NEUROPLASTICITY OF MICTURITION REFLEX PATHWAYS WITH
CYCLOPHOSPHAMIDE-INDUCED CYSTITIS
A Dissertation Presented
by
Mary Beth Klinger
to
The Faculty of the Graduate College
of
The University of Vermont
In Partial Fulfillment of the Requirements
for the Degree of Doctor of Philosophy
Specializing in Anatomy and Neurobiology
October, 2008
Accepted by the Faculty of the Graduate College, The University of Vermont, in
partial fulfillment of the requirements for the degree of Doctor of Philosophy,
specializing in Anatomy and Neurobiology.
Dissertation Examination Committee:
Advisor
~ a > ~ dA.e vt i z a r d &.D.
awe, Ph.D.
r
;
;
2'':l'"X
ChailpersOn
Mark T. Nelson, Ph.D.
Vice President for Research
and Dean of Graduate Studies
Date: July 14,2008
Abstract
Micturition requires the precise reciprocal function of the urinary bladder and
urethral outlet. Perhaps due to this degree of precision, micturition is prone to
dysfunction with injury or disease. One such disease, interstitial cystitis (IC)/painful
bladder syndrome (PBS), is characterized by urinary urgency, frequency and pelvic pain.
Inflammation has been implicated as a factor in IC/PBS. The overall hypothesis of this
project is that urinary bladder inflammation induces expression of inflammatory
mediators and changes neurotrophin receptor expression that contribute to functional
changes in the urinary bladder. Using a well-characterized rat model of
cyclophosphamide (CYP)-induced urinary bladder inflammation, the expression and
function of cyclooxygenase-2 (COX-2), a known inflammatory enzyme, and the p75
neurotrophin receptor (p75NTR), involved in neurotrophin signaling, were examined in
micturition reflex pathways using neuroanatomical, biochemical, molecular and
physiological techniques.
Although COX-2 expression is increased in urinary bladder and involved in
bladder hyperreflexia after CYP-induced cystitis, the localization and time course of
upregulation was not known. We hypothesized increased COX-2 expression in specific
tissue compartments (urothelium or smooth muscle) of the urinary bladder with CYPinduced inflammation. Western blotting for COX-2 showed a significant increase in
COX-2 expression in both detrusor and urothelium/suburothelium, with the greatest
increase in the urothelium/suburothelium. Immunostaining showed increased COX-2
staining in suburothelium with cystitis, co-localized with CD86, a marker for dendritic
cells and macrophages.
Nerve growth factor (NGF) has been implicated in inflammation, increased
voiding frequency and altered sensation in urinary bladder. The specific NGF tyrosine
kinase receptor, TrkA, is increased in bladder afferent cells with CYP. NGF also binds
p75NTR. The second goals were to examine the expression and functional role of p75NTR
in urinary bladder pathways in control and CYP-treated rats. We hypothesized that
p75NTR is constitutively expressed in micturition pathways and upregulated with cystitis.
With cystitis, p75NTR expression was increased in lumbosacral spinal cord and in bladder
afferent cells in dorsal root ganglia. Western blotting for p75NTR showed increased
expression in whole urinary bladder with cystitis. Based on bladder function effects of
TrkA blockade with cystitis, we hypothesized that p75NTR blockade in the urinary bladder
would also decrease bladder hyperreflexia with cystitis. The functional role of p75NTR
was studied by intravesical blockade by immunoneutralization with a monoclonal
antibody to p75NTR and by PD90780, known to block NGF-p75NTR binding. Both forms
of p75NTR blockade significantly decreased bladder capacity in control and CYP-treated
rats. Changes in micturition and threshold pressure, and non-voiding contractions were
also demonstrated.
In conclusion, these dissertation studies demonstrate that CYP-induced bladder
inflammation alters expression of inflammatory mediators and neurotrophin receptors in
micturition pathways. This altered expression can affect overall urinary bladder
function.
Citations
Material from this dissertation has been published in the following form:
Klinger, M.B., A. Dattilio, M.A. Vizzard. (2007). Expression of cyclooxygenase-2 in
urinary bladder in rats with cyclophosphamide-induced cystitis. American Journal of
Physiology: Regulatory, Integrative and Comparative Physiology, 293: R677-R685.
Klinger, M.B., B. Girard, M.A. Vizzard. (2008). p75NTR expression in rat urinary
bladder sensory neurons and spinal cord with cyclophosphamide-induced cystitis. The
Journal of Comparative Neurology, 507: 1379-1392.
ii
Dedication
A dedication to my parents,
my foundation and inspiration.
iii
Acknowledgements
The past five years have been filled with an incredible amount of learning and
wonderful experiences, and I have many people to thank. I would like to first thank Dr.
Margaret Vizzard, for all of the guidance, support and time that she has put into my
graduate training; she is a fantastic role model and mentor. The experience of being a
part of the Vizzard lab is one that I will never forget. I would like to thank all past and
present members of the Vizzard laboratory, especially Susan Malley, Abbey Dattilio, and
Kimberly Corrow for all of the laboratory techniques they have taught me over the years
and for always being there to provide a helping hand.
I would also like to thank my dissertation committee, Dr. Mark Nelson, Dr.
Cynthia Forehand, and Dr. Gary Mawe for offering so much of their time and helpful
suggestions. The University of Vermont Department of Anatomy and Neurobiology has
been a fantastic environment in which to do my graduate work, with innumerable
admirable people always ready with advice and support. I hope to always be among such
brilliant and thoughtful people throughout my career.
I have made many friends while here in Vermont who have helped to make this
journey that much easier and more fun. There are too many to name individually,
although I would like to and I thank you all. A special thank you to Dr. Julie Simpson,
Dr. Martin Hruska, and Dr. Eric Krauter, who inspired me as I watched them finish
graduate school and who were always there to help me throughout my own graduate
school journey. Also a special thank you to Ryan Lawrence, who has shown me constant
support, patience, and understanding throughout the past four years.
Finally, I am forever grateful to my parents Mark and Mary Klinger and to my
brother John for always knowing what to say to me when I felt down, and who have
always made me feel that I can accomplish absolutely anything.
iv
Table of Contents
CITATIONS ................................................................................................................................................. ii
DEDICATION............................................................................................................................................. iii
ACKNOWLEDGEMENTS.........................................................................................................................iv
LIST OF FIGURES .................................................................................................................................. viii
LIST OF TABLES ........................................................................................................................................x
CHAPTER 1: COMPREHENSIVE LITERATURE REVIEW................................................................1
I. INTRODUCTION ........................................................................................................................................1
II. ANATOMY AND FUNCTION OF THE LOWER URINARY TRACT ..................................................................3
A. Lower Urinary Tract Anatomy ..........................................................................................................3
B. Micturition Reflex..............................................................................................................................6
C. Urinary Bladder Innervation ..........................................................................................................11
III. BLADDER INFLAMMATION AND ASSOCIATED CHANGES......................................................................16
A. Cyclophosphamide (CYP) Cystitis ..................................................................................................16
B. CYP-induced cystitis: Changes in the micturition reflex pathway ..................................................19
C. How CYP cystitis can relate to human conditions ..........................................................................22
IV. CYCLOOXYGENASE-2 (COX-2) AND INFLAMMATION .........................................................................25
A. General Background .......................................................................................................................25
B. COX-2 and urinary bladder inflammation .....................................................................................29
V. NERVE GROWTH FACTOR (NGF) AND THE P75 NEUROTROPHIN RECEPTOR (P75NTR)............................31
A. NGF.................................................................................................................................................31
B. Receptor tyrosine kinase A (TrkA)...................................................................................................36
C. p75NTR ..............................................................................................................................................39
VI. PROJECT AIMS AND HYPOTHESES.........................................................................................................47
REFERENCES FOR COMPREHENSIVE LITERATURE REVIEW ........................................................................50
CHAPTER 2: EXPRESSION OF CYCLOOXYGENASE-2 IN URINARY BLADDER IN RATS
WITH CYCLOPHOSPHAMIDE-INDUCED CYSTITIS.......................................................................68
ABSTRACT .................................................................................................................................................69
INTRODUCTION..........................................................................................................................................70
MATERIALS AND METHODS ......................................................................................................................73
v
RESULTS....................................................................................................................................................80
DISCUSSION...............................................................................................................................................83
GRANTS.....................................................................................................................................................90
FIGURES ....................................................................................................................................................91
REFERENCES .............................................................................................................................................97
CHAPTER 3: P75NTR EXPRESSION IN RAT URINARY BLADDER SENSORY NEURONS AND
SPINAL CORD WITH CYCLOPHOSPHAMIDE-INDUCED CYSTITIS.........................................104
ABSTRACT ...............................................................................................................................................105
INTRODUCTION........................................................................................................................................106
MATERIALS AND METHODS ....................................................................................................................108
RESULTS..................................................................................................................................................120
DISCUSSION.............................................................................................................................................124
FIGURES ..................................................................................................................................................133
LITERATURE CITED .................................................................................................................................141
CHAPTER 4: THE ROLE OF P75NTR IN FEMALE RAT URINARY BLADDER WITH
CYCLOPHOSPHAMIDE (CYP)-INDUCED CYSTITIS .....................................................................152
ABSTRACT ...............................................................................................................................................153
INTRODUCTION........................................................................................................................................154
MATERIALS AND METHODS ....................................................................................................................157
RESULTS..................................................................................................................................................166
DISCUSSION.............................................................................................................................................170
ACKNOWLEDGEMENTS ............................................................................................................................180
FIGURES ..................................................................................................................................................183
REFERENCES ...........................................................................................................................................191
CHAPTER 5: SUMMARY AND CONCLUSIONS ...............................................................................204
FUTURE DIRECTIONS ...............................................................................................................................209
COMPREHENSIVE BIBLIOGRAPHY.................................................................................................213
vi
APPENDIX A: FUNCTIONAL AND SENSORY CHANGES IN P75NTR-/- MICE............................245
INTRODUCTION........................................................................................................................................246
MATERIALS AND METHODS ....................................................................................................................247
RESULTS..................................................................................................................................................249
FIGURES ..................................................................................................................................................251
DISCUSSION.............................................................................................................................................256
REFERENCES ...........................................................................................................................................258
vii
List of Figures
CHAPTER 1
FIGURE 1: BASIC BLADDER ANATOMY AND THE SUBUROTHELIAL PLEXUS. ......................................................4
FIGURE 2: IMPORTANT PARAMETERS OF CYSTOMETRY ..................................................................................10
FIGURE 3: NEURAL CIRCUITRY INVOLVED IN THE MICTURITION REFLEX........................................................14
FIGURE 4: THE PRODUCTION OF PROSTAGLANDINS FROM ARACHIDONIC ACID...............................................26
FIGURE 5: THE CYCLOOXYGENASE CONCEPT. ................................................................................................27
FIGURE 6: NEUROTROPHINS AND THEIR RECEPTORS. .....................................................................................36
Chapter 2
FIGURE 1: WESTERN BLOT IN DETRUSOR AND UROTHELIUM/SUBUROTHELIUM ..............................................91
FIGURE 2: COX-2 EXPRESSION IN URINARY BLADDER SECTIONS ...................................................................92
FIGURE 3: COX-2-IR NERVE FIBERS IN SUBUROTHELIAL PLEXUS ..................................................................93
FIGURE 4: COX-2 AND PGP9.5 EXPRESSION IN URINARY BLADDER WHOLE MOUNTS ....................................94
FIGURE 5: WHOLE MOUNT PREPARATION OF URINARY BLADDER...................................................................95
Chapter 3
FIGURE 1: P75NTREXONIII-/- MICE ......................................................................................................................133
FIGURE 2: P75NTR -IR IN LUMBOSACRAL SPINAL CORD .................................................................................134
FIGURE 3: P75NTR-IR CELLS IN THE LUMBOSACRAL DORSAL ROOT GANGLIA ...............................................135
FIGURE 4: NUMBERS OF P75NTR-IR CELLS IN THE LUMBOSACRAL DORSAL ROOT GANGLIA ..........................136
FIGURE 5: PERICELLULAR P75NTR-IR IN DRG FROM CONTROL AND CYP-TREATED RATS. ..........................137
FIGURE 6: P75NTR –IR IN BLADDER AFFERENT CELLS IN LUMBOSACRAL DORSAL ROOT GANGLION .............138
FIGURE 7: P75NTR MRNA IN L6-S1 DRG .....................................................................................................139
viii
Chapter 4
FIGURE 1: URINARY BLADDER WHOLE-MOUNT PREPARATIONS ...................................................................183
FIGURE 2: WESTERN BLOT FOR P75NTR EXPRESSION IN WHOLE URINARY BLADDER ....................................184
FIGURE 3: INTRAVESICAL INFUSION OF ANTI-P75NTR MONOCLONAL ANTIBODY ..........................................185
FIGURE 4: VOIDING FREQUENCY AND INTER-CONTRACTION INTERVAL........................................................186
FIGURE 5: INTRAVESICAL INFUSION OF ANTI- P75NTR MONOCLONAL ANTIBODY (100 µG/ML) .....................186
FIGURE 6: INTRAVESICAL INFUSION OF PD90780........................................................................................188
FIGURE 7: VOIDING FREQUENCY AND INTER-CONTRACTION INTERVAL IN CONTROL RATS ..........................189
FIGURE 8: VOIDING FREQUENCY AND INTER-CONTRACTION INTERVAL IN CYP-TREATED RATS .................190
Chapter 5
FIGURE 1: P75NTR BLOCKADE LEADS TO INCREASED BLADDER ACTIVITY ....................................................208
Appendix A
FIGURE 1: GENOTYPING OF P75NTREXONIII NULL MICE, WILDTYPE AND HETEROZYGOUS P75NTREXONIII MICE ....251
FIGURE 2: CYSTOMETRY IN P75NTREXONIII NULL MICE ....................................................................................252
FIGURE 3: TYROSINE HYDROXYLASE (TH) EXPRESSION IN P75NTREXONIII NULL MICE .....................................253
FIGURE 4: VASOACTIVE INTESTINAL POLYPEPTIDE (VIP) EXPRESSION IN P75NTREXONIII NULL MICE ..............254
FIGURE 5: CALCITONIN GENE-RELATED PEPTIDE (CGRP) EXPRESSION IN P75NTREXONIII NULL MICE ..............255
ix
List of Tables
CHAPTER 2
TABLE 1: PRIMARY AND SECONDARY ANTIBODIES USED, SOURCES AND APPLICATIONS ................................96
TABLE 2: EXPERIMENTS OF URINARY BLADDER SECTIONS OR WHOLE MOUNT PREPARATIONS .......................96
CHAPTER 3
TABLE 1: OLIGONUCLEOTIDE PRIMER SEQUENCES FOR P75NTR AND THE HOUSEKEEPING GENE, L32.........140
Chapter 4
TABLE 1: EFFECTS OF INTRAVESICAL INFUSION OF AN ANTI-P75NTR MONOCLONAL ANTIBODY ON
CYSTOMETRIC PARAMETERS. ..............................................................................................................181
TABLE 2: EFFECTS OF INTRAVESICAL INFUSION OF PD90780 ON CYSTOMETRIC PARAMETERS....................182
x
Chapter 1: Comprehensive Literature Review
I. Introduction
Micturition is an important process requiring complex neuronal organization that
involves the storage and periodic elimination of urine. Micturition is highly regulated
and involves peripheral and central innervation and pathways that are prone to injury and
disease. While much is now understood of normal micturition reflex circuitry, there is
much less information available about how the micturition reflex changes with injury or
disease. Bladder outlet obstruction, multiple sclerosis, Parkinson’s disease, overactive
bladder, spinal cord injury, and interstitial cystitis/painful bladder syndrome (IC/PBS) are
all conditions that affect the organized processes of bladder storage and efficient
elimination. Thus, neural injury or disease can affect the lower urinary tract and result in
pain, hyperreflexia, incontinence, or even bladder underactivity, which can severely
affect the quality of life of those affected (Michael et al., 2000).
IC/PBS is a syndrome characterized by urgency, frequency and pelvic pain
including pain at low to moderate bladder pressure. The cause of IC/PBS is unknown,
although many theories of etiology exist, including toxic agents in the urine, autoimmune
disorder, deficiency in the bladder wall, urothelial cell deficiency, pelvic floor injury, and
neurogenic causes (Erickson, 1999). Whatever the cause, inflammation of the bladder
has been implicated as a factor in IC/PBS; most patients with IC/PBS often show some
degree of inflammation, as evidence by the infiltration of inflammatory cells and
mediators in the bladder (Erickson, 1999). Chronic tissue inflammation can lead to
1
neuroplasticity, involving the sensitization of primary afferents or changes in central
synapses, resulting in hyperalgesia and allodynia (Cheppudira, 2006; Thompson et al.,
1995; Yoshimura and de Groat, 1999). In bladder, this could translate to uncomfortable
sensation/pain and increased frequency of elimination. It has already been shown that
bladder inflammation results in a multitude of effects centrally and peripherally,
including changes in neurochemistry, neurotrophin expression, prostaglandin expression,
electrophysiology of bladder afferents, and the re-organization of micturition reflex
pathways, among many others (Hu et al., 2003; Vizzard, 2000b; 2001; Yoshimura and de
Groat, 1999). The overall goal of this project was to further understand and characterize
the changes associated with bladder inflammation and specifically, the role that both
cyclooxygenase-2 (COX-2) and the neurotrophin receptor p75Neurotrophin receptor (NTR) play.
This project focused on COX-2 and p75NTR in micturition reflex pathways as well as the
role of p75NTR in bladder function.
2
II. Anatomy and Function of the Lower Urinary Tract
A. Lower Urinary Tract Anatomy
The lower urinary tract is made up of the urinary bladder and urethra (Figure 1).
The urinary bladder is divided into two main parts. Most superiorly, the body of the
bladder is located above the ureteral orifices. The bladder base consists of the trigone,
urethrovesical junction (bladder neck) and anterior bladder wall (Andersson and Arner,
2004; Elbadawi, 1996). The trigone is the area of bladder bounded by the ureteral
orifices and the urethrovesical junction.
The wall of the urinary bladder is organized in layers (Figure 1), with the
urothelium as the closest layer to the bladder lumen. Below the urothelium is the lamina
propria layer, which contains the suburothelial plexus of nerves (containing mostly
afferent nerves) and blood vessels (Andersson and Arner, 2004). The outermost layer of
the bladder is the detrusor smooth muscle, which consists of circular as well as
longitudinal smooth muscle layers. The urethra is also surrounded by smooth muscle,
although this is structurally and functionally different than bladder smooth muscle
(Andersson and Arner, 2004). There is an internal urethral sphincter that is under
involuntary control at the inferior end of the bladder and the superior end of the urethra
(Elbadawi, 1996). The external urethral sphincter is made of striated muscle to allow for
conscious control of bladder function and this is located inferior to the prostate in males
and at the inferior end of the urethra in females (Andersson and Arner, 2004).
3
B
Suburothelial plexus
C
AA
D
PGP 9.5
Figure 1: Basic bladder anatomy and the suburothelial plexus.
(A) Basic bladder anatomy includes the dome as the most superior part of the bladder. The body
is the part of the bladder located above the ureteral orifices. The neck is the base of the bladder.
The urethral outlet allows for the release of urine. (B) The bladder wall consists of urothelial
cells closest to the bladder lumen. The lamina propria layer is underneath the urothelium and it
contains the suburothelial plexus of nerves and blood vessels. The smooth muscle layer is the
furthest from the bladder lumen and contains longitudinal as well as circular muscle. (C)
Example of a urinary bladder taken from a female rat. The bladder is pinned out on Sylgard, and
detrusor (yellow arrows) is carefully separated from the inner urothelial layer (red arrows). The
suburothelial plexus comes off attached to the urothelial layer (Zvarova et al., 2004). (D)
Staining in the suburothelial plexus for PGP9.5, a neuronal marker. The suburothelial plexus
contains most of the afferent nerves in the urinary bladder.
4
The urothelium has three basic layers of cells: a basal cell layer with a basement
membrane underneath, an intermediate layer of cells, and a layer of transitional
epithelium made of hexagonal cells (also known as “umbrella cells”) that provide the
luminal lining of the urinary bladder (Birder, 2005; Cohen, 1995). A band of tight
junctions connects the cells to act as a barrier from the contents of the urine (Cohen,
1995).
Urothelial cells were once thought to simply provide a barrier between urine and
the underlying tissues. However, many recent studies have shown that urothelial cells
express receptors and ion channels associated with neuronal function, specifically
afferent neuronal function, which include bradykinin receptors, neurotrophin receptors
TrkA, TrkB and p75NTR, purinergic receptors P2X and P2Y, α- and β-adrenergic
receptors, and transient receptor potential (TRP) channels such as TRPV1 (Kullmann et
al., 2008; Murray et al., 2004). Urothelial cells also release neuroactive compounds (i.e.
acetylcholine, ATP, nitric oxide) (Birder, 2005). Bladder afferent nerves are located in
close proximity to urothelial cells, suggesting that signaling likely occurs between
afferents and urothelium (Birder, 2005; Kullmann et al., 2008).
The urine itself is made of multiple organic and inorganic substances, including
urea (formed from ammonia and CO2), uric acid (the product of the oxidation of purines),
creatinine (hydrated creatine), sodium, potassium, phosphates, sulfates, bicarbonate, and
ammonia (Cohen, 1995). Levels of each constituent as well as urinary pH vary widely
with food consumption and time of day (Cohen, 1995). It has been suggested that some
constituents of urine could impact the bladder by way of the urothelium (Cohen, 1995).
5
B. Micturition Reflex
The urinary bladder always exists in one of two modes: storage mode and
elimination mode. The bladder smooth muscle and the urethral outlet must function
reciprocally for the efficient elimination of urine (Fowler et al., 2008). During storage
mode, the bladder smooth muscle must remain relaxed to allow for filling, while the
urethral outlet is contracted (Fowler et al., 2008). Elimination mode requires contraction
of the bladder smooth muscle with relaxation of the urethral outlet, to allow urine flow
(Andersson and Arner, 2004). Precise organization of the reciprocal functions of the
urinary bladder and urethra and complex neural organization are required (Fowler et al.,
2008).
Storage mode
During storage mode, the detrusor smooth muscle must remain relaxed while the
urethral outlet remains contracted to ensure the retention of urine and continence.
Storage mode involves the slow filling of the urinary bladder, signaled by low-level
afferent firing of myelinated Aδ fibers (Figure 3) (Holstege, 2005). The sympathetic
pathway has a role in inhibition of parasympathetic efferent input to the detrusor smooth
muscle and in inhibition of parasympathetic activity in the autonomic ganglia (Fowler et
al., 2008). Sympathetic outflow and reflex pathways keep the urethra and urethral
sphincters contracted (Fowler et al., 2008). Conscious control of continence is provided
by cholinergic motor neurons to the striated muscle in the external urethral sphincter
6
(Fowler et al., 2008) (Elbadawi, 1996; Holstege, 2005). Studies have also shown that
there is activation of the periaqueductal gray (PAG) during bladder filling in humans,
which in turn influences the pontine micturition center (PMC), a part of the brainstem
involved in the switch between filling and voiding (Figure 3) (Blok and Holstege, 2000;
Fowler et al., 2008) (Holstege, 2005).
The PMC, located in the brainstem, is thought to be involved in coordinating the
switch between storage and elimination activity (Holstege, 2005). Drugs applied to the
PMC can change the bladder volume set point (i.e. threshold) to induce bladder voiding
activation (Fowler et al., 2008). The PMC receives bladder afferent projections and in
turn sends excitatory projections to the bladder motoneurons in the preganglionic
parasympathetic nucleus of the spinal cord (Holstege, 2005). The PMC also excites
GABA-ergic and glycinergic inhibitory interneurons of urethral sphincter (Holstege,
2005). In humans and cats, bladder filling afferent information most likely is relayed
first to the PAG, which then has projections to the PMC (Blok and Holstege, 2000;
Fowler et al., 2008). In rats, there is likely direct access between lumbosacral afferent
neurons and the PMC, possibly making rat voiding behavior less easily extrapolated to
human conditions with respect to the supraspinal elements of the micturition reflex (Blok
and Holstege, 2000).
Elimination mode
The elimination of urine involves the coordinated contraction of the detrusor and
relaxation and dilation of the urethral outlet. This involves inhibition of the sympathetic
output to the bladder and urethral outlet, and activation of the parasympathetic pathway.
7
Relaxation of the urethral smooth muscle is achieved by removal of adrenergic and
cholinergic excitatory inputs and the release of nitric oxide (NO) to elicit smooth muscle
relaxation (Fowler et al., 2008). Contraction of the detrusor smooth muscle is activated
by parasympathetic cholinergic efferent input to this muscle. The PMC has also been
shown to exhibit firing during bladder voiding activity (Fowler et al., 2008; Holstege,
2005).
Components of the micturition reflex as seen during cystometry
Cystometry is a technique used to measure bladder function in vivo. Cystometry
involves the constant infusion of saline into the urinary bladder of an experimental
animal through tubing that is secured in the dome of the bladder. The tubing is connected
to a pressure transducer, which then measures the changes in pressures associated with
micturition cycles.
Both conscious cystometry and cystometry in anesthetized animals are used
experimentally. There are some differences between methods, not the least of which is a
difference in bladder capacity (Cannon and Damaser, 2001; Ghoniem et al., 1996).
Animals under anesthesia have a significantly larger bladder capacity than conscious rats
(Cannon and Damaser, 2001; Ghoniem et al., 1996). It is also said that anesthesia may
compromise urodynamic parameters and may have profound effects on bladder function,
perhaps because general anesthesia may block glutamate transmission in the brain
(Cannon and Damaser, 2001; Ghoniem et al., 1996; Yokoyama et al., 1997). Careful
interpretation must be exercised when interpreting data from experiments using
anesthetized animals (Ghoniem et al., 1996). It is also true that conscious cystometry
8
might more closely reflect normal bladder functions. However, in both models, the
implantation of the tubing into the bladder may affect urothelial sensation or bladder
capacity. This is why a period of several days is recommended for the recovery of the
animal from surgery.
Figure 2 illustrates an example of one micturition cycle during a typical
cystometrogram recording in a conscious rat. Important parameters of cystometry
include filling pressure (the pressure during the filling phase of the micturition cycle),
threshold pressure (pressure at the beginning of the void event), micturition pressure (the
peak in pressure during the void event), inter-micturition interval (the amount of time
between the end of one void event and the end of the next), the frequency of non-voiding
contractions, and void volume (Maggi et al., 1986).
Changes that are detected in certain urodynamic parameters with experimentation
can be attributed to changes in afferent or efferent function. Experiments involving
blockade of nicotinic receptors in the pelvic ganglia in order to impair the efferent branch
of the micturition reflex (Maggi et al., 1986) demonstrated that threshold pressure, void
volume and inter-micturition interval are associated with the afferent limb of the
micturition reflex. Changes in micturition pressure are associated with changes in
efficiency of neurotransmission in the efferent branch of the micturition reflex (Maggi et
al., 1986).
Multiple possibilities exist for changes in the number of non-voiding contractions
with cystometry, including myogenic or neurogenic activities. Non-void contractions
during the filling phase could mean an increase in detrusor activity, including
9
(cm H2O)
Bladder Pressure
ICI
MP
TP
FP
Time (s)
Figure 2: Important parameters of cystometry
ICI: inter-contraction interval, FP: filling pressure, TP: threshold pressure, MP: micturition
pressure.
spontaneous contractions of the detrusor smooth muscle. This is often seen in spinal
cord-injured rats (Brading, 1997; Herrera et al., 2003; Yoshimura et al., 2006). Other
explanations include changes in the response of the urothelium to bladder distension,
possibly affecting the bladder afferents located in the suburothelial plexus (Herrera et al.,
2003). Experimental effects on afferent or efferent nerves are also possible sources of
neurogenic changes in the number of non-void contractions (Herrera et al., 2003).
10
C. Urinary Bladder Innervation
Sympathetic Innervation
Preganglionic sympathetic neurons are located in the intermediolateral (IML)
region (laminae V-VII) of the thoracolumbar spinal cord (L1-L2 in rats; T11-L2 in
humans) (Fowler et al., 2008). Sympathetic efferents travel in the hypogastric nerve to
the inferior mesenteric ganglia, then traveling in the hypogastric nerve to the pelvic
ganglia and lower urinary tract, where they activate α-adrenergic excitatory receptors in
the bladder base and urethral smooth muscle and β-adrenergic inhibitory receptors on the
detrusor smooth muscle (Figure 3)(Fowler et al., 2008).
Parasympathetic Innervation
Parasympathetic preganglionics are located in the sacral parasympathetic nucleus
(SPN) of the IML region (laminae V-VII) of sacral spinal cord (L6-S1 in rats; S2-S4 in
humans). Parasympathetic efferents travel in the pelvic nerve, with postganglionics
located in the major pelvic ganglion of rats (Keast et al., 1989). Postganglionic
parasympathetic nerves have an excitatory effect on detrusor smooth muscle and an
inhibitory effect on bladder base and urethra (Fowler et al., 2008). Post-junctional M3
muscarinic receptors expressed on the bladder smooth muscle are the receptors thought to
be most involved in excitatory transmission in the detrusor (Fowler et al., 2008).
However, a recent experiment showed that activation or inhibition of muscarinic
acetylcholine receptors (mAChRs) at the luminal surface of the bladder can affect bladder
function. This is presumably through interactions between the urothelium and the C-fiber
11
sensory nerves located within close proximity, demonstrating that parasympathetic
muscarinic transmission could be important not only in the detrusor smooth muscle, but
in the urothelium as well (Kullmann et al., 2008). Non-cholinergic parasympathetic
innervation involves adenosine triphosphate (ATP) activation of P2X receptors and NO
transmission, which is inhibitory to urethral smooth muscle (Fowler et al., 2008).
Somatic Innervation
Cholinergic neurons also innervate the striated muscle of the external urethral
sphincter, keeping the sphincter under conscious control (Fowler et al., 2008). These
neurons originate in the ventral horn of lumbosacral spinal cord (lamina IX) in the
dorsolateral nucleus and travel via the pudendal nerve to synapse on external urethral
sphincter muscle (Figure 3).
Bladder Afferent Pathways
Bladder afferent nerve fibers travel in both the hypogastric and pelvic nerves,
with their cell bodies in dorsal root ganglia (DRG) at spinal segment levels S2-S4 and
T11-L2 in humans and L6-S1 and L1-L2 in rats (Fowler et al., 2008). Bladder afferents
consist of lightly myelinated Aδ fibers and unmyelinated C-fibers. As stated above,
sensations of bladder filling are conveyed by Aδ fibers, the most important
mechanoreceptors of the bladder. C-fibers are normally “silent” but they do respond to
chemical or noxious stimuli (Figure 3) (Fowler et al., 2008). Aδ and C-fibers terminate
in the urothelium, suburothelium, and smooth muscle layers of the bladder (Kullmann et
al., 2008). Most of the bladder afferents project to lumbosacral spinal cord levels, as this
12
is the most important region for signaling the micturition reflex (Holstege, 2005). In the
bladder, most of the sensory nerves are located in a dense suburothelial plexus just
beneath the urothelium (Andersson and Arner, 2004)(Figure 1).
Bladder primary afferent fibers in the pelvic nerve project to the lumbosacral
spinal cord via Lissauer’s tract. Afferents from urinary bladder, uterus, and colon project
along the lateral side of the dorsal horn, forming the lateral collateral pathway (LCP)
(Kawatani et al., 1990). Afferent projections from the pudendal nerve and genital
structures project along the medial edge of the dorsal horn into the dorsal commissure
region, forming the medial collateral pathway (MCP) (Kawatani et al., 1990).
Many bladder afferents further project to the SPN, synapsing with preganglionic
parasympathetic neurons as well as interneurons (Morgan et al., 1981) (Fowler et al.,
2008). Primary bladder afferents from the pelvic and hypogastric nerves also project to
dorsal commissure and the superficial dorsal horn (Fowler et al., 2008). Lumbosacral
dorsal commissure, superficial dorsal horn and the parasympathetic nucleus all contain
interneurons important to urinary bladder function (Fowler et al., 2008). These
interneurons project locally in the spinal cord or to the brain (Fowler et al., 2008). Some
bladder afferents synapse with ascending pathways in the spinal cord which project to
neuronal populations in the brain involved in micturition control, including the PMC
(Fowler et al., 2008). Neuronal tracing studies using horseradish peroxidase showed that
the dorsal commissure and sacral parasympathetic nucleus are located periodically at
approximately 200 µm intervals (Morgan et al., 1981).
13
Cerebral Cortex
(+ -)
PAG
Brainstem
PMC
L1-L2
Hypogastric
nerve
L6-S1
A-δ myelinated
afferents
C-fiber
un-myelinated
afferents
SPN
Pelvic
nerve (+)
Pudendal (+)
nerve
(-)
(+)
Figure 3: Neural circuitry involved in the micturition reflex.
During filling, there is low-level Aδ afferent firing, stimulating sympathetics in the hypogastric
nerve to keep the detrusor smooth muscle relaxed and the urethra contracted. The pudendal nerve
provides conscious control to keep the external urethral sphincter contracted. C-fiber
unmyelinated afferents do not respond to normal bladder filling, but are “awakened” and
activated after spinal cord injury or by noxious stimulants, such as cold. Intense afferent firing
during bladder filling activates spinobulbospinal pathways, with afferent input to the
periaqueductal grey (PAG) and pontine micturition center (PMC), which in turn activate
preganglionics in the sacral parasympathetic nucleus (SPN) of lumbosacral spinal cord.
Postganglionics in the pelvic nerve then excite the detrusor smooth muscle, whereas sympathetic
and pudendal input to the urinary bladder and urethra are inhibited. The cerebral cortex also
provides conscious control over micturition.
14
The use of the rat model in studying micturition reflex pathways is very common,
as the comparison of rat anatomy to human anatomy is well known. Analogous spinal
cord segments involved in micturition reflex circuitry exist in rats, including the L1-L2
spinal cord segment that is analogous to the human T11-L2 spinal cord region which
contains the sympathetic outflow and some of the bladder afferent input. Analogous to
the human S2-S4 region is the L6-S1 region in rat, which contains the parasympathetic
outflow and receives most of the bladder afferent input (Shefchyk, 2002). It is also true
that rats, like humans and cats, have supraspinal control over the micturition reflex, with
a distinct region in the pons analogous to the PMC; the destruction of this region leads to
total urinary retention (Blok and Holstege, 2000; Maggi et al., 1986). However, rats
appear to have direct lumbosacral input to their PMC, perhaps the reason for a more
reflexic voiding behavior than “guarded” reflex behavior as seen in humans and cats
(Blok and Holstege, 2000). Guarded reflex behavior in humans and cats involves voiding
in a safe location.
15
III. Bladder Inflammation and Associated Changes
Bladder inflammation is often experimentally induced to study the effects of acute
and chronic bladder inflammation on bladder function and micturition reflex pathways in
experimental animals (Westropp and Buffington, 2002). Multiple models of cystitis are
in use, including cystitis that results from the intraperitoneal injection of
cyclophosphamide (CYP). The CYP model has been widely studied in order to
characterize the changes associated with this purely visceral inflammation model
(Lanteri-Minet et al., 1995). The results of experiments done in the CYP-treated animals
may have relevance to human conditions that involve bladder inflammation, including
IC/PBS (Westropp and Buffington, 2002).
A. Cyclophosphamide (CYP) Cystitis
CYP was originally used as an anti-tumor chemotherapeutic agent that had an
unfortunate side effect of painful hemorrhagic cystitis (Bautista et al., 2006; Cox, 1979b;
Maggi et al., 1992). Side effects of CYP therapy also include painful voiding, bladder
hyperreflexia and gross hematuria (Stillwell and Benson, 1988; Watson and Notley,
1973). Symptoms of CYP cystitis can also include increased somatic sensitivity (Guerios
et al., 2006). CYP is often used to model bladder inflammation because of its ease of
observation behaviorally and histologically, and because the inflammation is confined
specifically to the bladder (Bon et al., 2003; Lanteri-Minet et al., 1995). Experimental
CYP cystitis in animals results in histological changes in the urinary bladder that include
16
edema, vasodilation, infiltration of inflammatory cells such as mast cells, and
proliferation of nerve fibers (Yoshimura and de Groat, 1999). Bladder hyperreflexia is
seen as an increase in voiding frequency with CYP-induced cystitis, resulting in a shorter
inter-micturition interval and a decreased void volume; the presence of non-voiding
contractions during the filling phase is also seen (Hu et al., 2003; Maggi et al., 1992).
The causative agent of this effect of CYP was proven to be acrolein, a metabolite of CYP
that accumulates in the urine and contacts the bladder wall while being stored before
elimination (Cox, 1979b).
The activation of capsaicin-sensitive primary afferents by acrolein in urinary
bladder plays a significant role in the hyperreflexia associated with CYP-induced cystitis,
leading to neurogenic inflammation and nociception (Ahluwalia et al., 1994; Geppetti et
al., 2008; Maggi et al., 1992). Capsaicin is the pungent component of spicy chili peppers.
