JBC Papers in Press. Published on March 20, 2008 as Manuscript M710209200
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M710209200
Protein kinase C-theta is required for autophagy in response to
stress in the endoplasmic reticulum
Kenjiro Sakaki1, Jun Wu1 and Randal J. Kaufman1, 2, *
Departments of Biological Chemistry and 2Internal Medicine, University of Michigan Medical School,
Ann Arbor, Michigan 48109, USA
2
Howard Hughes Medical Institute, University of Michigan Medical School, Ann Arbor, Michigan 48109,
USA
1
Address correspondence to: Randal J. Kaufman, Ph.D. UM/HHMI 4570 MSRB II, 1150 W. Medical
Center Drive, Ann Arbor, MI 48109-0650. Phone: 734-763-9037; Fax: 734-763-9323 Email:
[email protected]
Running title: ER stress-induced autophagy requires PKC signaling.
-dependent PKCθ activation is specifically
required for autophagy in response to ER stress,
but not in response to amino acid starvation.
INTRODUCTION
Autophagy is a process by which intracellular
material is recycled to supply the cell with
nutrients and energy for survival under conditions
of severe stress, such as amino acid starvation.
Upon nutrient limitation, autophagy is induced
through the proliferation of cell membranes that
form the autophagosome for the engulfment of
large intracellular protein complexes and
subcellular organelles.
The autophagosome
docks and fuses with the lysosome to form the
autolysosome that degrades its lumenal contents in
order to recycle amino acids and fatty acids. This
“self-eating” process is typically induced under
conditions of nutrient starvation.
However,
autophagy also provides an essential role for the
clearance of dead-ended protein aggregates that
cannot be degraded by the concerted action of
molecular chaperones and the proteasome, such as
those that occur in Huntington’s disease and
Parkinson’s disease, (1-3). As there is a growing
understanding of the significance of autophagy in
fundamental pathological conditions ranging from
cancer to neurodegeneration, there is enthusiasm
for the development of novel therapeutic
interventions for these conditions (4). However,
although the molecular mechanisms that signal
autophagy have been extensively characterized in
budding yeast, the process in higher eukaryotes is
largely not understood.
1
Copyright 2008 by The American Society for Biochemistry and Molecular Biology, Inc.
Downloaded from www.jbc.org by on March 24, 2008
Autophagy is an evolutionally conserved
process for the bulk degradation of cytoplasmic
proteins and organelles. Recent observations
indicate that autophagy is induced in response
to cellular insults that result in the
accumulation of misfolded proteins in the lumen
of the endoplasmic reticulum (ER). However,
the signaling mechanisms that activate
autophagy under these conditions are not
understood.
Here, we report that ER
stress-induced
autophagy
requires
the
activation of Protein Kinase C theta (PKCθ), a
member of the novel-type PKC (nPKC) family.
Induction of ER stress by treatment with either
thapsigargin
or
tunicamycin
activated
autophagy in immortalized hepatocytes as
monitored by the conversion LC3-I to LC3-II,
clustering of LC3 into dot-like cytoplasmic
structures, and electron microscopic detection
of
autophagosomes.
Pharmacological
inhibition of PKCθ or siRNA-mediated
knockdown of PKCθ prevented the autophagic
response to ER stress. Treatment with ER
stressors induced PKCθ phosphorylation within
the activation loop and localization of
phospho-PKCθ
to
LC3-containing
dot
structures in the cytoplasm.
However,
signaling through the known unfolded protein
response (UPR) sensors was not required for
PKCθ activation.
PKCθ activation and
stress-induced autophagy were blocked by
chelation of intracellular Ca2+ with BAPTA-AM.
PKCθ was not activated or required for
autophagy in response to amino acid starvation.
These observations indicate that Ca2+
translation initiation factor 2 (eIF2α) at Ser51 to
attenuate mRNA translation and thereby reduce the
amount of the client proteins translocated into the
ER lumen. The PERK-eIF2α pathway also
up-regulates amino acid biosynthesis and
anti-oxidative stress-response genes through
promoting preferential translation of activating
transcription factor 4 (ATF4) mRNA. In parallel,
cleavage of ATF6α and IRE1α-mediated splicing
of X-box binding protein 1 (XBP1) mRNA
generate two transcription factors that induce
expression of genes encoding ER molecular
chaperones and ER-associated protein degradation
(ERAD) machinery. In this way, the UPR couples
the ER protein-folding capacity with the
protein-folding demand.
However, chronic
unresolved accumulation of unfolded protein in the
ER elicits an apoptotic program through ATF4- and
ATF6α- mediated transcriptional activation of the
C/EBP homologous protein transcription factor
CHOP/GADD153 (23-26). In addition, activated
IRE1α leads to phosphorylation c-Jun N-terminal
kinase JNK to also contribute to the apoptotic
program (27-29).
Presently, there are conflicting reports
regarding the requirement for UPR signaling in the
autophagic response to ER stress. Ogata et al.
reported that ER stress-induced autophagy requires
IRE1α-mediated activation of JNK (18).
In
contrast, Kuoroku et al. demonstrated that
transcriptional up-regulation of ATG12 requires
signaling through PERK-eIF2α (18,20). As ER
stress also results in Ca2+ leak from the ER (30),
ER stress-induced autophagy may also be mediated
through CaMKK-β-mediated activation of AMPK
to inhibit mTOR kinase (14,31,32). Consequently,
further studies are required to elucidate the
molecular signaling processes by which ER stress
induces autophagy.
The ER is the major intracellular Ca2+ storage
organelle of the cell. Ca2+ released from the ER
activates members of the protein kinase C (PKC)
family (33,34).
PKC isoforms function in
multiple cellular processes including cell growth
and differentiation, cell cycle control, ion flux,
protein secretion, tumorgenesis and apoptosis
(33,35,36). Recently, PKCs were suggested to
function in ER stress signaling (37-41), although to
date there are no studies that demonstrate a
requirement for PKC signaling in the autophagic
2
Downloaded from www.jbc.org by on March 24, 2008
Autophagy is induced by a group of
evolutionarily conserved autophagy gene-related
proteins (ATG proteins)(5). The process is initiated
when a class III PI3-kinase complex and ATG
proteins form an isolation membrane. A
ubiquitin-like protein conjugation pathway expands
the isolation membrane. LC3 (mammalian
homologue of Atg8) is synthesized as an inactive
soluble form (LC3-I) that is converted into an
active membranous form (LC3-II) by modification
with phosphatidylethanolamine (PE).
This
modification is mediated by the ubiquitin-like
conjugation system comprised of the E1-like ATG7
protein and the E2-like ATG3 protein. PE-modified
LC3-II binds to target membranes and, in
collaboration
with
ATG5-ATG12-ATG16
complexes, induces membrane alterations required
for autophagosome formation.
The molecular pathways that regulate
autophagy are most well understood in the context
of nutrient limitation. Autophagy is inhibited by
depletion of cellular energy and amino acid levels
through the target of rapamycin protein kinase TOR
(6-8). TOR activity is inhibited by the
AMP-activated protein kinase (AMPK) via a
pathway involving the GTPase-activating tuberous
sclerosis complex (TSC1/2) and its substrate RHEB,
that is a member of the RAS-family of GTP-binding
proteins (9). Upon energy depletion, the LKB1
tumor suppressor kinase phosphorylates and
activates AMPK. AMPK is also activated through
the Ca2+/calmodulin-dependent protein kinase
kinase-β (CaMKK-β) in response to Ca2+ release
from the ER (10-14). Intriguingly, ER-localized
BCL2 inhibits autophagy, possibly through
reducing Ca2+ mobilization from the ER lumen
(15,16).
