, T., and M. Nei. 1994. Variance and covariances of the numbers of synonymous and nonsynonymous substitutions per site. Mol. Biol. Evol. 11: 613– 619.
Korber, B. T. 2000. HIV signature and sequence variation analysis. In Computational and Evolutionary Analysis of HIV Molecular Sequences. A. G. Rodrigo
and G. H. Learn, eds. Kluwer Academic Publishers, Dordrecht, pp. 55–72.
Lossos, I. S., R. Tibshirani, B. Narasimhan, and R. Levy. 2000. The inference of
antigen selection on Ig genes. J. Immunol. 165: 5122–5126.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
7. Dorner, T., S. Kaschner, A. Hansen, A. Pruss, and P. E. Lipsky. 2001. Perturbations in the impact of mutational activity on V␭ genes in systemic lupus erythematosus. Arthritis Res. 3: 368 –374.
8. Revy, P., T. Muto, Y. Levy, F. Geissmann, A. Plebani, O. Sanal, N. Catalan,
M. Forveille, R. Dufourcq-Labelouse, A. Gennery, et al. 2000. Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form
of the hyper-IgM syndrome (HIGM2). Cell 102: 565–575.
9. Zeng, X., D. B. Winter, C. Kasmer, K. H. Kraemer, A. R. Lehmann, and
P. J. Gearhart. 2001. DNA polymerase eta is an A-T mutator in somatic hypermutation of immunoglobulin variable genes. Nat. Immunol. 2: 537–541.
10. Mascola, J. R., G. Stiegler, T. C. VanCott, H. Katinger, C. B. Carpenter,
C. E. Hanson, H. Beary, D. Hayes, S. S. Frankel, D. L. Birx, and M. G. Lewis.
2000. Protection of macaques against vaginal transmission of a pathogenic HIV1/SIV chimeric virus by passive infusion of neutralizing antibodies. Nat. Med. 6:
207–210.
11. Shibata, R., T. Igarashi, N. Haigwood, A. Buckler-White, R. Ogert, W. Ross,
R. Willey, M. W. Cho, and M. A. Martin. 1999. Neutralizing antibody directed
against the HIV-1 envelope glycoprotein can completely block HIV-1/SIV chimeric virus infections of macaque monkeys. Nat. Med. 5: 204 –210.
12. Mascola, J. R., M. G. Lewis, G. Stiegler, D. Harris, T. C. VanCott, D. Hayes,
M. K. Louder, C. R. Brown, C. V. Sapan, S. S. Frankel, et al. 1999. Protection
of Macaques against pathogenic simian/human immunodeficiency virus 89.6PD
by passive transfer of neutralizing antibodies. J. Virol. 73: 4009 – 4018.
13. Emini, E. A., W. A. Schleif, J. H. Nunberg, A. J. Conley, Y. Eda, S. Tokiyoshi,
S. D. Putney, S. Matsushita, K. E. Cobb, C. M. Jett, et al. 1992. Prevention of
HIV-1 infection in chimpanzees by gp120 V3 domain-specific monoclonal antibody. Nature 355: 728 –730.
14. Conley, A. J., J. A. Kessler, II, L. J. Boots, P. M. McKenna, W. A. Schleif,
E. A. Emini, G. E. Mark, III, H. Katinger, E. K. Cobb, S. M. Lunceford, et al.
1996. The consequence of passive administration of an anti-human immunodeficiency virus type 1 neutralizing monoclonal antibody before challenge of chimpanzees with a primary virus isolate. J. Virol. 70: 6751– 6758.
15. Wei, X., J. M. Decker, S. Wang, H. Hui, J. C. Kappes, X. Wu,
J. F. Salazar-Gonzalez, M. G. Salazar, J. M. Kilby, M. S. Saag, et al. 2003.
Antibody neutralization and escape by HIV-1. Nature 422: 307–312.
16. Richman, D. D., T. Wrin, S. J. Little, and C. J. Petropoulos. 2003. Rapid evolution of the neutralizing antibody response to HIV type 1 infection. Proc. Natl.
Acad. Sci. USA 100: 4144 – 4149.
17. McKeating, J. A., J. Gow, J. Goudsmit, L. H. Pearl, C. Mulder, and R. A. Weiss.
1989. Characterization of HIV-1 neutralization escape mutants. AIDS 3:
777–784.
18. Burns, D. P., C. Collignon, and R. C. Desrosiers. 1993. Simian immunodeficiency
virus mutants resistant to serum neutralization arise during persistent infection of
rhesus monkeys. J. Virol. 67: 4104 – 4113.
19. Nara, P., L. Smit, N. Dunlop, W. Hatch, M. Merges, D. Waters, J. Kelliher,
W. Krone, and J. Goudsmit. 1990. Evidence for rapid selection and deletion of
HIV-1 subpopulations in vivo by V3-specific neutralizing antibody: a model of
humoral-associated selection. Dev. Biol. Stand. 72: 315–341.