Pretreatment with capsaicin abolished the hyperreflexia seen with CYP (Maggi et al.,
1992). The TRPA1 channel was found to underlie responsiveness to acrolein toxicity
(Bautista et al., 2006; Dinis et al., 2004; Geppetti et al., 2008). Activation of this channel
in capsaicin-sensitive primary afferents by acrolein in the bladder leads to depolarization
of sensory neurons (Bautista et al., 2006; Dinis et al., 2004). This leads to numerous
effects, including the release of neuropeptides, vasodilation and other neurogenic
inflammatory effects, which in turn lead to hypersensitivity to mechanical stimuli and
bladder hyperreflexia (Ahluwalia et al., 1994; Bautista et al., 2006; Maggi et al., 1992).
This accounts for the initial steps of acrolein toxicity seen in urinary bladder (Bautista et
al., 2006). Neurochemical and electrophysiological changes in afferents also occur in
17
response to activation of primary afferents by acrolein exposure (Maggi et al., 1992;
Vizzard, 2000c; 2001; Yoshimura and de Groat, 1999).
Both TRPV1 and TRPA1 receptors are expressed by a subset of capsaicinsensitive afferents and both have been examined for their potential role in responding to
acrolein exposure (Bautista et al., 2006). The TRPV1 channel is activated by heat as well
as capsaicin (Bautista et al., 2006). While the TRPV1 channel is involved in the progress
of bladder hyperreflexia and peripheral mechanical hypersensitivity associated with CYP
cystitis, it is not as a direct result of acrolein exposure (Ahluwalia et al., 1994; Dinis et
al., 2004; Wang et al., 2008). It has been shown that TRPA1 is the presumptive channel
required for the inflammatory effects of acrolein exposure in the urinary bladder
(Geppetti et al., 2008).
TRPA1 is known to be activated by isothiocyanate or thiosulfinate compounds,
the pungent components of mustard oil and garlic (Bautista et al., 2006). Recent in vitro
studies have shown that cells expressing TRPA1 were responsive to acrolein application,
while cells expressing only TRPV1 were not (Bautista et al., 2006; Dinis et al., 2004).
Also, TRPV1-expressing neurons did not produce any current in response to acrolein
exposure, while TRPA1-expressing neurons did produce current (Bautista et al., 2006).
This demonstrated that TRPA1 is the receptor responsible for the depolarization of
afferents in response to acrolein, thus eliciting inflammatory pain (Dinis et al., 2004).
Other experimental approaches to induce cystitis include intravesical instillation
of lipopolysaccharide (LPS), acetic acid, mustard oil, hydrochloric acid (HCl), or
turpentine. Instillation of all of these compounds leads to bladder irritation and
18
inflammation by various methods. While there is no perfect model of human bladder
inflammation or of the human condition of IC/PBS, these models do provide the
opportunity to examine the effects of acute and chronic bladder inflammation and the
mechanisms of inflammation including structural, neurochemical and functional changes
in micturition reflexes (Westropp and Buffington, 2002). These models also often mimic
the inflammation-related histological changes seen in patients with IC/PBS, and many
also lead to bladder hyperreflexia, also a part of the constellation of symptoms seen with
IC (Kirimoto et al., 2007; Wheeler et al., 2001). However, some of these models induce
damage or effects that are not present in the human condition of IC/PBS, including
detrusor damage (Westropp and Buffington, 2002). Also, some models do not mimic all
of the symptoms of IC/PBS (Westropp and Buffington, 2002). However, IC/PBS does
occur naturally in cats. This feline IC model reproduces more features of human IC/PBS
than any other animal model previously described, including a waxing and waning course
(Westropp and Buffington, 2002). Limitations of the feline model include limited
availability of cats diagnosed with the disease and the fact that it is unknown how
widespread feline IC really is. These cats also do not provide the ability to examine acute
aspects of inflammation (Westropp and Buffington, 2002).
B. CYP-induced cystitis: Changes in the micturition reflex pathway
The inflammation or irritation of tissue can result in chronic pathological
conditions that induce changes in somatic sensory pathways, leading to hyperalgesia and
allodynia. This increased sensation can be caused by sensitization of peripheral afferents
(Dmitrieva and McMahon, 1996; Woolf et al., 1997) or changes in central synaptic
19
connections that process nociception (Lewin et al., 1992; Yoshimura and de Groat, 1999).
A multitude of changes in the micturition reflex pathway have been documented with
CYP-induced cystitis. These include bladder hyperreflexia, as mentioned above, and also
organizational changes, electrophysiological changes, neurochemical changes as well as
changes in somatic sensation (Hu et al., 2003; Vizzard, 2000b; 2001; Yoshimura and de
Groat, 1999).
The protein product of the immediate early gene c-fos (Fos) has been used to
mark the postsynaptic activation of spinal cord neurons receiving afferent input from the
lower urinary tract (Birder and de Groat, 1992; 1993). Growth-associated protein-43
(GAP-43) is a calmodulin-binding protein associated with synapse formation and an
ongoing capability for synaptic plasticity in adults (Vizzard and Boyle, 1999). With CYP
treatment in rats, changes in the distribution of the Fos protein in lumbosacral spinal cord
segments and expansion of spinal cord segments involved in micturition reflexes have
been demonstrated (Lanteri-Minet et al., 1995; Vizzard, 2000a). This suggests a change
in the organization of micturition reflex pathways, resulting in changes in synaptic
connections, afferent excitability or pain modulation systems (Vizzard, 2000a). Chronic
CYP treatment in rats also leads to increased expression of GAP-43 in micturition
pathways in the dorsal commissure, dorsal horn and IML cell column of the spinal cord,
suggesting the possibility of synaptic plasticity with CYP cystitis (Vizzard and Boyle,
1999).
Electrophysiological changes documented in bladder afferent cells with chronic
CYP-induced cystitis demonstrate an enhanced electrical excitability of C-fiber bladder
20
afferents, as well as significant hypertrophy of afferent cell bodies in rats in the L6-S1
DRG (Yoshimura and de Groat, 1999). CYP treatment in rats also leads to the increased
afferent firing in the pelvic nerve in response to distension, decreased the firing threshold
and increased the area of evoked action potentials (Yu and de Groat, 2008). Increased
excitability of bladder afferent neurons to stimulation could certainly contribute to pain
and hyperactivity of the urinary bladder as seen with CYP cystitis.
Neurochemical changes with CYP cystitis include an increase in the expression of
the neuropeptides calcitonin gene-related peptide (CGRP) and substance P as well
pituitary adenylate cyclase-activating polypeptide (PACAP) in lumbosacral DRG and
spinal cord regions involved in micturition afferent pathways (in rats: L1-L2, L6S1)(Vizzard, 2000c; 2001). The expression of the neurotrophin tropomyosin receptor
kinases A and B (TrkA and TrkB) and phosphorylated Trk (pTrk) also change in bladder
afferent neurons with CYP cystitis in rats, and this could occur in response to the changed
expression of neurotrophic factors in the inflamed urinary bladder (Qiao and Vizzard,
2002; Vizzard, 2000b). Bladder afferents in lumbosacral DRG exhibit an increased
expression of the transcription factor cAMP responsive-element binding protein (CREB)
with CYP-induced cystitis (Qiao and Vizzard, 2004). Phosphorylated CREB (p-CREB)
is co-localized with phosphorylated Trk receptors in lumbosacral DRG cells, suggesting
that p-CREB activity may be related to a neurotrophin/Trk signaling pathway in bladder
afferents (Qiao and Vizzard, 2004). Enhanced expression and function of the ATP
receptor purinergic 2X (P2X) in pelvic and lumbar splanchnic pathways has been
21
reported, suggesting a role for ATP signaling through this receptor in hyperreflexia and
hypersensitivity with CYP (Dang et al., 2008).
Sprouting of CGRP and vesicular acetylcholine transporter-immunoreactive (IR)
fibers were reported in the bladder urothelium and peptidergic sensory fibers were seen in
the detrusor smooth muscle with CYP cystitis, (Dickson et al., 2006) suggesting the
possibility that an increase in these fibers could result in bladder hyperreflexia and
hypersensitivity.
Symptoms of CYP cystitis can also include increased somatic sensitivity, as
evidenced by mechanical hypersensitivity of the hind limbs induced by application of von
Frey filaments in experimental animals (Bielefeldt et al., 2006; Guerios et al., 2006;
Guerios et al., 2008; Lamb et al., 2006)(Cheppudirah and Vizzard, unpublished
observations). Sensitization of pain pathways by inflammation can result in the
hypersensitization of neighboring organs and referred somatic cutaneous sites (Bielefeldt
et al., 2006).
These changes may play a role in the altered visceral sensation and bladder
hyperreflexia involved in human clinical syndromes, such as IC/PBS.
C. How CYP cystitis can relate to human conditions
The CYP-induced experimental model of urinary bladder inflammation could be
useful in modeling such syndromes as IC/PBS, which involves a persistent inflammatory
state in some patients. IC/PBS is more recently being called painful bladder syndrome
(PBS), so as to use a more symptom-oriented description (FitzGerald et al., 2006).
IC/PBS is a painful chronic disorder of the urinary bladder that exhibits urinary
22
frequency, urgency, and suprapubic pressure and pain with only small amounts of bladder
filling (Erickson, 1999).
IC/PBS affects anywhere from 44,000 to 1 million people in the United States
(Erickson and Davies, 1998) and bladder dysfunction in general affects an estimated 17
million Americans. The cost of treating urinary incontinence was estimated at $25
million in 1995.
Patients with IC/PBS show hypersensitivity to somatic stimuli, including
sensitivity to deep tissue pressure, the ischemic forearm test of pain tolerance, and
bladder distension (Ness et al., 2005). Some patients even report discomfort to sites other
than suprapubic, including lower back, buttocks, and upper thighs (FitzGerald et al.,
2005). Patients with IC/PBS also have more non-bladder related symptoms, such as
tingling of the fingers and toes and headaches, than age-matched controls (Westropp and
Buffington, 2002).
Most biopsies of bladders from patients with IC/PBS show some degree of
inflammation, as evidence by the infiltration of inflammatory cells and inflammatory
mediators such as lymphocytes, T cells, B cells, mast cells, interleukin-6 and interleukin2 (Erickson, 1999). The etiology of IC/PBS is unknown, although various theories have
been proposed, including neurogenic causes, infection, toxic agents in the urine,
deficiency in bladder wall lining, urothelial disorder, disorder of the pelvic floor
musculature, underlying endocrine abnormality, and autoimmune disorder (Buffington,
2004; Erickson, 1999). IC/PBS often shows comorbidity with arthritis, allergies,
endometriosis, fibromyalgia, migraine, irritable bowel syndrome and panic syndrome, all
23
of which become worsened by stress (Buffington, 2004; Theoharides, 2007; Westropp
and Buffington, 2002).
A link between chronic stress and the onset of symptoms of IC/PBS has been
reported (Million et al., 2007; Rothrock et al., 2001). Corticotropin-releasing factor
(CRF)-over-expressing mice were examined in order to investigate this link. CRF
initiates the activation of the hypothalamic-pituitary-adrenal (HPA) axis, which leads to
acute behavioral and visceral stress responses; an overactive HPA axis has also been
implicated in the pathogenesis of PBS/IC (Buffington, 2004; Million et al., 2007). CRFover-expressing mice show a significant increase in frequency of elimination in a novel
environment and an overall enhanced pelvic response to stressors (Million et al., 2007).
The CRF receptor type 1 has been implicated in visceral hyperalgesia seen in stressed rats
(Larauche et al., 2008). CRF has also been implicated in overactive bladder and the
stimulation of bladder activity, and a link has been shown between bladder disorders and
anxiety (Klausner and Steers, 2004).
24
IV. Cyclooxygenase-2 (COX-2) and inflammation
A. General Background
The cyclooxygenase enzymes are responsible for the synthesis of prostaglandins
from arachidonic acid. Prostaglandins have many roles in physiological functions,
including physiological “housekeeping” as well as inducible inflammatory functions.
Arachidonic acid is found in cell membrane phospholipids and must be liberated from the
membrane-bound phospholipids by phospholipase enzymes before COX enzymes can
form prostaglandins (Figure 4) (Mitchell and Warner, 1999). Two isoforms of COX have
been identified: COX-1 and COX-2. While both COX enzymes are involved in
beneficial, homeostatic functions as well as inflammatory and pain effects, a distinction is
often drawn between the two. In general, COX-1 is thought of as the constitutive
isoform, involved with many of the physiological functions of gastrointestinal, renal,
immune and cardiovascular systems (Parente and Perretti, 2003). COX-2 is thought of as
the inducible isoform, with its metabolites being released locally in sites of inflammation
or systemically after infection (Figure 5) (Mitchell and Warner, 1999). Cytokines and
growth factors have been implicated in the induction of COX-2 expression (Mitchell and
Warner, 1999). However, more research has shown that the story is not really as simple
as this.
Both COX-1 and COX-2 are responsible for the production of prostaglandin G2
(PGG2) and prostaglandin H2 (PGH2) (Mitchell and Warner, 1999). The presence of
different downstream enzymes then determines the formation of further prostaglandins
25
Membrane-bound phospholipids
+
Phospholipase A2
Arachidonic acid
COX-1
COX-2
PGG2
PGH2
PGE2, PGI2, TXA2, PGF2α, PGD2
Figure 4: The production of prostaglandins from arachidonic acid.
Arachidonic acid is produced from membrane-bound phospholipids by the enzyme phospholipase
A2. Cyclooxygenase (COX) enzymes then produce the prostaglandins PGG2 and PGH2 from
arachidonic acid. PGH2 is then formed into multiple other prostaglandins, some of which are
involved in inflammatory processes.
26
Original Cyclooxygenase (COX) Concept
Prostaglandins D2, E2, F2α, I2
Figure 5: The cyclooxygenase concept.
The COX enzymes are involved in homeostatic functions (COX-1) as well as inducible
inflammatory functions (COX-2). The presence of inflammatory cytokines and growth factors
contributes to the induction of COX-2, which then produces prostaglandins, which sensitize
nociceptors and lead to increased pain sensation. However, recent studies have also shown an
inducible role for COX-1 in pain.
27
from PGG2 and PGH2 (Figure 4) (Mitchell and Warner, 1999). PGH2 can be further
transformed into PGI2, thromboxane A2 (TXA2), PGE2, PGD2 and PGF2α (Parente and
Perretti, 2003). Important for inflammation, PGE2 is involved in pain sensitization
centrally and at nerve terminals in the periphery, and acts as a hyperalgesic and
vasodilator (Ahmadi et al., 2002; Mitchell and Warner, 1999; Parente and Perretti, 2003).
PGE2 also could function in a positive feedback loop, inducing the expression of more
COX-2 at inflammatory sites (Nantel et al., 1999; Parente and Perretti, 2003). PGI2 acts
as a vasodilator and both PGE2 and PGI2 are known to be hyperalgesic, potentiating
nociception induced by other factors via the cAMP pathway and activation of protein
kinase A (PKA) (Parente and Perretti, 2003; Richardson and Vasko, 2002). Among other
functions, TXA2 and PGD2 are involved in platelet aggregation, and PGF2 is involved in
vasoconstriction and broncoconstriction (Parente and Perretti, 2003).
While a clear distinction between the roles of COX-1 and COX-2 remains to be
established, it is known that selective inhibition of COX-2 does reduce inflammatory pain
in animal models and in humans (Morrison et al., 1999; Parente and Perretti, 2003;
Riendeau et al., 1997). In most mammalian tissues, COX-2 is undetectable in normal
conditions. COX-2 is then rapidly induced in inflammatory cells such as fibroblasts,
monocytes, and vascular endothelium in response to inflammatory mediators such as
growth factors and cytokines (Figure 5) (Parente and Perretti, 2003). Still, a role for
COX-1 in nociception and inflammation has also been reported and it is likely that
inflammation and inflammatory hyperalgesia result from cooperation between
prostaglandins produced by both COX enzymes (Parente and Perretti, 2003). The
28
biological functions of the two COX enzymes are much more complex and interrelated
than initially thought (Parente and Perretti, 2003).
B. COX-2 and urinary bladder inflammation
COX pathways and prostaglandins have a cytoprotective role in urinary bladder
and also are involved in micturition reflex (Wheeler et al., 2001). Prostaglandins
modulate the basal tone of the detrusor and influence detrusor contraction as well as
target primary bladder afferents, thus influencing the micturition reflex (Angelico et al.,
2006; Maggi, 1992). Endogenous prostaglandins are produced in the bladder wall during
distension and these may have an influence on afferent input, leading to alterations in
void contractions (Maggi, 1992; Wheeler et al., 2001). Application of prostaglandins to
the detrusor stimulates the micturition reflex (Maggi et al., 1984). PGE2 and PGI2 are the
predominant prostaglandins found in the rat and human urinary bladder, although PGD2
is also expressed (Hu et al., 2003; Wheeler et al., 2001). Treatment with systemic nonsteroidal anti-inflammatory drug (NSAID), which specifically targets the COX enzymes,
increases bladder capacity in experimental rats and NSAID application in vitro leads to
detrusor muscle relaxation (Abrams et al., 1979; Maggi et al., 1984; Maggi et al., 1988b).
Prostaglandins TXA2, PGE2, PGD2 and PGF2α influence contractile activity of detrusor
smooth muscle in vitro (Angelico et al., 2006). COX inhibitors have been shown to
attenuate detrusor instability in humans (Lecci et al., 2000). Furthermore, intravenous
administration of non-selective COX inhibitors reduces bladder activity in both control
rats and rats with bladders inflamed by intravesical administration of acetic acid
(Angelico et al., 2006). It has been postulated that COX-1 could be involved in
29
modulating the contraction threshold, while COX-2 could have more involvement in the
inflammatory response (Lecci et al., 2000).
In addition to the roles of COX pathways and prostaglandins in normal bladder
function, numerous studies have suggested a role for COX-2 in bladder inflammation and
even in the associated bladder hyperreflexia. We know that LPS bladder inflammation
in rats leads to the elevation of COX-2 protein in urinary bladders, but does not elevate
levels of COX-2 mRNA or COX-1 protein or mRNA (Wheeler et al., 2001). Urinary
levels of PGE2 and synthesis of PGE2 in bladder are also increased with LPS, suggesting
the importance of this molecule in the LPS inflammatory process (Wheeler et al., 2001).
Acute CYP-induced cystitis in female rats increased the expression of COX-2
immunoreactive cell profiles throughout the urinary bladder wall as well as increased
protein expression of PGD2 and PGE2 in the whole bladder (Hu et al., 2003).
Functionally, it has been shown that a COX-2 specific inhibitor, 5,5-dimethyl-3-(3fluorophenyl)-4-(4-methylsulfonyl)phenyl2(5H)-furanone (DFU) attenuates the bladder
hyperreflexia associated with CYP-induced cystitis in rats and rescues bladder capacity
(Hu et al., 2003). Prostaglandins and COX-2 may play a prominent role in bladder
function as well as a pathophysiological role in bladder inflammation and the associated
hyperreflexia.
30
V. Nerve Growth Factor (NGF) and the p75 neurotrophin receptor (p75NTR)
NGF was first discovered by Rita Levi-Montalcini in the 1950s as a target-derived
factor vital to the survival and outgrowth of sensory neurons (Aloe, 2004). Since then,
the specific receptor for NGF, TrkA, has been discovered and attributed as the receptor
required for the important neuronal survival functions of NGF. More recently, the
discovery of a pan-neurotrophin receptor, p75NTR, has made the study of neurotrophins
and NGF more interesting. p75NTR was initially discovered as a receptor for proNGF,
which led to apoptosis (Barker, 2004). Since then, p75NTR has been implicated in myriad
neuronal processes, including apoptosis and regeneration. For our purposes, p75NTR has
also been implicated as a co-receptor for TrkA, possibly enhancing TrkA binding and
specificity for NGF. Both NGF and TrkA are implicated in the processes of bladder
inflammation, NGF inducing bladder hyperreflexia and TrkA upregulated after CYPinduced cystitis. The next step is to determine what role p75NTR may play, if any, in
bladder inflammation and hyperreflexia.
A. NGF
NGF is one of a family of four mammalian neurotrophins that also includes brainderived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), and NT-4/5. Neurotrophins
are often target-derived and their retrograde transport to the perikaryon is thought to be
required for the neurotrophin effect on the neuron (Zweifel et al., 2005). NGF was the
first neurotrophin identified and it is involved in the development and survival of
peripheral sympathetic and sensory neurons (Chao et al., 2006; Frossard et al., 2004).
31
Centrally, NGF is involved in survival and maintenance of cholinergic neurons in the
basal forebrain (Chao et al., 2006). It has been shown that in the adult, NGF maintains
the normal properties of C-fiber afferents as well as all small size sensory neurons
(Chuang et al., 2001a). Other NGF functions include neuronal differentiation, neurite
outgrowth and sprouting, modulation of synaptic activity, gene regulation, survival
maintenance in the adult, and inflammatory pain (Friedman and Greene, 1999).
NGF has a prominent role in inflammation, central and peripheral pain
processing, and in the hyperalgesic effects of inflammation. Nociceptors continue to
express NGF receptors into adult life in humans and animals and NGF is now
additionally thought of as a “peripheral pain mediator” (Pezet and McMahon, 2006);
NGF is upregulated in many chronic pain conditions and inflamed tissues. Upregulation
of NGF is seen with peripheral inflammation and tissue injury (Lindholm et al., 1987;
Micera et al., 2007; Woolf et al., 1997). The induction of NGF expression is caused in
part by the actions of pro-inflammatory cytokines, including interleukin-1 and tumor
necrosis factor (Hefti et al., 2006). NGF levels can remain increased with chronic
inflammation (Hefti et al., 2006). Mast cells are an important inflammatory cell type;
mast cells stimulate the release of NGF, and NGF in turn stimulates mast cells under
conditions of tissue injury or inflammation, possibly creating a positive feedback loop for
inflammatory responses (Hefti et al., 2006). NGF also sensitizes TRPV1 receptors, by
initiating post-translational changes in the receptor, resulting in greater excitability (Hefti
et al., 2006). TRPV1 is a non-selective cation channel originally identified as the
capsaicin receptor (Hefti et al., 2006). Retrograde transport of NGF to the perikaryon
32
also increases the transcription of several nociception-related molecules, including
substance P, BDNF, the Nav1.8 Na+ ion channel and TRPV1 (Hefti et al., 2006).
Substance P and BDNF are involved in central sensitization to increase the excitability of
second-order spinal neurons; the Nav1.8 Na+ channel is expressed solely in nociceptors
(Hefti et al., 2006).
Injection of NGF into rat hindpaw creates allodynia and heat hyperalgesia due to
a wind-up response in the spinal cord (Thompson et al., 1995). Injection of carrageenan
or complete Freund’s adjuvant into the hindpaw of mice leads to a rise in endogenous
levels of NGF as well as the development of mechanical and heat hyperalgesia (Guerios
et al., 2006). Administration of NGF to DRG neurons or afferent terminals leads to
sensitization of these primary afferents by increasing the transcription levels of TRPV1,
upregulating neuropeptides (CGRP, substance P) and BDNF (Allen and Dawbarn, 2006;
Pezet and McMahon, 2006). The neuropeptides substance P and CGRP are released in
the periphery and centrally from activation of small-diameter sensory afferents and
through actions on endothelial cells, mast cells, immune cells and arterioles, they initiate
such inflammatory effects as vasodilation, plasma extravasation, and sensory neuron
hyperexcitability, resulting in redness, swelling, and hypersensitivity (Richardson and
Vasko, 2002). Exogenously applied NGF can also lead to the rapid sensitization of
Nav1.8 sodium channel that is expressed only on nociceptors, contributing to the
sensitization of primary afferent neurons after injury or inflammation (Allen and
Dawbarn, 2006). NGF protein levels are also increased on colonic epithelium after
33
trinitrobenzene sulphonic acid (TNBS)-induced colitis (Stanzel et al., 2008). NGF likely
serves as a link between inflammation and hyperalgesia (Lewin and Mendell, 1993).
There is a large body of evidence that supports the concept that NGF also has a
role in mediating the micturition reflex. NGF is expressed under normal conditions in the
urinary bladder, and part of its function is likely in the maintenance of sensory afferents
there (Chao and Hempstead, 1995; Chuang et al., 2001b). It also can interact with
afferents and contribute to pathological conditions including inflammation and bladder
hyperreflexia. Sources of NGF in the bladder include urothelium, detrusor smooth
muscle and inflammatory infiltrates, especially mast cells (Steers and Tuttle, 2006;
Vizzard, 2000b; Zvara and Vizzard, 2007). Mechanical stretch of the detrusor smooth
muscle results in the release of NGF mRNA and protein from the muscle (Vaidyanathan
et al., 1998).
There is also a wide range of evidence supporting the role of NGF in lower
urinary tract disorders: NGF levels are increased in the urine of patients with IC (Okragly
et al., 1999) and increased levels of NGF are seen in the bladders of patients with sensory
urgency (Lowe et al., 1997). NGF mRNA levels are increased in rat bladders with
chemically-induced cystitis (Oddiah et al., 1998; Vizzard, 2000b) and with bladder outlet
obstruction (Steers and Tuttle, 2006). While NGF levels in urinary bladder are reduced
with CYP cystitis, this could be attributed to retrograde transport of NGF to cell bodies in
the major pelvic ganglion or DRG (Birder et al., 2007; Murray et al., 2004; Vizzard,
2000b).
34
There is much functional evidence to support the role of NGF in bladder reflexes
as well as sensation. It has been shown that intravesical instillation of NGF sensitizes
bladder afferents, increasing their response to stimuli and making some responsive that
were not responsive before the instillation of NGF (Dmitrieva and McMahon, 1996).
Over-expression of NGF in detrusor in rats leads to hyperreflexia (Clemow et al., 1998;
Zvara and Vizzard, 2007). Sequestration of NGF reduces inflammation-induced
hyperreflexia in a rat model (Dmitrieva et al., 1997). Blockade of NGF reduces the
peripheral hypersensitivity seen with CYP cystitis also (Guerios et al., 2008). Systemic
administration of REN1820, an NGF scavenging agent and a recombinant protein of the
D5 extracellular domain of the NGF receptor tyrosine kinase TrkA, also reduces bladder
hyperreflexia in a CYP-induced inflammation model in rats (Hu et al., 2005). Intrathecal
administration of NGF increases NGF expression in bladder afferents, sensitizes bladder
afferents as well as increases bladder hyperreflexia, demonstrating that increased NGF
levels in micturition afferent pathways can contribute to bladder afferent plasticity,
contributing to changes in the micturition reflex (Yoshimura et al., 2006). Exogenous
NGF application to the rat bladder detrusor through an osmotic pump reduced bladder
capacity as well as increased expression of CGRP and Fos in lumbosacral spinal cord,
suggesting re-organization of micturition reflex pathways (Zvara and Vizzard, 2007). It
has also been suggested that Aδ fibers play a more important role in NGF-induced
bladder hyperreflexia than C-fibers (Chuang et al., 2001b).
35
NGF
TrkA
BDNF NT-4/5
TrkB
All 4
NT-3
TrkC
D1
p75NTR
D2
D3
D4
D5
kinase
domain
Type II
death
domain
Figure 6: Neurotrophins and their receptors.
Each neurotrophin binds specifically to a Trk receptor. They all also bind p75NTR, which is
known as the pan-neurotrophin receptor. p75NTR is a member of the tumor necrosis factor-α
family of receptors. Trk receptors have five extracellular domains. The D5 domain is important
for binding ligands (Allen and Dawbarn, 2006).
B. Receptor tyrosine kinase A (TrkA)
Neurotrophins bind with greater affinity to certain receptors. NGF specifically
binds TrkA, BDNF and NT-4/5 specifically bind TrkB, and NT-3 binds TrkC (Figure 6).
The Trk receptors have an intracellular structure consisting of a transmembrane domain,
a kinase domain and a 15-residue C-terminal tail. Extracellularly, Trk receptors can be
divided into five distinct domains D1-D5, where D5 is the closest to the cell membrane
and also serves as the binding domain (Allen and Dawbarn, 2006). Neurotrophin binding
to Trk receptors results in receptor dimerization and transphosphorylation of the
36
intracellular kinase domains (Allen and Dawbarn, 2006). Phosphorylated tyrosines then
can become docking sites for many signaling molecules, including those for the Ras,
phosphoinositide 3-kinase (PI3K) and phospholipase C-γ (PLC- γ) pathways (Allen and
Dawbarn, 2006; Chao and Hempstead, 1995; Kalb, 2005). Induction of p38 MAPK,
ERK and c-JUN N-terminal kinase are also achieved by NGF and possibly involved in
NGF-mediated hyperalgesia (Hefti et al., 2006). This signaling through MAP kinases
alters and influences post-translational processes as well as transcription (Richardson and
Vasko, 2002).
Neurotrophin signaling also often requires retrograde transport of neurotrophins
from the periphery to the perikaryon, resulting in retrograde effects on the cell body from
what are often great distances from the nerve terminals (Allen and Dawbarn, 2006; Miller
and Kaplan, 2001; Zweifel et al., 2005). It is unclear if internalization of a complete
ligand-receptor complex is necessary or if other modes of signal propagation are used for
the neurotrophin signal (Zweifel et al., 2005). However, there is considerable evidence
for a clathrin/dynamin dependent process of NGF-TrkA ligand-receptor internalization
and transport, although pincher-mediated endocytosis as well as caveolin-mediated
endocytosis have also been implicated (Zweifel et al., 2005).
As explained above, a role for NGF in sensory and sympathetic cell development,
maintenance, and inflammatory pain states has been described extensively. All of these
functions of NGF are mediated through the TrkA receptor. Perhaps underlining the
importance of NGF-TrkA signaling to pain sensation, the condition known as congenital
insensitivity to pain with andhidrosis (CIPA) results from a rare autosomal-recessive
37
genetic mutation in the TrkA gene (Allen and Dawbarn, 2006). NGF is involved in
regulating the gene expression of nociception-related molecules in TrkA-expressing
neurons (Allen and Dawbarn, 2006; Pezet and McMahon, 2006). Many have been
described above. These include substance P, CGRP, sodium channels and TRPV1 as
well as ion channels, and the P2X3 purinergic receptor (Allen and Dawbarn, 2006; Pezet
and McMahon, 2006). Post-translationally, increased neuronal sensitivity is achieved
through increased expression of CGRP and substance P release and the phosphorylation
of TRPV1 seen after NGF treatment of TrkA-expressing cells (Pezet and McMahon,
2006). It has also been demonstrated that TrkA-mediated activation of the MEK1ERK1/2 and PI3K pathways is involved in local axonal sprouting (Miller and Kaplan,
2001).
In urinary bladder afferents, TrkA immunoreactivity was upregulated in bladderprojecting afferent cells in DRG neurons at spinal cord levels L1 and L6 after acute and
chronic CYP-induced cystitis (Qiao and Vizzard, 2002). TrkA is also upregulated in the
major pelvic ganglion after CYP-induced cystitis (Murray et al., 2004). Phosphorylated
Trk expression is also increased in CYP cystitis, suggesting that the increased
phosphorylation of TrkA may be increasing the response of neurons to target-derived
NGF (Qiao and Vizzard, 2002). Also, the systemic administration of k252a, a Trk
specific antagonist, decreased the bladder activity associated with CYP-induced cystitis,
suggesting a role for NGF-TrkA signaling in CYP-induced bladder hyperreflexia (Hu and
Vizzard, unpublished observations).
38
C. p75NTR
While all neurotrophins NGF, BDNF, NT-3 and NT-4/5 bind to their specific Trk
receptors, they also all bind to p75NTR with comparable affinity (Allen and Dawbarn,
2006). As well as binding all neurotrophins and functioning independently, p75NTR also
regulates the affinity of Trk receptors for their specific ligands, thus leading to enhanced
Trk function and ligand specificity (Chao and Hempstead, 1995; Chao et al., 2006).
p75NTR has an extracellular domain that contains 4 cysteine-rich domains that are required
for ligand binding (Allen and Dawbarn, 2006; Barker, 2004). The intracellular portion of
p75NTR contains a type II death domain that is implicated in apoptosis. This domain is
common in members of the tumor necrosis factor-α (TNF-α) family of receptors,
although the structure of the death domain of p75NTR is distinct from other receptors in
the TNF-α family (Barker, 2004). p75NTR often acts as a co-receptor for activating
signaling cascades (especially with Trk receptors), but also functions on its own (Chao
and Hempstead, 1995). The results of the multiple interactions with co-receptors and
ligands of p75NTR often depend on the developmental stage and cell type where signaling
is occurring.
While p75NTR functions in the presence of Trk receptors are very important,
p75NTR has many other interesting binding partners and functions, including apoptosis
and neuronal growth regulation. For example, sortilin is a co-receptor for p75NTR binding
the NGF precursor molecule proNGF, and this signaling partnership results in apoptosis
(Barker, 2004; Chao and Hempstead, 1995). The affinity of proNGF for p75NTR is higher
than that of mature NGF (Barker, 2004). This cell death function of p75NTR may also be
39
important in regulating the development of central nervous system cell populations
(Friedman and Greene, 1999). It has also been shown that p75NTR stimulation activates
the transcription factor NFκB in Schwann cells and oligodendrocytes and the c-Jun Nterminal kinase (c-JNK) pathway in oligodendrocytes, facilitating cell survival (Chao and
Hempstead, 1995; Freund-Michel and Frossard, 2008; Friedman and Greene, 1999). The
consequences of this signaling are not yet fully understood (Friedman and Greene, 1999).
p75NTR also may form a three-receptor complex with the Nogo receptor and with Lingo-1
which results in neuronal growth inhibition (Barker, 2004). This p75NTR complex can
bind myelin-based growth inhibitors including Nogo, myelin-associated glycoprotein
(MAG) and oligodendrocyte myelin glycoprotein (OMgP) and result in the regulation of
RhoA, thus affecting neuronal growth (Barker, 2004; Dechant and Barde, 2002; Wong et
al., 2002).
The mechanisms of the internalization and movement of the p75NTR signal are as
yet poorly understood and many possibilities exist (Bronfman and Fainzilber, 2004).
Internalization of the receptor could result in lysosomal degradation or recycling of the
ligand-receptor complex or adaptor proteins could form a retrograde transport complex
with or without a signaling endosome (Bronfman and Fainzilber, 2004). A clathrindependent internalization of p75NTR has been demonstrated in PC12 cells, with
internalization occurring 3-fold slower than TrkA internalization in PC12 cells (FreundMichel and Frossard, 2008). This possibly leads to recycling of p75NTR at the cell
membrane (Freund-Michel and Frossard, 2008). p75NTR can also be subjected to
40
regulated intramembrane proteolysis, which means that the intracellular cleavage of
p75NTR could have its own signaling capabilities (Bronfman and Fainzilber, 2004).
In neurons expressing Trk receptors, p75NTR is typically thought to function as an
assistant to NGF signaling through TrkA. In studies in thoracic rat DRG, p75NTR was
found exclusively expressed in cells that also expressed TrkA (Wright and Snider, 1995).
Co-expression of p75NTR with members of the Trk family is thought to enhance binding,
increase sensitivity and to sharpen the discrimination of Trks for their specific
neurotrophin ligand (Barker, 2004; Chao and Hempstead, 1995; Lee et al., 2001; Teng
and Hempstead, 2004). It is also possible that p75NTR forms a complex with TrkA and
NGF, allowing for increased ligand selectivity of TrkA (Chao et al., 2006; Kahle et al.,
1994; Verdi et al., 1994). However, through analysis of the crystal structures of the
extracellular domains of TrkA and NGF, a recent study has determined that the formation
of an actual trimeric NGF- p75NTR-TrkA structure cannot occur (Wehrman et al., 2007).
However, a ligand-passing model has been suggested that involves the rapid binding of
NGF to the extracellular domain of p75NTR, and then NGF binding to TrkA. NGF can
then bind a second TrkA molecule, allowing for dimerization of TrkA upon NGF binding
(Barker, 2007; Wehrman et al., 2007). It is possible that TrkA-p75NTR signaling
pathways are different from TrkA signaling alone (Nykjaer et al., 2005). Convergence of
downstream signaling pathways of TrkA and p75NTR is also a likely possibility for the
communication between TrkA and p75NTR (Freund-Michel and Frossard, 2008).
While in some systems, p75NTR increases TrkA binding affinity for NGF, in other
systems, p75NTR also could function to reduce NGF-TrkA signaling by sequestering NGF,
41
leaving less available to bind TrkA (Coome et al., 1998; Dhanoa et al., 2006; Hannila et
al., 2004; Nykjaer et al., 2005). This scenario is possible in pathophysiological
conditions such as tissue injury or inflammation that involve the increased expression of
NGF; it is possible that TrkA and p75NTR no longer work synergistically in these
situations (Dhanoa et al., 2006). Sprouting is an NGF-mediated process of peripheral
axons. Mice that do not express p75NTR show increased sprouting in cerebellar and spinal
cord sensory neurons (Coome et al., 1998; Scott et al., 2005). p75NTR expression in
sympathetic neurons is important to ensure normal target sympathetic innervation and to
limit axonal arborization in tissues where NGF is elevated, such as in inflammation or
injury (Dhanoa et al., 2006). Increased sprouting in the p75NTR knockout mice has also
been shown for postganglionic sympathetic projections into cerebellum and trigeminal
ganglia (Dhanoa et al., 2006). Mice that over-express NGF and do not express p75NTR
show an increase in sympathetic fiber sprouting in target peripheral tissues, and the
authors suggest that NGF-TrkA signaling is enhanced in situations without p75NTR and
with the over-expression of NGF (Dhanoa et al., 2006). Enhanced sprouting of central
sensory processes is also seen in p75NTR knockout mice after dorsal rhizotomy, again
suggesting that the TrkA-NGF-dependent process of sensory neuron sprouting is
enhanced in the absence of p75NTR. It has been suggested that the binding of NGF to
p75NTR leaves less NGF available to signal via TrkA, thus permitting more NGF-TrkAmediated sprouting (Coome et al., 1998; Hannila and Kawaja, 2005; Miller et al., 1994).