Recently,
it
was
demonstrated
that
pharmacological perturbation of ER function
induces autophagy (14,17-20). Conditions that
disturb homeostasis in the ER, such as Ca2+
depletion from the ER or inhibition of asparagine
(N)-linked glycosylation, cause the accumulation
of unfolded protein in the ER lumen and activate
an adaptive signaling pathway termed the unfolded
protein response (UPR). In higher eukaryotes, the
ER-resident transmembrane proteins IRE1α,
PERK, and ATF6 act as proximal sensors to signal
the UPR (21,22). Upon accumulation of unfolded
protein in the ER, the protein kinase PERK
phosphorylates the alpha subunit of eukaryotic
media in the absence of TG. Where indicated,
Go6976, Rottlerin, BAPTA-AM or 3MA were
added to cell cultures for 20min prior to the
addition of TG or TM and these agents were
present during the entire time-course of the
experiment. For amino acid deprivation, cells
were rinsed three times with PBS and cultured in
Earl’s Balanced Salt Solution (EBSS) in the
absence or presence of amino acids (Invitrogen)
supplemented with 15% dialyzed FBS and 10nM
Bafilomycin A1.
response. In mammals, the protein kinase C
(PKC) family comprises 11 isoforms that are
classified into three subgroups based on their
domain structures. The classical PKCs (cPKC: α,
βI, βII and γ) possess the both C1 and C2 domains
that bind lipid cofactors (diacylglycerol) and Ca2+,
respectively. In contrast, the novel PKCs (nPKC:
δ, ε, η, µ and θ) lack a C2 domain and the atypical
PKCs (aPKC: ζ, λ and ι) lack both C1 and C2
domains (42). In addition to their diverse structures,
the different PKC isoforms display different
mechanisms of activation and tissue-specific
expression (42). Herein, we report that PKC theta
(PKCθ), a member of the nPKC family, is a novel
factor that mediates Ca2+-dependent induction of
autophagy in response to ER stress, but not in
response to amino acid starvation.
EXPERIMENTAL PROCEDURES
Chemical reagents and antibodies- Polyclonal
antibody against ATG8/LC3 was kindly provided
by Dr. Ron R. Kopito (Stanford University, CA,
USA). Polyclonal antibodies against PKCθ,
phospho-PKCθ (Thr538), PKCδ, phospho-PKCδ
(Thr505), PKCα phospho-PKCα/βI (Ser644/647)
and ERK1/2 were purchased from Cell Signaling
Inc. (Danvers, MA, USA). Polyclonal antibody
against Calnexin was purchased from Stressgen
Biotechnologies Inc. (San Diego, CA, USA).
Polyclonal antibody against CHOP was purchased
from Santa Cruz Biotechnology Inc. (Santa Cruz,
CA, USA). Monoclonal antibody against α-actin
was purchased from BD Biosciences (San Jose,
CA, USA). Thapsigargin (TG), Tunicamycin (TM),
Bafilomycin A1, and 3-methyladenine (3MA) were
purchased from Sigma-Aldrich Inc. (St. Louise,
MO, USA). Rottlerin and Go6976 were purchased
from Calbiochem (La Jolla, CA, USA).
Cell culture and stress treatments- Immortalized
hepatocytes were maintained in medium199
(Invitrogen
Inc.,
Carlsbad,
CA,
USA)
supplemented with 15% certified heat-inactivated
Fetal Bovine Serum (FBS) (Invitrogen). The cells
were treated with TG or TM to induce ER stress.
For transient treatment with TG, cells were
cultured in M199 medium containing 1µM TG for
3min or 10min and then the cells were rinsed three
times with PBS and cultured for 6hr in fresh M199
Generation of siRNA-knockdown stable cell lines siRNA-mediated knockdown was performed with
pRNAT6.1/Neo (GeneScript Inc., Piscataway, NJ,
3
Downloaded from www.jbc.org by on March 24, 2008
Primary hepatocyte isolation and immortalizationPrimary murine hepatocytes were isolated and
immortalized as previously described (43,44).
Briefly, livers from E19 day embryos were
harvested and mechanically dissociated with a
scalpel in 0.25% trypsin (Mg2+- and Ca2+- free).
Hepatocytes were further dissociated from the liver
pieces by gentle shaking at 37°C for 10min. The
liver mass was permitted to settle in order to
replace the trypsin solution with 0.05mg/ml
Liberase Blendzyme 4 solution (Roche Applied
Bioscience, Mannheim, Germany). After shaking
at 37°C for 20min, the cells were dispersed by
gentle pipetting and centrifuged at 50x g for 5min.
Hepatocytes were plated onto collagen-coated
plates (BD Bioscience) in M199 medium
supplemented with 10% heat-inactivated FBS and
containing penicillin and streptomycin. After
overnight incubation, cultures were rinsed
extensively to remove hematopoietic cells and
other non-adherent cells.
The puromycin-resistance retroviral vector
pBabe encoding SV40 large T antigen (LTAg, a
gift from P. Jat, Ludwig Institute for Cancer
Research, London, UK) was transfected into viral
PLAT-E packaging cells (kindly provided by D.
Fang, University of Missouri-Columbia Columbia,
MO) at 70% confluency using Fugene 6.
Medium containing virus was harvested and stored
at 0oC. Hepatocytes at 40% confluency were then
infected
by
incubation
with
polybrene
(8µg/ml)-supplemented virus at 32°C for 8hr and
then transferred to 37°C for 72hr prior to selection
with puromycin (1µg/ml) for 1week.
Cell
survival
assayMTT
[3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazoli
um bromide] reduction assays were performed
using the Cell Titer 96 AQueous One Solution
Reagent (Promega Inc., Madison, WI, USA) as
described by the supplier. Briefly, the cells were
plated onto 96-well tissue culture plates (100µl
medium/well) and propagated to ~50% confluency.
The cells were then treated with TG or TM with or
without 10mM 3MA, as described in the figure
legends. Cell Titer Reagent (10µl) was added
into each well and incubated for 2hr. A595nm was
measured using a VERSA-max microplate reader
(Molecular Device, Sunnyvale, CA, USA).
Electron microscopy- For transmission electron
microscopy (TEM), cell monolayers were rinsed in
serum-free medium and then fixed for one hour at
room temperature in 2.5% glutaraldehyde in 0.1M
Sorensen’s buffer, pH 7.4. Following a buffer rinse,
the cells were post-fixed for 15min in 1% osmium
tetroxide in the same buffer. The cells were then
rinsed in double-distilled water, en bloc stained for
one hour with a saturated, aqueous solution of
uranyl acetate, scraped from the culture dishes, and
collected by centrifugation in Eppendorf tubes.
For each subsequent step, the cells were
resuspended in the next reagent and then
centrifuged. The cells were dehydrated rapidly in
a graded series of ethanol, infiltrated and
embedded in Epon, and polymerized. Ultra-thin
sections were collected onto copper grids and
post-stained with uranyl acetate and lead citrate.