20. Cheng-Mayer, C., A. Brown, J. Harouse, P. A. Luciw, and A. J. Mayer. 1999.
Selection for neutralization resistance of the simian/human immunodeficiency
virus SHIVSF33A variant in vivo by virtue of sequence changes in the extracellular envelope glycoprotein that modify N-linked glycosylation. J. Virol. 73:
5294 –5300.
21. Evans, D. T., and R. C. Desrosiers. 2001. Immune evasion strategies of the
primate lentiviruses. Immunol. Rev. 183: 141–158.
22. Arendrup, M., A. Sonnerborg, B. Svennerholm, L. Akerblom, C. Nielsen,
H. Clausen, S. Olofsson, J. O. Nielsen, and J. E. Hansen. 1993. Neutralizing
antibody response during human immunodeficiency virus type 1 infection: type
and group specificity and viral escape. J. Gen. Virol. 74: 855– 863.
23. Chackerian, B., L. M. Rudensey, and J. Overbaugh. 1997. Specific N-linked and
O-linked glycosylation modifications in the envelope V1 domain of simian immunodeficiency virus variants that evolve in the host alter recognition by neutralizing antibodies. J. Virol. 71: 7719 –7727.
24. Rasmussen, R. A., R. Hofmann-Lehmann, P. L. Li, J. Vlasak, J. E. Schmitz,
K. A. Reimann, M. J. Kuroda, N. L. Letvin, D. C. Montefiori, H. M. McClure,
and R. M. Ruprecht. 2002. Neutralizing antibodies as a potential secondary protective mechanism during chronic SHIV infection in CD8⫹ T-cell-depleted macaques. AIDS 16: 829 – 838.
25. Schmitz, J. E., M. J. Kuroda, S. Santra, M. A. Simon, M. A. Lifton, W. Lin,
R. Khunkhun, M. Piatak, J. D. Lifson, G. Grosschupff, et al. 2003. Effect of
humoral immune responses on controlling viremia during primary infection of
rhesus monkeys with simian immunodeficiency virus. J. Virol. 77: 2165–2173.
26. Binley, J. M., B. Clas, A. Gettie, M. Vesanen, D. C. Montefiori, L. Sawyer,
J. Booth, M. Lewis, P. A. Marx, S. Bonhoeffer, and J. P. Moore. 2000. Passive
infusion of immune serum into simian immunodeficiency virus-infected rhesus
macaques undergoing a rapid disease course has minimal effect on plasma viremia. Virology 270: 237–249.
27. Arendrup, M., C. Nielsen, J. E. Hansen, C. Pedersen, L. Mathiesen, and
J. O. Nielsen. 1992. Autologous HIV-1 neutralizing antibodies: emergence of
neutralization-resistant escape virus and subsequent development of escape virus
neutralizing antibodies. J. Acquir. Immune Defic. Syndr. 5: 303–307.
28. Moog, C., H. J. Fleury, I. Pellegrin, A. Kirn, and A. M. Aubertin. 1997. Autologous and heterologous neutralizing antibody responses following initial seroconversion in human immunodeficiency virus type 1-infected individuals. J. Virol. 71: 3734 –3741.
29. Clements, J. E., R. C. Montelaro, M. C. Zink, A. M. Amedee, S. Miller,
A. M. Trichel, B. Jagerski, D. Hauer, L. N. Martin, R. P. Bohm, et al. 1995.
GC FUNCTION DURING SHIV INFECTION
The Journal of Immunology
66. Clarke, S. H., K. Huppi, D. Ruezinsky, L. Staudt, W. Gerhard, and M. Weigert.
1985. Inter- and intraclonal diversity in the antibody response to influenza haemagglutinin. J. Exp. Med. 161: 687–704.
67. Jacob, J., J. Przylepa, C. Miller, and G. Kelsoe. 1993. In situ studies of the
primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. III. The kinetics of
V region mutation and selection in germinal center B cells. J. Exp. Med. 178:
1293–1307.
68. Liu, Y. J., J. Zhang, P. J. Lane, E. Y. Chan, and I. C. MacLennan. 1991. Sites of
specific B cell activation in primary and secondary responses to T cell-dependent
and T cell-independent antigens. Eur. J. Immunol. 21: 2951–2962.
69. Jacob, J., R. Kassir, and G. Kelsoe. 1991. In situ studies of the primary immune
response to (4-hydroxy-3- nitrophenyl)acetyl. I. The architecture and dynamics of
responding cell populations. J. Exp. Med. 173: 1165–1175.
70. Feinberg, M. B., and J. P. Moore. 2002. AIDS vaccine models: challenging challenge viruses. Nat. Med. 8: 207–210.
71. Andris, J. S., P. H. Ehrlich, L. Ostberg, and J. D. Capra. 1992. Probing the human
antibody repertoire to exogenous antigens: characterization of the H and L chain
V region gene segments from anti-hepatitis B virus antibodies. J. Immunol. 149:
4053– 4059.