The ratio of p75NTR to TrkA may determine neuronal responsiveness and survival (Chao
et al., 2006).
42
In a knockout mouse model involving the deletion of exon III from the p75NTR
gene, distinct changes were seen in the sensory innervation phenotype (Lee et al., 1992).
The mice had decreased sensory innervation of CGRP and substance P-expressing
neurons in their footpads, which led to loss of heat sensitivity and ulceration of distal
limbs (Lee et al., 1992). This effect was rescued by crossing a human transgene encoding
p75NTR into mutant mice, indicating that p75NTR has an important role in sensory
innervation (Lee et al., 1992). A second line of transgenic mice involves deletion of exon
IV from the p75NTR gene. This line demonstrated a similar decrease in sensory
innervation and decreased temperature sensation as the exon III knockout mice did
(Dhanoa et al., 2006). Changes in levels of sympathetic axonal sprouting have since been
demonstrated in both lines of p75NTR transgenic mice (Coome et al., 1998; Dhanoa et al.,
2006).
It is possible that p75NTR functions in the sensation of pain as well as in
inflammatory plasticity, including long-term changes in sensory pathways after
inflammation. p75NTR is increased in DRG after nerve injury and may be associated with
the neuropathic pain seen after nerve injury (Obata et al., 2006). The neuropeptide
substance P is upregulated and released from sensory neurons after exposure to high
levels of NGF. An in vitro experiment using sensory neurons showed that blockade of
TrkA and p75NTR independently inhibited the release of substance P from these neurons,
suggesting that both TrkA and p75NTR are required for the upregulation and release of
substance P in this system (Skoff and Adler, 2006). Freund’s adjuvant-induced arthritis
is a chronic inflammatory pain model that results from injection of complete Freund’s
43
adjuvant (CFA) into the hindpaw of an experimental animal. This treatment increases
TrkA and p75NTR protein expression in DRG cells and in the dorsal horn of lumbar spinal
cord levels L3-L5, which receive afferents from hind paws (Pezet et al., 2001). This
suggests that this chronic inflammatory pain model involves NGF, which may signal via
TrkA and p75NTR receptors, thus contributing to central neuroplasticity (Pezet et al.,
2001). The mRNA expression of p75NTR is also increased in DRG with peripheral
inflammation resulting from the injection of CFA into the hindpaws of rats (Cho et al.,
1996). The same technique was used in neonatal rats and mRNA expression of p75NTR
and TrkA were upregulated in the DRGs of rat pups, implicating the signaling pathways
of p75NTR and TrkA in the development of sensory and sympathetic neurons and in the
neuroplasticity associated with inflammation in newborn pups (Chien et al., 2007).
The roles o f p75NTR have not been completely resolved, but there are lines of
evidence indicating that it is an active player in neuronal plasticity. Research examining
p75NTR expression in the bladder includes experiments in the streptozotocin (STZ)induced diabetes model, neuropathic bladder in human patients, in experimental nerve
regeneration and in bladder inflammation models (Cho et al., 1996; Elsasser-Beile et al.,
2000; Tong and Cheng, 2005; Vaidyanathan et al., 1998; Wakabayashi et al., 1998;
Wakabayashi et al., 1996; Wakabayashi et al., 1995). STZ is used to model diabetes in
experimental rats and diabetes is often associated with bladder dysfunction (Tong and
Cheng, 2005). Both protein and mRNA expression of NGF were down-regulated in the
bladder of rats with STZ-induced diabetes, and p75NTR mRNA expression is also downregulated (Delcroix et al., 1998; Tong and Cheng, 2005). This reduction in neurotrophic
44
factor as well as neurotrophin receptor could indicate the importance of NGF and the
p75NTR receptor in the maintenance of bladder afferents, and may indicate that the loss of
these in the bladder could lead to the bladder pathology seen with diabetes (Delcroix et
al., 1998; Tong and Cheng, 2005). It is also possible that target-derived changes in NGF
levels drive changes in p75NTR expression (Delcroix et al., 1998). Biopsies taken from
patients with neuropathic bladder were examined with immunohistochemistry for
p75NTR-immunoreactivity (IR) and IR was seen in urothelium as well as in nerve fibers
located near to the urothelium (Vaidyanathan et al., 1998). Nerve crush injury was
performed at the major pelvic ganglion of experimental male rats and regeneration
occurred after about 60 days (Wakabayashi et al., 1998). After this time, bladders were
examined for p75NTR–IR and GAP-43-IR. The density of both p75NTR–IR and GAP-43IR nerve fibers was increased in the bladders 30 days after the crush, implicating both
GAP-43 and p75NTR in nerve regeneration and neuroplasticity in the urinary bladder after
nerve injury (Wakabayashi et al., 1998). A few other studies have examined p75NTR –IR
in the rat urinary bladder with or without CYP-induced cystitis (Wakabayashi et al.,
1996; Wakabayashi et al., 1995). Most of the p75NTR staining found in control bladders
was in nerve fibers running freely in the lamina propria, on the surface of Schwann cells,
and in the vicinity of blood vessels (Wakabayashi et al., 1996; Wakabayashi et al., 1995).
A few nerve fibers were also labeled in the control detrusor and some p75NTR-IR fibers
also co-labeled with tyrosine hydroxylase (Wakabayashi et al., 1995). No staining was
seen in the urothelium (Wakabayashi et al., 1995). Staining after 2 or 3-day CYP
treatment was increased in thick nerve fiber bundles in the smooth muscle. The authors
45
suggested that p75NTR expression in the muscle could be involved in the hyperalgesia
associated with CYP cystitis due to the increased expression of NGF in the urinary
bladder smooth muscle (Wakabayashi et al., 1996).
While it is clear that p75NTR is expressed in urinary bladder reflex pathways and
that its expression is plastic with some pathological conditions, much remains to be
determined. It is likely that the ratio of expression of TrkA to p75NTR receptors
influences the overall NGF binding affinity and signaling effects (Chao and Hempstead,
1995).
While the importance of p75NTR is becoming more clear in many tissue types and
in NGF signaling, virtually nothing is known about p75NTR signaling in the bladder, even
though NGF signaling appears to have importance in bladder activity with and without
bladder inflammation. This dissertation focused on determining the expression and
functional role of p75NTR in the urinary bladder.
46
VI. Project aims and hypotheses
The goal of this project was to examine changes in micturition reflex pathways,
including the urinary bladder, lumbosacral spinal cord and DRG and bladder function
with bladder inflammation using the CYP model of cystitis. The overall hypothesis of
this project is that urinary bladder inflammation induces expression of inflammatory
enzymes and changes in neurotrophin receptor expression that contribute to functional
changes in the urinary bladder. This project focused specifically on the expression of
COX-2 (Aim 1) and p75NTR (Aim 2) in the urinary bladder and micturition reflex
pathways, and on the functional role of p75NTR (Aim 3) in the urinary bladder of
experimental animals.
COX-2 has been implicated in normal bladder function as well as in bladder
hyperreflexia seen with bladder inflammation (Wheeler et al., 2001). Systemic
administration of a COX-2 inhibitor resulted in the attenuation of bladder hyperreflexia
seen with CYP cystitis (Hu et al., 2003). Inflammatory stimuli increases COX-2
expression in inflamed tissues, and COX-2 protein and mRNA expression in the urinary
bladder are increased with CYP treatment (Hu et al., 2003), but the localization and
cellular sources of the COX-2 upregulation remained to be shown. We hypothesized
increased COX-2 expression in specific tissue compartments of the urinary bladder
(urothelium or detrusor) with CYP-induced inflammation. This was the goal of Aim 1,
described in Chapter 2.
47
NGF is also implicated in normal bladder function as well as in the plasticity of
bladder function with cystitis (Chao and Hempstead, 1995; Chuang et al., 2001b). NGF
is increased in the urine of patients with IC/PBS and in experimentally induced
inflammation, and exogenous application of NGF results in bladder hyperreflexia and
increased afferent sensitivity (Clemow et al., 1998; Dmitrieva and McMahon, 1996;
Dmitrieva et al., 1997; Okragly et al., 1999; Zvara and Vizzard, 2007). The specific NGF
tyrosine kinase receptor, TrkA, is increased in bladder afferent cells with CYP. While
there is evidence for a role of NGF and NGF-TrkA signaling in inflammatory responses
as well as in bladder inflammation, thus far very little attention has been paid to the role
that the pan-neurotrophin receptor p75NTR might play in normal micturition reflexes and
how this might change in response to bladder inflammation. Thus, aims 2 and 3 of this
project focused on the expression and function of p75NTR in bladder and micturition reflex
pathways in control and CYP-treated rats. We hypothesized that p75NTR is constitutively
expressed in micturition pathways and upregulated with cystitis. Based on bladder
function effects of TrkA blockade with cystitis, we also hypothesized that p75NTR
blockade in the urinary bladder would also decrease bladder hyperreflexia with cystitis.
The functional role of p75NTR was studied by intravesical blockade by
immunoneutralization with a monoclonal antibody to p75NTR and by PD90780, known to
block NGF-p75NTR binding. A summary of aims and hypotheses for this dissertation
follows below.
48
Aim 1: To determine the expression of COX-2 in urinary bladder urothelium,
suburothelium and detrusor smooth muscle in control animals and after acute and chronic
CYP-induced cystitis.
Hypothesis: COX-2 expression is increased in specific tissue compartments of the
urinary bladder with the bladder inflammation with CYP-induced cystitis.
Aim 2: To determine the expression p75NTR in micturition reflex pathways in control
animals and after CYP-induced cystitis.
Hypothesis: p75NTR is constitutively expressed in micturition reflex pathways and
expression is upregulated with urinary bladder inflammation.
Aim 3: To determine the effect of intravesical p75NTR blockade on bladder function in
both control and CYP treated animals.
Hypothesis: Blockade of p75NTR in urinary bladder decreases voiding frequency in
control rats and decreases bladder hyperreflexia in CYP-treated rats.
49
References for Comprehensive Literature Review
Abrams PH, Sykes JA, Rose AJ, Rogers AF. 1979. The synthesis and release of
prostaglandins by human urinary bladder muscle in vitro. Invest Urol 16(5):346348.
Ahluwalia A, Maggi CA, Santicioli P, Lecci A, Giuliani S. 1994. Characterization of the
capsaicin-sensitive component of cyclophosphamide-induced inflammation in the
rat urinary bladder. Br J Pharmacol 111(4):1017-1022.
Ahmadi S, Lippross S, Neuhuber WL, Zeilhofer HU. 2002. PGE(2) selectively blocks
inhibitory glycinergic neurotransmission onto rat superficial dorsal horn neurons.
Nat Neurosci 5(1):34-40.
Allen SJ, Dawbarn D. 2006. Clinical relevance of the neurotrophins and their receptors.
Clin Sci (Lond) 110(2):175-191.
Aloe L. 2004. Rita Levi-Montalcini: the discovery of nerve growth factor and modern
neurobiology. Trends Cell Biol 14(7):395-399.
Andersson KE, Arner A. 2004. Urinary bladder contraction and relaxation: physiology
and pathophysiology. Physiol Rev 84(3):935-986.
Angelico P, Guarneri L, Velasco C, Cova R, Leonardi A, Clarke DE, Testa R. 2006.
Effect of cyclooxygenase inhibitors on the micturition reflex in rats: correlation
with inhibition of cyclooxygenase isozymes. BJU Int 97(4):837-846.
Barker PA. 2004. p75NTR is positively promiscuous: novel partners and new insights.
Neuron 42(4):529-533.
Barker PA. 2007. High affinity not in the vicinity? Neuron 53(1):1-4.
50
Bautista DM, Jordt SE, Nikai T, Tsuruda PR, Read AJ, Poblete J, Yamoah EN, Basbaum
AI, Julius D. 2006. TRPA1 mediates the inflammatory actions of environmental
irritants and proalgesic agents. Cell 124(6):1269-1282.
Bielefeldt K, Lamb K, Gebhart GF. 2006. Convergence of sensory pathways in the
development of somatic and visceral hypersensitivity. Am J Physiol Gastrointest
Liver Physiol 291(4):G658-665.
Birder LA. 2005. More than just a barrier: urothelium as a drug target for urinary bladder
pain. Am J Physiol Renal Physiol 289(3):F489-495.
Birder LA, de Groat WC. 1992. Increased c-fos expression in spinal neurons after
irritation of the lower urinary tract in the rat. J Neurosci 12(12):4878-4889.
Birder LA, de Groat WC. 1993. Induction of c-fos expression in spinal neurons by
nociceptive and nonnociceptive stimulation of LUT. Am J Physiol 265(2 Pt
2):R326-333.
Birder LA, Wolf-Johnston A, Griffiths D, Resnick NM. 2007. Role of urothelial nerve
growth factor in human bladder function. Neurourol Urodyn 26(3):405-409.
Blok BF, Holstege G. 2000. The pontine micturition center in rat receives direct
lumbosacral input. An ultrastructural study. Neurosci Lett 282(1-2):29-32.
Bon K, Lichtensteiger CA, Wilson SG, Mogil JS. 2003. Characterization of
cyclophosphamide cystitis, a model of visceral and referred pain, in the mouse:
species and strain differences. J Urol 170(3):1008-1012.
Brading AF. 1997. A myogenic basis for the overactive bladder. Urology 50(6A
Suppl):57-67; discussion 68-73.
51
Bronfman FC, Fainzilber M. 2004. Multi-tasking by the p75 neurotrophin receptor:
sortilin things out? EMBO Rep 5(9):867-871.
Buffington CA. 2004. Comorbidity of interstitial cystitis with other unexplained clinical
conditions. J Urol 172(4 Pt 1):1242-1248.
Cannon TW, Damaser MS. 2001. Effects of anesthesia on cystometry and leak point
pressure of the female rat. Life Sci 69(10):1193-1202.
Chao MV, Hempstead BL. 1995. p75 and Trk: a two-receptor system. Trends Neurosci
18(7):321-326.
Chao MV, Rajagopal R, Lee FS. 2006. Neurotrophin signalling in health and disease.
Clin Sci (Lond) 110(2):167-173.
Cheppudira BP. 2006. Characterization of hind paw licking and lifting to noxious radiant
heat in the rat with and without chronic inflammation. J Neurosci Methods.
Chien CC, Fu WM, Huang HI, Lai YH, Tsai YF, Guo SL, Wu TJ, Ling QD. 2007.
Expression of neurotrophic factors in neonatal rats after peripheral inflammation.
J Pain 8(2):161-167.
Cho HJ, Park EH, Bae MA, Kim JK. 1996. Expression of mRNAs for preprotachykinin
and nerve growth factor receptors in the dorsal root-ganglion following peripheral
inflammation. Brain Res 716(1-2):197-201.
Chuang YC, Fraser MO, Yu Y, Beckel JM, Seki S, Nakanishi Y, Yokoyama H,
Chancellor MB, Yoshimura N, de Groat WC. 2001a. Analysis of the afferent limb
of the vesicovascular reflex using neurotoxins, resiniferatoxin and capsaicin. Am
J Physiol Regul Integr Comp Physiol 281(4):R1302-1310.
52
Chuang YC, Fraser MO, Yu Y, Chancellor MB, de Groat WC, Yoshimura N. 2001b. The
role of bladder afferent pathways in bladder hyperactivity induced by the
intravesical administration of nerve growth factor. J Urol 165(3):975-979.
Clemow DB, Steers WD, McCarty R, Tuttle JB. 1998. Altered regulation of bladder
nerve growth factor and neurally mediated hyperactive voiding. Am J Physiol
275(4 Pt 2):R1279-1286.
Cohen SM. 1995. Role of urinary physiology and chemistry in bladder carcinogenesis.
Food Chem Toxicol 33(9):715-730.
Coome GE, Elliott J, Kawaja MD. 1998. Sympathetic and sensory axons invade the
brains of nerve growth factor transgenic mice in the absence of p75NTR
expression. Exp Neurol 149(1):284-294.
Cox PJ. 1979. Cyclophosphamide cystitis--identification of acrolein as the causative
agent. Biochem Pharmacol 28(13):2045-2049.
Dang K, Lamb K, Cohen M, Bielefeldt K, Gebhart GF. 2008. Cyclophosphamideinduced bladder inflammation sensitizes and enhances P2X receptor function in
rat bladder sensory neurons. J Neurophysiol 99(1):49-59.
Dechant G, Barde YA. 2002. The neurotrophin receptor p75(NTR): novel functions and
implications for diseases of the nervous system. Nat Neurosci 5(11):1131-1136.
Delcroix JD, Michael GJ, Priestley JV, Tomlinson DR, Fernyhough P. 1998. Effect of
nerve growth factor treatment on p75NTR gene expression in lumbar dorsal root
ganglia of streptozocin-induced diabetic rats. Diabetes 47(11):1779-1785.
53
Dhanoa NK, Krol KM, Jahed A, Crutcher KA, Kawaja MD. 2006. Null mutations for
exon III and exon IV of the p75 neurotrophin receptor gene enhance sympathetic
sprouting in response to elevated levels of nerve growth factor in transgenic mice.
Exp Neurol 198(2):416-426.
Dickson A, Avelino A, Cruz F, Ribeiro-da-Silva A. 2006. Peptidergic sensory and
parasympathetic fiber sprouting in the mucosa of the rat urinary bladder in a
chronic model of cyclophosphamide-induced cystitis. Neuroscience 141(3):16331647.
Dinis P, Charrua A, Avelino A, Yaqoob M, Bevan S, Nagy I, Cruz F. 2004. Anandamideevoked activation of vanilloid receptor 1 contributes to the development of
bladder hyperreflexia and nociceptive transmission to spinal dorsal horn neurons
in cystitis. J Neurosci 24(50):11253-11263.
Dmitrieva N, McMahon SB. 1996. Sensitisation of visceral afferents by nerve growth
factor in the adult rat. Pain 66(1):87-97.
Dmitrieva N, Shelton D, Rice AS, McMahon SB. 1997. The role of nerve growth factor
in a model of visceral inflammation. Neuroscience 78(2):449-459.
Elbadawi A. 1996. Functional anatomy of the organs of micturition. Urol Clin North Am
23(2):177-210.
Elsasser-Beile U, Gutzeit O, Bauer S, Katzenwadel A, Schultze-Seemann W, Wetterauer
U. 2000. Systemic and local immunomodulatory effects of intravesical BCG
therapy in patients with superficial urinary bladder carcinomas. J Urol
163(1):296-299.
54
Erickson DR. 1999. Interstitial cystitis: update on etiologies and therapeutic options. J
Womens Health Gend Based Med 8(6):745-758.
Erickson DR, Davies MF. 1998. Interstitial cystitis. Int Urogynecol J Pelvic Floor
Dysfunct 9(3):174-183.
FitzGerald MP, Brensinger C, Brubaker L, Propert K. 2006. What is the pain of
interstitial cystitis like? Int Urogynecol J Pelvic Floor Dysfunct 17(1):69-72.
FitzGerald MP, Kenton KS, Brubaker L. 2005. Localization of the urge to void in
patients with painful bladder syndrome. Neurourol Urodyn 24(7):633-637.
Fowler CJ, Griffiths D, de Groat WC. 2008. The neural control of micturition. Nat Rev
Neurosci 9(6):453-466.
Friedman WJ, Greene LA. 1999. Neurotrophin signaling via Trks and p75. Exp Cell Res
253(1):131-142.
Frossard N, Freund V, Advenier C. 2004. Nerve growth factor and its receptors in asthma
and inflammation. Eur J Pharmacol 500(1-3):453-465.
Geppetti P, Nassini R, Materazzi S, Benemei S. 2008. The concept of neurogenic
inflammation. BJU Int 101 Suppl 3:2-6.
Ghoniem GM, Shoukry MS, Monga M. 1996. Effects of anesthesia on urodynamic
studies in the primate model. J Urol 156(1):233-236.
Guerios SD, Wang ZY, Bjorling DE. 2006. Nerve growth factor mediates peripheral
mechanical hypersensitivity that accompanies experimental cystitis in mice.
Neurosci Lett 392(3):193-197.
55
Guerios SD, Wang ZY, Boldon K, Bushman W, Bjorling DE. 2008. Blockade of NGF
and trk receptors inhibits increased peripheral mechanical sensitivity
accompanying cystitis in rats. Am J Physiol Regul Integr Comp Physiol.
Hannila SS, Kawaja MD. 2005. Nerve growth factor-mediated collateral sprouting of
central sensory axons into deafferentated regions of the dorsal horn is enhanced in
the absence of the p75 neurotrophin receptor. J Comp Neurol 486(4):331-343.
Hannila SS, Lawrance GM, Ross GM, Kawaja MD. 2004. TrkA and mitogen-activated
protein kinase phosphorylation are enhanced in sympathetic neurons lacking
functional p75 neurotrophin receptor expression. Eur J Neurosci 19(10):29032908.
Hefti FF, Rosenthal A, Walicke PA, Wyatt S, Vergara G, Shelton DL, Davies AM. 2006.
Novel class of pain drugs based on antagonism of NGF. Trends Pharmacol Sci
27(2):85-91.
Herrera GM, Pozo MJ, Zvara P, Petkov GV, Bond CT, Adelman JP, Nelson MT. 2003.
Urinary bladder instability induced by selective suppression of the murine small
conductance calcium-activated potassium (SK3) channel. J Physiol 551(Pt 3):893903.
Holstege G. 2005. Micturition and the soul. J Comp Neurol 493(1):15-20.
Hu VY, Malley S, Dattilio A, Folsom JB, Zvara P, Vizzard MA. 2003. COX-2 and
prostanoid expression in micturition pathways after cyclophosphamide-induced
cystitis in the rat. Am J Physiol Regul Integr Comp Physiol 284(2):R574-585.
56
Hu VY, Zvara P, Dattilio A, Redman TL, Allen SJ, Dawbarn D, Stroemer RP, Vizzard
MA. 2005. Decrease in bladder overactivity with REN1820 in rats with
cyclophosphamide induced cystitis. J Urol 173(3):1016-1021.
Kahle P, Barker PA, Shooter EM, Hertel C. 1994. p75 nerve growth factor receptor
modulates p140trkA kinase activity, but not ligand internalization, in PC12 cells.
J Neurosci Res 38(5):599-606.
Kalb R. 2005. The protean actions of neurotrophins and their receptors on the life and
death of neurons. Trends Neurosci 28(1):5-11.
Kawatani M, Takeshige C, de Groat WC. 1990. Central distribution of afferent pathways
from the uterus of the cat. J Comp Neurol 302(2):294-304.
Keast JR, Booth AM, de Groat WC. 1989. Distribution of neurons in the major pelvic
ganglion of the rat which supply the bladder, colon or penis. Cell Tissue Res
256(1):105-112.
Kirimoto T, Nakano K, Irimura K, Hayashi Y, Matsuura N, Kiniwa M, Oka T,
Yoshimura N. 2007. Beneficial effects of suplatast tosilate (IPD-1151T) in a rat
cystitis model induced by intravesical hydrochloric acid. BJU Int 100(4):935-939.
Klausner AP, Steers WD. 2004. Corticotropin releasing factor: a mediator of emotional
influences on bladder function. J Urol 172(6 Pt 2):2570-2573.
Kullmann FA, Artim DE, Birder LA, de Groat WC. 2008. Activation of muscarinic
receptors in rat bladder sensory pathways alters reflex bladder activity. J Neurosci
28(8):1977-1987.
57
Lamb K, Zhong F, Gebhart GF, Bielefeldt K. 2006. Experimental colitis in mice and
sensitization of converging visceral and somatic afferent pathways. Am J Physiol
Gastrointest Liver Physiol 290(3):G451-457.
Lanteri-Minet M, Bon K, de Pommery J, Michiels JF, Menetrey D. 1995.
Cyclophosphamide cystitis as a model of visceral pain in rats: model elaboration
and spinal structures involved as revealed by the expression of c-Fos and Krox-24
proteins. Exp Brain Res 105(2):220-232.
Larauche M, Bradesi S, Million M, McLean P, Tache Y, Mayer EA, McRoberts JA.
2008. Corticotropin-releasing factor type 1 receptors mediate the visceral
hyperalgesia induced by repeated psychological stress in rats. Am J Physiol
Gastrointest Liver Physiol 294(4):G1033-1040.
Lecci A, Birder LA, Meini S, Catalioto RM, Tramontana M, Giuliani S, Criscuoli M,
Maggi CA. 2000. Pharmacological evaluation of the role of cyclooxygenase
isoenzymes on the micturition reflex following experimental cystitis in rats. Br J
Pharmacol 130(2):331-338.
Lee FS, Kim AH, Khursigara G, Chao MV. 2001. The uniqueness of being a
neurotrophin receptor. Curr Opin Neurobiol 11(3):281-286.
Lee KF, Li E, Huber LJ, Landis SC, Sharpe AH, Chao MV, Jaenisch R. 1992. Targeted
mutation of the gene encoding the low affinity NGF receptor p75 leads to deficits
in the peripheral sensory nervous system. Cell 69(5):737-749.
Lewin GR, Mendell LM. 1993. Nerve growth factor and nociception. Trends Neurosci
16(9):353-359.
58
Lewin GR, Winter J, McMahon SB. 1992. Regulation of Afferent Connectivity in the
Adult Spinal Cord by Nerve Growth Factor. Eur J Neurosci 4(8):700-707.
Lindholm D, Heumann R, Meyer M, Thoenen H. 1987. Interleukin-1 regulates synthesis
of nerve growth factor in non-neuronal cells of rat sciatic nerve. Nature
330(6149):658-659.
Lowe EM, Anand P, Terenghi G, Williams-Chestnut RE, Sinicropi DV, Osborne JL.
1997. Increased nerve growth factor levels in the urinary bladder of women with
idiopathic sensory urgency and interstitial cystitis. Br J Urol 79(4):572-577.
Maggi CA. 1992. Prostanoids as local modulators of reflex micturition. Pharmacol Res
25(1):13-20.
Maggi CA, Evangelista S, Grimaldi G, Santicioli P, Giolitti A, Meli A. 1984. Evidence
for the involvement of arachidonic acid metabolites in spontaneous and druginduced contractions of rat urinary bladder. J Pharmacol Exp Ther 230(2):500513.
Maggi CA, Giuliani S, Patacchini R, Conte B, Furio M, Santicioli P, Meli P, Gragnani L,
Meli A. 1988. The effect of SC-19220, a prostaglandin antagonist, on the
micturition reflex in rats. Eur J Pharmacol 152(3):273-279.
Maggi CA, Lecci A, Santicioli P, Del Bianco E, Giuliani S. 1992. Cyclophosphamide
cystitis in rats: involvement of capsaicin-sensitive primary afferents. J Auton
Nerv Syst 38(3):201-208.
Maggi CA, Santicioli P, Meli A. 1986. The nonstop transvesical cystometrogram in
urethane-anesthetized rats: a simple procedure for quantitative studies on the
59
various phases of urinary bladder voiding cycle. J Pharmacol Methods 15(2):157167.
Micera A, Lambiase A, Stampachiacchiere B, Bonini S, Levi-Schaffer F. 2007. Nerve
growth factor and tissue repair remodeling: trkA(NGFR) and p75(NTR), two
receptors one fate. Cytokine Growth Factor Rev 18(3-4):245-256.
Michael YL, Kawachi I, Stampfer MJ, Colditz GA, Curhan GC. 2000. Quality of life
among women with interstitial cystitis. J Urol 164(2):423-427.
Miller FD, Kaplan DR. 2001. On Trk for retrograde signaling. Neuron 32(5):767-770.
Miller FD, Speelman A, Mathew TC, Fabian J, Chang E, Pozniak C, Toma JG. 1994.
Nerve growth factor derived from terminals selectively increases the ratio of p75
to trkA NGF receptors on mature sympathetic neurons. Dev Biol 161(1):206-217.
Million M, Wang L, Stenzel-Poore MP, Coste SC, Yuan PQ, Lamy C, Rivier J,
Buffington T, Tache Y. 2007. Enhanced pelvic responses to stressors in female
CRF-overexpressing mice. Am J Physiol Regul Integr Comp Physiol
292(4):R1429-1438.
Mitchell JA, Warner TD. 1999. Cyclo-oxygenase-2: pharmacology, physiology,
biochemistry and relevance to NSAID therapy. Br J Pharmacol 128(6):11211132.
Morgan C, Nadelhaft I, de Groat WC. 1981. The distribution of visceral primary afferents
from the pelvic nerve to Lissauer's tract and the spinal gray matter and its
relationship to the sacral parasympathetic nucleus. J Comp Neurol 201(3):415440.
60
Morrison BW, Christensen S, Yuan W, Brown J, Amlani S, Seidenberg B. 1999.
Analgesic efficacy of the cyclooxygenase-2-specific inhibitor rofecoxib in postdental surgery pain: a randomized, controlled trial. Clin Ther 21(6):943-953.
Murray E, Malley SE, Qiao LY, Hu VY, Vizzard MA. 2004. Cyclophosphamide induced
cystitis alters neurotrophin and receptor tyrosine kinase expression in pelvic
ganglia and bladder. J Urol 172(6 Pt 1):2434-2439.
Nantel F, Denis D, Gordon R, Northey A, Cirino M, Metters KM, Chan CC. 1999.
Distribution and regulation of cyclooxygenase-2 in carrageenan-induced
inflammation. Br J Pharmacol 128(4):853-859.
Ness TJ, Powell-Boone T, Cannon R, Lloyd LK, Fillingim RB. 2005. Psychophysical
evidence of hypersensitivity in subjects with interstitial cystitis. J Urol
173(6):1983-1987.
Nykjaer A, Willnow TE, Petersen CM. 2005. p75NTR--live or let die. Curr Opin
Neurobiol 15(1):49-57.
Obata K, Katsura H, Sakurai J, Kobayashi K, Yamanaka H, Dai Y, Fukuoka T, Noguchi
K. 2006. Suppression of the p75 neurotrophin receptor in uninjured sensory
neurons reduces neuropathic pain after nerve injury. J Neurosci 26(46):1197411986.
Oddiah D, Anand P, McMahon SB, Rattray M. 1998. Rapid increase of NGF, BDNF and
NT-3 mRNAs in inflamed bladder. Neuroreport 9(7):1455-1458.
Okragly AJ, Niles AL, Saban R, Schmidt D, Hoffman RL, Warner TF, Moon TD,
Uehling DT, Haak-Frendscho M. 1999. Elevated tryptase, nerve growth factor,
61
neurotrophin-3 and glial cell line-derived neurotrophic factor levels in the urine of
interstitial cystitis and bladder cancer patients. J Urol 161(2):438-441; discussion
441-432.
Parente L, Perretti M. 2003. Advances in the pathophysiology of constitutive and
inducible cyclooxygenases: two enzymes in the spotlight. Biochem Pharmacol
65(2):153-159.
Pezet S, McMahon SB. 2006. Neurotrophins: Mediators and Modulators of Pain. Annu
Rev Neurosci.
Pezet S, Onteniente B, Jullien J, Junier MP, Grannec G, Rudkin BB, Calvino B. 2001.
Differential regulation of NGF receptors in primary sensory neurons by adjuvantinduced arthritis in the rat. Pain 90(1-2):113-125.
Qiao LY, Vizzard MA. 2002. Cystitis-induced upregulation of tyrosine kinase (TrkA,
TrkB) receptor expression and phosphorylation in rat micturition pathways. J
Comp Neurol 454(2):200-211.
Qiao LY, Vizzard MA. 2004. Up-regulation of phosphorylated CREB but not c-Jun in
bladder afferent neurons in dorsal root ganglia after cystitis. J Comp Neurol
469(2):262-274.
Richardson JD, Vasko MR. 2002. Cellular mechanisms of neurogenic inflammation. J
Pharmacol Exp Ther 302(3):839-845.
Riendeau D, Charleson S, Cromlish W, Mancini JA, Wong E, Guay J. 1997. Comparison
of the cyclooxygenase-1 inhibitory properties of nonsteroidal anti-inflammatory
62
drugs (NSAIDs) and selective COX-2 inhibitors, using sensitive microsomal and
platelet assays. Can J Physiol Pharmacol 75(9):1088-1095.
Rothrock NE, Lutgendorf SK, Kreder KJ, Ratliff T, Zimmerman B. 2001. Stress and
symptoms in patients with interstitial cystitis: a life stress model. Urology
57(3):422-427.
Scott AL, Borisoff JF, Ramer MS. 2005. Deafferentation and neurotrophin-mediated
intraspinal sprouting: a central role for the p75 neurotrophin receptor. Eur J
Neurosci 21(1):81-92.
Skoff AM, Adler JE. 2006. Nerve growth factor regulates substance P in adult sensory
neurons through both TrkA and p75 receptors. Exp Neurol 197(2):430-436.
Stanzel RD, Lourenssen S, Blennerhassett MG. 2008. Inflammation causes expression of
NGF in epithelial cells of the rat colon. Exp Neurol 211(1):203-213.
Steers WD, Tuttle JB. 2006. Mechanisms of Disease: the role of nerve growth factor in
the pathophysiology of bladder disorders. Nat Clin Pract Urol 3(2):101-110.
Stillwell TJ, Benson RC, Jr. 1988. Cyclophosphamide-induced hemorrhagic cystitis. A
review of 100 patients. Cancer 61(3):451-457.
Teng KK, Hempstead BL. 2004. Neurotrophins and their receptors: signaling trios in
complex biological systems. Cell Mol Life Sci 61(1):35-48.
Theoharides TC. 2007. Treatment approaches for painful bladder syndrome/interstitial
cystitis. Drugs 67(2):215-235.
Thompson SW, Dray A, McCarson KE, Krause JE, Urban L. 1995. Nerve growth factor
induces mechanical allodynia associated with novel A fibre-evoked spinal reflex
63
activity and enhanced neurokinin-1 receptor activation in the rat. Pain 62(2):219231.
Tong YC, Cheng JT. 2005. Changes in bladder nerve-growth factor and p75 genetic
expression in streptozotocin-induced diabetic rats. BJU Int 96(9):1392-1396.
Vaidyanathan S, Krishnan KR, Mansour P, Soni BM, McDicken I. 1998. p75 nerve
growth factor receptor in the vesical urothelium of patients with neuropathic
bladder: an immunohistochemical study. Spinal Cord 36(8):541-547.
Verdi JM, Birren SJ, Ibanez CF, Persson H, Kaplan DR, Benedetti M, Chao MV,
Anderson DJ. 1994. p75LNGFR regulates Trk signal transduction and NGFinduced neuronal differentiation in MAH cells. Neuron 12(4):733-745.
Vizzard MA. 2000a. Alterations in spinal cord Fos protein expression induced by bladder
stimulation following cystitis. Am J Physiol Regul Integr Comp Physiol
278(4):R1027-1039.
Vizzard MA. 2000b. Changes in urinary bladder neurotrophic factor mRNA and NGF
protein following urinary bladder dysfunction. Exp Neurol 161(1):273-284.
Vizzard MA. 2000c. Up-regulation of pituitary adenylate cyclase-activating polypeptide
in urinary bladder pathways after chronic cystitis. J Comp Neurol 420(3):335-348.
Vizzard MA. 2001. Alterations in neuropeptide expression in lumbosacral bladder
pathways following chronic cystitis. J Chem Neuroanat 21(2):125-138.
Vizzard MA, Boyle MM. 1999. Increased expression of growth-associated protein (GAP43) in lower urinary tract pathways following cyclophosphamide (CYP)-induced
cystitis. Brain Res 844(1-2):174-187.
64
Wakabayashi Y, Maeda T, Aimi Y, Kwok YN. 1998. Increase of low-affinity
neurotrophin receptor p75 and growth-associated protein-43 immunoreactivities
in the rat urinary bladder during experimentally induced nerve regeneration. J
Urol 160(4):1513-1517.
Wakabayashi Y, Maeda T, Kwok YN. 1996. Increase of p75 immunoreactivity in rat
urinary bladder following inflammation. Neuroreport 7(6):1141-1144.
Wakabayashi Y, Tomoyoshi T, Tooyama I, Kitahama K, Kim SU, Maeda T. 1995. Lowaffinity nerve growth factor receptor immunoreactivity in the human urinary
bladder. Neurosci Lett 186(1):9-12.
Wang ZY, Wang P, Merriam FV, Bjorling DE. 2008. Lack of TRPV1 inhibits cystitisinduced increased mechanical sensitivity in mice. Pain.