The sections were viewed on a Philips CM100 at
Immunoblotting and immunofluorescence analysisFor immunoblotting analysis, cells were harvested
in RIPA buffer (150mM NaCl, 1.0% NP-40,
0.5%DOC, 0.1% SDS, 50mM Tris-HCl pH 8.0)
containing Complete Mini EDTA-free protease
inhibitor cocktail (Roche) and 50mM NaF. Protein
concentrations were measured using the Dc protein
4
Downloaded from www.jbc.org by on March 24, 2008
assay system (BioRad Laboratories Inc., Hercules,
CA, USA). Equal amounts of protein were
separated by SDS-PAGE and transferred to PVDF
membranes (BioRad). Transferred membranes
were incubated with blocking solution (5% BSA,
150mM NaCl, 20mM Tris-HCl pH7.5, 0.1%
Tween-20), treated with primary antibodies
(diluted with blocking buffer, 1:250 for α-CHOP
antibody, 1:5000 for α-actin and α-LC3 antibody,
1:1000 for all other antibodies), and treated with
HRP-conjugated anti-mouse or anti-rabbit IgG
(Promega) as secondary antibodies for detection.
Gel images were developed using BioMax MR
film (KODAK Inc., Tokyo Japan) and an M35A
X-OMAT processor (KODAK).
For immunofluorescence analysis, cells were
cultured to ~80% confluency using the LabTek-II
Chamber Slide System (Nalge Nunc International
Inc., Rochester, NY, USA). After stress treatment,
cells were fixed with 4% paraformaldehyde and
permeabilized with 0.1% Triton X-100 in PBS.
Chamber Slides were incubated with blocking
solution (2% BSA in PBS), treated with primary
antibody (1:1000 dilution for all of antibodies
except for 1:5000 dilution for α-LC3 antibody),
and treated with Alexa Fluor (488- or 594-)
anti-rabbit IgG (Invitrogen) as the secondary
antibody. Microscopic observation was performed
using an Olympus BX-51 Research Microscope
(Olympus Imaging America, Center Valley, PA,
USA).
USA).
siRNA-expression
plasmids
were
constructed according to the manufacture’s
instructions (http://www.genscript.com/rnai.html).
Briefly, 70bases of siRNA primers were designed
by siRNA Target Finder and siRNA Construct
Builder (GenScript Inc.). The nucleotide sequences
of the inserted siRNA were: PKCθ si1
(5’-GATCCCGTTTATCAATGCACTTCTTGTGT
TGATATCCGCACAAGAAGTGCATTGATAAAT
TTTTTCCAAA);
PKCθ
si2
(5’-GATCCCGTTTATACCACAAAGATTGGCAT
TGATATCCGTGCCAATCTTTGTGGTATAAATT
TTTTCCAAA);
and
GFP
(5’-GATCCCGTAGTTGCCGTCGTCCTTGAAG
TTGATATCCGCTTCAAGGACGACGGCAACT
ATTTTTTCCAAA). A pair of primers was
annealed in 1xSSC solution and ligated into the
BamHI and HindIII sites of pRNAT-6.1/Neo using
the Rapid DNA ligation kit (Roche Applied
Bioscience). Purified plasmid DNA was confirmed
by DNA sequencing and transfected into the
immortalized hepatocytes using Fugene6.0
(Roche). Immortalized clones were selected in
medium containing 400µg/ml, maintained in
medium
containing
200µg/ml
Geneticin
(Invitrogen)
and
were
analyzed
by
immunoblotting.
Subcellular
fractionationTG-treated
immortalized hepatocytes were harvested by
scraping in PBS and collected by centrifugation at
600x g for 5min. After the supernatant was
removed, the cells were resuspended in three
volumes of 1x hypotonic buffer (10mM HEPES
pH7.8, 1mM EGTA and 25mM potassium
chloride) and then incubated on ice for 20min. The
cell suspensions were centrifuged at 600x g for
5min and the pellets were resuspended in two
volumes of 1x isotonic buffer (1x hypotonic buffer
with 250mM sucrose) and subjected to dounce
homogenization.
The
homogenates
were
centrifuged at 1000x g for 10min to remove the
cell debris and the supernatants were centrifuged at
12,000x g for 15min to obtain the
post-mitochondrial supernatant fractions. The
supernatants were centrifuged at 100,000x g for
60min to isolate the supernatant cytosolic fractions.
Then, pellets were resuspended in isotonic buffer
and centrifuged at 100,000x g for 60min to obtain
the microsomal pellet fractions. Equal percentages
of the cytosolic fractions and microsomal fractions
were analyzed by western blotting.
All
procedures for the cells fractionation were
performed on ice with Complete-mini EDTA-free
protease inhibitor cocktail (Roche) and 50mM
sodium fluoride.
Autophagy is required for survival in response to
ER stress- We next determined whether cells
require autophagy to survive ER stress. MTT
reduction analysis revealed that treatment with
either TG or tunicamycin (TM), an inhibitor of
N-linked glycosylation, reduced viability to
approximately 65% compared to untreated cells
(Fig. 2A). Treatment with 3MA to inhibit
autophagy
further
reduced
viability
to
approximately 40%, suggesting that autophagy
does increase viability of ER-stressed cells. To
determine whether the ER stress-induced
autophagy may be a consequence of ER
stress-induced apoptosis, cells were transiently
treated with TG for 10min, and then cultured in the
absence of TG for 6hr.
Cell viability was
significantly improved in the cells transiently
treated with TG for 10min compared to cells
continuously treated with TG for 6hr (Fig. 2B).
However, both conditions significantly induced the
UPR, monitored by either Xbp1 mRNA splicing or
CHOP expression (Fig. 2C). Both the 10min
RESULTS
The autophagic response is induced by ER
stress- Recently, it was demonstrated that ER stress
induces autophagy in S. cerevisiae and mammalian
cells (17-20). In mammalian cells, autophagy is
detected by phosphatidylethanolamine addition to
LC3 and its relocalization to membranes (45).
LC3-I and LC3-II are distinguishable by
SDS-PAGE due to increased mobility of LC3-II
that occurs as a consequence of increased
hydrophobicity caused by lipidation. In addition,
the distribution of LC3 changes from a diffuse
cytoplasmic localization to dot-like structures that
represent the autophagosome. We measured LC3
modification and localization in immortalized
hepatocytes in response to the SERCA Ca2+
5
Downloaded from www.jbc.org by on March 24, 2008
ATPase inhibitor thapsigargin (TG). Treatment
with 1mM TG for 8hr caused conversion of LC3-I
to LC3-II and LC3 localization to dot structures in
the cytoplasm (Fig. 1A-C). Treatment with 5mM
3-methyladenine (3MA), an inhibitor of class III
PI3-K (encoded by a single gene, the mammalian
homologue
of
VPS34)
that
prevents
autophagosome formation, partially inhibited the
TG-dependent production of LC3-II and LC3
localization to dot structures (Fig. 1 A-C).
Ultrastructural analysis by TEM detected the
presence of numerous double membrane-enclosed
vesicles that contained membranous and
cytoplasmic material in TG-treated cells (Fig. 1D
b-d). These structures are characteristic of
autophagosomes.