72. Sakurai, H., R. A. Williamson, J. E. Crowe, J. A. Beeler, P. Poignard,
R. B. Bastidas, R. M. Chanock, and D. R. Burton. 1999. Human antibody responses to mature and immature forms of viral envelope in respiratory syncytial
virus infection: significance for subunit vaccines. J. Virol. 73: 2956 –2962.
73. Ivanovski, M., F. Silvestri, G. Pozzato, S. Anand, C. Mazzaro, O. R. Burrone, and
D. G. Efremov. 1998. Somatic hypermutation, clonal diversity, and preferential
expression of the VH 51p1/VL kv325 immunoglobulin gene combination in hepatitis C virus-associated immunocytomas. Blood 91: 2433–2442.
74. William, J., C. Euler, S. Christensen, and M. J. Shlomchik. 2002. Evolution of
autoantibody responses via somatic hypermutation outside of germinal centers.
Science 297: 2066 –2070.
75. Matsumoto, M., S. F. Lo, C. J. Carruthers, J. Min, S. Mariathasan, G. Huang,
D. R. Plas, S. M. Martin, R. S. Geha, M. H. Nahm, and D. D. Chaplin. 1996.
Affinity maturation without germinal centres in lymphotoxin-␣-deficient mice.
Nature 382: 462– 466.
76. Takahashi, Y., P. R. Dutta, D. M. Cerasoli, and G. Kelsoe. 1998. In situ studies
of the primary immune response to (4-hydroxy-3- nitrophenyl)acetyl. V. Affinity
maturation develops in two stages of clonal selection. J. Exp. Med. 187: 885– 895.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
55. Rogozin, I. B., and N. A. Kolchanov. 1992. Somatic hypermutagenesis in immunoglobulin genes. II. Influence of neighbouring base sequences on mutagenesis. Biochim. Biophys. Acta 1171: 11–18.
56. Betz, A. G., M. S. Neuberger, and C. Milstein. 1993. Discriminating intrinsic and
antigen-selected mutational hotspots in immunoglobulin V genes. Immunol. Today 14: 405– 411.
57. Rada, C., G. T. Williams, H. Nilsen, D. E. Barnes, T. Lindahl, and
M. S. Neuberger. 2002. Immunoglobulin isotype switching is inhibited and somatic hypermutation perturbed in UNG-deficient mice. Curr. Biol. 12:
1748 –1755.
58. Barbas, C. F., T. A. Collet, W. Amberg, P. Roben, J. M. Binley, D. Hoekstra,
D. Cababa, T. M. Jones, R. A. Williamson, G. R. Pilkington, et al. 1993. Molecular profile of an antibody response to HIV-1 as probed by combinatorial
libraries. J. Mol. Biol. 230: 812– 823.
59. Toran, J. L., L. Kremer, L. Sanchez-Pulido, I. M. de Alboran, G. del Real,
M. Llorente, A. Valencia, M. A. de Mon, and A. C. Martinez. 1999. Molecular
analysis of HIV-1 gp120 antibody response using isotype IgM and IgG phage
display libraries from a long-term non-progressor HIV-1-infected individual. Eur.
J. Immunol. 29: 2666 –2675.
60. Cavacini, L. A., C. L. Emes, A. V. Wisnewski, J. Power, G. Lewis, D. Montefiori,
and M. R. Posner. 1998. Functional and molecular characterization of human
monoclonal antibody reactive with the immunodominant region of HIV type 1
glycoprotein 41. AIDS Res. Hum. Retroviruses 14: 1271–1280.
61. Bagley, J., P. J. Dillon, C. Rosen, J. Robinson, J. Sodroski, and W. A. Marasco.
1994. Structural characterization of broadly neutralizing human monoclonal antibodies against the CD4 binding site of HIV-1 gp120. Mol. Immunol. 31:
1149 –1160.
62. David, D., and M. Zouali. 1995. Variable region light chain genes encoding
human antibodies to HIV-1. Mol. Immunol. 32: 77– 88.
63. Moran, M. J., J. S. Andris, Y.-I. Matsumato, J. D. Capra, and E. M. Hersh. 1993.
Variable region genes of anti-HIV human monoclonal antibodies: non-restricted
use of the V gene repertoire and extensive somatic mutation. Mol. Immunol. 30:
1543–1551.
64. Kunert, R., F. Ruker, and H. Katinger. 1998. Molecular characterization of five
neutralizing anti-HIV type 1 antibodies: identification of nonconventional D segments in the human monoclonal antibodies 2G12 and 2F5. AIDS Res. Hum.
Retroviruses 14: 1115–1128.
65. Pascual, V., Y.-J. Liu, A. Magalski, O. de Bouteiller, J. Banchereau, and
J. D. Capra. 1994. Analysis of somatic mutation in five B cell subsets of human
tonsil. J. Exp. Med. 180: 329 –339.
1119