Watson NA, Notley RG. 1973. Urological complications of cyclophosphamide. Br J Urol
45(6):606-609.
Wehrman T, He X, Raab B, Dukipatti A, Blau H, Garcia KC. 2007. Structural and
mechanistic insights into nerve growth factor interactions with the TrkA and p75
receptors. Neuron 53(1):25-38.
Westropp JL, Buffington CA. 2002. In vivo models of interstitial cystitis. J Urol 167(2 Pt
1):694-702.
Wheeler MA, Yoon JH, Olsson LE, Weiss RM. 2001. Cyclooxygenase-2 protein and
prostaglandin E(2) production are up-regulated in a rat bladder inflammation
model. Eur J Pharmacol 417(3):239-248.
65
Wong ST, Henley JR, Kanning KC, Huang KH, Bothwell M, Poo MM. 2002. A
p75(NTR) and Nogo receptor complex mediates repulsive signaling by myelinassociated glycoprotein. Nat Neurosci 5(12):1302-1308.
Woolf CJ, Allchorne A, Safieh-Garabedian B, Poole S. 1997. Cytokines, nerve growth
factor and inflammatory hyperalgesia: the contribution of tumour necrosis factor
alpha. Br J Pharmacol 121(3):417-424.
Wright DE, Snider WD. 1995. Neurotrophin receptor mRNA expression defines distinct
populations of neurons in rat dorsal root ganglia. J Comp Neurol 351(3):329-338.
Yokoyama O, Yoshiyama M, Namiki M, de Groat WC. 1997. Influence of anesthesia on
bladder hyperactivity induced by middle cerebral artery occlusion in the rat. Am J
Physiol 273(6 Pt 2):R1900-1907.
Yoshimura N, Bennett NE, Hayashi Y, Ogawa T, Nishizawa O, Chancellor MB, de Groat
WC, Seki S. 2006. Bladder overactivity and hyperexcitability of bladder afferent
neurons after intrathecal delivery of nerve growth factor in rats. J Neurosci
26(42):10847-10855.
Yoshimura N, de Groat WC. 1999. Increased excitability of afferent neurons innervating
rat urinary bladder after chronic bladder inflammation. J Neurosci 19(11):46444653.
Yu Y, de Groat WC. 2008. Sensitization of pelvic afferent nerves in the in vitro rat
urinary bladder-pelvic nerve preparation by purinergic agonists and
cyclophosphamide pretreatment. Am J Physiol Renal Physiol 294(5):F1146-1156.
66
Zvara P, Vizzard MA. 2007. Exogenous overexpression of nerve growth factor in the
urinary bladder produces bladder overactivity and altered micturition circuitry in
the lumbosacral spinal cord. BMC Physiol 7:9.
Zweifel LS, Kuruvilla R, Ginty DD. 2005. Functions and mechanisms of retrograde
neurotrophin signalling. Nat Rev Neurosci 6(8):615-625.
67
Chapter 2: Expression of Cyclooxygenase-2 in Urinary Bladder in Rats
with Cyclophosphamide-induced Cystitis
Klinger, M.B., A. Dattilio, M.A. Vizzard. (2007). Expression of
cyclooxygenase-2 in urinary bladder in rats with cyclophosphamideinduced cystitis. American Journal of Physiology: Regulatory,
Integrative and Comparative Physiology, 293: R677-R685.
68
Abstract
These studies examined the expression of cyclooxygenase-2 (COX-2) expression in the
urothelium and suburothelial space and detrusor from rats treated with cyclophosphamide
(CYP) to induce acute (4 hr), intermediate (48 hr) or chronic (10 day) cystitis. Western
blotting and immunohistochemistry were used to demonstrate COX-2 expression. In
whole mount preparations of urinary bladder, nerve fibers in the suburothelial plexus and
inflammatory cell infiltrates were characterized for COX-2 expression after CYP-induced
cystitis. COX-2 expression significantly (p ≤ 0.01) increased in the urothelium +
suburothelium and detrusor smooth muscle with acute, intermediate and chronic (10 day)
CYP-induced cystitis but expression in urothelium + suburothelium was significantly
greater. CYP-induced upregulation of COX-2 showed by immunostaining in the
urothelium + suburothelium was similar to that observed with western blotting and also
demonstrated COX-2 inflammatory cell infiltrates (CD86+) and nerve fibers (PGP+) in
the suburothelial plexus. Although COX-2 expression was significantly (p ≤ 0.01)
increased in detrusor smooth muscle, immunohistochemistry failed to demonstrate an
obvious change in COX-2-IR in detrusor muscle but COX-2 inflammatory infiltrates
were present throughout the detrusor. COX-2-IR nerve fibers exhibited increased density
in the suburothelial plexus with acute or chronic CYP-induced cystitis. COX-2-IR
macrophages (CD86+) were present throughout the urinary bladder with acute and
chronic CYP-induced cystitis. These studies demonstrate cellular targets in the urinary
bladder where COX-2 inhibitors may act.
69
Introduction
Experiments involving a chemically (cyclophosphamide, CYP)-induced urinary
bladder inflammation have demonstrated alterations in neurochemical (Braas et al., 2006;
Dattilio and Vizzard, 2005; Vizzard, 2001), organizational (Vizzard, 2000b; Vizzard and
Boyle, 1999) and electrophysiological (Yoshimura and de Groat, 1999) properties of
micturition reflex pathways. Possible mechanisms underlying the neural plasticity
following CYP-induced cystitis may involve altered expression of neurotrophic factors
(Murray et al., 2004; Vizzard, 2000b), cytokines (Malley and Vizzard, 2002) and/or
neural activity in the urinary bladder. The presence of proinflammatory cytokines and
growth factors can induce cyclooxygenase-2 (COX-2), an inflammatory response gene
(Mitchell and Warner, 1999). CYP-induced cystitis induces a number of neurotrophic
factors (Murray et al., 2004; Vizzard, 2000b), including nerve growth factor, in the
urinary bladder and pelvic ganglia.
In addition to COX-2 being induced in response to inflammatory stimuli
(Fujisawa et al., 2005; Hu et al., 2003; Linden et al., 2004; Mitchell and Warner, 1999;
Schafers et al., 2004; Yiangou et al., 2006), studies have demonstrated upregulation of
COX-2 in the urinary bladder as a result of urinary bladder outlet obstruction (Park et al.,
1999; Park et al., 1997) and postnatal development (Park et al., 1997). Complete bladder
outlet obstruction in mice significantly upregulated COX-2 expression in detrusor smooth
muscle cells and this has been suggested to be a result of mechanical stretch (Park et al.,
1999). During development, embryonic expression of COX-2 transcript in bladder is
70
100-fold higher compared to postnatal or adult bladder (Park et al., 1997). In our previous
studies, COX-2 mRNA was increased in the whole urinary bladder after acute and
chronic CYP treatment (Hu et al., 2003). COX-2 protein expression in inflamed bladders
paralleled that of COX-2 mRNA (Hu et al., 2003). Prostaglandins generated by the COX2 enzyme are also mediators of altered neuronal activity in inflamed tissues and have
been demonstrated to stimulate the micturition reflex, possibly through activation of
capsaicin sensitive bladder afferents (Andersson and Wein, 2004; Maggi, 1992; Maggi et
al., 1988a). Prostaglandins have been suggested to play a physiological role in
contributing to the basal tone of the detrusor and modulating activity of bladder nerves
(Andersson and Wein, 2004; Maggi, 1992; Maggi et al., 1988a). A number of COX-2
inhibitors have also been shown to increase bladder capacity in experimental cystitis
induced by CYP (Hu et al., 2003; Lecci et al., 2000).
An increase in COX-2 expression induced by complete bladder outlet obstruction
has been specifically localized to the detrusor smooth muscle cells (Park et al., 1999).
With respect to COX-2 upregulation induced by CYP-induced cystitis (Hu et al., 2003),
there is currently no information that addresses the cellular sources in the urinary bladder
that express COX-2 with bladder inflammation of varying duration. The purpose of this
study was to determine: (1) COX-2 protein expression in the urothelium + suburothelium
compared to detrusor smooth muscle by western blotting after CYP-induced cystitis of
varying duration; (2) cellular location of COX-2 in urinary bladder of control rats or after
CYP-induced cystitis using immunohistochemistry with an emphasis on urothelial cell,
nerve fiber and inflammatory cell infiltrate expression; (3) intensity of COX-2
71
immunoreactivity in the urothelium after CYP-induced cystitis using semi-quantitative
image analysis. In contrast to COX-2 expression in detrusor smooth muscle cells with
outlet obstruction (Park et al., 1999), the present study demonstrates robust expression of
COX-2 protein in the urothelium, inflammatory cell infiltrates and to a lesser extent,
detrusor smooth muscle with CYP-induced cystitis.
72
Materials and Methods
Adult female Wistar rats (150 - 250g) were purchased from Charles River Canada
(St. Constant, Canada). Chemicals used in these studies were purchased from Sigma
ImmunoChemicals (St. Louis, MO). Primary antibodies for immunohistochemistry were
purchased from commercial sources (Tables 1). Secondary antibodies were purchased
from Jackson ImmunoResearch, West Grove, PA (Table 1).
Cyclophosphamide (CYP)-Induced Cystitis-Acute, Intermediate or Chronic
Chemical cystitis was induced in adult female Wistar rats by CYP treatment.
CYP is metabolized to acrolein, an irritant eliminated in the urine (Cox, 1979a). CYP
was administered in one of the following ways (Corrow and Vizzard, 2007a): (1) 4 hr
(150 mg/kg; i.p.) prior to euthanasia of the animals to elicit acute inflammation (n = 21);
(2) 48 hr (150 mg/kg; i.p.) prior to euthanasia to examine an intermediate inflammation
(n = 21) or (3) administered every third day for 10 days to elicit chronic inflammation (n
= 21; 75 mg/kg; i.p). All injections of CYP were performed under isoflurane (2%)
anesthesia. Control animals (n= 21) were gender matched to the experimental groups and
received a corresponding volume of saline (0.9%) or distilled water injected (i.p.) under
isoflurane (2%) anesthesia. Animals were euthanized by isoflurane anesthesia (4%) plus
thoracotomy at the indicated time points and the urinary bladder was harvested and
weighed. The University of Vermont IACUC approved all experimental procedures
(#06-014) involving animal use. Animal care was under the supervision of UVM’s
Office of Animal Care in accordance with AAALAC and NIH guidelines. All efforts
73
were made to minimize animal stress/distress and suffering and to use the minimum
number of animals.
Western Blotting for COX-2
The urothelium + suburothelium was dissected from the detrusor smooth muscle
using fine forceps under a dissecting microscope (Dattilio and Vizzard, 2005).
Urothelium + suburothelium or detrusor were homogenized separately in tissue protein
extraction agent with protease inhibitors (Roche, Indianapolis, IN) and aliquots were
removed for protein assay. Samples (20 µg) were suspended in sample buffer for
fractionation on gels and subjected to SDS-PAGE. Proteins were transferred to
nitrocellulose membranes and efficiency of transfer was evaluated. Membranes were
blocked overnight in a solution of 5% milk, 3% bovine serum albumin in Tris-Buffered
Saline with 0.1% Tween. Membranes were incubated in goat anti-COX-2 (Table 1)
overnight at 4 oC. Washed membranes were incubated in a species-specific secondary
antibody (Table 1) for 2 hr at room temperature for enhanced chemiluminescence
detection (Pierce, Rockford, IL). Blots were exposed to Biomax film (Kodak, Rochester,
NY), and developed. The intensity of each band was analyzed and background
intensities subtracted using Un-Scan It software (Silk Scientific, Orem, UT). Human
recombinant COX-2 (1:1000; Cayman Chemical Co., Ann Arbor, MI) was used as a
positive control and Western blotting of erk1 and erk2 (1:1000; Cell Signaling
Technology, Danvers, MA) in samples was used as a loading control. Additional loading
controls including GAPDH and L32 revealed identical results to those obtained with
74
erk1/2. Preabsorption of COX-2 antisera with appropriate immunogen (1 µg ml-1)
reduced staining in blots to background levels. To confirm the specificity of our split
bladder preparations, urothelium + suburothelium and detrusor samples were examined
for the presence of α-smooth muscle actin and uroplakin II by western blotting. In
urothelium + suburothelium samples, only uroplakin II was present. Conversely, in
detrusor samples, only α-smooth muscle actin was present.
Immunohistochemistry
Cryostat sections of the bladder (10 µm) from control (n = 7) and experimental
treatments (acute, intermediate, chronic CYP-induced cystitis; n = 7 each) were examined
for COX-2 immunoreactivity (IR). The urinary bladder was post-fixed in 4%
paraformaldehyde, placed in ascending concentrations of sucrose (10-30%) in 0.1 M PBS
for cryoprotection, sectioned on a freezing cryostat and directly mounted on gelled
(0.5%) microscope slides for on-slide processing (Vizzard, 1997). Briefly, sections were
incubated overnight at room temperature with mouse anti-COX-2 (Table 1) in 1% donkey
serum and 0.1 M PBS, and then washed (3 × 10 min) with 0.1 M PBS, pH 7.4. The
tissues were then incubated with secondary antibody (Table 1) for 2 hr at room
temperature. Following washing, the slides were coverslipped with Citifluor (Citifluor
Ltd., London). Control sections incubated in the absence of primary or secondary
antibody were also processed and evaluated for specificity or background staining levels.
In the absence of primary antibody, no positive immunostaining was observed.
Whole Mount Bladder Preparation
75
The urinary bladder from control (n = 5) and experimental treatments (n = 5 each)
was dissected and placed in Krebs solution. The bladder was cut open along the midline
and pinned to a sylgard-coated dish. The bladder was incubated for 1.5 hr at room
temperature in cold fixative (2% paraformaldehyde + 0.2% picric acid) and urothelium
removed as previously described (Zvarova and Vizzard, 2005). Urothelium and bladder
musculature were processed for COX-2-IR (as described above). Whole mounts stained
for COX-2 were also stained with antiserum to the pan-neuronal marker, protein gene
product (PGP)9.5. COX-2-immunoreactive cells and associated processes in the
suburothelial space were obvious with CYP treatment but were not PGP positive. To
determine the cell types expressing COX-2-IR in the suburothelial region and throughout
the urinary bladder, additional immunostaining for COX-2 and markers of intermediate
filaments (GFAP, vimentin), glial and Schwann cells (S-100), interstitial cells (c-kit),
macrophages, dendritic cell populations and monocytes (CD86), and activated B
lymphocytes (CD80) was performed (Table 1). For single staining for COX-2-IR, we
used a mouse anti-COX-2 antibody (Table 1). For double staining procedures, either a
mouse anti-COX-2 or rabbit anti-COX-2 antibody was used depending upon the host of
the other primary antibody (Table 1). COX-2-IR in the urinary bladder was equivalent
with either the mouse anti-COX-2 or rabbit anti-COX-2 antibody. Control (n = 4) and
CYP-treated tissues (n = 4 each) were incubated overnight at room temperature in a
cocktail of COX-2 antiserum (as above) plus PGP, vimentin, GFAP, S-100, c-kit, CD80
or CD86 (Table 1). After washing, the tissues were incubated in a cocktail of species-
76
specific secondary antibodies (Table 1) for 2 h at room temperature, followed by washing
and coverslipping.
Assessment of Positively Stained Urinary Bladder Regions
Immunohistochemistry on bladder sections or whole mounts was performed on
control and experimental tissues simultaneously to reduce the incidence of staining
variation that can occur between tissues processed on different days. Staining observed
in experimental tissue was compared to that observed from experiment-matched negative
controls. Urinary bladder sections or whole mounts exhibiting immunoreactivity that was
greater than the background level observed in experiment-matched negative controls
were considered positively stained.
Visualization and quantitative analysis of COX-2 –IR in urothelium
Six to 10 urinary bladder sections from control and experimental groups were
examined under an Olympus fluorescence photomicroscope with a multiband filter set for
simultaneous visualization of the Cy3 and Cy2 fluorophores. Cy3 was visualized with a
filter with an excitation range of 560-596 nm and an emission range from 610-655 nm.
Cy2 was viewed by using a filter with an excitation range of 447-501 nm and an emission
range from 510-540 nm. Quantification of COX-2-IR in the urothelium was performed as
previously described (LaBerge et al., 2006a; Yuridullah et al., 2006). Grayscale images
acquired in tiff format were imported into Meta Morph image analysis software (version
4.5r4; Universal Imaging, Downingtown, PA). The opened image was first calibrated for
pixel size by applying a previously created calibration file. The free hand drawing tool
was selected and the urothelium was drawn and measured in total pixels area. A
77
threshold encompassing an intensity range of 100-250 grayscale values was applied to the
region of interest in the least brightly stained condition first. The same threshold was
subsequently used for all images. Percent COX-2 expression above threshold in the total
area selected was then calculated. Quantification of COX-2 expression in nerve fibers in
the suburothelial plexus was performed as previously described (Corrow and Vizzard,
2007a; LaBerge et al., 2006a; Yuridullah et al., 2006) and modified from Brady et al.
(Brady et al., 2004). Grayscale images acquired in tiff format were imported into Image J
(Abramoff et al., 2004) and images were thresholded. Images were acquired from the
trigone region of the suburothelial plexus in control and treated rats. A rectangle of fixed
dimension (500 x 500 pixels) was placed on the section according to a random selection
of x and y coordinates. This process was repeated 7 times for each image. The average
density of COX-2-IR nerve fibers was then calculated.
Statistics
All values are means ± S.E.M. Comparisons of COX-2 densitometry values from
western blots of urinary bladder samples were made using ANOVA. Percentage data
from image analysis were arcsin transformed to meet the requirements of this statistical
test. Animals, processed and analyzed on the same day, were tested as a block in the
ANOVA. When F ratios exceeded the critical value (p ≤ 0.05), the Dunnett’s post-hoc
test was used to compare the control means with each experimental mean.
Figure Preparation
Digital images were obtained using a CCD camera (MagnaFire SP; Optronics;
Optical Analysis Corp., Nashua, NH) and LG-3 frame grabber attached to an Olympus
78
microscope (Optical Analysis Corp.). Exposure times were held constant when acquiring
images from control and experimental animals processed and analyzed on the same day.
Images were imported into Adobe Photoshop 7.0 (Adobe Systems Incorporated, San
Jose, CA) where groups of images were assembled and labeled.
79
Results
COX-2 protein expression in detrusor smooth muscle, urothelium + suburothelium
with CYP-induced cystitis
COX-2 protein expression in detrusor as determined by western blotting significantly (p
≤ 0.01) increased (6-fold) with acute (4 h), intermediate (48 h; 4.2-fold) or chronic CYPtreatment (6.3-fold)(Fig. 1A, B). COX-2 protein expression in urothelium +
suburothelium also significantly (p ≤ 0.01) increased with acute (15-fold), intermediate
(16-fold) or chronic (17-fold) CYP treatment (Fig. 1C, D). Basal COX-2 expression in
detrusor was significantly (p ≤ 0.01) greater than that in urothelium + suburothelium.
The fold-increase in COX-2 expression in the urothelium + suburothelium induced by
CYP-induced cystitis was significantly (p ≤ 0.01) greater at all time points examined
compared to detrusor (Fig. 1E).
COX-2-Immunoreactivity (IR) in Urinary Bladder with CYP-Induced Cystitis
The expression of COX-2-IR was virtually absent in the urothelium of urinary
bladder sections from control rats (Fig. 2A). However, some COX-2-IR was present in
the detrusor smooth muscle of control rats (Fig. 2A). With acute (4 hr; Fig. 2B, C),
intermediate (48 hr) and chronic CYP-treatment (Fig. 2D, E), COX-2-IR was increased
primarily in the urothelium and in the suburothelial region. COX-2-IR in the urothelium
and suburothelial regions induced by cystitis was non-homogenous throughout the
urothelium; patchy in appearance and intensity. COX-2-IR was present in detrusor
smooth muscle with CYP-treatment but changes in COX-2 staining intensity were not
80
obvious. We chose to focus the quantitation of COX-2 expression on the urothelium
because expression was dramatically and obviously upregulated in the urothelium with
CYP-treatment. COX-2 expression in the urothelium significantly (p ≤ 0.001) increased
in the urothelium with acute (4 hr; 2.4-fold), and chronic CYP-treatment (3.5-fold).
COX-2 expression in urinary bladder nerve fibers and inflammatory infiltrates
after CYP treatment
To determine if COX-2-IR was present in the suburothelial nerve plexus, whole
mount preparations of urinary bladder were prepared to aid in the visualization of the
nerve plexus. COX-2-IR nerve fibers were observed in the suburothelial plexus from
control rats (Fig. 3A) and the density significantly (p ≤ 0.01) increased with CYPinduced cystitis (4 hr; Fig. 3B and chronic; Fig. 3D, Fig. 3E). COX-2-IR nerve fibers
were most obvious in the trigone region. COX-2-IR nerve fibers in suburothelial nerve
plexus exhibited colocalization with the pan-neuronal marker, PGP9.5 (Fig. 4). In whole
mount and sections of the urinary bladder after CYP treatment of all durations, fusiform
cells with short processes in the suburothelial region were observed to exhibit COX-2-IR
(Fig. 2C-F). In whole mounts, these cells and processes were located in a different focal
plane compared to the suburothelial plexus (Fig. 3, Fig. 5B). COX-2-IR cells were
abundant within the suburothelial region (Fig. 2B-E) and scattered throughout the
detrusor smooth muscle in bladder sections. These cells displayed a similar morphology
to macrophages previously described in the urinary bladder after CYP-induced cystitis
(Corrow and Vizzard, 2007a) but we pursued additional double-labeling studies with
markers of other cellular candidates based upon morphology to determine the identity of
81
these cells (Table 2). Double-labeling experiments of urinary bladder sections or whole
mount preparations demonstrated that these COX-2-IR cells expressed the CD86 antigen
(e.g., macrophages, dendritic cells) (Fig. 2F; Fig. 5B) (Table 2) but did not express
immunoreactivity for vimentin, GFAP, c-kit, S-100 or CD80 (Table 2).
82
Discussion
These studies demonstrate several novel findings with respect to COX-2 expression in
micturition reflexes with CYP-induced cystitis. COX-2 expression is significantly
increased in the urothelium + suburothelium and detrusor smooth muscle with acute (4
hr), intermediate (48 hr) and chronic (10 day) CYP-induced cystitis as determined by
western blotting but expression in urothelium + suburothelium is significantly greater.
COX-2 immunostaining in the urothelium + suburothelium generally mirrored that
observed by western blotting and also demonstrated COX-2 inflammatory cell infiltrates
and nerve fibers in the suburothelial plexus. Although COX-2 expression was
significantly increased in detrusor smooth muscle as determined by western blotting,
immunostaining failed to demonstrated an obvious change in COX-2-IR in detrusor
muscle but COX-2 inflammatory infiltrates were present throughout the detrusor. COX2-IR nerve fibers exhibited increased density in the suburothelial plexus in whole mount
preparations with acute or chronic CYP-induced cystitis. Migration of macrophages
(CD86+) in the suburothelial space and detrusor with CYP-induced cystitis is dramatic
and expression of COX-2-IR is present in both acute and chronic inflammation of the
urinary bladder. Inhibitors of COX-2 that have been shown to reduce bladder
overactivity (Hu et al., 2003; Jang et al., 2006; Lecci et al., 2000) with bladder
inflammation are likely to exert effects on the urothelium, inflammatory cell infiltrates
and suburothelial nerve plexus among other targets.
83
A number of previous studies have demonstrated roles for COX-2 and
prostaglandins in bladder overactivity induced by bladder inflammation (Angelico et al.,
2006; Hu et al., 2003; Jang et al., 2006; Lecci et al., 2000; Maggi, 1992; Maggi et al.,
1988a). It has previously been suggested that prostanoids are key mediators following the
induction of CYP-induced cystitis (48 hr) (Hu et al., 2003; Lecci et al., 2000). Our
previous studies (Hu et al., 2003) have also demonstrated mRNA and protein for COX-2
upregulation in whole urinary bladder with CYP-induced cystitis. PGE2 and PGD2
expression in the urinary bladder with acute, intermediate and chronic CYP-induced
cystitis is also increased (Hu et al., 2003). Previous studies using selective or nonselective inhibitor of COX-2 demonstrated an increase in bladder capacity in rodents
treated with CYP (Angelico et al., 2006; Hu et al., 2003; Lecci et al., 2000). In these
studies (Angelico et al., 2006; Hu et al., 2003; Lecci et al., 2000), COX-2 inhibitors were
delivered systemically and any understanding of potential sites of action was limited. In
addition, our previous study (Hu et al., 2003) used whole urinary bladder with no
emphasis on cell types in the urinary bladder that may express COX-2 with CYP-induced
cystitis. In the present study, we demonstrate several potential sites of action of such
inhibitors in the urinary bladder including the urothelium, macrophages and suburothelial
nerve plexus. The functional studies are consistent with an effect of COX-2 inhibitors on
bladder afferents or urothelium (increased bladder capacity, reduced micturition
frequency) (Hu et al., 2003; Lecci et al., 2000). The present studies also provide
anatomical data to support the use of an intravesical route of administration of COX-2
inhibitors (Jang et al., 2006) in reducing bladder overactivity induced by CYP.
84
A number of reports have demonstrated upregulation of COX-2 in response to
inflammatory stimuli (Fujisawa et al., 2005; Hu et al., 2003; Linden et al., 2004; Mitchell
and Warner, 1999; Schafers et al., 2004; Yiangou et al., 2006). A recent report (Liu et
al., 2006) emphasizes the inclusion of a number of controls to be certain that a signal
obtained by western blotting, is, indeed, reflective of COX-2. We have performed each
of these suggested controls. [1] We have included a purified, recombinant COX-2
protein as a positive control in our western blots that is located at 74-kD. A review of the
literature reveals that the mature, enzymatically active form of COX-2 is located in the
70- to 74-kD range on denaturing acrylamide gel electrophoresis. This is consistent with
the COX-2 protein identified from urinary bladders in the present and previous (16)
study. The difference in band location for the positive control and the samples may be
attributed to several issues: species differences as the positive control is from human,
nonglycosylated forms of COX-2 and/or incomplete proteolysis. [2] We have identified
(16) increased COX-2 mRNA in urinary bladder induced by CYP treatment to further
support our western blot results. [3] We have demonstrated upregulation of two
prostaglandins (PG), PGE2 and PGD2, in urinary bladder with CYP treatment as further
evidence that COX-2 may affect bladder function through downstream activation of PG
(16).
Immunohistochemical studies demonstrated that increases in COX-2 protein
determined by western blotting are a reflection of increased urothelial cell expression of
COX-2, COX-2-IR macrophages (CD86+), and COX-2-IR nerve fibers in the
suburothelial plexus. A number of studies have demonstrated COX-2-IR in nerves (i.e.,
85
endoneurium) in response inflammatory stimuli alone or as a result of neural injury
(Durrenberger et al., 2006; Pesce et al., 2006). In the present study, we have confirmed
that COX-2-IR is present in nerve in the suburothelial plexus and that COX-2-IR nerve
fibers increase in density in the trigone region of the urinary bladder with acute and
chronic CYP-induced cystitis. One limitation to this study is the method used to
determine density of innervation. All COX-2-IR structures in the whole mount within the
same plane of focus are captured in the frame and density determination is performed on
all COX-2-IR structures. Therefore, COX-2-IR macrophages or other COX-2-IR
inflammatory cell infiltrates of unknown cellular phenotype may have increased the
density determinations that we have attributed to nerve fibers. However, a large
proportion of the COX-2-IR nerve fibers were not located in the same focal plane as the
macrophages so we feel that this possibility is limited in the present study. Afferent
nerve fibers make a large contribution to this neural plexus although some contribution
from efferent sources cannot be ruled out (Dixon et al., 2000). Previous studies have
shown COX-2-IR in primary afferent cells in dorsal root ganglia (Vizzard et al.,
preliminary data) (Dou et al., 2004; Durrenberger et al., 2006) and therefore there is
precedent for COX-2 expression in afferent nerves.
Urothelial cells share a number of similarities with sensory neurons and the
urothelium has been suggested (Birder, 2005; 2006) to have ‘neuronal-like’ properties.
Urothelial cells express a number of receptors and ion channels similar to those found in
sensory neurons (Birder, 2005; 2006; Corrow and Vizzard, 2007a; LaBerge et al., 2006a;
Murray et al., 2004) and it was therefore not surprising to observe COX-2 expression in
86
the urothelium after CYP-induced cystitis. COX-2-IR in the urothelium was observed in
apical, intermediate and basal cells. Immortalized human urothelial cells express COX-2
and inducible nitric oxide synthase (iNOS) after stimulation of β-adrenergic receptors
(Harmon et al., 2005). The present study adds to the growing list of similarities between
urothelial cells and sensory neurons and may also suggest that urothelial cells participate
in the transduction of inflammatory signals to the central nervous system (Birder, 2005;
2006).
A number of previous studies have also demonstrated COX-2 expression in
macrophages (Tsai et al., 2007; Yamashita et al., 2007; Yiangou et al., 2006).
Surprisingly, in our previous study (Hu et al., 2003), we failed to demonstrate COX-2-IR
in macrophages, although present in the bladder after CYP-induced cystitis, but
demonstrated COX-2-IR in mast cells in the inflamed bladder. In the present study, the
immunostaining confirms that a proportion of COX-2-IR in the suburothelial space and
detrusor express the antigen CD86. Although our present study does not rule out a
contribution from mast cells, the prominent, cellular staining in the suburothelial region
largely represents macrophages. The reason for this difference is not known but likely
reflects our choice of COX-2 antiserum as has been suggested in the COX-2 literature
(Yiangou et al., 2006). We used a monoclonal COX-2 antibody in the present study
because the polyclonal antibody used in our previous study was inconsistent in its
staining for this study.
Previous studies have demonstrated robust COX-2 expression in the detrusor
smooth muscle after complete bladder outlet obstruction in mice and this increase has
87
been attributed to mechanical stretch (Park et al., 1999; Park et al., 1997). In contrast, no
COX-2 expression was present in the urothelium or suburothelial region in control tissues
or after outlet obstruction (Park et al., 1999; Park et al., 1997). The present study clearly
demonstrates a larger COX-2 contribution from the urothelium and suburothelial region
in response to CYP-induced cystitis. This difference probably is a reflection of COX-2
protein induced by an inflammatory stimulus versus a mechanical stimulus. In both
bladder inflammation and outlet obstruction, COX-2 is either demonstrated or
hypothesized to contribute to bladder overactivity/hyperactivity (Hu et al., 2003; Lecci et
al., 2000; Park et al., 1999; Park et al., 1997) although the source of COX-2 and resultant
production of prostaglandins is likely to be different. It is interesting that COX-2 is
highly expressed in the urinary bladder during development and that bladder outlet
obstruction represents reactivation of this gene (Park et al., 1997). The urinary bladder
during early postnatal development exhibits spontaneous bladder contractions (Ng et al.,
2007; Park et al., 1997) but the contribution of COX-2 to this function is presently
unknown.
COX-2 expression can be stimulated by growth factors, proinflammatory
cytokines and chemokines (Khanapure et al., 2007; Yermakova and O'Banion, 2000).
Changes in neurotrophic factor expression in the urinary bladder with cystitis including
β-nerve growth factor, brain-derived neurotrophic factor, glial cell line-derived
neurotrophic factor, neurotrophin (NT)-3 and NT-4 (Murray et al., 2004; Vizzard, 2000b)
have been demonstrated. Robust (Malley and Vizzard, 2002) changes in a number of
urinary bladder cytokines including IL-1-β, IL-2, IL-4, IL-6 and more modest changes in
88
TNF-α/ or TNF-β with CYP-induced cystitis have also been demonstrated. Most
recently, we have demonstrated upregulation of the chemokine, fractalkine, and
fractalkine receptor in the urinary bladder and specifically in the urothelium with CYPinduced cystitis (Yuridullah et al., 2006). Separately or in combination, neurotrophic
factors, proinflammatory cytokines and chemokines expressed in the inflamed urinary
bladder may also contribute to COX-2 upregulation.
In summary, these studies have demonstrated significant changes in COX-2
expression in the urinary bladder after CYP-induced cystitis examined at three time
points (acute, intermediate and chronic). Specifically, COX-2 expression is significantly
increased in the urothelium, in nerve fibers in the suburothelial plexus and in
macrophages in the suburothelial space. Although western blotting demonstrates COX-2
expression in detrusor smooth muscle, this change likely reflects COX-2 expression in
inflammatory cell infiltrates as immunostaining for COX-2 in detrusor smooth muscle
did not exhibit robust changes in COX-2 expression. A number of cellular sources in the
urinary bladder express COX-2 after CYP-induced cystitis that may be induced by
neurotrophic factors, cytokines and chemokines in the inflamed bladder. The present
study defines some bladder cellular sources that are likely targets of COX-2 inhibitors.
89
Grants
This work was funded by NIH grants DK051369, DK060481, DK065989.
90
Figures
Figure 1: Western blot in detrusor and urothelium/suburothelium
A. Representative example of a western blot of detrusor smooth muscle (20 µg) for COX-2 expression in
control rats and those treated with cyclophosphamide (CYP) for varying duration. Total ERK staining was
used as a loading control. B. Histogram of relative COX-2 band density in all groups examined normalized
to total ERK in the same samples. COX-2 expression in detrusor smooth muscle is significantly increased
with acute (4 hr), intermediate (48 hr) and chronic (10 day) CYP-treatment. *, p ≤ 0.01. n = 5-7. C.
Representative example of a western blot of urothelium + suburothelium (20 µg) for COX-2 expression in
control rats and those treated with cyclophosphamide (CYP) for varying duration. Total ERK staining was
used as a loading control. D. Histogram of relative COX-2 band density in all groups examined normalized
to total ERK in the same samples. COX-2 expression in urothelium + suburothelium is significantly
increased with acute (4 hr), intermediate (48 hr) and chronic (10 day) CYP-treatment. *, p ≤ 0.01. n = 5-7.
E. The fold change in COX-2 expression in the urothelium (U) and suburothelium (SubU; white bars) is
greater compared to that in detrusor (black bars) with CYP-induced cystitis. *, p ≤ 0.01 with statistical
analyses performed on raw data.
91
Figure 2: COX-2 expression in urinary bladder sections
Fluorescence images of COX-2 expression in urinary bladder sections of control (A), 4 hr (B, C), and
chronic (D, E) CYP treated rats. For all images, exposure times were held constant and all tissues were
processed simultaneously. In control rats, little if any COX-2 expression was visible in the urothelium (U;
A). CYP treatment (4 hr, B, C; chronic, D, E) upregulated expression of COX-2 in the urothelium in all
layers (apical, intermediate and basal) of the urothelium. CYP-induced cystitis (all time points) also
increased COX-2-IR in the suburothelium (Sub U; C, D, E). In normal urinary bladder, the detrusor
smooth muscle expressed basal COX-2 but increases with cystitis were not obvious. F. COX-2-IR
inflammatory cell infiltrates were present in the urinary bladder of rats with CYP treatment (4 hr (C),
chronic (D, E). Merged image of double-label immunostaining revealed that COX-2-IR (red) was present
in cells that expressed the cytoplasmic antigen, CD86 (e.g., macrophages, dendritic cells) (F, arrows). L,
lumen; Sub U, suburothelium; sm, smooth muscle. Calibration bar represents 50 µm.
92
Figure 3: COX-2-IR nerve fibers in suburothelial plexus
Fluorescence photographs of COX-2-IR nerve fibers in the suburothelial plexus in whole mount
preparations of the urothelium/suburothelium in control (A), acute (B), intermediate (C) and chronic CYP
treated rats (D). COX-2-IR nerve fibers in the suburothelial plexus in the urothelium/suburothelium whole
mount preparation in the trigone region increased in density with CYP-induced cystitis (4 hr (B) and
chronic (D). Single COX-2-IR nerve fibers (arrows) as well as COX-2-IR nerve bundles (asterisks) were
observed in the suburothelial plexus. E. Summary histogram of increase in COX-2-IR nerve fiber density
with CYP-induced cystitis. *, p ≤ 0.01. Calibration bar represents 80 µm.
93
Figure 4: COX-2 and PGP9.5 expression in urinary bladder whole mounts
COX-IR fibers (A, C) expressed immunoreactivity for the pan neuronal marker, protein gene product
(PGP9.5; B, D). Fluorescence images of COX-2-IR (A, C) processes in urinary bladder whole mounts with
CYP-induced cystitis and PGP9.5 staining (B, D) in the same whole mounts to demonstrate colocalization
of COX-2-IR and PGP9.5 staining. COX-2-IR was present in single nerve fibers (A, B, arrowheads) and
nerve bundles (A-D, arrows). Some COX-2-IR nerve fibers exhibited a winding trajectory (A-D, arrows)
whereas other COX-2-IR nerve fibers coursed linearly and lacked obvious varicosities (A, B, arrowheads).
Numerous COX-2-IR macrophages were also present (C). Calibration bar represents 40 µm.
94
Figure 5: Whole mount preparation of urinary bladder.