In addition, TG treatment
altered the structure of the ER where it became
distended with a greater amount of electron dense
material (Fig. 1D, a-b). This morphology is typical
of cells in which unfolded proteins accumulate in
the ER lumen (46). Finally, vacuole-like structures
that apparently contained fragments of ER were
observed in TG-treated cells (Fig. 1D, e-f). These
vacuole-like structures suggested that portions of
the ER were engulfed and degraded by the
autolysosome. These structures are reminiscent of
structures recently described in S. cerevisiae that
occur in response to ER stress (17,47)
60 kV. Images were recorded digitally using a
Hamamatsu ORCA-HR digital camera system with
AMT software (Advanced Microscopy Techniques
Corp., Danvers, MA).
stress-induced autophagy.
transient TG treatment, as well as the 6hr
continuous TG treatment, produced significant
numbers of cells with LC3-containing dot
structures (Fig. 2D, E). In contrast, significantly
fewer dot structures were observed in cells that
were transiently treated with TG for only 3min
(Fig. 2E). Because the 10min transient TG
treatment induced autophagy without significant
cell death, the majority of our experiments were
performed using cells treated transiently with TG
for 10min.
Autophagy induced by ER stress requires PKCθThe requirement for PKC activity in ER
stress-induced autophagy was studied using
specific PKC inhibitors. Go6976 inhibits cPKCs
(IC50=2.3 and 6.2nM for PKCα and PKCβI,
respectively) and Rottlerin inhibits nPKCs
(IC50=3-6µM for PKCδ and PKCθ, 60-80µM for
PKCε). We found that 20µM Rottlerin significantly
blocked formation of LC3-containing dot
structures in response to TG treatment, whereas
1µM Go6976 had no effect (Fig. 3A, B). This
result suggested that PKCδ and/or PKCθ might be
required for ER stress-induced autophagy.
To elucidate whether ER stress-induced
autophagy requires PKCθ, we established stable
clones of hepatocytes that express small interfering
RNAs (siRNA) to knockdown expression of
PKCθ. In order to minimize potential off-target
effects of the siRNA, we targeted two different
regions within PKCθ mRNA. Control cells were
derived that express siRNA specific to green
fluorescence protein (GFP). The expression of
PKCθ mRNA in cells transfected with PKCθ
siRNA was reduced to ~10% of that in cells with
the control GFP siRNA, whereas the expression of
PKCδ mRNA was not changed (data not shown).
Expression of PCKθ protein was reduced
approximately 2- to 3- fold in the PCKθ
knockdown cells (Fig. 3C). Where TG treatment
induced the conversion of LC3-I to LC3-II and
formation of LC3-containing dot structures in cells
that express the control GFP siRNA, these
processes were significantly reduced in cells
expressing either of the PKCθ siRNAs (Fig. 3C, D,
and data not shown). In contrast, knockdown of
PKCθ did not significantly affect UPR activation
monitored by CHOP expression (Fig. 3C). These
observations indicate that PKCθ is required for ER
6
Downloaded from www.jbc.org by on March 24, 2008
ER stress induces Ca2+-dependent phosphorylation
and localization of PKCθ to LC3-containing dot
structures- PKCθ requires phosphorylation within
the activation loop to elicit protein kinase activity
and for proper intracellular localization (48-50).
Immunoblot analysis demonstrated that TG
treatment
specifically
increased
PKCθ
phosphorylation at Thr538 within the activation
loop, whereas phosphorylation observed at known
activating sites in PKCα/βII (Thr638/641), PKCδ
(Thr505) or PKCδ (Ser643) (48,49,51-53) was not
significantly altered (Fig. 4A). Significantly less
PKCθ Thr538 phosphorylation was observed upon
TG treatment of the PKCθ-knockdown cells (Fig.
3C). In addition, Rottlerin treatment significantly
reduced TG-induced formation of LC3-containing
dots structures and also PKCθ Thr538
phosphorylation in immortalized hepatocytes, as
well as in murine embryonic fibroblasts
(Supplemental Fig. S1).
Therefore, the
requirement for PKCθ for TG-induced autophagy
does not appear to be restricted to immortalized
hepatocytes. Finally, transient over-expression of
Thr538Ala mutant PKCθ partially prevented ER
stress-induced formation of LC3-containing dots in
immortalized hepatocytes (Supplemental Fig. S2).
Taken together, these results support the hypothesis
that phosphorylation at Thr538 in PKCθ
contributes to ER stress-induced autophagy.
The
intracellular
localization
of
phosphorylated PKCθ in response to ER stress was
determined by confocal immunofluorescence
microscopy and subcellular fractionation. Upon
TG treatment, phosphorylated PKCθ (Thr538) was
localized to dot structures in the cytoplasm (Fig.
4B). To analyze whether these dot structures may
represent autophagosomes, cells were transiently
transfected with an EGFP-LC3 expression vector
and subsequently treated with TG. The cells were
then fixed analyzed by immunofluorescence for
detection of LC3 and phospho-PKCθ (Thr538).
The
results
demonstrated
that
both
phospho-PKCθand LC3 co-localized with the
EGFP-LC3-containing dot structures in the
cytoplasm (Fig. 4C).
The localization of phosphorylated PKCθ was
also studied by cellular subfractionation. The
majority of phospho-PKCθ (T538) was detected in
UPR signaling is not required for PKCθ
phosphorylation in response to ER stress- Previous
reports have indicated that the IRE1α and
PERK-eIF2α UPR pathways participate in the
regulation of ER stress-induced autophagy. We
have tested the requirements for UPR signaling in
PKCθ activation by analysis of immortalized
hepatocytes that harbor IRE1α deletion, ATF6α
deletion, or Ser51Ala knock-in mutation at the
PERK phosphorylation site in eIF2α. The results
show that ER stress–induced autophagy was
significantly reduced in hepatocytes derived from
Ser51Ala eIF2α knock-in mutant mice, and
partially reduced in hepatocytes lacking IRE1α
(Fig. 8A,B), consistent with previous findings
(18,20). In contrast, ER stress-induced autophagy
was not significantly affected in hepatocytes
deleted in ATF6α (Fig. 8C).
However,
hepatocytes from IRE1α-null or ATF6α-null mice,
as well as hepatocytes from Ser51Ala knock-in
mutant eIF2α mice, all exhibit ER stress-induced
PKCθ phosphorylation.
Therefore, PKCθ
activation does not require signaling through the
IRE1α, ATF6α, or PERK/eIF2α UPR pathways.
PKCθ activation is specifically required for
autophagy in response to ER stress, but not in
response to amino acid starvation- The signaling
pathways that induce autophagy in mammalian
cells have been most extensively characterized by
analysis of the response to nutrition starvation.
During nutrient starvation, mTOR kinase
7
Downloaded from www.jbc.org by on March 24, 2008
phosphorylates ATG13 to form an autophagy
regulatory complex that is essential to initiate the
autophagic response (54,55). Therefore, we
examined the requirement for PKCθ in the
autophagic response to nutrition starvation.