A. Dissection of urinary bladder into urothelium + suburothelium and detrusor components. The
urothelium and suburothelium layer (red arrows) is reflected back from the detrusor (yellow arrows). B.
Numerous CD86+ macrophages were present in whole mount preparations of the urinary bladder with
CYP-induced cystitis (4 hr). Calibration bar represents 80 µm in B.
95
Table 1: Primary and secondary antibodies used, sources and applications
Primary
Antibody
Goat antiCOX-2
Mouse antiCOX-2
Rabbit antiCOX-2
Mouse antiGFAP
Rabbit anti-S100
Rabbit anti-ckit
Mouse antiCD86
Mouse antiCD80
Mouse antiPGP
Source
Santa Cruz,
Santa Cruz, CA
Cayman, Ann
Arbor, MI
Santa Cruz
Sigma-Aldrich,
St. Louis, MO
DAKO
Cytomation,
Denmark
Santa Cruz
Primary
Dilution
1:200
Secondary
Antibody
HRP donkey
anti-goat
Cy3 donkey
anti-mouse
Cy3 donkey
anti-mouse
Cy2 donkey
anti-mouse
Cy2 goat
anti-rabbit
1:50
1:500
1:5000
1:200
1:1000
Biolegend, San
Diego, CA
Biolegend
1:25
Abcam, Inc.,
Cambridge,
MA
1:15
Cy2 goat
anti-rabbit
Cy2 donkey
anti-mouse
Cy2 donkey
anti-mouse
Cy2 donkey
anti-mouse
1:25
Secondary
Dilution
1:15K
Application
1:100
IHC
1:100
IHC
1:100
IHC
1:500
IHC
1:500
IHC
1:100
IHC
1:100
IHC
1:100
IHC
WB
Table 2: Experiments of urinary bladder sections or whole mount preparations
Antibody
Staining of cryostat bladder
Staining of bladder whole-
sections
mounts
vimentin
-
-
GFAP
-
-
S-100
-
-
c-kit
-
-
CD86
+
+
CD80
-
ND
The phenotype of COX-2-IR cells in the suburothelial space and detrusor in bladder sections and whole
mounts induced by CYP-induced cystitis was determined using a number of antisera. COX-2-IR cell
bodies in the suburothelial space and throughout the detrusor only expressed immunoreactivity to the CD86
antigen. +, presence of staining; - absence of staining; ND, not determined.
96
References
1.
Abramoff MD, Magelhaes PJ, and Ram SJ. Image processing with ImageJ.
Biophotonics International 11: 36-42, 2004.
2.
Andersson KE and Wein AJ. Pharmacology of the lower urinary tract: basis for
current and future treatments of urinary incontinence. Pharmacol Rev 56: 581-631, 2004.
3.
Angelico P, Guarneri L, Velasco C, Cova R, Leonardi A, Clarke DE, and
Testa R. Effect of cyclooxygenase inhibitors on the micturition reflex in rats: correlation
with inhibition of cyclooxygenase isozymes. BJU Int 97: 837-846, 2006.
4.
Birder LA. More than just a barrier: urothelium as a drug target for urinary
bladder pain. Am J Physiol Renal Physiol 289: F489-495, 2005.
5.
Birder LA. Role of the urothelium in urinary bladder dysfunction following
spinal cord injury. Prog Brain Res 152: 135-146, 2006.
6.
Braas KM, May V, Zvara P, Nausch B, Kliment J, Dunleavy JD, Nelson MT,
and Vizzard MA. Role for pituitary adenylate cyclase activating polypeptide in cystitisinduced plasticity of micturition reflexes. Am J Physiol Regul Integr Comp Physiol 290:
R951-962, 2006.
7.
Brady CM, Apostolidis AN, Harper M, Yiangou Y, Beckett A, Jacques TS,
Freeman A, Scaravilli F, Fowler CJ, and Anand P. Parallel changes in bladder
suburothelial vanilloid receptor TRPV1 and pan-neuronal marker PGP9.5
immunoreactivity in patients with neurogenic detrusor overactivity after intravesical
resiniferatoxin treatment. BJU Int 93: 770-776, 2004.
97
8.
Corrow KA and Vizzard MA. Phosphorylation of Extracellular Signal-
Regulated Kinases (pERK) in Urinary Bladder in Rats with Cyclophosphamide (CYP)Induced Cystitis. Am J Physiol Regul Integr Comp Physiol, 2007.
9.
Cox P. Cyclophosphamide cystitis-identification of acrolein as the causative
agent. Biochem Pharmacol 28: 2045-2049, 1979.
10.
Dattilio A and Vizzard MA. Up-regulation of protease activated receptors in
bladder after cyclophosphamide induced cystitis and colocalization with capsaicin
receptor (VR1) in bladder nerve fibers. J Urol 173: 635-639, 2005.
11.
Dixon JS, Jen PY, and Gosling JA. The distribution of vesicular acetylcholine
transporter in the human male genitourinary organs and its co-localization with
neuropeptide Y and nitric oxide synthase. Neurourol Urodyn 19: 185-194, 2000.
12.
Dou W, Jiao Y, Goorha S, Raghow R, and Ballou LR. Nociception and the
differential expression of cyclooxygenase-1 (COX-1), the COX-1 variant retaining
intron-1 (COX-1v), and COX-2 in mouse dorsal root ganglia (DRG). Prostaglandins
Other Lipid Mediat 74: 29-43, 2004.
13.
Durrenberger PF, Facer P, Casula MA, Yiangou Y, Gray RA, Chessell IP,
Day NC, Collins SD, Bingham S, Wilson AW, Elliot D, Birch R, and Anand P.
Prostanoid receptor EP1 and Cox-2 in injured human nerves and a rat model of nerve
injury: a time-course study. BMC Neurol 6: 1, 2006.
14.
Fujisawa H, Nakagawa S, Ohkubo Y, Matsui M, Yamaguchi S, Kawamura
M, Hatanaka K, Kawakubo Y, Hiramoto Y, Kobayashi H, and Harada Y. Local and
98
systemic expression of inducible nitric oxide synthase in comparison with that of
cyclooxygenase-2 in rat carrageenin-induced pleurisy. Nitric Oxide 12: 80-88, 2005.
15.
Harmon EB, Porter JM, and Porter JE. Beta-adrenergic receptor activation in
immortalized human urothelial cells stimulates inflammatory responses by PKAindependent mechanisms. Cell Commun Signal 3: 10, 2005.
16.
Hu VY, Malley S, Dattilio A, Folsom JB, Zvara P, and Vizzard MA. COX-2
and prostanoid expression in micturition pathways after cyclophosphamide-induced
cystitis in the rat. Am J Physiol Regul Integr Comp Physiol 284: R574-585, 2003.
17.
Jang J, Park EY, Seo SI, Hwang TK, and Kim JC. Effects of intravesical
instillation of cyclooxygenase-2 inhibitor on the expression of inducible nitric oxide
synthase and nerve growth factor in cyclophosphamide-induced overactive bladder. BJU
Int 98: 435-439, 2006.
18.
Khanapure SP, Garvey DS, Janero DR, and Letts LG. Eicosanoids in
inflammation: biosynthesis, pharmacology, and therapeutic frontiers. Curr Top Med
Chem 7: 311-340, 2007.
19.
LaBerge J, Malley SE, Zvarova K, and Vizzard MA. Expression of
corticotropin-releasing factor and CRF receptors in micturition pathways after
cyclophosphamide-induced cystitis. Am J Physiol Regul Integr Comp Physiol 291: R692703, 2006.
20.
Lecci A, Birder LA, Meini S, Catalioto RM, Tramontana M, Giuliani S,
Criscuoli M, and Maggi CA. Pharmacological evaluation of the role of cyclooxygenase
99
isoenzymes on the micturition reflex following experimental cystitis in rats. Br J
Pharmacol 130: 331-338, 2000.
21.
Linden DR, Sharkey KA, Ho W, and Mawe GM. Cyclooxygenase-2
contributes to dysmotility and enhanced excitability of myenteric AH neurones in the
inflamed guinea pig distal colon. J Physiol 557: 191-205, 2004.
22.
Liu YT, Kardosh A, Cooc J, and Schonthal AH. Potential misidentification of
cyclooxygenase-2 by Western blot analysis and prevention through the inclusion of
appropriate controls. Mol Biotechnol 34: 329-335, 2006.
23.
Maggi CA. Prostanoids as local modulators of reflex micturition. Pharmacol Res
25: 13-20, 1992.
24.
Maggi CA, Giuliani S, Conte B, Furio M, Santicioli P, Meli P, Gragnani L,
and Meli A. Prostanoids modulate reflex micturition by acting through capsaicinsensitive afferents. Eur J Pharmacol 145: 105-112, 1988.
25.
Malley SE and Vizzard MA. Changes in urinary bladder cytokine mRNA and
protein after cyclophosphamide-induced cystitis. Physiol Genomics 9: 5-13, 2002.
26.
Mitchell JA and Warner TD. Cyclo-oxygenase-2: pharmacology, physiology,
biochemistry and relevance to NSAID therapy. Br J Pharmacol 128: 1121-1132, 1999.
27.
Murray E, Malley SE, Qiao LY, Hu VY, and Vizzard MA. Cyclophosphamide
induced cystitis alters neurotrophin and receptor tyrosine kinase expression in pelvic
ganglia and bladder. J Urol 172: 2434-2439, 2004.
100
28.
Ng YK, de Groat WC, and Wu HY. Smooth muscle and neural mechanisms
contributing to the down-regulation of neonatal rat spontaneous bladder contractions
during postnatal development. Am J Physiol Regul Integr Comp Physiol, 2007.
29.
Park JM, Yang T, Arend LJ, Schnermann JB, Peters CA, Freeman MR, and
Briggs JP. Obstruction stimulates COX-2 expression in bladder smooth muscle cells via
increased mechanical stretch. Am J Physiol 276: F129-136, 1999.
30.
Park JM, Yang T, Arend LJ, Smart AM, Schnermann JB, and Briggs JP.
Cyclooxygenase-2 is expressed in bladder during fetal development and stimulated by
outlet obstruction. Am J Physiol 273: F538-544, 1997.
31.
Pesce C, Grattarola M, Menini S, and Fiallo P. Cyclooxygenase 2 expression
in vessels and nerves in reversal reaction leprosy. Am J Trop Med Hyg 74: 1076-1077,
2006.
32.
Schafers M, Marziniak M, Sorkin LS, Yaksh TL, and Sommer C.
Cyclooxygenase inhibition in nerve-injury- and TNF-induced hyperalgesia in the rat. Exp
Neurol 185: 160-168, 2004.
33.
Tsai CS, Chen FH, Wang CC, Huang HL, Jung SM, Wu CJ, Lee CC,
McBride WH, Chiang CS, and Hong JH. Macrophages from irradiated tumors express
higher levels of inos, arginase-i and COX-2, and promote tumor growth. Int J Radiat
Oncol Biol Phys, 2007.
34.
Vizzard MA. Alterations in neuropeptide expression in lumbosacral bladder
pathways following chronic cystitis. J Chem Neuroanat 21: 125-138, 2001.
101
35.
Vizzard MA. Changes in urinary bladder neurotrophic factor mRNA and NGF
protein following urinary bladder dysfunction. Exp Neurol 161: 273-284, 2000.
36.
Vizzard MA. Increased expression of neuronal nitric oxide synthase in bladder
afferent and spinal neurons following spinal cord injury. Dev Neurosci 19: 232-246,
1997.
37.
Vizzard MA and Boyle MM. Increased expression of growth-associated protein
(GAP-43) in lower urinary tract pathways following cyclophosphamide (CYP)-induced
cystitis. Brain Res 844: 174-187, 1999.
38.
Yamashita M, Tsuji S, Nishiyama A, Myrvik QN, Henriksen RA, and
Shibata Y. Differential subcellular localization of COX-2 in macrophages phagocytosing
heat-killed Mycobacterium bovis BCG. Am J Physiol Cell Physiol, 2007.
39.
Yermakova A and O'Banion MK. Cyclooxygenases in the central nervous
system: implications for treatment of neurological disorders. Curr Pharm Des 6: 17551776, 2000.
40.
Yiangou Y, Facer P, Durrenberger P, Chessell IP, Naylor A, Bountra C,
Banati RR, and Anand P. COX-2, CB2 and P2X7-immunoreactivities are increased in
activated microglial cells/macrophages of multiple sclerosis and amyotrophic lateral
sclerosis spinal cord. BMC Neurol 6: 12, 2006.
41.
Yoshimura N and de Groat WC. Increased excitability of afferent neurons
innervating rat urinary bladder after chronic bladder inflammation. J Neurosci 19: 46444653, 1999.
102
42.
Yuridullah R, Corrow KA, Malley SE, and Vizzard MA. Expression of
fractalkine and fractalkine receptor in urinary bladder after cyclophosphamide (CYP)induced cystitis. Auton Neurosci 126-127: 380-389, 2006.
43.
Zvarova K and Vizzard MA. Distribution and fate of cocaine- and
amphetamine-regulated transcript peptide (CARTp)-expressing cells in rat urinary
bladder: a developmental study. J Comp Neurol 489: 501-517, 2005.
103
Chapter 3: p75NTR Expression in Rat Urinary Bladder Sensory Neurons
and Spinal Cord with Cyclophosphamide-Induced Cystitis
Klinger, M.B., B. Girard, M.A. Vizzard. (2008). p75NTR expression in rat
urinary bladder sensory neurons and spinal cord with cyclophosphamide-induced
cystitis. The Journal of Comparative Neurology, 507: 1379-1392.
104
Abstract
A role for nerve growth factor (NGF) in contributing to increased voiding
frequency and altered sensation from the urinary bladder has been suggested. Previous
studies have examined the expression and regulation of tyrosine kinase receptors (Trks)
in micturition reflexes with urinary bladder inflammation. The present studies examine
the expression and regulation of another receptor known to bind NGF, p75NTR, after
various durations of bladder inflammation induced by cyclophosphamide (CYP). CYPinduced cystitis increased (p ≤ 0.001) p75NTR expression in the superficial lateral and
medial dorsal horn in L1-L2 and L6-S1 spinal segments. The number of p75NTR-IR cells
in the lumbosacral dorsal root ganglia (DRG) also increased (p ≤ 0.05) with CYP-induced
cystitis (acute, intermediate and chronic). Quantitative, real-time polymerase chain
reaction also demonstrated significant increases (p ≤ 0.01) in p75NTR mRNA in DRG with
intermediate and chronic CYP-induced cystitis. Retrograde dye-tracing techniques with
Fastblue were used to identify presumptive bladder afferent cells in the lumbosacral
DRG. In bladder afferent cells in DRG, p75NTR-IR was also increased (p ≤ 0.01) with
cystitis. In addition to increases in p75NTR-IR in DRG cell bodies, increases (p ≤ 0.001)
in pericellular (encircling DRG cells) p75NTR-IR in DRG also increased. Confocal
analyses demonstrated that pericellular p75NTR-IR was not colocalized with the glial
marker, glial fibrillary acidic protein (GFAP). These studies demonstrate that p75NTR
expression in micturition reflexes is present constitutively and modified by bladder
inflammation. The functional significance of p75NTR expression in micturition reflexes
remains to be determined.
105
Introduction
Neurotrophic factors are important in the maintenance and survival of peripheral
neurons as well as in neuronal plasticity (Allen and Dawbarn, 2006; Dmitrieva et al.,
1997). Nerve growth factor (NGF) binds to two receptors with high-affinity, the p75NTR
receptor, a member of the tumor necrosis factor family of receptors and TrkA, a receptor
tyrosine kinase. The majority of NGF-responsive cells express both p75NTR and TrkA
(Chao and Hempstead, 1995) and TrkA is exclusively expressed with p75NTR in DRG
(Wright and Snider, 1995). NGF selectively binds TrkA whereas p75NTR can bind all
neurotrophins and precursor molecules with the same affinity (Huang et al., 1999). The
ability of NGF to bind two very distinct receptors and the resulting signaling via this
receptor complex has puzzled researchers (Barker, 2007). The original function
attributed to p75NTR was as an accessory protein that modulates Trk receptors to regulate
their affinity for their appropriate ligand (Barker, 2007; Chao et al., 2006). It has become
a prevailing concept that p75NTR and TrkA combine to form a receptor complex that
results in high-affinity NGF binding (Chao et al., 2006; Kahle et al., 1994; Verdi et al.,
1994). However, a recent study (Wehrman et al., 2007) provides structural and
mechanistic evidence for a ligand-passing model in which NGF rapidly associates with
p75 NTR and then is presented to TrkA (Wehrman et al., 2007).
At sites of tissue injury, inflammation or target organ hypertrophy, growth factors
including NGF are upregulated (Lewin and Mendell, 1993; Lindholm et al., 1987; Meller
et al., 1994; Thompson et al., 1995; Woolf et al., 1997). An increase in NGF and brainderived neurotrophic factor (BDNF) in the urine and/or bladder are among previously
106
documented changes with bladder inflammation (Lowe et al., 1997; Oddiah et al., 1998;
Okragly et al., 1999; Steers et al., 1994; Steers and Tuttle, 2006). Excess NGF in the
urinary bladder may increase voiding frequency (Chuang et al., 2001b) secondary to
neurochemical and other neurophenotypic responses. Intravesical administration of
exogenous NGF in animals facilitates afferent firing and increases voiding frequency that
can be blocked by anti-NGF (Dmitrieva et al., 1997). Exogenous administration of NGF
into the detrusor smooth muscle also increased voiding frequency, augmented central
responses to bladder distention and increased neuropeptide expression in the urinary
bladder and lumbosacral spinal cord (Zvara and Vizzard, 2007). We have demonstrated
(Hu et al., 2005) that the NGF scavenging agent (REN1820) reduces voiding frequency
and pain behaviors in rats with cyclophosphamide (CYP)-induced bladder inflammation.
Our previous studies (Qiao and Vizzard, 2002) have demonstrated significant
upregulation of TrkA and TrkB in bladder afferent cells in lumbosacral DRG with CYPinduced bladder inflammation. The potential interactions between TrkA and p75NTR in
micturition reflex pathways under control (non-inflamed) or inflamed conditions have not
been investigated.
Few studies have examined the role of p75NTR in LUT pathways (Elsasser-Beile et
al., 2000; Jahed and Kawaja, 2005) and only one (Wakabayashi et al., 1996) has
examined expression in urinary bladder after inflammation. p75NTR expression in bladder
afferent cells in the dorsal root ganglia (DRG) and central micturition pathways
mediating micturition have not been examined. The present study was designed to
determine p75NTR expression in bladder afferent pathways, including lumbosacral spinal
107
cord, and bladder afferent cells in DRG. We examined changes in p75NTR expression in
micturition pathways and p75NTR mRNA in L6-S1 DRG with varying durations (4 hours
(hr; acute), 48 hr (intermediate), and 10 days (chronic) of bladder inflammation induced
by CYP.
Materials and Methods
Cyclophosphamide (CYP)-Induced Cystitis
Acute, intermediate and chronic CYP-induced cystitis rat models were examined
in these studies (Corrow and Vizzard, 2007b; Klinger et al., 2007; Qiao and Vizzard,
2002; Vizzard, 2000b). Chronic CYP (Sigma)-induced cystitis: rats received drug
injection (75 mg/kg, intraperitoneal, i.p.) every third day for 10 days. Intermediate CYPinduced cystitis: rats received a single injection (150 mg/kg, i.p.) and tissues were
examined 48 hours (hr) later. Acute CYP-induced cystitis: rats received a single injection
(150 mg/kg, i.p.) and survived for 4 hours (hr). Control rats received volume-matched
injections of saline (0.9%; i.p.) or no treatment and no difference among the control
groups was observed. All injections were performed under isoflurane (2%) anesthesia.
All experimental protocols involving animal use were approved by the University of
Vermont Institutional Animal Care and Use Committee (IACUC # 06-014). Animal care
was under the supervision of the University of Vermont's Office of Animal Care
Management in accordance with the Association for Assessment and Accreditation of
Laboratory Animal Care (AAALAC) and National Institutes of Health guidelines. All
efforts were made to minimize the potential for animal pain, stress or distress.
108
Retrograde labeling of bladder afferent neurons
Four to six days prior to CYP injection, saline or no treatment, Fast-blue (FB; 4%,
weight/volume; Polyol, Gross-Umstadt, Germany) was injected into the bladder to
retrogradely label bladder afferent neurons in control (n=4) and CYP-treated (n=4 for
each group) rats. As previously described (Qiao and Vizzard, 2002; Vizzard, 2000c), a
total volume of 40 µl divided into six to eight injections was injected into the dorsal
surface of the bladder wall with particular care to avoid injections into the bladder lumen,
major blood vessels, or overlying fascial layers. At each injection site, the needle was
kept in place for several seconds after injection, and the site was washed with saline to
minimize contamination of adjacent organs with FB.
Tissue processing
After CYP treatment (4 hr, 48 hr, or chronic), animals were deeply anesthetized
with isoflurane (3–4%) and then euthanized via thoracotomy. The spinal cord and DRG
were quickly removed and postfixed in 4% paraformaldehyde for 3 hr or 1 hr,
respectively. Tissue was then placed overnight in sucrose (30%) in 0.1 M PBS for
cryoprotection. In pilot studies, intracardiac perfusion combined with post-fixation was
also performed and p75NTR-IR was compared between different fixation protocols.
p75NTR-IR was most consistent and robust with the post-fixation protocol. Thus, this
method was used for all subsequent studies. Spinal cord segments were identified based
upon at least two criteria: (1) the T13 DRG was present after the last rib, and (2) the L6
vertebra was the last moveable vertebra followed by the fused sacral vertebrae. Another
109
less precise criterion is the observation that the L6 DRG are the smallest ganglia
following the largest DRG, L5. DRG and spinal cord segments (L1, L2, L5–S1) were
sectioned parasagittally at a thickness of 20 or 30 µm, respectively, on a cryostat. Some
DRG (L1, L2, L6, S1) were specifically chosen for analysis based upon the previously
determined segmental representation of urinary bladder circuitry (Donovan et al., 1983;
Keast and De Groat, 1992; Nadelhaft and Vera, 1995). Bladder afferents are not
distributed within the L4–L5 DRG (Donovan et al., 1983; Keast and De Groat, 1992) that
contain only somatic afferents nor are neurons that are involved in urinary bladder
function observed in the L4–L5 spinal segments (Nadelhaft and Vera, 1995). Thus, the
L5 DRG served as an internal control for these studies. Tissues from control animals
were handled in an identical manner to that described above.
p75NTR immunohistochemistry
Spinal cord and DRG sections for both control and CYP-treated rats were
processed for p75NTR immunoreactivity (IR) using an on–slide processing technique
(Vizzard, 1997). Groups of control animals and experimental animals were processed
simultaneously to decrease the possible incidence of variation in staining and background
between tissues and between animals. Spinal cord and DRG sections were incubated
overnight at room temperature with rabbit anti–p75NTR antibody (1:15,000, Advanced
Targeting Systems, San Diego, CA) in 1% goat serum and 0.1 M KPBS (Phosphate
Buffer Solution with potassium), and then washed (3×15 min) with 0.1 M KPBS, pH 7.4.
Tissue was then incubated with Cy3-conjugated goat anti–rabbit IgG (1:500; Jackson
110
ImmunoResearch) for 2 hr at room temperature. After several rinses with 0.1 M KPBS,
tissues were mounted with Citifluor (Citifluor, London, UK) on slides and coverslipped.
Control tissues incubated in the absence of primary or secondary antibody were also
processed and evaluated for specificity or background staining levels. In the absence of
primary antibody, no positive immunostaining was observed. Although the rabbit
polyclonal antibody (1:15,000, Advanced Targeting Systems, San Diego, CA) was used
in this study, staining with a mouse monoclonal antibody (1:500, Advanced Targeting
Systems, San Diego, CA) was also performed and showed similar staining patterns in
DRG and spinal cord but with reduced staining intensity.
p75NTRexonIII deficient mice
Breeding pairs of p75NTRexonIII+/- mice were generously provided by Dr. Hermes
Yeh (Dept. of Physiology, Dartmouth Medical School). Mice were bred locally and
DNA genotyping performed on tail snips. Wildtype and p75NTRexonIII deficient mice from
the same litters were used to characterize the specificity of the antiserum to p75NTR.
DRG and spinal cord were harvested and immunohistochemical processing was
performed as described above. Tissues from littermate wildtype and p75NTRexonIII
deficient mice were processed simultaneously using identical antibodies from start to
finish.
Antibody characterization
Polyclonal anti-p75NTR is a purified rabbit polyclonal antibody. The antisera was
developed in rabbit against an extracellular fragment from the mouse p75NTR (amino
111
acids 43-161; manufacturer’s technical information). This is a well-characterized
antibody that was originally developed and the specificity demonstrated by Huber and
Chao (Huber and Chao, 1995a; b) using a variety of approaches including the
demonstration of p75NTR expression in transgenic mice expressing p75NTR gene
sequences (Huber and Chao, 1995a; b). Specificity has also been demonstrated according
to the manufacturer. This antibody also produces a similar pattern of immunoreactivity
in rodent spinal dorsal horn and DRG as demonstrated in numerous previous publications
(Delcroix et al., 1998); King et al., 2000; Hu and McLachlan, 2003; Obata et al., 2006)
and in our pilot studies using a mouse monoclonal antibody to p75NTR. Mice with
different splice variants of p75NTR are available (Dhanoa et al., 2006) and carry null
mutations for p75NTRexonIII or p75NTRexonIV . These strains lack full-length p75NTR
expression and exhibit loss of p75NTR function. In wildtype littermates and in mice with a
null mutation for p75NTRexonIII , we examined p75NTR expression in DRG and spinal cord.
Staining in the wildtype DRG was robust (Fig. 1A) whereas staining in DRG from
p75NTRexonIII deficient mice revealed extremely faint and sparse p75NTR-IR (Fig. 1B). To
obtain images that were not completely black, the exposure time for p75NTRexonIII-/- DRG
images was increased to 4 times longer than that used to acquire wildtype images. These
results are similar to previous studies where reduced intensity and appearance of p75NTRIR was observed in superior cervical ganglia in p75NTRexonIII deficient mice (Dhanoa et al.,
2006).
Monoclonal anti-glial fibrillary acidic protein (GFAP) is a purified mouse
monoclonal antibody. The antibody is derived from the hybridoma produced by the
112
fusion of mouse myeloma cells and splenocytes from an immunized mouse. The
immunogen was purified GFAP from pig spinal cord (manufacturer’s technical
information). The antibody recognizes the 50 kDa intermediate filament protein, GFAP,
but not other intermediate filaments (manufacturer’s technical information). The epitope
recognized by the monoclonal anti-GFAP is localized on the carboxy terminal Cys II
fragment of GFAP and the N-terminal part of the tail sequence of the molecule (Debus et
al., 1983; Shaw and Hawkins, 1992). This antibody produced the same pattern of
immunoreactivity in rodent DRG as demonstrated in numerous previous publications (Hu
and McLachlan, 2003; Karchewski et al., 2004; Obata et al., 2006; Xie et al., 2006).
Assessment of positive staining in lumbosacral spinal cord and DRG
Staining observed in experimental tissue was compared with that observed from
experiment-matched negative controls. Tissues exhibiting immunoreactivity that was
greater than the background level observed in experiment-matched negative controls
were considered positively stained.
Data analysis of p75NTR and FB-labeled DRG
Tissues were examined under an Olympus fluorescence photomicroscope for
visualization of Cy3 and FB. Cy3 was visualized with a filter with an excitation range of
560–596 nm and an emission range of 610–655 nm. In DRG from control and CYPtreated rats, p75NTR –immunoreactive (IR) cell profiles were counted in 5-8 sections of
each selected DRG (L1, L2, L5–S1). Only cell profiles with a nucleus were quantified.
113
DRG sections with FB-labeled cells were viewed with a filter with an excitation
wavelength of 340–380 nm and an emission wavelength of 420 nm. Cells colabeled with
FB and p75NTR –IR were similarly counted. Numbers of p75NTR –IR cell profiles per
DRG section are presented (mean ± SEM). The percentage of presumptive bladder
afferent cells (FB-labeled) expressing p75NTR –IR in each DRG examined is also
presented (mean ± SEM). The results were not corrected for double-counting. p75NTR-IR
cells were quantified in a blinded fashion and p75NTR-IR and FB-labeled cells were
quantified by two individuals. Comparisons between control and CYP-treated groups
were made by using analysis of variance (ANOVA). Percentage data were arcsintransformed to meet the requirements of this statistical test. Animals, processed and
analyzed on the same day, were tested as a block in the ANOVA. Thus, day was treated
as a blocking effect in the model. Two variables were tested in the analysis: (1) duration
of inflammation versus none (control), and (2) the effect of day (i.e., tissue from
experimental and control groups of animals were processed on different days). When F
ratios exceeded the critical value (p ≤ 0.05), the Newman–Keuls test was used for
multiple comparisons among means.
Quantitative analysis of pericellular p75NTR–IR in DRG
Six to 10 DRG sections from each of L1, L2, L5-S1 in control and experimental
groups were examined under an Olympus fluorescence photomicroscope (Optical
Analysis, Nashua, NH) with a multiband filter set for visualization of the Cy3
fluorophore. Grayscale images acquired in tiff format were imported into Meta Morph
114
image analysis software (version 4.5r4; Universal Imaging, Downingtown, PA) as
previously described (Laberge et al., 2006b; Yuridullah et al., 2006). Four boxes of equal
size were drawn and placed randomly over the DRG images. A threshold within an
intensity range of 100–250 grayscale values was applied to the region of interest in the
least brightly stained condition first. The same threshold was subsequently used for all
images. Average intensity was calculated within the selected areas. The average intensity
represents the average value of all of the pixels above the threshold value. Percent p75NTR
expression above threshold in the total area selected was then calculated and averaged for
all samples from control (n = 4) and CYP-treated (n = 4 for each experimental condition)
rats. The percentage of p75NTR–IR expression in CYP-treated rats was therefore
expressed as a percentage of control.
p75NTR-IR and glial fibrillary acidic protein (GFAP)-IR in lumbosacral DRG
To more fully characterize the pericellular p75NTR-IR seen in lumbosacral DRG,
double-labeling was performed with anti-p75NTR (as described previously) as well as
mouse monoclonal anti-GFAP (1:5,000; Sigma-Aldrich, Inc., St. Louis, MO). Primary
and subsequently, secondary antibodies (Cy3-conjugated goat anti-rabbit (1:500) and
Cy2-conjugated goat anti-mouse (1:50; Jackson ImmunoResearch), were applied as a
cocktail to tissue sections for on-slide processing. Tissue was examined and optical
sections were acquired using a Zeiss LSM 510 confocal scanning system attached to a
Zeiss LSM 510 microscope using a plan Fluor 40x oil objective. Excitation wavelengths
115
of 488 nm and 543 nm were used. Control experiments demonstrated that the Cy2 and
Cy3 fluorochromes had no overlap in emission when sequential scanning was performed.
To determine the degree of colocalization of GFAP with p75NTR , release 3.2 of the Carl
Zeiss LSM software was used in optical sections. For these analyses, we demonstrated
absence of bleed-through and background staining and autofluorescence was removed
from all images, and analyses were performed only on optical sections. Changes in
pericellular staining were most dramatic in L5-S1 DRG and thus, the colocalization
analyses from control and CYP-treated rats were restricted to these DRG.
Data analyses of p75NTR–IR in lumbosacral spinal cord
Tissues were examined under an Olympus fluorescence photomicroscope for
visualization of Cy3. Grayscale images were obtained in 8-bit monochrome tiff format
files. No adjustments were made to the grayscale images. The density of p75NTR–IR in
specific regions of spinal cord was determined by densitometry analysis (ImageJ, v.
1.34s). Spinal cord segments (L1-L2, L5-S1) were sectioned throughout the rostralcaudal extent of the segment. All tissue sections were then processed for p75NTR–IR as
previously described. A 1:4 series of spinal cord sections was then used for semi–
quantitative analysis of p75NTR –IR. Spinal cord sections were not selected based upon
staining intensity, and no sections were discarded from the analysis because of low
staining. The following regions of spinal cord from both CYP-treated and control
animals were analyzed: superficial, lateral dorsal horn (LDH), medial dorsal horn
(MDH), and dorsal commissure (DCM) regions, the region of the sacral parasympathetic
116
nucleus (SPN; L6, S1), the region of the intermediolateral nucleus (IML; L1, L2), and the
region of the lateral collateral pathway (LCP; L6, S1). Spinal cord sections were viewed
with a 20× objective and captured through a video camera attachment to the microscope
with the exposure time, brightness, and contrast being held constant. The image was
converted into grayscale. The spinal cord section was centered in the field, and four
standard size squares were overlaid on the areas of interest (LDH, MDH, DCM, SPN,
IML, and LCP regions). The labeled area within the square was measured. Transmittance
(t) was calculated as t = (gray level + 1/256). Optical density (OD) was derived from
OD=–log t. The background staining for each section was subtracted from the images.
Differences in p75NTR expression in L1-L2 and L6-S1 spinal segments with cystitis were
similar; these data (L1-L2 and L6-S1) were pooled for data presentation. Comparisons
among control and experimental groups were made by ANOVA. When F ratios exceeded
the critical value (p ≤ 0.05), Newman-Keuls test was used for multiple comparisons
among means.
Real-time quantitative reverse transcription-polymerase chain reaction
(Q RT-PCR)
L6 and S1 DRG were dissected under RNase-free conditions and total RNA was
extracted using the STAT-60 total RNA/mRNA isolation reagent (Tel-Test ‘B’,
Friendswood, TX, USA). Complementary DNA was synthesized using SuperScript II
reverse transcriptase and random hexamer primers with the SuperScript II
Preamplification System (Invitrogen, Carlsbad, CA, USA) in a 20 µl final reaction
volume. The quantitative PCR standard for p75 and L32 transcripts was prepared with
117
the amplified p75 cDNA products ligated directly into pCR2.1 TOPO vector using the
TOPO TA cloning kit (Invitrogen). The nucleotide sequences of the inserts were verified
by automated fluorescent dideoxy dye terminator sequencing (Vermont Cancer Center
DNA Analysis Facility). To estimate the relative expression of the receptor transcripts,
10-fold serial dilutions of stock plasmids were prepared as quantitative standards. The
range of standard concentrations was determined empirically.
Real-time quantitative PCR was performed using SYBR Green I detection as
previously described (Girard et al., 2006). Complementary DNA templates, diluted 5-fold
to minimize the inhibitory effects of the reverse transcription reaction components, were
assayed using SYBR Green I JumpStartTM. Taq ReadyMix (Sigma, St. Louis, MO,
USA) containing 3.5 mM MgCl2, 200 mM dATP, dGTP, dCTP and dTTP, 0.64 U Taq
DNA polymerase and 300 nM of each primer in a final 25 µl reaction volume. The realtime quantitative PCR was performed on an Applied Biosystems 7500 Fast real-time
PCR system (Applied Biosystems, Foster City, CA, USA) using the following standard
conditions: (i) initial heating 94 °C for 2 min; (ii) amplification over 40 cycles at 94 °C
for 15 seconds (s) and 65 °C or 60 °C for 30 s.
The amplified product from these amplification parameters was subjected to SYBR
Green I melting analysis by ramping the temperature of the reaction samples from 60 °C
to 95 °C. A single DNA melting profile was observed under these dissociation assay
conditions demonstrating amplification of a single unique product, free of primer dimers
or other anomalous products. Oligonucleotide primer sequences for p75NTR and the
housekeeping gene, L32, used in these studies are described in Table 1.
118
For data analyses, a standard curve was constructed by amplification of serially
diluted plasmids containing the receptor target sequence. Data were analyzed at the
termination of each assay using the Sequence Detection Software version 1.3.1 (Applied
Biosystems, Norwalk, CT). In standard assays, default baseline settings were selected.
The increase in SYBR Green I fluorescence intensity (DRn) was plotted as a function of
cycle number and the threshold cycle was determined by the software as the
amplification cycle at which the DRn first intersects the established baseline.
119
Results
p75NTR-IR in spinal cord in control rats and after CYP-induced cystitis
In spinal cord levels examined (L1-L2, L5-S1), p75NTR was expressed in certain
regions of the spinal cord in both control rats and after CYP-induced cystitis. In the
spinal cord of control animals (L1-L2, L5-S1), p75NTR-IR was present in superficial
dorsal horn (medial and lateral laminae I-II; Fig. 2). Faint p75NTR-IR was expressed in
the dorsal commissure (DCM), located dorsal to the central canal and in the lateral
collateral pathway of Lissauer (LCP) in L6-S1 spinal cord segments in control animals.
p75NTR –IR was also observed in the SPN (L6-S1) or IML (L1-L2) regions in control rats.
p75NTR staining in all regions was punctate in appearance and probably represented
staining in nerve terminals because p75NTR-IR was not observed in any neuronal cell
bodies in the dorsal or lateral horn. On rare occasions, p75NTR-IR ventral horn
motoneurons were observed.
Following CYP treatment of varying duration, the intensity of p75NTR staining
significantly increased in both medial (MDH) and lateral superficial dorsal horn (LDH)
(Fig. 2B, C). In spinal cord segments L1-L2, p75NTR staining intensity increased
significantly in both MDH and LDH for all CYP treatment durations examined (4 hr, 48
hr, or chronic; p ≤ 0.001)(Fig. 2E). p75NTR staining intensity in the LDH of L6-S1 also
increased significantly (p ≤ 0.001) at all durations of CYP treatment (Fig. 2D). In
addition to changes in the density of p75NTR –IR in the superficial laminae of the LDH
and MDH, p75NTR –IR also extended into deeper laminae of the DH with CYP-induced
cystitis (Fig. 2B, C). Although spinal cords demonstrated p75NTR-IR in DCM and LCP,
120
this staining was not different (Fig. 2) among control and experimental groups. p75NTR –
IR in the SPN region in the L6-S1 spinal cord or IML region of the L1-L2 spinal
segments was also not changed with CYP-induced cystitis of any duration examined. No
changes in p75NTR-IR in the L5 spinal cord were demonstrated with CYP-induced cystitis
of any duration examined.
p75NTR-IR is increased in lumbosacral dorsal root ganglion (DRG) cells after CYPinduced cystitis
p75NTR expression was observed in the cytoplasm of DRG cells in all levels
examined (L1-L2; L5-S1). The number of cells that showed positive staining for p75NTR
(Fig. 3A-D; Fig. 4) increased significantly (p ≤ 0.05) in all levels examined after chronic
CYP treatment. This increase in numbers of p75NTR-IR DRG cells was also significant
in L1 and S1 DRG after 48 hr CYP treatment and in L5-S1 DRG with acute (4 hr) CYP
treatment (p ≤ 0.05) (Fig. 4).
Pericellular p75NTR-IR in lumbosacral DRG
In addition to the p75NTR expression seen in the cytoplasm, p75NTR –IR was also
observed surrounding individual DRG cells (Fig. 5B, D, F). This pericellular staining
was observed in control animals as well as after acute (4 hr and 48 hr) and chronic CYPinduced cystitis in lumbosacral DRG (L5-S1)(Fig. 5B, D, F). The intensity of the
staining was significantly (p ≤ 0.001) increased after chronic in L5-S1 DRG, after 48 hr
CYP in L5 and L6 DRG and after 4 hr CYP treatment in L6 DRG (Fig. 5A, C, E, H).
121
To determine whether the pericellular staining was associated with glial cells in
the DRG, DRG were stained with the antibodies to the glial cell marker, glial fibrillary
acidic protein (GFAP), as well as with anti-p75NTR and optical sections were used to
determine colocalization. Upon examination with confocal microscopy (Fig. 5G; Fig.
6G), co-localization with these antibodies was not observed. Separate, non-overlapping
GFAP-IR and p75NTR-IR was observed in all DRG examined. Using colocalization
software on the metaconfocal system, we determined that the greatest coefficient of
colocalization for GFAP and p75NTR in DRG examined from control or CYP-treated rats
was 0.3 (range 0.05-0.3) indicating very little colocalization of GFAP with p75NTR. As a
comparison, a coefficient of colocalization of 1 is indicative of complete colocalization
whereas 0 indicates no colocalization. Thus, we conclude that pericellular p75NTR
represents DRG cell membrane staining.
p75NTR-IR in bladder afferents
To determine whether p75NTR-IR is expressed in bladder afferent cells in DRG
from control or after bladder inflammation, Fastblue (FB) was injected into the urinary
bladder to retrogradely label bladder afferent cells in the L1, L2, L6 and S1 DRG (Fig.
6B, E). In control animals (Fig. 6A-C), 25-43% of bladder afferent cells expressed
p75NTR-IR in L1, L2 and L5-S1 DRG (Fig. 6G). After 4 hr CYP (Fig. 6H), there was a
significant (p ≤ 0.01) increase in the percentage of bladder afferent cells that expressed
p75NTR-IR in L1 (58.4% ± 3.5), L2 (42.3% ± 1.6), L6 (53.3% ± 3.8), and S1 (71.3% ±
3.8) DRG. After 48 hr CYP treatment (Fig. 6D-F), a significant (p ≤ 0.01) increase in the
122
percentage of bladder afferent cells expressing p75NTR-IR was demonstrated in L1
(63.2% ± 2.4), L6 (57.7% ± 4.8) and S1 (66.5% ± 3.0) DRG. After chronic CYP
treatment (Fig. 6G, H), a significant (p ≤ 0.01) increase in the percentage of bladder
afferent cells expressing p75NTR-IR was demonstrated in L1 (67.6% ± 1.5), L2 (71.4% ±
4.5), L6 (69.4% ± 4.3), and S1 (67.5% ± 7.6). No changes were observed in the
percentage of bladder afferents expressing p75NTR-IR in the L2 DRG with 48 hr CYP
treatment (Fig. 6H).
p75NTR mRNA expression in DRG with CYP-induced cystitis
Acute (4 hr) CYP-induced cystitis produced a significant (p ≤ 0.01) reduction in p75NTR
mRNA in the L6 DRG (Fig. 7). In contrast, a significant (p ≤ 0.01) increase in p75NTR
mRNA was observed 48 hr after CYP-treatment (Fig. 7). With chronic CYP-treatment,
no additional change in transcript expression was observed compared to control (Fig. 7).
There was a significant (p ≤ 0.01) increase in p75NTR transcript with 48 hr and chronic
CYP treatment compared to acute (4 hr) treatment (Fig. 7). A similar biphasic change in
p75NTR mRNA expression in the S1 DRG with CYP treatment was also observed but
these changes did not reach significance (Fig. 7).
123
Discussion
These studies demonstrate several novel findings: (1) constitutive p75NTR
expression in spinal pathways involved in micturition reflexes in control rats is
significantly increased after acute, intermediate or chronic CYP-induced cystitis; (2)
constitutive p75NTR -immunoreactivity (IR) in lumbosacral dorsal root ganglia (DRG) is
significantly upregulated with CYP-induced cystitis of varying duration; (3) bladder
afferent cells retrogradely labeled with Fastblue (FB) express p75NTR-IR in control rats
and the percentage of bladder afferents expressing p75NTR is significantly increased with
CYP-induced cystitis; (4) CYP-induced cystitis also increased pericellular p75NTR -IR in
DRG and this staining did not exhibit colocalization with the glial marker, GFAP; (5)
p75NTR transcript in DRG exhibited a biphasic response to CYP-induced cystitis with
acute cystitis decreasing p75NTR mRNA whereas intermediate and chronic CYP-induced
cystitis increased p75NTR transcript with respect to the acute condition. These studies
demonstrate p75NTR expression in micturition pathways that is modifiable with varying
degrees of bladder inflammation.
Although numerous studies have suggested a central or peripheral role for p75NTR
after axotomy (Hannila and Kawaja, 2005; Keast and Kepper, 2001; Obata et al., 2006;
Scott et al., 2005; Wakabayashi et al., 1998) or peripheral somatic inflammation (Chien
et al., 2007; Cho et al., 1996; Pezet et al., 2001) few studies have examined the role of
p75NTR in normal or inflamed lower urinary tract pathways (Elsasser-Beile et al., 2000;
Jahed and Kawaja, 2005; Tong and Cheng, 2005; Vaidyanathan et al., 1998;
Wakabayashi et al., 2002; Wakabayashi et al., 1998) (Wakabayashi et al., 1996). To our
124
knowledge, no studies have examined changes in p75NTR expression in central or
peripheral micturition reflex pathways after bladder inflammation. In contrast, p75NTR
expression in the urinary bladder has been examined in rodent and human conditions of
neuropathic bladder inflammation and diabetes. Acute cystitis resulted in increased
p75NTR-IR in nerve bundles in the detrusor smooth muscle (Wakabayashi et al., 1996). In
patients with neuropathic bladder, increased expression of p75NTR has been shown in the
umbrella and basal layers of the urothelium in addition to being expressed in bladder
nerves (Vaidyanathan et al., 1998). In contrast, p75NTR mRNA is decreased in urinary
bladder or sensory neurons in the DRG (Delcroix et al., 1998) of streptozotocin-induced
diabetic rats but restoration of normal blood glucose level or exogenous, systemic
treatment with NGF returned transcript expression to normal in urinary bladder (Tong
and Cheng, 2005) or DRG (Delcroix et al., 1998). Thus, a number of studies have
demonstrated that p75NTR expression is modifiable in the urinary bladder.
The current studies demonstrate significant increases in p75NTR in the superficial
laminae of the dorsal horn; however, changes in p75NTR expression in other regions of the
lumbosacral spinal cord involved in bladder reflex function (i.e., SPN, LCP, DCM) were
not observed. Previous studies have suggested a role for p75NTR in both restraining and
facilitating axonal growth in the dorsal horn after dorsal rhizotomy, spinal cord injury and
during development (Hannila and Kawaja, 2005; Scott et al., 2005). p75NTR expression
and upregulation with CYP-induced cystitis in the lumbosacral DH may represent central
projections of sensory neurons, terminals of projection neurons and/or descending p75NTR
systems (Pioro and Cuello, 1990; Sobreviela et al., 1994) exhibiting p75NTR–IR whereas
125
interneuronal expression of p75NTR is less likely (Bothwell, 1995). Most recently it has
been demonstrated that p75NTR is anterogradely transported by the dorsal roots to central
terminals in the spinal cord DH (Delcroix et al., 1998; Zweifel et al., 2005). Increased
expression of p75NTR was observed in the superficial laminae of the DH in rostral lumbar
(L1-L2) and caudal lumbosacral (L6-S1) spinal segments known to innervate the urinary
bladder. Previous studies in this laboratory (Vizzard, 2001; Zvarova et al., 2004) have
also demonstrated changes in calcitonin gene-related peptide, substance P, pituitary
adenylate cyclase activating polypeptide and galanin expression in superficial laminae of
the DH in the lumbosacral spinal cord after CYP-induced cystitis.
In support of p75NTR-IR nerve terminals in the DH of the spinal cord representing,
in part, the central projections of sensory neurons in the lumbosacral DRG, the present
study demonstrated p75NTR expression in DRG cells. Similar to what we observed in the
DH of the spinal cord, CYP-induced cystitis increased p75NTR expression in lumbosacral
DRG examined. Previous studies have demonstrated p75NTR-IR in DRG cells with
increased expression after nerve injury (Obata et al., 2006). Previous studies have
demonstrated p75NTR expression in both cell bodies in DRG (Bennett et al., 1996; Hu and
McLachlan, 2000; Obata et al., 2006) and encircling (pericelluar staining) (Hu and
McLachlan, 2000; Obata et al., 2006) DRG cells. These two types of staining patterns
are consistent with that observed in the present study. Previous studies have
demonstrated co-labeling of the glial marker, GFAP and pericellular p75NTR expression in
DRG (Hu and McLachlan, 2000; Obata et al., 2006). It was concluded that the
126
pericellular p75NTR staining was expressed in satellite glial cells after peripheral nerve
lesion. In contrast, the present studies did not demonstrate significant overlap of p75NTR
pericellular staining in lumbosacral DRG in control rats or after CYP-induced cystitis. It
should be noted that our conclusions were based upon confocal imaging of DRG sections
and determination of a coefficient of colocalization using optical sections. Previous
studies have concluded colabeling of GFAP and pericellular p75NTR staining in DRG
based upon the use of traditional epifluoresence microscopy (Hu and McLachlan, 2000;
Obata et al., 2006). In addition, when DRG sections in the present study are imaged with
epifluorescence microscopy and merged images are created, we would also conclude,
incorrectly, that the pericellular p75NTR -IR was colocalized with GFAP. In addition to
changes in p75NTR protein expression in DRG cells, we also demonstrated a biphasic
response in p75NTR mRNA with CYP-induced cystitis. Increases in p75NTR mRNA were
demonstrated with intermediate and chronic CYP-induced cystitis. In contrast, decreases
in p75NTR mRNA were observed with acute CYP treatment. This decrease in p75NTR
mRNA is at odds with the observed increase in p75NTR –IR in DRG with acute cystitis.
Differences in transcript and protein expression are not uncommon and likely reflect an
increase in translation efficiency, additional changes in posttranslational mechanisms, or
increased stability of mRNA transcript (Kruttgen et al., 1998; Sherer et al., 1998a; Sherer
et al., 1998b; Vizzard, 2000b).
Increased p75NTR expression was also observed in the L5 DRG known not to be
involved in micturition reflexes but to receive sensory information from the hindpaw. It
is interesting to note that the CYP-induced cystitis model in the rodent produces somatic
127
sensitization in the hindpaw (Guerios et al., 2006)(Vizzard and Cheppudirah, unpublished
observations). Mechanical sensitivity as assessed with von Frey monofilaments is
increased although thermal sensitivity remains unchanged (Guerios et al., 2006)(Vizzard
and Cheppudirah, unpublished observations). Thus, increased p75NTR expression in the
L5 DRG may be related to increased sensitivity in this referred site (Guerios et al.,
2006)(Vizzard and Cheppudirah, unpublished observations). No changes in p75NTR
expression in the L5 spinal segment were present with any duration of CYP treatment
used in the present study. This may reflect a lack of anterograde transport of p75NTR in
L5 DRG to central terminals in the spinal cord (Delcroix et al., 1998; Zweifel et al.,
2005).
Although p75NTR expression has been demonstrated in sensory neurons in the
DRG, the innervation targets of the DRG cells expressing p75NTR -IR have not been
previously identified. In the present study, presumptive bladder afferent cells in the DRG
were identified by injection of Fastblue into the urinary bladder and subsequent
retrograde transport to lumbosacral DRG innervating the urinary bladder. These studies
demonstrate that approximately 25-43% of bladder afferent cells express p75NTR -IR
under control conditions. This percentage is in very close agreement with previous
studies demonstrating a similar percentage of bladder afferent cells expressing the
tropomyosin related tyrosine kinase receptors (Trk) TrkA or TrkB (Qiao and Vizzard,
2002). Previous studies have demonstrated almost complete colocalization of p75NTR and
Trk receptors in DRG (Chao and Hempstead, 1995; Wright and Snider, 1995). CYP-
128
induced cystitis increased p75NTR expression in bladder afferent cells in all lumbosacral
DRG examined (L1, L2, L6, S1). Increased expression occurred with acute, intermediate
and chronic CYP-induced cystitis. The increased p75NTR expression observed in bladder
afferent cells with cystitis was different than that observed for either TrkA or TrkB (Qiao
and Vizzard, 2002). Increased TrkA expression was restricted to L1 and L6 DRG with
varying durations of cystitis and increased TrkB expression was broadly distributed
among L1, L2, L6 and S1 but only demonstrated an increase with acute CYP-induced
cystitis (Qiao and Vizzard, 2002). Thus, although basal expression of p75NTR in bladder
afferent cells resembled the percentage of bladder afferent cells expressing TrkA or
TrkB, the response to CYP-induced cystitis differed. This difference may reflect the
numerous, potential independent roles that p75NTR may play with neurotrophins and other
receptors including, Trk, Nogo, LINGO-1 and sortilin (Allen and Dawbarn, 2006;
Bronfman and Fainzilber, 2004; Nykjaer et al., 2005).
Target-derived changes in NGF with bladder inflammation may drive changes in
p75NTR expression in central and peripheral micturition reflexes. Previous studies have
demonstrated that exogenous or elevated endogenous NGF can alter p75NTR expression
(Delcroix et al., 1998; King et al., 2000; Mousa et al., 2007). The exact contribution of
NGF to bladder function is not known but a correlation between increased voiding
frequency and elevated urinary bladder NGF has been suggested. Experimentally-induced
cystitis increases voiding frequency and alters bladder NGF protein and transcript.
Intrathecal (Yoshimura et al., 2006), intravesical delivery of NGF (Dmitrieva et al., 1997)
or adenovirus-mediated NGF overexpression (Lamb et al., 2004) in the bladder increase
129
voiding frequency and bladder afferent cell hyperexcitability (Yoshimura et al., 2006;
Yoshimura et al., 2002) in control rats. NGF scavenging methods (Dmitrieva et al., 1997;
Hu et al., 2005) reduce voiding frequency in rats with experimentally induced
inflammation. Elevated levels of neurotrophins are detected in the urine of women with
painful bladder syndrome (Okragly et al., 1999) (PBS)/interstitial cystitis (IC) or in the
urothelium of individuals with neuropathic bladder (Lowe et al., 1997). However, a
recent study failed to demonstrate an association between increased
urothelium/suburothelium NGF with detrusor overactivity or bladder sensation (Birder et
al., 2007).
Neurotrophins, through interactions with Trk and/or p75NTR receptors, may
contribute to neurochemical (Vizzard, 2000a; 2001), electrophysiological (Yoshimura et
al., 2002) and organizational (Steers and Tuttle, 2006; Vizzard, 2000c) plasticity of lower
urinary tract pathways after CYP-induced cystitis. Neurotrophin/Trk/p75NTR interactions
could induce long-term changes in cells (Steers and Tuttle, 2006), including: (1)
mediating neurotransmitter phenotype; (2) influencing dendrite size and synaptic
reorganization; (3) increasing synaptic efficacy; and (4) controlling innervation density
and target organ function. Additional p75NTR functions independent of Trk may also
include myelination, axonal growth and regeneration (Nykjaer et al., 2005). Although
p75NTR has been shown to increase binding affinity of TrkA for NGF and increase the
activities of the TrkA receptor in some systems (Chao and Hempstead, 1995), p75NTR
may also hinder TrkA binding to NGF by sequestering increased amounts of NGF,
leaving less available to bind TrkA (Dhanoa et al., 2006; Hannila and Kawaja, 2005;
130
Nykjaer et al., 2005). Previous studies have demonstrated that expression of p75NTR and
TrkA can result in synergistic and antagonistic functions (Schweigreiter, 2006). It is
likely that the role of p75NTR in micturition reflexes is dependent on the balance between
NGF/p75NTR and NGF/TrkA signaling in bladder afferents and the extent to which this
balance is altered with bladder inflammation. The function of p75NTR in micturition
reflex function in control rats and after CYP-induced cystitis is the subject of ongoing
physiological studies.
131
Other Acknowledgements:
We gratefully acknowledge the generous gift of p75NTRexonIII+/- mice from Dr. Hermes
Yeh, Dartmouth Medical School.
132
Figures
Figure 1: p75NTRexonIII-/- mice
p75NTRexonIII-/- mice exhibit minimal p75NTR-IR when tested with antisera used in the present study.
Lumbosacral (L6-S1) dorsal root ganglion (DRG) sections from littermate wildtype and p75NTRexonIII-/- mice
were used to determine the specificity of p75NTR antisera used in the present study. All DRG sections were
reacted simultaneously using identical reagents. A. In wildtype S1 DRG, robust p75NTR-IR was present in
neuronal cell bodies. B. In contrast, S1 DRG sections from p75NTRexonIII-/- mice only exhibited the faintest
p75NTR-IR. Panels A and B represent images captured at different exposure times. To see any p75NTR-IR in
the null mice, exposure times were increased to 4X that used to capture images from wildtype sections
further demonstrating the faint p75NTR-IR. Calibration bar represents 80 µm.
133
Figure 2: p75NTR -IR in lumbosacral spinal cord
NTR
p75 -IR is increased in specific regions of the lumbosacral (L1, L2, L6, S1) spinal cord with
cyclophosphamide (CYP)-induced cystitis. Fluorescence images of p75NTR expression in the dorsolateral
quadrant of lumbosacral (L6) spinal cord from control (A), 4 hour (B) and chronic (C) CYP treated rats. AC. p75NTR-IR is constitutively expressed in the superficial lateral (LDH) and medial dorsal horn (MDH);
faint p75NTR-IR was expressed in lateral collateral pathway (LCP) and dorsal commissure (DCM). With
CYP-induced cystitis, p75NTR-IR significantly (p ≤ 0.001) increased in the LDH and MDH of L6-S1 and
L1-L2 spinal segments. D. Summary histogram of p75NTR staining in L1-L2 spinal segments induced in
LDH and MDH with varying duration of CYP-induced cystitis presented as a percentage of p75NTR staining
intensity in control tissues. E. Summary histogram of p75NTR staining in L6-S1 spinal segments induced in
LDH and MDH with varying duration of CYP-induced cystitis presented as a percentage of p75NTR staining
intensity in control tissues. Statistical analyses were performed on raw data. F. Drawing of a hemisection
of lumbosacral spinal cord section for orientation purposes. *, p ≤ 0.001. n=4. SPN, sacral
parasympathetic nucleus; CC, central canal. Calibration bar represents 100 µm.
134
A
Control
B
4 Hour
C
48 Hour
D
Chronic
Figure 3: p75NTR-IR cells in the lumbosacral dorsal root ganglia
CYP-induced cystitis increases the number of p75NTR-IR cells in the lumbosacral dorsal root ganglia
(DRG). Fluorescence images of p75NTR-IR in L1 DRG in control (A), 4 hour (B), 48 hour (C) and chronic
(D) CYP treated rats. White arrows indicate cells demonstrate some examples of p75NTR–IR cells. Yellow
arrowheads demonstrate some examples of DRG cells that did not exhibit p75NTR-IR. Calibration bar
represents 60 µm.
135
Number of p75 NTR-IR cells/section
60
*
50
*
*
40
*
Control
*
30
48 Hour
Chronic
20
10
4 Hour
*
*
*
**
0
L1
L2
L5
L6
S1
Figure 4: numbers of p75NTR-IR cells in the lumbosacral dorsal root ganglia
Summary histogram of numbers of dorsal root ganglion (DRG) cells that exhibit p75NTR-IR under control
conditions and after induction of CYP-induced cystitis (4 hour, 48 hour, chronic). (n = 5 for each; *, p ≤
0.05)
136
Control
A
B
Control
48 Hour
D
48 Hour
Chronic
F
Chronic
Chronic
H
4
3
2
1
C
1
2
3
4
E
1
2
3
G
4
3000
% of control
2500
2000
*
1500
1000
500
*
4 Hour
48 Hour
Chronic
*
*
*
*
0
L5
L6
S1
Figure 5: Pericellular p75NTR-IR in DRG from control and CYP-treated rats.
Pericellular p75NTR-IR increased in lumbosacral dorsal root ganglia (DRG) with CYP treatment. A
threshold encompassing an intensity range of 100-250 grayscale values was applied to the region of interest
in control DRG (A). The same threshold was subsequently used for all images (C, E). Four boxes of fixed
dimension were randomly placed in DRG images. Percent p75NTR expression above threshold was then
calculated. Grayscale versions of p75NTR-IR in control DRG (A), or with 48 hour or chronic CYPtreatment (E). Images are thresholded and little p75NTR-IR (absence of purple within the outlined region) is
above threshold in control DRG compared to significant p75NTR-IR that is above threshold after 48 hr CYP
treatment (C, presence of purple) or chronic treatment (E). Fluorescence images of p75NTR-IR in S1 DRG
from control (B), 48 hour (D), and chronic (F) CYP treatments. H. Summary histogram of p75NTR
expression above threshold in selected regions was calculated and presented as a percentage of control
(n=4; *, p ≤ 0.01). Calibration bar represents 40 µm (A-F), 20 µm (G).
137
A
B
C
Control
Control
Control
D
E
F
48 Hour
48 Hour
48 Hour
Chronic
% bladder afferent p75
NTR
-IR cells
G
100
90
80
70
60
H
*
**
#
#
**
50
*
* *
*
Control
4 Hour
48 Hour
Chronic
40
30
20
10
0
L1
L2
L5
L6
S1
Figure 6: p75NTR –IR in bladder afferent cells in lumbosacral dorsal root ganglion
CYP-induced cystitis increases p75NTR-IR in bladder afferent (Fastblue, FB-labeled) cells in the
lumbosacral DRG. A-C. L6 DRG section from control rat demonstrating p75NTR-IR (A), bladder afferent
cells (FB-labeled) in same section (B) and merged image (C) demonstrating bladder afferent cells with
p75NTR-IR (pinkish-purple/magenta). D-F. L6 DRG section from rat with 48 hour induced cystitis (D),
bladder afferent cells (FB-labeled) in same section (E) and merged image (F) demonstrating bladder
afferent cells with p75NTR-IR (pinkish-purple/magenta). White arrows indicate some examples of bladder
afferent cells that exhibit p75NTR-IR. Not all bladder afferent cells express p75NTR-IR (yellow arrowheads)
and not all cells expressing p75NTR-IR are bladder afferent cells (green arrows). G. Triple-labeled image
demonstrating p75NTR-IR (red) in bladder afferent cells (blue) in L6 DRG section from a rat treated
chronically with CYP. The DRG section was also stained for glial fibrillary acidic protein (GFAP; green).
Bladder afferent cells exhibiting both FB and p75NTR-IR appear pinkish-purple/magenta). (H) Summary
histogram of the percentage of bladder afferent cells expressing p75NTR-IR in control and CYP-treated rats.
(n=4 for each group, #, p ≤ 0.01; *, p ≤ 0.001). Calibration bar represents 35 µm.
138
Figure 7: p75NTR mRNA in L6-S1 DRG
CYP-induced cystitis induces a biphasic response in p75NTR mRNA in L6-S1 DRG. For each experimental
time period, total RNA from individual L6 or S1 DRG was reverse transcribed, and the cDNA templates
synthesized from control and CYP-treated DRG were analyzed by real-time quantitative PCR using primers
specific for rat p75NTR. Transcript levels are normalized to the housekeeping gene, L32 and expressed as
relative change compared to control (100%). n = 5 for all; *, p ≤ 0.01 versus control; **, p ≤ 0.01 versus 4
hour treatment.
139
Table 1: Oligonucleotide primer sequences for p75NTR and the housekeeping gene, L32.
Primer
name
p75NTR upper
p75NTR lower
Primers sequences
Location
TGCTGCTGCTGCTGATTCTA
ACAAGGTCTTGCTCTGGAGGA
47U20a
654L21a
L32 upper
L32 lower
CCTGGCGTTGGGATTGGTGA
GAAAAGCCATCGTAGAAAGA
83U20b
129L20b
Annealing
temp.
65 °C
60 °C
a: Primer positions are given as the nucleotide sequences for the Rattus norvegicus
p75 precursor protein gene sequence with GenBank accession number NM_012610.
b: Primer positions are given as the nucleotide sequences for the Rattus norvegicus
L32 precursor protein gene sequence with GenBank accession number NM_013226.
140
Literature Cited
Allen SJ, Dawbarn D. 2006. Clinical relevance of the neurotrophins and their receptors.
Clin Sci (Lond) 110(2):175-191.
Barker PA. 2007. High affinity not in the vicinity? Neuron 53(1):1-4.
Bennett DL, Averill S, Clary DO, Priestley JV, McMahon SB. 1996. Postnatal changes in
the expression of the trkA high-affinity NGF receptor in primary sensory neurons.
Eur J Neurosci 8(10):2204-2208.
Birder LA, Wolf-Johnston A, Griffiths D, Resnick NM. 2007. Role of urothelial nerve
growth factor in human bladder function. Neurourol Urodyn 26(3):405-409.
Bothwell M. 1995. Functional interactions of neurotrophins and neurotrophin receptors.
Ann Rev Neurosci 18:223-253.
Bronfman FC, Fainzilber M. 2004. Multi-tasking by the p75 neurotrophin receptor:
sortilin things out? EMBO Rep 5(9):867-871.
Chao MV, Hempstead BL. 1995. p75 and Trk: a two-receptor system. Trends Neurosci
18(7):321-326.
Chao MV, Rajagopal R, Lee FS. 2006. Neurotrophin signalling in health and disease.
Clin Sci (Lond) 110(2):167-173.
Chien CC, Fu WM, Huang HI, Lai YH, Tsai YF, Guo SL, Wu TJ, Ling QD. 2007.
Expression of neurotrophic factors in neonatal rats after peripheral inflammation.
J Pain 8(2):161-167.
141
Cho HJ, Park EH, Bae MA, Kim JK. 1996. Expression of mRNAs for preprotachykinin
and nerve growth factor receptors in the dorsal root-ganglion following peripheral
inflammation. Brain Res 716(1-2):197-201.
Chuang YC, Fraser MO, Yu Y, Chancellor MB, de Groat WC, Yoshimura N. 2001. The
role of bladder afferent pathways in bladder hyperactivity induced by the
intravesical administration of nerve growth factor. J Urol 165(3):975-979.
Corrow KA, Vizzard MA. 2007. Phosphorylation of extracellular signal-regulated
kinases in urinary bladder in rats with cyclophosphamide-induced cystitis. Am J
Physiol Regul Integr Comp Physiol 293(1):R125-134.
Debus E, Weber K, Osborn M. 1983. Monoclonal antibodies specific for glial fibrillary
acidic (GFA) protein and for each of the neurofilament triplet polypeptides.
Differentiation; Research Biol Diversity 25(2):193-203.
Delcroix JD, Michael GJ, Priestley JV, Tomlinson DR, Fernyhough P. 1998. Effect of
nerve growth factor treatment on p75NTR gene expression in lumbar dorsal root
ganglia of streptozocin-induced diabetic rats. Diabetes 47(11):1779-1785.
Dhanoa NK, Krol KM, Jahed A, Crutcher KA, Kawaja MD. 2006. Null mutations for
exon III and exon IV of the p75 neurotrophin receptor gene enhance sympathetic
sprouting in response to elevated levels of nerve growth factor in transgenic mice.
Exp Neurol 198(2):416-426.
Dmitrieva N, Shelton D, Rice AS, McMahon SB. 1997. The role of nerve growth factor
in a model of visceral inflammation. Neuroscience 78(2):449-459.
142
Donovan MK, Winternitz SR, Wyss JM. 1983. An analysis of the sensory innervation of
the urinary system in the rat. Brain Res Bull 11(3):321-324.
Elsasser-Beile U, Gutzeit O, Bauer S, Katzenwadel A, Schultze-Seemann W, Wetterauer
U. 2000. Systemic and local immunomodulatory effects of intravesical BCG
therapy in patients with superficial urinary bladder carcinomas. J Urol
163(1):296-299.
Girard BA, Lelievre V, Braas KM, Razinia T, Vizzard MA, Ioffe Y, El Meskini R,
Ronnett GV, Waschek JA, May V. 2006. Noncompensation in peptide/receptor
gene expression and distinct behavioral phenotypes in VIP- and PACAP-deficient
mice. J Neurochem 99(2):499-513.
Guerios SD, Wang ZY, Bjorling DE. 2006. Nerve growth factor mediates peripheral
mechanical hypersensitivity that accompanies experimental cystitis in mice.
Neurosci Lett 392(3):193-197.
Hannila SS, Kawaja MD. 2005. Nerve growth factor-mediated collateral sprouting of
central sensory axons into deafferentated regions of the dorsal horn is enhanced in
the absence of the p75 neurotrophin receptor. J Comp Neurol 486(4):331-343.
Hu P, McLachlan EM. 2000. Distinct sprouting responses of sympathetic and peptidergic
sensory axons proximal to a sciatic nerve transection in guinea pigs and rats.
Neurosci Lett 295(1-2):59-63.
Hu P, McLachlan EM. 2003. Selective reactions of cutaneous and muscle afferent
neurons to peripheral nerve transection in rats. J Neurosci 23(33):10559-10567.
143
Hu VY, Zvara P, Dattilio A, Redman TL, Allen SJ, Dawbarn D, Stroemer RP, Vizzard
MA. 2005. Decrease in bladder overactivity with REN1820 in rats with
cyclophosphamide induced cystitis. J Urol 173(3):1016-1021.
Huang CS, Zhou J, Feng AK, Lynch CC, Klumperman J, DeArmond SJ, Mobley WC.
1999. Nerve growth factor signaling in caveolae-like domains at the plasma
membrane. J Biol Chem 274(51):36707-36714.
Huber LJ, Chao MV. 1995a. Mesenchymal and neuronal cell expression of the p75
neurotrophin receptor gene occur by different mechanisms. Dev Biol 167(1):227238.
Huber LJ, Chao MV. 1995b. A potential interaction of p75 and trkA NGF receptors
revealed by affinity crosslinking and immunoprecipitation. J Neurosci Res
40(4):557-563.
Jahed A, Kawaja MD. 2005. The influences of p75 neurotrophin receptor and brainderived neurotrophic factor in the sympathetic innervation of target tissues during
murine postnatal development. Auton Neurosci 118(1-2):32-42.
Kahle P, Barker PA, Shooter EM, Hertel C. 1994. p75 nerve growth factor receptor
modulates p140trkA kinase activity, but not ligand internalization, in PC12 cells.
J Neurosci Res 38(5):599-606.
Karchewski LA, Bloechlinger S, Woolf CJ. 2004. Axonal injury-dependent induction of
the peripheral benzodiazepine receptor in small-diameter adult rat primary
sensory neurons. Eur J Neurosci 20(3):671-683.
144
Keast JR, De Groat WC. 1992. Segmental distribution and peptide content of primary
afferent neurons innervating the urogenital organs and colon of male rats. J Comp
Neurol 319(4):615-623.
Keast JR, Kepper ME. 2001. Differential regulation of trkA and p75 in noradrenergic
pelvic autonomic ganglion cells after deafferentation of their cholinergic
neighbours. Eur J Neurosci 13(2):211-220.
King VR, Bradbury EJ, McMahon SB, Priestley JV. 2000. Changes in truncated trkB and
p75 receptor expression in the rat spinal cord following spinal cord hemisection
and spinal cord hemisection plus neurotrophin treatment. Exp Neurol 165(2):327341.
Klinger MB, Dattilio A, Vizzard MA. 2007. Expression of cyclooxygenase-2 in urinary
bladder in rats with cyclophosphamide-induced cystitis. Am J Physiol Regul
Integr Comp Physiol 293(2):R677-685.
Kruttgen A, Moller JC, Heymach JV, Jr., Shooter EM. 1998. Neurotrophins induce
release of neurotrophins by the regulated secretory pathway. Proc Natl Acad Sci
(USA) 95(16):9614-9619.
Laberge J, Malley SE, Zvarova K, Vizzard MA. 2006. Expression of corticotropin
releasing factor (CRF) and CRF receptors in micturition pathways after
cyclophosphamide (CYP)-induced cystitis. Am J Physiol Regul Integr Comp
Physiol.
Lamb K, Gebhart GF, Bielefeldt K. 2004. Increased nerve growth factor expression
triggers bladder overactivity. J Pain 5(3):150-156.
145
Lewin GR, Mendell LM. 1993. Nerve growth factor and nociception. Trends Neurosci
16(9):353-359.
Lindholm D, Heumann R, Meyer M, Thoenen H. 1987. Interleukin-1 regulates synthesis
of nerve growth factor in non-neuronal cells of rat sciatic nerve. Nature
330(6149):658-659.
Lowe EM, Anand P, Terenghi G, Williams-Chestnut RE, Sinicropi DV, Osborne JL.
1997. Increased nerve growth factor levels in the urinary bladder of women with
idiopathic sensory urgency and interstitial cystitis. Br J Urol 79(4):572-577.
Meller ST, Cummings CP, Traub RJ, Gebhart GF. 1994. The role of nitric oxide in the
development and maintenance of the hyperalgesia produced by intraplantar
injection of carrageenan in the rat. Neuroscience 60(2):367-374.
Mousa SA, Cheppudira BP, Shaqura M, Fischer O, Hofmann J, Hellweg R, Schafer M.
2007. Nerve growth factor governs the enhanced ability of opioids to suppress
inflammatory pain. Brain 130(Pt 2):502-513.
Nadelhaft I, Vera PL. 1995. Central nervous system neurons infected by pseudorabies
virus injected into the rat urinary bladder following unilateral transection of the
pelvic nerve. J Comp Neurol 359(3):443-456.
Nykjaer A, Willnow TE, Petersen CM. 2005. p75NTR--live or let die. Curr Opin
Neurobiol 15(1):49-57.
Obata K, Katsura H, Sakurai J, Kobayashi K, Yamanaka H, Dai Y, Fukuoka T, Noguchi
K. 2006. Suppression of the p75 neurotrophin receptor in uninjured sensory
146
neurons reduces neuropathic pain after nerve injury. J Neurosci 26(46):1197411986.
Oddiah D, Anand P, McMahon SB, Rattray M. 1998. Rapid increase of NGF, BDNF and
NT-3 mRNAs in inflamed bladder. Neuroreport 9(7):1455-1458.
Okragly AJ, Niles AL, Saban R, Schmidt D, Hoffman RL, Warner TF, Moon TD,
Uehling DT, Haak-Frendscho M. 1999. Elevated tryptase, nerve growth factor,
neurotrophin-3 and glial cell line-derived neurotrophic factor levels in the urine of
interstitial cystitis and bladder cancer patients. J Urol 161(2):438-441; discussion
441-432.
Pezet S, Onteniente B, Jullien J, Junier MP, Grannec G, Rudkin BB, Calvino B. 2001.
Differential regulation of NGF receptors in primary sensory neurons by adjuvantinduced arthritis in the rat. Pain 90(1-2):113-125.
Pioro EP, Cuello AC. 1990. Distribution of nerve growth factor receptor-like
immunoreactivity in the adult rat central nervous system. Effect of colchicine and
correlation with the cholinergic system--II. Brainstem, cerebellum and spinal
cord. Neuroscience 34(1):89-110.