Phosphorylation of PKCθ (Thr538) was not
observed in response to amino acid starvation
conditions that induce autophagy (Fig. 7A). In
addition, the autophagic response to amino acid
starvation was not reduced by siRNA-mediated
knockdown of PKCθ (Fig. 7B, C). A marker for
mTOR kinase activation is phosphorylation of p70
S6 kinase (p70 S6K) at Thr389. In response to
amino acid starvation, p70 S6K was immediately
dephosphorylated within 30min, consistent with
inactivation of mTOR kinase. In contrast, p70
S6K phosphorylation was not reduced upon
treatment with TG (Fig. 7D). These observations
indicate that ER stress-induced autophagy is
executed in an mTOR-independent manner, and
that PKCθ is specifically required for ER
stress-induced autophagy.
the membrane fraction with the ER membrane
marker calnexin (Fig. 4D). Therefore, both the
immunofluorescence
data
and
cellular
subfractionation experiments indicate that ER
stress induces localization of phospho-PKCθ with
LC3-II in dot structures.
Upon treatment with either TG or TM, the
kinetics of PKCθ phosphorylation correlated with
the processing of LC3-I to LC3-II and the
formation of LC3-containing dots (Fig. 5A, B).
However, the conversion of LC3-I to LC3-II,
formation
of
LC3-containing
dots,
and
phosphorylation of PKCθ occurred within 1-2hr
after TG treatment and at 8-12hr after TM
treatment. In contrast, the induction of the UPR,
monitored by Xbp1 mRNA splicing, occurred
within 30min after treatment with either TG or TM
(Fig. 5C). TG induces ER stress through inhibition
of the SERCA ATPase and depletion of ER
lumenal Ca2+ that is required for ER protein
folding and chaperone functions. In contrast, TM
inhibits N-linked glycosylation that interferes with
protein folding, and after prolonged treatment,
induces Ca2+ leak from the ER (30). Therefore, it
is possible that the different kinetics observed for
TG-induced
and
TM-induced
PKCθ
phosphorylation, LC3-II conversion, and LC3 dot
structure formation may be a consequence of
different rates of Ca2+ release from the ER.
To test the requirement for an increase in
cytosolic Ca2+, we studied the effect of the
membrane permeable intracellular Ca2+ chelator
BAPTA-AM. BAPTA-AM treatment prevented
the formation of LC3-containing dot structures
(Fig. 6A), partially inhibited the conversion of
LC3-I to LC3-II (Fig. 6B), and also significantly
reduced PKCθ phosphorylation and localization to
dot structures (Fig. 6B,C) in response to TG
treatment. These observations indicate that Ca2+
leak from the ER is required for PKCθ activation
and localization to dot structures, as well as ER
stress-induced autophagy.
In this study, we demonstrated that protein
kinase C theta (PKCθ) is specifically activated and
required for autophagy in response to ER stress,
but not for autophagy in response to amino acid
starvation. This conclusion is supported by the
following observations: 1) ER stress induced by
TG or TM coordinately induced phosphorylation
of PKCθ within the activation loop at Thr538,
conversion of LC3-I to LC3-II, and formation of
LC3-containing dot structures in the cytoplasm, a
typical marker of autophagy; 2) the nPKC inhibitor
Rottlerin and PKCθ siRNA-mediated knockdown
significantly blocked autophagy in response ER
stress; 3) ER stressed was associated with
localization of phosphorylated PKCθ to
LC3-containing dot structures in the cytoplasm; 4)
an increase in cytosolic Ca2+ was required for ER
stress-induced PKCθ
phosphorylation and
localization to dot structures, as well as for LC3-I
conversion to LC3-II and formation of
LC3-containing dot structures; 5) PKCθ was not
phosphorylated in response to amino acid
starvation; and 6) amino acid starvation-induced
autophagy was not blocked by PKCθ knockdown.
PKCθ was originally identified as an essential
factor for TCR/CD3-induced T cell activation.
During T cell stimulation, PKCθ is activated by
PLCγ1 and IP3-K, which are downstream of
TCR/CD3 and the Src/Syc family of
protein-tyrosine kinases (PTKs). PKCθ regulates
the activation of AP-1, NFκB and CREB to
stimulate IL-2 gene expression (56). However,
very little is known about the role of PKCθ in
other tissues and cell types. PKCθ was reported to
inhibit insulin receptor signaling (57), although
analysis of Pkcθ-/- mice has yielded conflicting
reports on the role of PKCθ in development of
insulin resistance (58,59). Recently, ER stress
was also reported to cause insulin resistance in
liver tissue (60,61). Future studies are required to
determine whether PKCθ activation couples ER
homeostasis with insulin receptor signaling.
The precise mechanism by which PKCθ is
activated in response to ER stress remains
unknown.
Ca2+ chelation by BAPTA-AM
treatment inhibited both PKCθ phosphorylation
and localization to dot structures in the cytosol, as
8
Downloaded from www.jbc.org by on March 24, 2008
well as autophagy in response to ER stress,
suggesting that Ca2+ leak from the stressed ER
plays a fundamental role in PKCθ activation.
Since PKCθ is a PKC isoform that is not directly
regulated by Ca2+, it is likely that Ca2+ plays an
indirect role in PKCθ activation (Fig. 9). In
preliminary studies we found that the
phospholipase C (PLC) inhibitor U73122 partially
inhibited autophagy in response to ER stress (data
not shown). Previously, the expression of a set of
genes was shown to respond to altered ER Ca2+
homeostasis in a PLC-dependent manner (62).
Future studies should determine whether a
Ca2+-dependent PLC pathway activates PKCθ in
response to ER stress.
Our findings support the notion that PKCθ
activation and autophagy in response to ER stress
is independent from the mTOR kinase signal
transduction pathway. This observation conflicts
with recent findings by Hoyer-Hansen et al. that
concluded autophagy in response to TG-treatment
occurs through inactivation of mTOR kinase that is
mediated
by
CaMKKβ/AMPK-dependent
activation of TSC2 (14). It is possible that the
discrepancy results from differences in the
experimental conditions and/or cell types analyzed.
Where Hoyer-Hansen et al. studied the autophagic
response in MCF-7S1 breast carcinoma cells
treated with 100nM TG for 24hr, we analyzed
responses in hepatocytes after a shorter time period
(6-8hr) using 1µM TG. Although we have not
detected expression of PKCθ in MCF7 cells (data
not shown), we have shown that PKCθ
phosphorylation is required for ER stress-induced
autophagy in another cell type, MEFs. Therefore,
we do not believe our findings are restricted to
immortalized hepatocytes. Although we did not
observe dephosphorylation of p70 S6K after 6-8 hr
of TG treatment, we did detect p70 S6K
dephosphorylation after 12-16 hrs in hepatocytes
(data not shown). It is possible that a
PKCθ-dependent pathway is required for
autophagy in response to acute severe ER stress,
whereas an mTOR-dependent pathway is required
for autophagy in response to chronic ER stress,
possibly related to secondary effects of ER stress
on nutrient metabolism.
Recently, ER stress-induced autophagy was
independently reported to require either the
IRE1α/JNK UPR subpathway or the PERK/eIF2α
DISCUSSION
UPR subpathway (18,20). We have observed that
mutation at the PERK phosphorylation site in
eIF2α or deletion of IRE1α did not interfere with
PCKθ phosphorylation, although they did reduce
ER stress-induced autophagy, consistent with
previous findings (18, 20). In addition, both eIF2α
phosphorylation and Xbp1 mRNA splicing were
intact after TG treatment in PKCθ knockdown
cells (data not shown). Therefore, it is unlikely that
PKCθ is required for either IRE1α or PERK
signaling. Finally, deletion of ATF6α did not
reduce ER stress-induced autophagy or PKCθ
activation. Therefore, UPR signaling appears to
be independent of the PKCθ requirement for ER
stress-induced autophagy. Studies are underway
to identify upstream regulators and downstream
targets of PKCθ activation that occur in response
to ER stress.