Qiao LY, Vizzard MA. 2002. Cystitis-induced upregulation of tyrosine kinase (TrkA,
TrkB) receptor expression and phosphorylation in rat micturition pathways. J
Comp Neurol 454(2):200-211.
Schweigreiter R. 2006. The dual nature of neurotrophins. Bioessays 28(6):583-594.
147
Scott AL, Borisoff JF, Ramer MS. 2005. Deafferentation and neurotrophin-mediated
intraspinal sprouting: a central role for the p75 neurotrophin receptor. Eur J
Neurosci 21(1):81-92.
Shaw G, Hawkins J. 1992. Identification of spinal cord polypeptides related to glial
fibrillary acidic protein (GFAP). Neuroreport 3(6):461-464.
Sherer TB, Neff PS, Hankins GR, Tuttle JB. 1998a. Mechanisms of increased NGF
production in vascular smooth muscle of the spontaneously hypertensive rat. Exp
Cell Res 241(1):186-193.
Sherer TB, Neff PS, Tuttle JB. 1998b. Increased nerve growth factor mRNA stability
may underlie elevated nerve growth factor secretion from hypertensive vascular
smooth muscle cells. Brain Res Mol Brain Res 62(2):167-174.
Sobreviela T, Clary DO, Reichardt LF, Brandabur MM, Kordower JH, Mufson EJ. 1994.
TrkA-immunoreactive profiles in the central nervous system: colocalization with
neurons containing p75 nerve growth factor receptor, choline acetyltransferase,
and serotonin. J Comp Neurol 350(4):587-611.
Steers WD, Mackway-Gerardi AM, Ciambotti J, de Groat WC. 1994. Alterations in
neural pathways to the urinary bladder of the rat in response to streptozotocininduced diabetes. J Auton Nerv Syst 47(1-2):83-94.
Steers WD, Tuttle JB. 2006. Mechanisms of Disease: the role of nerve growth factor in
the pathophysiology of bladder disorders. Nat Clin Pract Urol 3(2):101-110.
Thompson SW, Dray A, McCarson KE, Krause JE, Urban L. 1995. Nerve growth factor
induces mechanical allodynia associated with novel A fibre-evoked spinal reflex
148
activity and enhanced neurokinin-1 receptor activation in the rat. Pain 62(2):219231.
Tong YC, Cheng JT. 2005. Changes in bladder nerve-growth factor and p75 genetic
expression in streptozotocin-induced diabetic rats. BJU Int 96(9):1392-1396.
Vaidyanathan S, Krishnan KR, Mansour P, Soni BM, McDicken I. 1998. p75 nerve
growth factor receptor in the vesical urothelium of patients with neuropathic
bladder: an immunohistochemical study. Spinal Cord 36(8):541-547.
Verdi JM, Birren SJ, Ibanez CF, Persson H, Kaplan DR, Benedetti M, Chao MV,
Anderson DJ. 1994. p75LNGFR regulates Trk signal transduction and NGFinduced neuronal differentiation in MAH cells. Neuron 12(4):733-745.
Vizzard MA. 1997. Increased expression of neuronal nitric oxide synthase in bladder
afferent and spinal neurons following spinal cord injury. Dev Neurosci 19(3):232246.
Vizzard MA. 2000a. Alterations in spinal cord Fos protein expression induced by bladder
stimulation following cystitis. Am J Physiol Regul Integr Comp Physiol
278(4):R1027-1039.
Vizzard MA. 2000b. Changes in urinary bladder neurotrophic factor mRNA and NGF
protein following urinary bladder dysfunction. Exp Neurol 161(1):273-284.
Vizzard MA. 2000c. Up-regulation of pituitary adenylate cyclase-activating polypeptide
in urinary bladder pathways after chronic cystitis. J Comp Neurol 420(3):335-348.
Vizzard MA. 2001. Alterations in neuropeptide expression in lumbosacral bladder
pathways following chronic cystitis. J Chem Neuroanat 21(2):125-138.
149
Wakabayashi Y, Kawakami T, Aimi Y, Okada Y. 2002. Development of growthassociated protein-43 and neurotrophin receptor immunoreactivities in the rat
urinary bladder. Anat Embryol (Berl) 205(3):255-261.
Wakabayashi Y, Maeda T, Aimi Y, Kwok YN. 1998. Increase of low-affinity
neurotrophin receptor p75 and growth-associated protein-43 immunoreactivities
in the rat urinary bladder during experimentally induced nerve regeneration. J
Urol 160(4):1513-1517.
Wakabayashi Y, Maeda T, Kwok YN. 1996. Increase of p75 immunoreactivity in rat
urinary bladder following inflammation. Neuroreport 7(6):1141-1144.
Wehrman T, He X, Raab B, Dukipatti A, Blau H, Garcia KC. 2007. Structural and
mechanistic insights into nerve growth factor interactions with the TrkA and p75
receptors. Neuron 53(1):25-38.
Woolf CJ, Allchorne A, Safieh-Garabedian B, Poole S. 1997. Cytokines, nerve growth
factor and inflammatory hyperalgesia: the contribution of tumour necrosis factor
alpha. Br J Pharm 121(3):417-424.
Wright DE, Snider WD. 1995. Neurotrophin receptor mRNA expression defines distinct
populations of neurons in rat dorsal root ganglia. J Comp Neurol 351(3):329-338.
Yoshimura N, Bennett NE, Hayashi Y, Ogawa T, Nishizawa O, Chancellor MB, de Groat
WC, Seki S. 2006. Bladder overactivity and hyperexcitability of bladder afferent
neurons after intrathecal delivery of nerve growth factor in rats. J Neurosci
26(42):10847-10855.
150
Yoshimura N, Seki S, Chancellor MB, de Groat WC, Ueda T. 2002. Targeting afferent
hyperexcitability for therapy of the painful bladder syndrome. Urology 59(5
Suppl 1):61-67.
Yuridullah R, Corrow KA, Malley SE, Vizzard MA. 2006. Expression of fractalkine and
fractalkine receptor in urinary bladder after cyclophosphamide (CYP)-induced
cystitis. Auton Neurosci 126-127:380-389.
Zvarova K, Murray E, Vizzard MA. 2004. Changes in galanin immunoreactivity in rat
lumbosacral spinal cord and dorsal root ganglia after spinal cord injury. J Comp
Neurol 475(4):590-603.
Zweifel LS, Kuruvilla R, Ginty DD. 2005. Functions and mechanisms of retrograde
neurotrophin signalling. Nature Rev 6(8):615-625.
151
Chapter 4: The Role of p75NTR in Female Rat Urinary
Bladder with Cyclophosphamide (CYP)-Induced Cystitis
152
Abstract
Previous studies demonstrated changes in urinary bladder neurotrophin content
and upregulation of neurotrophin receptors, TrkA and the p75 neurotrophin receptor
(p75NTR), in micturition reflex pathways after cyclophosphamide (CYP)-induced cystitis.
p75NTR can bind NGF and modulate NGF-TrkA binding and signaling. We examined
p75NTR expression and the role of p75NTR in the micturition reflex in control and CYPtreated rats. p75NTR–immunoreactivity (IR) was present throughout the urinary bladder.
CYP-induced cystitis (4 hour (h), 48 h, chronic) increased (p ≤ 0.05) p75NTR expression
in whole urinary bladder as shown by western blotting. The role of p75NTR in bladder
function in control and CYP-treated rats was determined using conscious cystometry and
immunoneutralization or PD90780, a compound known to specifically block NGF
binding to p75NTR. An anti-p75NTR monoclonal antibody or PD90780 was infused
intravesically and cystometric parameters were evaluated. Both methods of p75NTR
blockade significantly (p ≤ 0.05) decreased the intercontracton interval and void volume
in control and CYP-treated rats. Intravesical infusion of PD90780 also significantly (p ≤
0.001) increased intravesical pressure and increased the number of number of nonvoiding contractions during the filling phase. Control intravesical infusions of isotype
matched IgG and vehicle were without effect. These studies demonstrate: (1) ubiquitous
p75NTR expression in urinary bladder and increased expression with CYP-induced
cystitis; (2) p75NTR blockade at the level of the urinary bladder produces bladder
hyperreflexia in control and CYP-treated rats. The overall activity of the urinary bladder
reflects the balance of NGF-p75NTR and NGF-TrkA signaling.
153
Introduction
Nerve growth factor (NGF) is important in sensory and sympathetic neuronal
development and maintenance (Huang et al., 1999); however, many recent studies
suggest additional role(s) for NGF in painful somatic and visceral inflammatory
conditions (Chien et al., 2007)Friedman, 1999 #151}(Allen and Dawbarn, 2006; Chuang
et al., 2001b; Frossard et al., 2004; Pezet and McMahon, 2006). NGF upregulation occurs
at sites of tissue injury and inflammation (Lindholm et al., 1987; Woolf et al., 1997) and
changes in NGF levels in urine as well as urinary bladder have been documented in
humans with painful bladder syndrome (PBS)/interstitial cystitis (IC) and rodents with
bladder inflammation (Lowe et al., 1997; Oddiah et al., 1998; Okragly et al., 1999;
Vizzard, 2000b). A number of addition and subtraction studies have begun to
demonstrate the role(s) of NGF in inflammatory conditions of the urinary bladder. For
example, intravesical infusion or intramuscular detrusor administration of exogenous
NGF results in increased bladder activity, sensitization of bladder afferents (Chuang et
al., 2001b; Dmitrieva and McMahon, 1996; Dmitrieva et al., 1997), increased expression
of Fos protein in lumbosacral spinal cord in response to bladder distention and increased
expression of neuropeptides in lumbosacral spinal cord (Zvara and Vizzard, 2007).
Strategies to reduce NGF in micturition reflex pathways reduce or eliminate these effects
(Dmitrieva et al., 1997; Hu et al., 2005).
NGF signals through its specific receptor TrkA, as well as p75NTR. TrkA is a
tropomyosin-related receptor tyrosine kinase receptor and p75NTR belongs to the tumor
154
necrosis factor-α family of receptors (Allen and Dawbarn, 2006; Barker, 2004; Bronfman
and Fainzilber, 2004). p75NTR binds all neurotrophins, including brain-derived
neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and NT-4/5. NGF-TrkA signaling is
involved in some inflammatory effects of NGF (Pezet and McMahon, 2006), including
sensitization of nociceptive afferents and the release of neuropeptides. TrkA expression
is increased in bladder afferent cells in lumbosacral dorsal root ganglia (DRG) with acute
and chronic cyclophosphamide (CYP)-induced bladder inflammation (Qiao and Vizzard,
2002). In addition, p75NTR expression is also significantly upregulated in bladder afferent
cells (2.4-2.8-fold) in lumbosacral DRG after CYP-induced cystitis (Klinger et al., 2008).
The pan-neurotrophin receptor p75NTR exhibits an ubiquitous distribution, has many
functions and multiple binding partners and ligands (Barker, 2004; Bronfman and
Fainzilber, 2004). In the absence of Trk expression, p75NTR is suggested to be involved
in apoptosis and regulation of neuronal growth (Barker, 2004; Friedman and Greene,
1999); however, in the presence of TrkA, p75NTR is suggested to function by enhancing
Trk binding to neurotrophins (Barker, 2004; 2007; Wehrman et al., 2007). p75NTR
expression has previously been identified in the urinary bladder (Vaidyanathan et al.,
1998; Wakabayashi et al., 1996; Wakabayashi et al., 1995) but few studies have
examined the role of p75NTR in bladder function or in the context of urinary bladder
inflammation (Wakabayashi et al., 1996). Although we do know that p75NTR expression
is present in micturition reflex pathways in control rats and is regulated with CYPinduced cystitis (Klinger et al., 2008), the potential role(s) of p75NTR in urinary bladder
reflexes have not been explored. In this study we determined: (1) expression of p75NTR
155
in the urinary bladder with immunohistochemistry and western blot and regulation of
p75NTR expression after CYP-induced cystitis; (2) the effect of immunoneutralization
with an anti- p75NTR monoclonal antibody on bladder function in female rats without
(non-inflamed) and with bladder inflammation (48 hr CYP treatment) using conscious
cystometry; (3) the effect of intravesical infusion of PD90780, a compound known to
specifically block NGF binding to p75NTR (Colquhoun et al., 2004; Hefti et al., 2006;
Spiegel et al., 1995), in female rats without (non-inflamed) and with bladder
inflammation (48 hr CYP treatment) using conscious cystometry.
156
Materials and Methods
Cyclophosphamide-induced cystitis: acute, intermediate or chronic
Chemical cystitis was induced in adult (200-225 g), female Wistar rats by CYP treatment
(Klinger et al., 2008; Murray et al., 2004; Vizzard, 2001; Vizzard and Boyle, 1999). CYP
was administered in one of the following ways: 1) 4 hours (h) (150 mg/kg; i.p.) prior to
euthanasia of the animals to elicit acute bladder inflammation; 2) 48 h (150 mg/kg; i.p.)
prior to euthanasia to examine an intermediate inflammation; or 3) administered every
3rd day for 9 days to elicit chronic bladder inflammation (75 mg/kg; i.p.). All injections
of CYP were performed under isoflurane (2%) anesthesia. Control animals were gender
matched to the experimental groups and received a corresponding volume of saline
(0.9%) or distilled water injected intraperitoneally under isoflurane (2%) anesthesia.
Animals were euthanized by isoflurane anesthesia (5%) plus thoracotomy at the indicated
time points, and the urinary bladder was harvested and weighed. The University of
Vermont Institutional Animal Care and Use Committee approved all experimental
procedures (protocol number 06-014) involving animal use. Animal care was under the
supervision of University of Vermont College of Medicine's Office of Animal Care in
accordance with American Association for Accreditation of Laboratory Animal Care and
National Institutes of Health guidelines. All efforts were made to minimize animal
stress/distress and suffering and to use the minimum number of animals.
Whole-mount bladder preparation and immunohistochemistry
157
The urinary bladder from control (n = 5) and CYP treatment (n = 5) was dissected
and placed in Krebs solution. The bladder was cut open along the midline and pinned to a
Sylgard-coated dish. The bladder was incubated for 3 h at room temperature in cold
fixative (2% paraformaldehyde + 0.2% picric acid), and the urothelium was removed as
previously described (Zvarova et al., 2004). Urothelium and bladder musculature were
processed separately for p75NTR-IR. Control and CYP-treated tissues were incubated
overnight at room temperature in rabbit anti-p75NTR antiserum (1:3000; Advanced
Targeting Systems (ATS), San Diego, CA) in 1% goat serum and 0.1 M KPBS (0.1 M
phosphate buffered saline (PBS) with potassium) and then washed (3 × 15 minutes) with
0.1 M KPBS, pH 7.4. After washing, the tissue was incubated in a species-specific
secondary antibody (1:500; Cy3-conjugated goat anti-rabbit; Jackson Immunoresearch,
West Grove, PA) for 2 h at room temperature, followed by washing and coverslipping
with Citifluor (London, UK). Control tissues incubated in the absence of primary or
secondary antibody were also processed and evaluated for specificity or background
staining levels. In the absence of primary antibody, no positive immunostaining was
observed. The specificity of the p75NTR antiserum was previously established (Klinger et
al., 2008). Some whole-mount preparations were stained with the pan neuronal marker,
protein gene product 9.5 (Abcam, Cambridge, MA; 1:15) to visualize nerve fibers in the
suburothelial plexus and to demonstrate that suburothelial nerve fibers expressed p75NTRIR.
p75NTR localization in urinary bladder sections after intravesical p75NTR infusion
158
Immediately after cystometric analyses, urinary bladders were harvested from rats
that had received intravesical infusion of monoclonal antibody to p75NTR and those that
had received intravesical infusion of protamine sulfate. Animals were deeply
anesthetized with isoflurane (5%) and euthanized via thoracotomy. Bladders were
quickly removed and postfixed in 4% paraformaldehyde overnight. Tissues were
cryoprotected by immersion in 30% sucrose (in 0.1 M phosphate-buffered saline)
overnight. Bladders were sectioned (20 µm) on a cryostat and directly mounted on gelled
(0.5%) microscope slides. Tissue was incubated in secondary antibody (Cy2-conjugated
goat anti-mouse; Jackson ImmunoResearch, West Grove, PA) for two h and washed (3
×15 minutes) at room temperature with 0.1 KPBS (pH 7.4). Slides were coverslipped
with Citifluor (London, UK).
Assessment of positive staining in urinary bladder
Staining observed in experimental tissue was compared with that observed from
experiment-matched negative controls. Tissues exhibiting immunoreactivity that was
greater than the background level observed in experiment-matched negative controls
were considered positively stained.
Imaging and Visualization of Bladder Sections
Tissues were examined under an Olympus fluorescence photomicroscope (Optical
Analysis, Nashua, NH) for visualization of Cy2. Cy2 was visualized with a filter with an
excitation range of 470-490 and an emission range from 510-530. Images of bladder
159
sections were captured through a video camera attachment to the microscope with the
exposure time, brightness, and contrast being held constant.
Imaging and visualization of bladder whole-mounts
Tissue was examined and optical sections were acquired using a Zeiss LSM 510
confocal scanning system attached to a Zeiss LSM 510 microscope using a plan Fluor
20x or 10x objective. An excitation wavelength of 543 nm was used for visualization of
p75NTR. Bladder whole-mount images were captured through a video camera attachment
to the microscope with the exposure time, brightness, and contrast held constant.
Western blotting for p75NTR expression in whole urinary bladder
Whole urinary bladders were homogenized separately in tissue protein extraction
agent with protease inhibitors (T-PER; Roche, Indianapolis, IN), and aliquots were
removed for protein assay. Samples (23 µg) were suspended in sample buffer for
fractionation on gels and subjected to SDS-PAGE. Proteins were transferred to
nitrocellulose membranes, and efficiency of transfer was evaluated. Membranes were
blocked overnight in a solution of 5% milk, 3% bovine serum albumin in Tris-buffered
saline with 0.1% Tween. Membranes were incubated in rabbit anti-p75NTR (1:2000; ATS)
overnight at 4°C. Washed membranes were incubated in a species-specific secondary
antibody (1:7000; goat anti-rabbit horseradish peroxidase) for 2 h at room temperature for
160
enhanced chemiluminescence detection (Pierce, Rockford, IL). Blots were exposed to
Biomax film (Kodak, Rochester, NY) and developed. The intensity of each band was
analyzed, and background intensities were subtracted using Un-Scan It software (Silk
Scientific, Orem, UT). Western blot analysis of erk1 and erk2 (1:2000; Cell Signaling
Technology, Danvers, MA) in samples was used as a loading control. The specificity of
the p75NTR antiserum was previously established (Klinger et al., 2008). In pilot studies,
the concentration of p75NTR antiserum used for western blotting studies of urinary bladder
was titrated. The p75NTR antiserum concentration selected for experimentation did not
result in saturation in control tissues and permitted changes in p75NTR expression with
CYP treatment to be evaluated semi-quantitatively.
Intravesical catheter placement
A lower midline abdominal incision was performed under general anesthesia with
2-3% isoflurane using aseptic techniques. Polyethylene tubing (PE-50, Clay Adams,
Parsippany, NJ) with the end flared by heat was inserted into the dome of the bladder and
secured in place with a 6-0 nylon purse-string suture (Hu et al., 2003; Studeny et al.,
2008). The distal end of the tubing was sealed, tunneled subcutaneously, and
externalized at the back of the neck, out of the animal’s reach. Animals were maintained
for 72 h after surgery to ensure complete recovery.
Cystometry
161
The effects of p75NTR blockade on bladder function in control (no inflammation)
and CYP-treated rats (48 h) were evaluated by immunoneutralization with intravesical
infusion of anti-p75NTR monoclonal antibody (ATS; 100 µg/ml) or PD90780 (Pfizer; 10100 µM), known to specifically block NGF- p75NTR (Colquhoun et al., 2004; Hefti et al.,
2006; Spiegel et al., 1995) using conscious cystometry and continuous infusion of
intravesical saline. Intravesical instillation of an isotype-matched IgG and saline (room
temperature, 0.9%) were used as controls. Animals were placed conscious and
unrestrained in recording cages with a balance and pan for urine collection and
measurement placed below (Braas et al., 2006; Hu et al., 2005; Zvara and Vizzard, 2007).
Intravesical pressure changes were recorded using a Small Animal Cystometry System
(Med Associates, Inc.). Saline at room temperature was infused at a rate of 10 ml/h to
elicit repetitive bladder contractions. At least four reproducible micturition cycles were
recorded after an initial stabilization period of 25 - 30 minutes. Voided saline was
collected to determine voided volume. Intercontraction interval, maximal voiding
pressure, pressure threshold for voiding and baseline resting pressure were measured
(Maggi et al., 1986). The number of non-voiding bladder contractions (NVCs) per
voiding cycle during the filling phase was determined. For these studies, NVCs were
defined as rhythmic intravesical pressure rises greater than 7 cm H2O from baseline
pressure without a release of fluid from the urethra. Exclusion criteria Rats were removed
from study when adverse events occurred that included: ≥ 20% reduction in body weight
post surgery, a significant post-operative event, lethargy, pain or distress not relieved by
our IACUC-approved regimen of post-operative analgesics or hematuria in control
162
rodents. In the present study, no rats were excluded from the study or from analysis due
to any of these exclusion criteria. In addition, behavioral movements such as grooming,
standing, walking, and defecation rendered bladder pressure recordings during these
events unusable (Streng et al., 2006). Experiments were conducted at similar times of the
day to avoid the possibility that circadian variations were responsible for changes in
bladder capacity measurements (Dorr, 1992). Rats were euthanized at the conclusion of
study and urinary bladder harvested as described above.
Drug treatments
The effects of p75NTR blockade on bladder function in control (no inflammation) and
CYP-treated rats (48 h) were evaluated by immunoneutralization with intravesical
infusion of anti-p75NTR monoclonal antibody (ATS; 100 µg/ml) or PD90780 (Pfizer; 10100 µM), known to specifically block NGF-p75NTR (Colquhoun et al., 2004; Hefti et al.,
2006; Spiegel et al., 1995) using conscious cystometry . Immediately before cystometric
analysis, rats were anesthetized (1-2% isoflurane) and bladders were manually emptied
with the Credé maneuver. A solution of protamine sulfate (Sigma-Aldrich, St. Louis,
MO; 10 mg/ml in sterile saline) was then infused into the bladder (≤ 1 ml) and
maintained (45 minutes (min)) in the bladder while the rat was anesthetized with
isoflurane (1-2%) to prevent voiding and expulsion of bladder contents (Corrow and
Vizzard, 2007b). Protamine sulfate is used to disrupt urothelial cell-to-cell contact and
increase urothelial permeability (Nishiguchi et al., 2005). This concentration of
protamine sulfate does not affect voiding frequency (Chuang et al., 2003; Fraser et al.,
163
2003). The bladder was then flushed with 0.9% sterile saline and emptied. Rats were
then infused (≤ 1 ml) with either anti-p75NTR monoclonal antibody (n = 9) or with
PD90780 (n = 24) and maintained (30 min) in the bladder while the rat was anesthetized
(isoflurane, 1-2%) to prevent voiding and expulsion of bladder contents (Braas et al.,
2006; Corrow and Vizzard, 2007b). The concentrations and duration of PD90780
infusion chosen for this study were based on previous experiments with PD90780
(Allington et al., 2001; Colquhoun et al., 2004; Du et al., 2006; Spiegel et al., 1995;
Wang et al., 2001). The concentration anti-p75NTR monoclonal antibody used for
intravesical infusion was based on previous studies using anti-p75NTR or anti-NGF in
intrathecal infusion or cell culture applications (Du et al., 2006; Ito et al., 2003; Obata et
al., 2006; Seki et al., 2002; Seki et al., 2004).
Figure preparation
Digital images were obtained using a charge-coupled device camera (MagnaFire
SP, Optronics; Optical Analysis, Nashua, NH) and LG-3 frame grabber attached to an
Olympus microscope (Optical Analysis). Exposure times were held constant when
acquiring images from control and experimental animals processed and analyzed on the
same day. Images were imported into
Adobe Photoshop 8.0 (Adobe Systems, San Jose, CA) where groups
of images were assembled and labeled.
Materials
164
All standard chemicals were obtained from Sigma-Aldrich or Fisher and were
either analytical or laboratory grade. PD90780 was obtained through a compound
transfer agreement with Pfizer, Inc. (Groton, CT).
Statistical Analyses
All values represent mean ± S.E.M. Data were compared one-way analysis of
variance (ANOVA) or two-way ANOVA, where appropriate. When F ratios exceed the
critical value (p ≤ 0.05), the Dunnett’s post-hoc test was used to compare group means.
165
Results
p75NTR immunoreactivity (IR) in urinary bladder
To determine the localization of p75NTR expression in the urinary bladder, wholemount preparations were prepared in control (Fig. 1A-J), and 4 hour (h) (not shown) and
chronic CYP-treated rats (not shown). p75NTR expression was present in the urothelium
and neuronal fibers in the urinary bladder of control rats and CYP-treated rats. p75NTR –
IR was seen in urothelial cells (Fig. 1A, B, D), nerve fibers (Fig. 1B-J) in the
suburothelial plexus, and in nerve fibers in the detrusor in both control and CYP-treated
rats. Nerve fibers adjacent to and encircling suburothelial vasculature also exhibited
p75NTR –IR (Fig. 1C, D, H-J). p75NTR-immunoreactive suburothelial nerve fibers and
nerve fibers associated with the suburothelial vasculature also exhibited
immunoreactivity for the pan neuronal marker, protein gene product (PGP9.5) (Fig. 1EJ). Given the widespread and overlapping nature of the p75NTR –IR in the defined
structures, it was not possible to quantify changes in p75NTR –IR in individual structures
with CYP-induced cystitis. Rather, we examined regulation of p75NTR protein expression
in whole urinary bladder using western blotting techniques.
p75NTR protein expression in urinary bladder with CYP-induced cystitis
p75NTR protein expression in whole urinary bladder as determined by Western
blot analysis significantly (p ≤ 0.05) increased after 4 h (7.7-fold), 48 h (11.1-fold) or
chronic CYP-treatment (3.3-fold) (Fig. 2A, B).
166
Effects of immunoneutralization of p75NTR on cystometry in rats with and without CYPinduced cystitis with intravesical instillation of anti-p75 monoclonal antibody
Control (no inflammation) Intravesical infusion of an anti-p75NTR monoclonal antibody
(100 µg/ml; Fig. 3B, D) increased voiding frequency, with a decreased intercontraction
interval (ICI) (p ≤ 0.001) and decreased void volume (p ≤ 0.001) compared to control rats
(Fig. 3A)(Fig. 4A, B) without intravesical anti-p75NTR instillation. Intravesical infusion of
a monoclonal antibody to p75NTR did not affect baseline, micturition or threshold pressure
or non-voiding contractions during the filling phase (Table 1).
CYP treatment As previously demonstrated, CYP-treatment (48 h) decreased ICI (p ≤
0.001) and void volume (p ≤ 0.001; Fig. 4) and increased micturition (p ≤ 0.001) and
threshold pressure (p ≤ 0.001; Table 1). Intravesical infusion of anti-p75NTR monoclonal
antibody (100 µg/ml) in 48 h CYP-treated rats (Fig. 3D) resulted in an additional increase
in voiding frequency with associated decreased ICI (p ≤ 0.001) and decreased void
volume (p ≤ 0.005; Fig. 4A, B, Table 1). There were no significant changes in
micturition pressure, threshold pressure or non-voiding contractions as compared to rats
with only 48 h CYP-treatment (Fig. 3C)(Table 1). Control experiments with intravesical
infusion of an isotype-matched monoclonal IgG (100 µg/ml) or protamine sulfate (10
mg/ml) showed no effects on bladder function in control or CYP-treated rats (Figs. 3, 4;
Table 1) compared to rats without protamine sulfate or antibody infusion in control or
CYP-treated rats. In pilot studies performed without the initial infusion of protamine
sulfate, no changes in bladder function with subsequent intravesical infusion of the anti-
167
p75NTR monoclonal antibody (100 µg/ml) were observed. Therefore, all subsequent
experiments included protamine sulfate intravesical infusion. The duration of antip75NTR monoclonal antibody effects on all cystometric parameters evaluated in control
and CYP-treated rats was 30-40 min.
p75NTR immunoreactivity (IR) in urinary bladder after intravesical instillation of antip75NTR monoclonal antibody
p75NTR-IR was examined after intravesical instillation of anti-p75NTR monoclonal
antibody by application of a species-specific secondary antibody to cryostat sections (20
µm). p75NTR –IR was present in urothelium and lamina propria (Fig. 5A). p75NTR –IR
decreased in intensity with increasing distance from the bladder lumen. Urinary bladder
sections from rats not receiving intravesical instillation of anti-p75NTR monoclonal
antibody exhibited no immunoreactivity above background levels (Fig. 5B).
Effects of NGF-p75NTR blockade on cystometry in rats with and without CYP-induced
cystitis with intravesical instillation of PD90780
Control (no inflammation) rats PD90780, a compound that specifically blocks NGF
binding to p75NTR (Colquhoun et al., 2004; Hefti et al., 2006; Spiegel et al., 1995), was
infused intravesically (10 µM, 25 µM, 50 µM, and 100 µM) in rats without CYP-induced
cystitis and the effects on cystometric parameters were determined (Fig. 6A-D).
Intravesical instillation of PD90780 decreased void volume (p ≤ 0.002) at all
concentrations evaluated, and decreased ICI at 10 µM (p ≤ 0.05; Fig. 7) and 50 µM (p ≤
168
0.05) (Fig. 6A, B; Fig. 7). PD90780 instillation increased threshold pressure at 25 µM
and 50 µM (p ≤ 0.02) and increased micturition and baseline pressure at all
concentrations (p ≤ 0.002; Table 2) evaluated. Effects of intravesical infusion of
PD90780 in control rats (no inflammation) on void volume were more variable than that
observed in CYP-treated rats (below) (data not shown); there was a disparity between
void volume and infused volume suggestive of potential PD90780 effects on urethral
outlet function.
CYP treatment Intravesical infusion of PD90780 in CYP-treated (48 h) rats significantly
increased voiding frequency (Fig. 6C, D) with a decreased void volume (p ≤ 0.002; Fig.
8B) and ICI (p ≤ 0.002; Fig. 8A) compared to rats with CYP-treatment (48 h) alone.
PD90780 (10 µM, 50 µM, 100 µM) significantly (p ≤ 0.001) increased threshold,
baseline and micturition pressure (Table 2). The numbers of non-voiding contractions
per micturition cycle during the filling phase were significantly (p ≤ 0.002) increased at
10 µM and 50 µM PD90780 concentrations (Table 2). The duration of PD90780 effects
for all concentrations examined for all cystometric parameters evaluated in control and
CYP-treated rats was 30-40 min.
169
Discussion
We have demonstrated several novel findings with respect to the expression and
regulation of p75NTR in urinary bladder with CYP-induced cystitis and the role of p75NTR
in urinary bladder function in control (no inflammation) and CYP-treated rats. p75NTR is
expressed throughout the urinary bladder and is present in nerve fibers of the detrusor
smooth muscle, the suburothelial nerve plexus, urothelial cells, and nerve fibers
associated with the suburothelial bladder vasculature. Total urinary bladder p75NTR
expression increased after acute (4 h), intermediate (48 h) and chronic CYP-induced
cystitis. p75NTR blockade via immunoneutralization and PD90780, known to block NGFp75 NTR interactions (Colquhoun et al., 2004; Hefti et al., 2006; Spiegel et al., 1995),
resulted in bladder hyperreflexia in control rats and further enhanced bladder
hyperreflexia in CYP-treated (48 h) rats associated with decreased void volumes and
intercontraction intervals (ICI) and increased number of non-voiding contractions for
PD90780. These studies suggest that p75NTR interactions can affect overall bladder
function.
NGF binds to two receptors, the p75NTR receptor, a member of the tumor necrosis
factor family of receptors and TrkA, a receptor tyrosine kinase (Allen and Dawbarn,
2006; Barker, 2007; Frossard et al., 2004). However, little information exists concerning
the underlying interactions between neurotrophins, TrkA and p75NTR receptors in
mediating inflammatory-induced changes in micturition pathways. The majority of
NGF-responsive cells express both p75NTR and TrkA (Chao and Hempstead, 1995) and
170
TrkA is exclusively expressed with p75NTR in rat DRG (Wright and Snider, 1995). NGF
selectively binds TrkA whereas p75NTR can bind all neurotrophins with the same affinity
(Huang et al., 1999). p75NTR also binds neurotrophin precursor molecules with high
affinity, including proNGF (Huang et al., 1999). The ability of NGF to bind two very
distinct receptors and the resulting signaling via this receptor complex has puzzled
researchers (Barker, 2007). Much of the recent attention on p75NTR has been focused on
its role in apoptosis and neuronal growth inhibition. However, the original function
attributed to p75NTR was as an accessory protein that modulates Trk receptors to regulate
their affinity for their appropriate ligand (Barker, 2007; Chao et al., 2006). The coexpression of TrkA and p75NTR in heterologous cells results in high-affinity NGF binding
sites (Barker, 2004; Verdi et al., 1994). Thus, it has become a prevailing concept that
p75NTR and TrkA combine to form a receptor complex that results in high-affinity NGF
binding (Chao et al., 2006). However, a recent study (Wehrman et al., 2007) provides
structural and mechanistic evidence for a ligand-passing model in which NGF rapidly
associates with p75 NTR and then is presented to TrkA (Wehrman et al., 2007). In the
model presented, blocking NGF binding to p75NTR attenuates NGF binding to TrkA and
subsequent TrkA activation (Wehrman et al., 2007). It is also suggested that convergent
signaling pathways activated by p75NTR and TrkA could underlie the complex crosstalk
between p75NTR and TrkA (Barker, 2007; Wehrman et al., 2007).
We have recently demonstrated upregulation of p75NTR in dye-labeled
lumbosacral bladder afferents and in the superficial laminae of the dorsal horn in central
171
micturition reflex pathways after acute and chronic CYP-induced cystitis (Klinger et al.,
2008). Few studies have examined the regulation of p75NTR in rat urinary bladder after
experimentally induced nerve regeneration or urinary bladder inflammation (ElsasserBeile et al., 2000; Jahed and Kawaja, 2005; Wakabayashi et al., 1998; Wakabayashi et
al., 1996). To our knowledge, no study has addressed the functional role of p75NTR in
micturition reflex pathways.
It is well documented that NGF is important in a number of inflammatory
conditions including urinary bladder, colon and lung inflammation (Delafoy et al., 2006;
Freund-Michel and Frossard, 2008; Stanzel et al., 2008; Vizzard, 2000b). The exact
contribution of NGF to bladder function is not known but a role for NGF in bladder
hyperreflexia and bladder overactivity has been suggested (Chuang et al., 2001b;
Clemow et al., 1998; Dmitrieva et al., 1997; Guerios et al., 2006; Hu et al., 2005; Oddiah
et al., 1998; Zvara and Vizzard, 2007). Experimentally induced cystitis induces bladder
hyperreflexia and increases bladder NGF protein and transcript (Murray et al., 2004;
Vizzard, 2000b). In the spontaneously hypertensive rat model, increased expression of
bladder NGF is associated with hyperactive voiding (Clemow et al., 1998). Bladder outlet
obstruction is associated with increased expression of bladder NGF (Steers et al., 1991;
Steers and Tuttle, 2006; Zvara et al., 2002). Intrathecal (Yoshimura et al., 2006),
intravesical delivery of NGF (Dmitrieva et al., 1997) or adenovirus-mediated NGF
overexpression (Lamb et al., 2004) in the bladder induces bladder hyperreflexia and
bladder afferent cell hyperexcitability (Yoshimura et al., 2006; Yoshimura et al., 2002) in
172
control rats. NGF scavenging methods (Dmitrieva et al., 1997; Hu et al., 2005) reduce
bladder hyperreflexia in rats with experimentally induced inflammation. Elevated levels
of neurotrophins are detected in the urine of women with painful bladder syndrome
(Okragly et al., 1999) (PBS)/interstitial cystitis (IC) or in the urothelium of individuals
with neuropathic bladder (Lowe et al., 1997). However, a recent study failed to
demonstrate an association between increased urothelium/suburothelium NGF with
detrusor overactivity or bladder sensation (Birder et al., 2007). More recently, it has been
demonstrated that urinary NGF levels are increased in overactive bladder (OAB), urinary
incontinence and decreased in patients responding to botulinum toxin-A treatment (Liu
and Kuo, 2008a; b). Thus, NGF may be a potential biomarker for OAB.