ACKNOWLEDGEMENTS
of Michigan) for instruction in preparation of murine hepatocyte primary cultures, and Dr. Sung-Hoon
Back (University of Michigan) for assistance in microscopic analysis.
We acknowledge Dr. Tomohiro
Yorimitsu (University of Michigan), Dr. Takashi Ueno (Juntendo University, Japan), and Dr.
Stephan Shaw (National Cancer Institute, Bethesda, MD) for fruitful discussions. We gratefully
acknowledge the staff of the University of Michigan Department of Cell & Developmental Biology
Microscopy and Image-analysis Laboratory (Bruce Donohoe, Dorothy Sorenson, Sasha Meshinchi,
Shelley Almburg, Krystyna Pasyk, and Chris Edwards) for their assistance with sample preparation and
imaging.
We thank members of the Kaufman lab Robert Clark and Dr. Kezhong Zhang for providing
the Ire1α-/- immortalized hepatocytes. We thank Drs. Yuka Eura (National Cardiovascular Center (Osaka,
Japan) and D. Thomas Rutkowski for critical reading of the manuscript.
Portions of this work were
supported by NIH grants RO1-DK042394, RO1-HL052173, and PO1-HL057346.
RJK is an Investigator
of the Howard Hughes Medical Institute.
The abbreviations used are: ER, endoplasmic reticulum; PKC, protein kinase C; LC3, microtubule
binding protein light chain 3; BAPTA, 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid,
tetraacetoxymethyl
ester;
UB,
ubiquitin;
PE,
phosphatidylethanolamine;
MTT
,
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; TOR, target of rapamycin; AMPK,
AMP-activated protein kinase; TSC, Tuberous Sclerosis; RHEB, ras homolog enriched in brain;
CaMKK-beta, Ca2+/calmodulin dependent protein kinase beta; IRE, inositol-requiring protein 1; PERK;
PKR-like ER kinase; ATF, activating transcription factor; Xbp-1, X-box binding protein 1; ERAD, ER
associated protein degradation; UPR, unfolded protein response; C/EBP, CCAAT/enhancer-binding
protein; CHOP, C/EBP homologous protein; JNK, c-Jun N-terminal kinase; 3MA, 3-methyladenine; TG,
thapsigargin; TM, tunicamycin; NaF, sodium fluoride; HRP, horseradish peroxidase; SERCA,
sarcoplasmic/endoplasmic reticulum Ca++ ATPase; PI3-K, phosphatidylinositol 3-kinase; VPS, vacuolar
protein sorting; PLC, phospholipase C; TCR, T-cell receptor; AP-1, activator protein 1; NFκB, nuclear
factor-kappa B; CREB, cAMP response element binding protein; MEF, mouse embryonic fibroblast;
9
Downloaded from www.jbc.org by on March 24, 2008
We thank Dr. Ron Kopito (Stanford University) for providing LC3 antibody, Dr. Alan Cheng (University
eIF2α, eukaryotic translation initiation factor alpha; GFP, green fluorescence protein; TEM, transmission
electron microscopy; FBS, fetal bovine serum; PBS, phosphate buffered saline; SSC, 150mM sodium
chloride/ 15mM sodium citrate; BSA, bovine serum albumin.
Keywords:
Unfolded protein response, LC3, autophagosome, calcium, thapsigargin
Downloaded from www.jbc.org by on March 24, 2008
10
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
11
Downloaded from www.jbc.org by on March 24, 2008
12.
Mizushima, N., and Klionsky, D. J. (2007) Annu Rev Nutr 27,19-40
He, C., and Klionsky, D. J. (2006) ACS Chem Biol 1(4), 211-213
Levine, B., and Kroemer, G. (2008) Cell 132(1), 27-42
Rubinsztein, D. C., Gestwicki, J. E., Murphy, L. O., and Klionsky, D. J. (2007) Nat Rev Drug
Discov 6(4), 304-312
Mizushima, N., Levine, B., Cuervo, A. M., and Klionsky, D. J. (2008) Nature 451(7182),
1069-1075
Codogno, P., and Meijer, A. J. (2005) Cell Death Differ 12 Suppl 2, 1509-1518
Klionsky, D. J., Cregg, J. M., Dunn, W. A., Jr., Emr, S. D., Sakai, Y., Sandoval, I. V., Sibirny, A.,
Subramani, S., Thumm, M., Veenhuis, M., and Ohsumi, Y. (2003) Dev Cell 5(4), 539-545
Dann, S. G., Selvaraj, A., and Thomas, G. (2007) Trends Mol Med 13(6), 252-259
Sarbassov, D. D., Ali, S. M., and Sabatini, D. M. (2005) Curr Opin Cell Biol 17(6), 596-603
Hawley, S. A., Pan, D. A., Mustard, K. J., Ross, L., Bain, J., Edelman, A. M., Frenguelli, B. G.,
and Hardie, D. G. (2005) Cell Metab 2(1), 9-19
Shaw, R. J., Bardeesy, N., Manning, B. D., Lopez, L., Kosmatka, M., DePinho, R. A., and Cantley,
L. C. (2004) Cancer Cell 6(1), 91-99
Shaw, R. J., Kosmatka, M., Bardeesy, N., Hurley, R. L., Witters, L. A., DePinho, R. A., and
Cantley, L. C. (2004) Proc Natl Acad Sci U S A 101(10), 3329-3335
Woods, A., Dickerson, K., Heath, R., Hong, S. P., Momcilovic, M., Johnstone, S. R., Carlson, M.,
and Carling, D. (2005) Cell Metab 2(1), 21-33
Hoyer-Hansen, M., Bastholm, L., Szyniarowski, P., Campanella, M., Szabadkai, G., Farkas, T.,
Bianchi, K., Fehrenbacher, N., Elling, F., Rizzuto, R., Mathiasen, I. S., and Jaattela, M. (2007)
Mol Cell 25(2), 193-205
Ferrari, D., Pinton, P., Szabadkai, G., Chami, M., Campanella, M., Pozzan, T., and Rizzuto, R.
(2002) Cell Calcium 32(5-6), 413-420
Oakes, S. A., Lin, S. S., and Bassik, M. C. (2006) Curr Mol Med 6(1), 99-109
Bernales, S., McDonald, K. L., and Walter, P. (2006) PLoS Biol 4(12), e423
Ogata, M., Hino, S., Saito, A., Morikawa, K., Kondo, S., Kanemoto, S., Murakami, T., Taniguchi,
M., Tanii, I., Yoshinaga, K., Shiosaka, S., Hammarback, J. A., Urano, F., and Imaizumi, K. (2006)
Mol Cell Biol 26(24), 9220-9231
Yorimitsu, T., Nair, U., Yang, Z., and Klionsky, D. J. (2006) J Biol Chem 281(40), 30299-30304
Kouroku, Y., Fujita, E., Tanida, I., Ueno, T., Isoai, A., Kumagai, H., Ogawa, S., Kaufman, R. J.,
Kominami, E., and Momoi, T. (2007) Cell Death Differ 14(2), 230-239
Ron, D., and Walter, P. (2007) Nat Rev Mol Cell Biol 8(7), 519-529
Schroder, M., and Kaufman, R. J. (2006) Curr Mol Med 6(1), 5-36
Ma, Y., Brewer, J. W., Diehl, J. A., and Hendershot, L. M. (2002) J Mol Biol 318(5), 1351-1365
Wu, J., Rutkowski, D. T., Dubois, M., Swathirajan, J., Saunders, T., Wang, J., Song, B., Yau, G. D.,
and Kaufman, R. J. (2007) Dev Cell 13(3), 351-364
Yamamoto, K., Sato, T., Matsui, T., Sato, M., Okada, T., Yoshida, H., Harada, A., and Mori, K.
(2007) Dev Cell 13(3), 365-376
Marciniak, S. J., Yun, C. Y., Oyadomari, S., Novoa, I., Zhang, Y., Jungreis, R., Nagata, K.,
Harding, H. P., and Ron, D. (2004) Genes Dev 18(24), 3066-3077
Urano, F., Wang, X., Bertolotti, A., Zhang, Y., Chung, P., Harding, H. P., and Ron, D. (2000)
Science 287(5453), 664-666
Nishitoh, H., Matsuzawa, A., Tobiume, K., Saegusa, K., Takeda, K., Inoue, K., Hori, S., Kakizuka,
A., and Ichijo, H. (2002) Genes Dev 16(11), 1345-1355
Hetz, C., Bernasconi, P., Fisher, J., Lee, A. H., Bassik, M. C., Antonsson, B., Brandt, G. S.,
Iwakoshi, N. N., Schinzel, A., Glimcher, L. H., and Korsmeyer, S. J. (2006) Science 312(5773),
572-576
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
12
Downloaded from www.jbc.org by on March 24, 2008
41.
Deniaud, A., Sharaf El Dein, O., Maillier, E., Poncet, D., Kroemer, G., Lemaire, C., and Brenner,
C. (2007) Oncogene 27(3), 285-299
Criollo, A., Vicencio, J. M., Tasdemir, E., Maiuri, M. C., Lavandero, S., and Kroemer, G. (2007)
Autophagy 3(4), 350-353
Yorimitsu, T., and Klionsky, D. J. (2007) Autophagy 3(2), 160-162
Gutcher, I., Webb, P. R., and Anderson, N. G. (2003) Cell Mol Life Sci 60(6), 1061-1070
Sousa, M., Barros, A., and Tesarik, J. (1996) Mol Hum Reprod 2(12), 967-977
Altman, A., and Villalba, M. (2003) Immunol Rev 192, 53-63
Baier, G. (2003) Immunol Rev 192, 64-79
Klarl, B. A., Lang, P. A., Kempe, D. S., Niemoeller, O. M., Akel, A., Sobiesiak, M., Eisele, K.,
Podolski, M., Huber, S. M., Wieder, T., and Lang, F. (2006) Am J Physiol Cell Physiol 290(1),
C244-253
Akar, U., Ozpolat, B., Mehta, K., Fok, J., Kondo, Y., and Lopez-Berestein, G. (2007) Mol Cancer
Res 5(3), 241-249
Fujita, M., Sugama, S., Nakai, M., Takenouchi, T., Wei, J., Urano, T., Inoue, S., and Hashimoto,
M. (2007) J Biol Chem 282(8), 5736-5748
Lee, W., Kim, D. H., Boo, J. H., Kim, Y. H., Park, I. S., and Mook-Jung, I. (2005) Apoptosis
10(2), 407-415
Nagai, K., Chiba, A., Nishino, T., Kubota, T., and Kawagishi, H. (2006) J Nutr Biochem 17(8),
525-530
Liu, W. S., and Heckman, C. A. (1998) Cell Signal 10(8), 529-542
Valverde, A. M., Burks, D. J., Fabregat, I., Fisher, T. L., Carretero, J., White, M. F., and Benito, M.
(2003) Diabetes 52(9), 2239-2248
Berry, M. N., Edwards, A.M., Barritt, G.J. (1991) ISOLATED HEPATOCYTES Preparation,
Properties and Applications Elsevier
Tanida, I., Ueno, T., and Kominami, E. (2004) Int J Biochem Cell Biol 36(12), 2503-2518
Rutkowski, D. T., Arnold, S. M., Miller, C. N., Wu, J., Li, J., Gunnison, K. M., Mori, K., Sadighi
Akha, A. A., Raden, D., and Kaufman, R. J. (2006) PLoS Biol 4(11), e374
Bernales, S., Schuck, S., and Walter, P. (2007) Autophagy 3(3), 285-287
Liu, Y., Graham, C., Li, A., Fisher, R. J., and Shaw, S. (2002) Biochem J 361(Pt 2), 255-265
Parekh, D. B., Ziegler, W., and Parker, P. J. (2000) Embo J 19(4), 496-503
Sparatore, B., Passalacqua, M., Pedrazzi, M., Ledda, S., Patrone, M., Gaggero, D., Pontremoli, S.,
and Melloni, E. (2003) FEBS Lett 554(1-2), 35-40
Kitatani, K., Idkowiak-Baldys, J., and Hannun, Y. A. (2007) J Biol Chem 282(28), 20647-56
Dutil, E. M., Toker, A., and Newton, A. C. (1998) Curr Biol 8(25), 1366-1375
Choi, E. Y., Lee, S., Oh, H. M., Kim, Y. D., Choi, E. J., Kim, S. H., Kim, S. W., Choi, S. C., and
Jun, C. D. (2007) Life Sci 80(5), 436-445
Inoki, K., Ouyang, H., Li, Y., and Guan, K. L. (2005) Microbiol Mol Biol Rev 69(1), 79-100
Yorimitsu, T., and Klionsky, D. J. (2005) Cell Death Differ 12 Suppl 2, 1542-1552
Altman, A., and Villalba, M. (2002) J Biochem (Tokyo) 132(6), 841-846
Haasch, D., Berg, C., Clampit, J. E., Pederson, T., Frost, L., Kroeger, P., and Rondinone, C. M.
(2006) Biochem Biophys Res Commun 343(2), 361-368
Gao, Z., Wang, Z., Zhang, X., Butler, A. A., Zuberi, A., Gawronska-Kozak, B., Lefevre, M., York,
D., Ravussin, E., Berthoud, H. R., McGuinness, O., Cefalu, W. T., and Ye, J. (2007) Am J Physiol
Endocrinol Metab 292(1), E84-91
Kim, J. K., Fillmore, J. J., Sunshine, M. J., Albrecht, B., Higashimori, T., Kim, D. W., Liu, Z. X.,
Soos, T. J., Cline, G. W., O'Brien, W. R., Littman, D. R., and Shulman, G. I. (2004) J Clin Invest
114(6), 823-827
Nakatani, Y., Kaneto, H., Kawamori, D., Yoshiuchi, K., Hatazaki, M., Matsuoka, T. A., Ozawa, K.,
Ogawa, S., Hori, M., Yamasaki, Y., and Matsuhisa, M. (2005) J Biol Chem 280(1), 847-851
Ozcan, U., Cao, Q., Yilmaz, E., Lee, A. H., Iwakoshi, N. N., Ozdelen, E., Tuncman, G., Gorgun,
62.
C., Glimcher, L. H., and Hotamisligil, G. S. (2004) Science 306(5695), 457-461
Liang, S. H., Zhang, W., McGrath, B. C., Zhang, P., and Cavener, D. R. (2006) Biochem J 393(Pt
1), 201-209
Downloaded from www.jbc.org by on March 24, 2008
13
FIGURE LEGENDS
Figure 1. ER stress induces autophagy in immortalized hepatocytes.
Immortalized hepatocytes were treated with TG (1µM) in the presence or absence of 3MA (5mM) for 8hr
and analyzed for LC3-II production (A) and LC3-containing dot structures (B). (C) The results from B
were quantified by counting the number of cells with LC3 dots relative to the total number of observed
cells. The number of LC3-containing dot structures observed in response to amino acid starvation for
90min in the presence or absence of 3MA (5mM) was quantified as described in Experimental Procedures.
(D) TEM micrographs of control and TG-treated immortalized hepatocytes are shown. Compared to the
ER observed in untreated cells (a. arrows), the ER in cells treated with TG (1µM for 8hr) had greater
electron density (b. arrows). Autophagosomes were frequently observed in the TG-treated cells (b-d.
arrow heads). Vacuoles with fragments of ER were also observed only in the TG-treated cells (e-f).
Figure 3. nPKC is required for autophagy in response to ER stress.
Immortalized hepatocytes were treated transiently with TG (1µM for 10min) and then incubated in
complete M199 medium lacking TG for 6hr. Where indicated, either Go6976 (1µM) or Rottlerin
(20µM) were present during the timecourse of the experiment as described in Experimental Procedures.
(A,B) After 6hr, the cells were stained with anti-LC3 antibody for analysis by immunofluorescence
microscopy and dot structures were quantified. (C) Immortalized hepatocytes that express the indicated
siRNAs were treated transiently with TG for 10min and propagated 6hr in complete medium lacking TG
for western blot analysis to monitor LC3 conversion, total PKCθ, and phosphorylated (Thr538) PKCθ,
PKCδ and CHOP as described in Experimental Procedures. (D) LC3 immunofluorescence was performed
to analyze and quantify LC3-containing dots.
Figure 4. PKCθ is required for autophagy induction in response to ER stress.
Immortalized hepatocytes were subjected to 10min transient TG (1µM) treatment and then incubated for
2hr or 6hr in complete medium. Immunoblotting was performed to detect phosphorylated PKCθ, PKCδ
and PKCα/βI (A) and immunofluorescence was performed to localize phosphorylated PKCθ (B). (C)
Immortalized hepatocytes were transiently transfected with an EGFP-LC3 expression vector and
subsequently treated with TG for 8hr. The cells were stained with primary antibody against LC3 or
phospho-PKCθ (Thr539) and then anti-rabbit IgG conjugated with Rhodamine as a secondary antibody.
(D) Immortalized hepatocytes were treated with TG for 6hr and then harvested for subcellular
fractionation. Membrane and cytosolic fractions were subjected to western blot analysis to detect LC3-II,
phospho-PKCθ (Thr538), calnexin (membrane marker) and ERK1/2 kinase (cytosolic marker).
Figure 5. PKCθ activation coincides with ER stress-induced autophagy.
The kinetics of PKCθ phosphorylation and conversion of LC3-I to LC3-II were monitored in
14
Downloaded from www.jbc.org by on March 24, 2008
Figure 2. ER stress-induced autophagy is required for survival.
(A) Immortalized hepatocytes were treated with TG (12.5nM) or TM (250ng/ml) for 24hr or 43hr,
respectively, and survival was measured by MTT assay. Results are normalized to untreated cells. (B-E)
Cells were treated with TG (1µM) either transiently for 10min (B-E) with a 3hr (B) or 6hr recovery time
in media lacking TG, or continuously in media containing TG for 3hr (B) or 6hr. (B) Cell viability was
measured by MTT assay. (C) Total RNA was prepared for analysis by RT-PCR for Xbp1 mRNA splicing
and rotein extracts were analyzed by western immunoblot for CHOP and α-actin as a loading control.
(D,E) Cells were analyzed by immunofluorescence using anti-LC3 antibody and dot structures were
quantified. For panel E, cells were also treated transiently with TG for 3min and allowed to recover in
media lacking TG for 6hr.
immortalized hepatocytes treated continuously for increasing periods of time with TG (1µM) or TM
(10µg/ml). (A) Cell extracts were prepared for western blot analysis for LC3-I and LC3-II, and total vs
phosphorylated PKCθ. (B) Cells were prepared for immunofluorescence analysis for LC3 and dot
structures were quantified. (C) In parallel, UPR induction was monitored by analysis of Xbp1 mRNA
splicing as described in Experimental Procedures.
Figure 6. Calcium mediates PKCθ activation and autophagy in response to ER stress.
Cells were treated continuously with TG (1µM) in the presence or absence of BAPTA-AM (20µM) for
6hr (A & B) or 8hr (C). (A) Cells were analyzed by immunofluorescence for LC3 and dot structures
were quantified. (B) Western blot analysis was performed for total PKCθ, phosphorylated PKCθ, and
LC3. (C) Cells were analyzed by immunofluorescence for LC3 as described in Experimental
Procedures.
Figure 8. PKCθ-mediated autophagy does not require UPR signaling.
Ire1α-/- (A), S51A eIF2α (B) and Atf6-/- (C) mutant immortalized hepatocytes and their respective
litter-matched control wild-type cells were subject to transient TG treatment (1µM 10min) and cultured in
TG-free medium for the indicated periods. Cells lysates were prepared and analyzed by western blotting
with PKCθ, phospho-PKCθ (Thr538) and LC3 antibodies (upper panels). In parallel, immunostaining was
performed to quantify the percentage of cells containing LC3 dots (lower panels).
Figure 9. Model depicting the role of PKCθ in ER stress-induced autophagy.
Disruption of ER homeostasis results in Ca2+ leak into the cytosol. The increase in cytosolic Ca2+ induces
phosphorylation within the activation-loop of PKCθ. PKCθ phosphorylation is inhibited by BAPTA-AM.
Phosphorylated PKCθ translocates with LC3 to dot structures in the cytoplasm. PKCθ is required for ER
stress-induced LC3-conversion and autophagy.
15
Downloaded from www.jbc.org by on March 24, 2008
Figure 7. PKCθ is not required for autophagy in response to amino acid starvation.
Cells were subjected to transient 10min treatment with TG (1µM) and then incubated for increasing
periods of time in complete medium. In parallel, cells were deprived of amino acids as described in
Experimental Procedures. (A) Phosphorylation of PKCθ (Thr538) was monitored by western blot analysis.
(B,C) Autophagy in control GFP- and PKCθ- knockdown cells was analyzed by immunofluorescence
microscopy for LC3 and quantification. (D) Cells were treated as above with TG or by amino acid
deprivation for the indicated times. Cell extracts were prepared for western blot analysis to detect
phosphorylation of p70 S6 kinase (Thr389).