Neurotrophins, through interactions with Trk and/or p75NTR receptors, may
contribute to neurochemical (Vizzard, 2000b; 2001), electrophysiological (Yoshimura et
al., 2002) and organizational (Steers and Tuttle, 2006; Vizzard, 2000b) plasticity of
micturition pathways after cystitis. Neurotrophin/Trk and/or p75NTR interactions could
induce long-term changes in cells (Steers and Tuttle, 2006), including: (1) mediating
neurotransmitter phenotype; (2) influencing dendrite size and synaptic reorganization; (3)
increasing synaptic efficacy; and (4) controlling innervation density and target organ
function. Consistent with the effects of exogenous NGF on urinary bladder function, it
has also been shown that sequestration of NGF or TrkA decreases bladder hyperreflexia
and improves animal well being (Dmitrieva et al., 1997; Hu et al., 2005). Systemic
administration of REN1820, an NGF sequestering protein, decreased bladder
173
hyperreflexia associated with CYP-induced cystitis (Hu et al., 2005). Sequestration of
NGF with a TrkA fusion protein also reduced bladder hyperreflexia following turpentine
oil intravesical instillation (Dmitrieva et al., 1997). Intravenous administration of k252a,
an inhibitor of Trk receptors, reduced referred somatic hypersensitivity of rat hindpaws
induced by CYP-induced cystitis (Guerios et al., 2006). Intravesical instillation of k252a
in CYP-treated rats also reduces bladder hyperreflexia (Vizzard et al., in preparation).
Blockade of the NGF-TrkA pathway in respiratory inflammation models with k252a
(Mohtasham et al., 2007) or NGF blocking antibodies decreased recruitment of
inflammatory cells and bronchial hyperresponsiveness, respectively (Frossard et al.,
2004). Immunoneutralization of p75NTR in adult rat sensory neurons inhibits upregulation
of substance P induced by NGF application (Skoff and Adler, 2006). Studies using
p75NTR knock-out (KO) mice or immunoneutralization of p75NTR reduced bronchial
hyperresponsiveness and substance P release in the airway (Farraj et al., 2006; Kerzel et
al., 2003; Tokuoka et al., 2001).
In contrast to reduced hyperresponsiveness with p75NTR blockade or absence
(p75NTR KO) in the pulmonary system (Farraj et al., 2006; Kerzel et al., 2003; Tokuoka et
al., 2001), the present studies demonstrate bladder hyperreflexia or enhanced
hyperreflexia in control or CYP-treated rats following intravesical blockade of p75NTR by
two different approaches. Immunoneutralization of p75NTR via intravesical instillation of
an anti-p75NTR monoclonal antibody increased urinary bladder frequency (decreased
intercontraction interval (ICI), decreased void volume) in both control (no inflammation)
174
and CYP-treated rats whereas intravesical pressures (baseline, micturition, threshold)
were not affected. To confirm that the observed changes in bladder function were not
associated with non-specific actions of immunoglobulin, intravesical instillation of
isotype-matched IgG was infused and was without effect on any cystometric parameter
evaluated. Intravesical infusion of PD90780, known to block NGF-p75NTR interactions
(Colquhoun et al., 2004; Hefti et al., 2006; Spiegel et al., 1995), produced similar but also
additional changes in the cystometric parameters evaluated. PD90780 increased voiding
frequency (decreased ICI, decreased void volume) in control and CYP-treated rats, but
also altered threshold, baseline and micturition pressures; vehicle infusions were without
effect. This study and previous studies have demonstrated that CYP-treatment produces
bladder hyperreflexia in addition to a number of neurochemical, electrophysiological and
organizational changes of the micturition reflex (Hu et al., 2003; Hu et al., 2005; Vizzard,
2000a; 2001; Vizzard and Boyle, 1999; Yoshimura and de Groat, 1999). The
demonstration that p75NTR blockade further increases bladder hyperreflexia shows that
the frequency of the micturition reflex is not saturated with CYP treatment but can be
further modulated.
Intravesical infusion of PD90780 produced some differential effects between
control (no inflammation) and CYP-treated rats in contrast to the effects produced by
immunoneutralization of p75NTR with an anti-p75NTR monoclonal antibody that were
similar in control and CYP-treated rats. In control rats treated with intravesical
instillation of PD90780, there was evidence of incomplete voiding as rats exhibited small
175
void volumes in comparison to infused volume. This mismatch between void and infused
volumes was not observed in CYP-treated rats infused with PD90780 or in control or
CYP-treated rats infused with anti-p75NTR monoclonal antibody. This mismatch between
void volume and infused volume may suggest PD90780 effects on the urethral outlet.
Given the ubiquitous expression of p75NTR throughout the urinary bladder demonstrated
in the present studies and the peripheral and central nervous system in general (Friedman
and Greene, 1999; Frossard et al., 2004; Wakabayashi et al., 1998; Wakabayashi et al.,
1996), it would not be surprising that the urethra expressed p75NTR. Why the potential
effects of PD90780 on the urethra are exhibited in control but not CYP-treated rats may
be related to p75NTR and NGF expression in the urinary bladder with CYP-induced
cystitis. Previous and present studies demonstrated significant increases in total p75NTR
and NGF bladder expression with CYP-induced cystitis (Hu et al., 2005; Klinger et al.,
2008; Murray et al., 2004; Vizzard, 2000b). In control rats with less p75NTR and NGF
expression in the urinary bladder, infusion of PD90780 may exert bladder and urethral
effects because the drug may be more available and have broader effects and affect NGFp75NTR interactions at the urethra. In contrast, with CYP-induced cystitis and increased
p75NTR and NGF expression in the urinary bladder, effects of PD90780 infusion may be
less available and restricted to the urinary bladder. PD90780 effects on ICI and void
volume in control rats were also demonstrated at the lowest concentration (10 µM)
evaluated whereas PD90780 effects in CYP-treated rats (48 h) were observed at 25 µM
PD90780. Thus, differences in p75NTR and NGF expression in control versus inflamed
urinary bladder may also underlie differences in effective doses of PD90780. Another
176
possibility underlying differential effects of PD90780 in control and CYP-treated rats
may be due to variable penetration of PD90780 in the inflamed urinary bladder with
CYP-treatment.
Cystometric effects of p75NTR blockade with intravesical instillation of an antip75NTR monoclonal antibody may be due to blockade of other neurotrophins, in addition
to NGF, binding to p75NTR since brain derived neurotrophic factor (BDNF), neurotrophin
(NT)-3 and NT-4 may also bind p75NTR, are also present in urinary bladder, and
expression of BDNF, NT-3 and NT-4 is altered by CYP-induced cystitis (Vizzard,
2000b). However, the PD90780 compound, which specifically blocks NGF binding to
p75NTR (Colquhoun et al., 2004; Hefti et al., 2006; Spiegel et al., 1995), produced similar
and broader cystometric changes. Thus, we suggest that the observed cystometric effects
are attributable to blockade of p75NTR-NGF interactions.
These studies demonstrate widespread p75NTR expression in many cell types in the
urinary bladder and increased total p75NTR expression in the urinary bladder with CYPinduced cystitis. This makes it difficult to determine the exact site(s) of action in the
urinary bladder of the p75NTR antibody. We do know that intravesical infusion of antip75NTR monoclonal antibody without infusion of protamine sulfate showed no
cystometric effects. This likely indicates a site of p75NTR action deep to the urothelium,
since protamine sulfate is used to disrupt cell-to-cell contact of urothelial cells (Chuang et
al., 2003; Stein et al., 1996). Our demonstration of p75NTR –IR after intravesical infusion
177
of anti- p75NTR supports this suggestion as p75NTR –IR is present in the lamina propria.
Potential targets include the suburothelial nerve plexus, interstitial cells of Cajal and
myofibroblasts all distributed beneath the urothelium (Andersson and Arner, 2004) as
well as inflammatory cell infiltrates in bladders from CYP-treated rats and nerve fibers
innervating the detrusor smooth muscle.
p75NTR receptor blockade at the level of the urinary bladder produced changes in
ICI, void volume, changes in threshold and micturition pressure and increases in the
number of non-voiding contractions during the filling phase. Changes in ICI resulting in
changes in void volume, and changes in threshold pressure are suggestive of changes on
the afferent limb of the micturition reflex. Changes in micturition pressure are thought to
be dependent on the efficiency of neurotransmission of bladder efferents (Maggi et al.,
1986). Changes in non-voiding contractions observed with PD90780 infusions in CYPtreated rats may have both myogenic and neurogenic components (Gillespie, 2005;
Herrera et al., 2003; Streng et al., 2006). For example, myogenic contractions could
trigger afferent firing which then evokes a reflex efferent discharge that amplifies the
myogenic contraction. Effects of intravesical anti-p75NTR infusion were limited to ICI
and void volume without effects on intravesical pressures suggesting that the afferent
limb of the micturition reflex is targeted. Greater concentrations of anti-p75NTR were not
evaluated in the present study so it is not known if additional cystometric changes would
have emerged suggestive of effects on the efferent limb of the micturition reflex. In
178
contrast, effects of PD90780 on ICI, void volume and intravesical pressures suggest that
both the afferent and efferent limbs of the micturition reflex are affected.
The present experiments show that p75NTR blockade at the level of the urinary
bladder increases voiding frequency in control rats and further increases voiding
frequency in CYP-treated rats. Thus, one function of p75NTR and NGF-p75NTR
interactions in vivo may be to reduce bladder activity or to offset bladder hyperreflexia
induced by CYP-induced cystitis. Whereas it is known that p75NTR expression can
enhance TrkA-NGF binding in some systems (Allen and Dawbarn, 2006; Chao and
Hempstead, 1995), it is also possible that NGF binding to p75NTR could reduce NGFTrkA signaling by sequestering NGF away from TrkA (Dhanoa et al., 2006; Hannila and
Kawaja, 2005; Nykjaer et al., 2005). The importance of p75NTR in bladder function may
depend on the balance of NGF/TrkA and NGF/p75NTR signaling. Although perhaps less
clinically relevant than OAB, detrusor overactivity or bladder hyperreflexia, detrusor
underactivity is a clinical problem that is seen most often in men although women are
also affected (Cucchi et al., 2008). It consists of reduced muscle contraction strength or
velocity and often results in incomplete voiding, post-void residual, prolonged emptying
and reduced free uroflow (Cucchi et al., 2007; Cucchi et al., 2008). Detrusor
underactivity can be neurogenic, idiopathic or a result of bladder outflow obstruction
(Cucchi et al., 2007; Murakami et al., 2008). Whether blockade of p75NTR in this context
would be beneficial or whether p75NTR receptors are regulated by detrusor underactivity
awaits further study.
179
Acknowledgements
The authors gratefully acknowledge the technical expertise and support provided by
the VT Cancer Center DNA Analysis Facility. The authors thank Abbey Dattilio, Kristen
Schutz and Susan Malley for technical assistance.
Grants
This work was funded by NIH grants DK051369, DK060481, and DK065989. NIH
Grant Number P20 RR16435 from the COBRE Program of the National Center also
supported the project for Research Resources.
180
Intravesical
Infusion
Control
(no CYP)
48 h CYP
no antibody
Threshold
Pressure
(cm H2O)
Micturition
Pressure
(cm H2O)
Baseline
Pressure
(cm H2O)
Non-Voiding
Contractions
per Micturition
Cycle
15.1 ± 0.9
38.5 ± 1.3
15.1 ± 0.9
0.7 ± 0.3
15.0 ± 0.6
0.8 ± 0.3
anti-p75NTR
monoclonal
antibody
14.2 ± 1.0
no antibody
19.3 ± 0.7
anti-p75NTR
monoclonal
antibody
13.9 ± 1.1
39.5 ± 2.0
*
46.7 ± 1.4
*
44.1 ± 2.0
20.0 ± 0.8
*
14.0 ± 1.0
0.2 ± 0.1
*
0.3 ± 0.1
Table 1: Effects of intravesical infusion of an anti-p75NTR monoclonal antibody on
cystometric parameters.
Effects of intravesical infusion of an anti-p75NTR monoclonal antibody on baseline pressure, threshold
pressure, micturition pressure and numbers of non-voiding contractions (NVCs) per micturition cycle are
indicated. Threshold pressure and micturition pressure were significantly increased after 48 h CYP
treatment. No effects of anti-p75NTR monoclonal antibody on threshold pressure, baseline pressure or peak
micturition pressure were observed. The no antibody group received intravesical infusion of protamine
sulfate (10 mg/ml), which did not differ from rats receiving intravesical infusion of protamine sulfate and
isotype-matched IgG. Values are means ± S.E.M. *, p ≤ 0.001 compared to isotype-matched IgG infusion
in control rats. n = 4-11 rats in each group.
181
Threshold
Pressure
(cm H2O)
Micturition
Pressure
(cm H2O)
Baseline
Pressure
(cm H2O)
PS only
15.1 ± 0.9
38.5 ± 1.3
15.1 ± 0.9
10 µM PD90780
17.0 ± 1.3
47.1 ± 3.0 *
18.4 ± 1.2 *
1.9 ± 0.7
25 µM PD90780
20.2 ± 1.5 *
50.8 ± 1.8 *
21.5 ± 1.3 *
0.8 ± 0.4
50 µM PD90780
19.4 ± 1.1 *
47.1 ± 2.6 *
21.5 ± 1.0 *
1.6 ± 0.4
100 µM PD90780
19.1 ± 1.2
51.0 ± 2.1 *
21.3 ± 1.4 *
1.0 ± 0.4
PS only
19.3 ± 0.7
46.7 ± 1.4
20.0 ± 0.8
0.2 ± 0.1
10 µM PD90780
25.1 ± 0.8 *
57.8 ± 2.8 *
24.3 ± 0.6*
1.1 ± 0.3 *
25 µM PD90780
22.1 ± 1.7
49.1 ± 3.1
21.8 ± 1.7
0.3 ± 0.2
50 µM PD90780
25.7 ± 0.8 *
61.2 ± 2.5 *
27.7 ± 1.3*
0.6 ± 0.2 *
100 µM PD90780
24.0 ± 0.8 *
56.1 ± 2.6 *
24.3 ± 0.8*
0.3 ± 0.1
Intravesical
Infusion
no
CYP
48 h
CYP
Non-Voiding
Contractions
per
Micturition
Cycle
0.7 ± 0.3
Table 2: Effects of intravesical infusion of PD90780 on cystometric parameters.
Effects of intravesical infusion of PD90780 on baseline pressure, threshold pressure, micturition pressure
and non-voiding contractions (NVCs) per micturition cycle are indicated. In control rats (no CYP
treatment), intravesical infusion of PD90780 significantly increased micturition pressure and threshold
pressure. In CYP-treated rats (48 h), PD90780 infusion significantly increased threshold pressure,
micturition pressure and NVCs. PS, protamine sulfate (10 mg/ml). Values are means ± S.E.M. *, p ≤
0.001 compared to PS (10 mg/ml) and saline infusion in control rats. n = 4-11 rats in each group.
182
Figures
Figure 1: Urinary Bladder whole-mount preparations
p75NTR and pan-neuronal marker, protein gene product 9.5 (PGP9.5) immunoreactivity (IR) in urinary
bladder whole-mount preparations with the urothelium/suburothelium dissected from the detrusor smooth
muscle. A. Confocal image of p75NTR–IR in urothelial cells. B. Epifluorescence image of p75NTR–IR
suburothelial nerve fibers (yellow arrows) in close proximity to p75NTR–IR urothelial cells (white arrows).
C. p75NTR–IR in suburothelial nerve fibers (white arrows) and vasculature (yellow arrows). D. p75NTR–
IR in vasculature (yellow arrows), nerve fibers (white arrows) and urothelial cells out of the focal plane
(asterisks). p75NTR-immunoreactive suburothelial fibers (arrows E, H) also expressed PGP9.5-IR (arrows
F, I). Panels G and J show merged images of E, H and F, I, respectively. Calibration bar represents 100
µm.
183
Figure 2: Western blot for p75NTR expression in whole urinary bladder
A. Representative western blot of whole urinary bladder (23 μg) for p75NTR expression in control rats and
those treated with cyclophosphamide (CYP) for varying duration. Erk1 staining was used as a loading
control. B. Histogram of relative p75NTR band density in all groups examined normalized to Erk1 in the
same samples. p75NTR expression in whole urinary bladder is significantly increased with acute (4 h),
intermediate (48 h) and chronic CYP treatment. *, p ≤ 0.05. n = 4 for all groups.
184
Figure 3: Intravesical infusion of anti-p75NTR monoclonal antibody
Intravesical infusion of anti-p75NTR monoclonal antibody in control and in CYP-treated (48 h) rats
increased voiding frequency (decreased intercontraction interval). Representative cystometrogram
recordings in rats treated with (A) intravesical protamine sulfate in control rats, (B) protamine sulfate and
anti-p75NTR monoclonal antibody (100 µg/ml) in control rats, (C) protamine sulfate in CYP-treated (48 h)
rats, (D) protamine sulfate and anti- p75NTR monoclonal antibody (100 µg/ml) in CYP-treated (48 h) rats.
185
Figure 4: Voiding frequency and inter-contraction interval
Intravesical infusion of anti- p75NTR monoclonal antibody (100 µg/ml) significantly increased voiding
frequency in control and in CYP-treated (48 h) rats. Both inter-contraction interval (A) and void volume
(B) were significantly (p ≤ 0.001) reduced with intravesical infusion of anti-p75NTR. n = 4-11 for all
groups.
186
Figure 5: p75NTR-IR in urinary bladder sections after intravesical infusion of anti-p75NTR
p75NTR-IR in urinary bladder sections after intravesical infusion of anti-p75NTR and application of speciesspecific secondary antibodies to demonstrate penetration of the antibody into the urinary bladder with
intravesical infusion. Epifluorescence images of (A) rat urinary bladder after intravesical infusion of antip75NTR (100 µg/ml) and (B) rat urinary bladder after only intravesical infusion of protamine sulfate. A.
p75NTR -IR is observed in urothelium and lamina propria, with staining reduced with increasing distance
from the bladder lumen. B. No p75NTR-IR was observed in rat urinary bladder in the absence of intravesical
antibody infusion. U, urothelium; LP, lamina propria; l, lumen. Calibration bar represents 120 µm.
187
Figure 6: Intravesical infusion of PD90780
Intravesical infusion of PD90780, a compound that specifically blocks NGF binding to p75NTR, results in
decreased bladder capacity in control (no inflammation) and in 48 h CYP-treated rats. Representative
cystometrogram recordings in rats treated with (A) intravesical protamine sulfate in control rats, (B)
protamine sulfate and PD90780 (100 µM) in control rats, (C) protamine sulfate in CYP-treated (48 h) rats,
(D) protamine sulfate and PD90780 (100 µM) in CYP-treated (48 h) rats.
188
Figure 7: Voiding frequency and inter-contraction interval in control rats
Summary histograms of the effects of intravesical infusion of PD90780 in control rats (no CYP treatment).
A. Infusion of PD90780 (10, 50 µM) significantly (p ≤ 0.05) reduced inter-contraction interval. B. Void
volume in control rats was also significantly (p ≤ 0.05) reduced at all PD90780 concentrations evaluated
(10 µM, 25 µM, 50 µM, 100 µM). n = 4-6 for all groups.
189
Figure 8: Voiding frequency and inter-contraction interval in CYP-treated rats
Summary histograms of the effects of intravesical infusion of PD90780 in CYP-treated (48 h) rats. Rats
were treated with CYP 48 h prior to intravesical infusion of PD90780 and analysis with conscious
cystometry. A. Intravesical infusion of PD90780 (25 µM, 50µM, 100 µM) significantly (p ≤ 0.002)
reduced inter-contraction interval in rats treated with CYP (48 h). B. Void volume in CYP- treated (48 h)
rats was also significantly (p ≤ 0.002) reduced at these same concentrations. n = 5-11 for all groups.
190
References
1.
Allen SJ and Dawbarn D. Clinical relevance of the neurotrophins and their
receptors. Clin Sci (Lond) 110: 175-191, 2006.
2.
Allington C, Shamovsky IL, Ross GM, and Riopelle RJ. Zinc inhibits
p75NTR-mediated apoptosis in chick neural retina. Cell Death Differ 8: 451-456, 2001.
3.
Andersson KE and Arner A. Urinary bladder contraction and relaxation:
physiology and pathophysiology. Physiol Rev 84: 935-986, 2004.
4.
Barker PA. High affinity not in the vicinity? Neuron 53: 1-4, 2007.
5.
Barker PA. p75NTR is positively promiscuous: novel partners and new insights.
Neuron 42: 529-533, 2004.
6.
Birder LA, Wolf-Johnston A, Griffiths D, and Resnick NM. Role of urothelial
nerve growth factor in human bladder function. Neurourol Urodyn 26: 405-409, 2007.
7.
Braas KM, May V, Zvara P, Nausch B, Kliment J, Dunleavy JD, Nelson MT,
and Vizzard MA. Role for pituitary adenylate cyclase activating polypeptide in cystitisinduced plasticity of micturition reflexes. Am J Physiol Regul Integr Comp Physiol 290:
R951-962, 2006.
8.
Bronfman FC and Fainzilber M. Multi-tasking by the p75 neurotrophin
receptor: sortilin things out? EMBO Rep 5: 867-871, 2004.
9.
Chao MV and Hempstead BL. p75 and Trk: a two-receptor system. Trends
Neurosci 18: 321-326, 1995.
10.
Chao MV, Rajagopal R, and Lee FS. Neurotrophin signalling in health and
disease. Clin Sci (Lond) 110: 167-173, 2006.
191
11.
Chien CC, Fu WM, Huang HI, Lai YH, Tsai YF, Guo SL, Wu TJ, and Ling
QD. Expression of neurotrophic factors in neonatal rats after peripheral inflammation. J
Pain 8: 161-167, 2007.
12.
Chuang YC, Chancellor MB, Seki S, Yoshimura N, Tyagi P, Huang L,
Lavelle JP, De Groat WC, and Fraser MO. Intravesical protamine sulfate and
potassium chloride as a model for bladder hyperactivity. Urology 61: 664-670, 2003.
13.
Chuang YC, Fraser MO, Yu Y, Chancellor MB, de Groat WC, and
Yoshimura N. The role of bladder afferent pathways in bladder hyperactivity induced by
the intravesical administration of nerve growth factor. J Urol 165: 975-979, 2001.
14.
Clemow DB, Steers WD, McCarty R, and Tuttle JB. Altered regulation of
bladder nerve growth factor and neurally mediated hyperactive voiding. Am J Physiol
275: R1279-1286, 1998.
15.
Colquhoun A, Lawrance GM, Shamovsky IL, Riopelle RJ, and Ross GM.
Differential activity of the nerve growth factor (NGF) antagonist PD90780 [7(benzolylamino)-4,9-dihydro-4-methyl-9-oxo-pyrazolo[5,1-b]quinazoline-2 -carboxylic
acid] suggests altered NGF-p75NTR interactions in the presence of TrkA. J Pharmacol
Exp Ther 310: 505-511, 2004.
16.
Corrow KA and Vizzard MA. Phosphorylation of extracellular signal-regulated
kinases in urinary bladder in rats with cyclophosphamide-induced cystitis. Am J Physiol
Regul Integr Comp Physiol 293: R125-134, 2007.
192
17.
Cucchi A, Quaglini S, Guarnaschelli C, and Rovereto B. Urodynamic findings
suggesting two-stage development of idiopathic detrusor underactivity in adult men.
Urology 70: 75-79, 2007.
18.
Cucchi A, Quaglini S, and Rovereto B. Development of idiopathic detrusor
underactivity in women: from isolated decrease in contraction velocity to obvious
impairment of voiding function. Urology 71: 844-848, 2008.
19.
Delafoy L, Gelot A, Ardid D, Eschalier A, Bertrand C, Doherty AM, and
Diop L. Interactive involvement of brain derived neurotrophic factor, nerve growth
factor, and calcitonin gene related peptide in colonic hypersensitivity in the rat. Gut 55:
940-945, 2006.
20.
Dhanoa NK, Krol KM, Jahed A, Crutcher KA, and Kawaja MD. Null
mutations for exon III and exon IV of the p75 neurotrophin receptor gene enhance
sympathetic sprouting in response to elevated levels of nerve growth factor in transgenic
mice. Exp Neurol 198: 416-426, 2006.
21.
Dmitrieva N and McMahon SB. Sensitisation of visceral afferents by nerve
growth factor in the adult rat. Pain 66: 87-97, 1996.
22.
Dmitrieva N, Shelton D, Rice AS, and McMahon SB. The role of nerve growth
factor in a model of visceral inflammation. Neuroscience 78: 449-459, 1997.
23.
Dorr W. Cystometry in mice--influence of bladder filling rate and circadian
variations in bladder compliance. J Urol 148: 183-187, 1992.
193
24.
Du Y, Fischer TZ, Clinton-Luke P, Lercher LD, and Dreyfus CF. Distinct
effects of p75 in mediating actions of neurotrophins on basal forebrain oligodendrocytes.
Mol Cell Neurosci 31: 366-375, 2006.
25.
Elsasser-Beile U, Gutzeit O, Bauer S, Katzenwadel A, Schultze-Seemann W,
and Wetterauer U. Systemic and local immunomodulatory effects of intravesical BCG
therapy in patients with superficial urinary bladder carcinomas. J Urol 163: 296-299,
2000.
26.
Farraj AK, Haykal-Coates N, Ledbetter AD, Evansky PA, and Gavett SH.
Inhibition of pan neurotrophin receptor p75 attenuates diesel particulate-induced
enhancement of allergic airway responses in C57/B16J mice. Inhal Toxicol 18: 483-491,
2006.
27.
Fraser MO, Chuang YC, Tyagi P, Yokoyama T, Yoshimura N, Huang L, De
Groat WC, and Chancellor MB. Intravesical liposome administration--a novel
treatment for hyperactive bladder in the rat. Urology 61: 656-663, 2003.
28.
Freund-Michel V and Frossard N. The nerve growth factor and its receptors in
airway inflammatory diseases. Pharmacol Ther 117: 52-76, 2008.
29.
Friedman WJ and Greene LA. Neurotrophin signaling via Trks and p75. Exp
Cell Res 253: 131-142, 1999.
30.
Frossard N, Freund V, and Advenier C. Nerve growth factor and its receptors
in asthma and inflammation. Eur J Pharmacol 500: 453-465, 2004.
31.
Gillespie JI. Inhibitory actions of calcitonin gene-related peptide and capsaicin:
evidence for local axonal reflexes in the bladder wall. BJU Int 95: 149-156, 2005.
194
32.
Guerios SD, Wang ZY, and Bjorling DE. Nerve growth factor mediates
peripheral mechanical hypersensitivity that accompanies experimental cystitis in mice.
Neurosci Lett 392: 193-197, 2006.
33.
Hannila SS and Kawaja MD. Nerve growth factor-mediated collateral sprouting
of central sensory axons into deafferentated regions of the dorsal horn is enhanced in the
absence of the p75 neurotrophin receptor. J Comp Neurol 486: 331-343, 2005.
34.
Hefti FF, Rosenthal A, Walicke PA, Wyatt S, Vergara G, Shelton DL, and
Davies AM. Novel class of pain drugs based on antagonism of NGF. Trends Pharmacol
Sci 27: 85-91, 2006.
35.
Herrera GM, Pozo MJ, Zvara P, Petkov GV, Bond CT, Adelman JP, and
Nelson MT. Urinary bladder instability induced by selective suppression of the murine
small conductance calcium-activated potassium (SK3) channel. J Physiol 551: 893-903,
2003.
36.
Hu VY, Malley S, Dattilio A, Folsom JB, Zvara P, and Vizzard MA. COX-2
and prostanoid expression in micturition pathways after cyclophosphamide-induced
cystitis in the rat. Am J Physiol Regul Integr Comp Physiol 284: R574-585, 2003.
37.
Hu VY, Zvara P, Dattilio A, Redman TL, Allen SJ, Dawbarn D, Stroemer
RP, and Vizzard MA. Decrease in bladder overactivity with REN1820 in rats with
cyclophosphamide induced cystitis. J Urol 173: 1016-1021, 2005.
38.
Huang CS, Zhou J, Feng AK, Lynch CC, Klumperman J, DeArmond SJ, and
Mobley WC. Nerve growth factor signaling in caveolae-like domains at the plasma
membrane. J Biol Chem 274: 36707-36714, 1999.
195
39.
Ito H, Nomoto H, and Furukawa S. Growth arrest of PC12 cells by nerve
growth factor is dependent on the phosphatidylinositol 3-kinase/Akt pathway via p75
neurotrophin receptor. J Neurosci Res 72: 211-217, 2003.
40.
Jahed A and Kawaja MD. The influences of p75 neurotrophin receptor and
brain-derived neurotrophic factor in the sympathetic innervation of target tissues during
murine postnatal development. Auton Neurosci 118: 32-42, 2005.
41.
Kerzel S, Path G, Nockher WA, Quarcoo D, Raap U, Groneberg DA, Dinh
QT, Fischer A, Braun A, and Renz H. Pan-neurotrophin receptor p75 contributes to
neuronal hyperreactivity and airway inflammation in a murine model of experimental
asthma. Am J Respir Cell Mol Biol 28: 170-178, 2003.
42.
Klinger MB, Girard B, and Vizzard MA. p75NTR expression in rat urinary
bladder sensory neurons and spinal cord with cyclophosphamide-induced cystitis. J
Comp Neurol 507: 1379-1392, 2008.
43.
Lamb K, Gebhart GF, and Bielefeldt K. Increased nerve growth factor
expression triggers bladder overactivity. J Pain 5: 150-156, 2004.
44.
Lindholm D, Heumann R, Meyer M, and Thoenen H. Interleukin-1 regulates
synthesis of nerve growth factor in non-neuronal cells of rat sciatic nerve. Nature 330:
658-659, 1987.
45.
Liu HT and Kuo HC. Urinary nerve growth factor level could be a potential
biomarker for diagnosis of overactive bladder. J Urol 179: 2270-2274, 2008.
196
46.
Liu HT and Kuo HC. Urinary Nerve Growth Factor Levels Are Increased in
Patients with Bladder Outlet Obstruction with Overactive Bladder Symptoms and
Reduced After Successful Medical Treatment. Urology, 2008.
47.
Lowe EM, Anand P, Terenghi G, Williams-Chestnut RE, Sinicropi DV, and
Osborne JL. Increased nerve growth factor levels in the urinary bladder of women with
idiopathic sensory urgency and interstitial cystitis. Br J Urol 79: 572-577, 1997.
48.
Maggi CA, Santicioli P, and Meli A. The nonstop transvesical cystometrogram
in urethane-anesthetized rats: a simple procedure for quantitative studies on the various
phases of urinary bladder voiding cycle. J Pharmacol Methods 15: 157-167, 1986.
49.
Mohtasham L, Auais A, and Piedimonte G. Nerve growth factor mediates
steroid-resistant inflammation in respiratory syncytial virus infection. Pediatr Pulmonol
42: 496-504, 2007.
50.
Murakami S, Yoshida M, Masunaga K, Maeda Y, and Ueda S. Change in
acetylcholine release from rat bladder with partial outlet obstruction. BJU Int 101: 633639, 2008.
51.
Murray E, Malley SE, Qiao LY, Hu VY, and Vizzard MA. Cyclophosphamide
induced cystitis alters neurotrophin and receptor tyrosine kinase expression in pelvic
ganglia and bladder. J Urol 172: 2434-2439, 2004.
52.
Nishiguchi J, Hayashi Y, Chancellor MB, de Miguel F, de Groat WC, Kumon
H, and Yoshimura N. Detrusor overactivity induced by intravesical application of
adenosine 5'-triphosphate under different delivery conditions in rats. Urology 66: 13321337, 2005.
197
53.
Nykjaer A, Willnow TE, and Petersen CM. p75NTR--live or let die. Curr Opin
Neurobiol 15: 49-57, 2005.
54.
Obata K, Katsura H, Sakurai J, Kobayashi K, Yamanaka H, Dai Y, Fukuoka
T, and Noguchi K. Suppression of the p75 neurotrophin receptor in uninjured sensory
neurons reduces neuropathic pain after nerve injury. J Neurosci 26: 11974-11986, 2006.
55.
Oddiah D, Anand P, McMahon SB, and Rattray M. Rapid increase of NGF,
BDNF and NT-3 mRNAs in inflamed bladder. Neuroreport 9: 1455-1458, 1998.
56.
Okragly AJ, Niles AL, Saban R, Schmidt D, Hoffman RL, Warner TF, Moon
TD, Uehling DT, and Haak-Frendscho M. Elevated tryptase, nerve growth factor,
neurotrophin-3 and glial cell line-derived neurotrophic factor levels in the urine of
interstitial cystitis and bladder cancer patients. J Urol 161: 438-441; discussion 441-432,
1999.
57.
Pezet S and McMahon SB. Neurotrophins: Mediators and Modulators of Pain.
Annu Rev Neurosci, 2006.
58.
Qiao LY and Vizzard MA. Cystitis-induced upregulation of tyrosine kinase
(TrkA, TrkB) receptor expression and phosphorylation in rat micturition pathways. J
Comp Neurol 454: 200-211, 2002.
59.
Seki S, Sasaki K, Fraser MO, Igawa Y, Nishizawa O, Chancellor MB, de
Groat WC, and Yoshimura N. Immunoneutralization of nerve growth factor in
lumbosacral spinal cord reduces bladder hyperreflexia in spinal cord injured rats. J Urol
168: 2269-2274, 2002.
198
60.
Seki S, Sasaki K, Igawa Y, Nishizawa O, Chancellor MB, De Groat WC, and
Yoshimura N. Suppression of detrusor-sphincter dyssynergia by immunoneutralization
of nerve growth factor in lumbosacral spinal cord in spinal cord injured rats. J Urol 171:
478-482, 2004.
61.
Skoff AM and Adler JE. Nerve growth factor regulates substance P in adult
sensory neurons through both TrkA and p75 receptors. Exp Neurol 197: 430-436, 2006.
62.
Spiegel K, Agrafiotis D, Caprathe B, Davis RE, Dickerson MR, Fergus JH,
Hepburn TW, Marks JS, Van Dorf M, Wieland DM, and et al. PD 90780, a non
peptide inhibitor of nerve growth factor's binding to the P75 NGF receptor. Biochem
Biophys Res Commun 217: 488-494, 1995.
63.
Stanzel RD, Lourenssen S, and Blennerhassett MG. Inflammation causes
expression of NGF in epithelial cells of the rat colon. Exp Neurol 211: 203-213, 2008.
64.
Steers WD, Ciambotti J, Etzel B, Erdman S, and de Groat WC. Alterations in
afferent pathways from the urinary bladder of the rat in response to partial urethral
obstruction. J Comp Neurol 310: 401-410, 1991.
65.
Steers WD and Tuttle JB. Mechanisms of Disease: the role of nerve growth
factor in the pathophysiology of bladder disorders. Nat Clin Pract Urol 3: 101-110, 2006.
66.
Stein PC, Pham H, Ito T, and Parsons CL. Bladder injury model induced in rats
by exposure to protamine sulfate followed by bacterial endotoxin. J Urol 155: 11331138, 1996.
199
67.
Streng T, Hedlund P, Talo A, Andersson KE, and Gillespie JI. Phasic non-
micturition contractions in the bladder of the anaesthetized and awake rat. BJU Int 97:
1094-1101, 2006.
68.
Studeny S, Cheppudira BP, Meyers S, Balestreire EM, Apodaca G, Birder
LA, Braas KM, Waschek JA, May V, and Vizzard MA. Urinary Bladder Function and
Somatic Sensitivity in Vasoactive Intestinal Polypeptide (VIP)(-/-) Mice. J Mol Neurosci,
2008.
69.
Tokuoka S, Takahashi Y, Masuda T, Tanaka H, Furukawa S, and Nagai H.
Disruption of antigen-induced airway inflammation and airway hyper-responsiveness in
low affinity neurotrophin receptor p75 gene deficient mice. Br J Pharmacol 134: 15801586, 2001.
70.
Vaidyanathan S, Krishnan KR, Mansour P, Soni BM, and McDicken I. p75
nerve growth factor receptor in the vesical urothelium of patients with neuropathic
bladder: an immunohistochemical study. Spinal Cord 36: 541-547, 1998.
71.
Verdi JM, Birren SJ, Ibanez CF, Persson H, Kaplan DR, Benedetti M, Chao
MV, and Anderson DJ. p75LNGFR regulates Trk signal transduction and NGF-induced
neuronal differentiation in MAH cells. Neuron 12: 733-745, 1994.
72.
Vizzard MA. Alterations in neuropeptide expression in lumbosacral bladder
pathways following chronic cystitis. J Chem Neuroanat 21: 125-138, 2001.
73.
Vizzard MA. Alterations in spinal cord Fos protein expression induced by
bladder stimulation following cystitis. Am J Physiol Regul Integr Comp Physiol 278:
R1027-1039, 2000.
200
74.
Vizzard MA. Changes in urinary bladder neurotrophic factor mRNA and NGF
protein following urinary bladder dysfunction. Exp Neurol 161: 273-284, 2000.
75.
Vizzard MA and Boyle MM. Increased expression of growth-associated protein
(GAP-43) in lower urinary tract pathways following cyclophosphamide (CYP)-induced
cystitis. Brain Res 844: 174-187, 1999.
76.
Wakabayashi Y, Maeda T, Aimi Y, and Kwok YN. Increase of low-affinity
neurotrophin receptor p75 and growth-associated protein-43 immunoreactivities in the rat
urinary bladder during experimentally induced nerve regeneration. J Urol 160: 15131517, 1998.
77.
Wakabayashi Y, Maeda T, and Kwok YN. Increase of p75 immunoreactivity in
rat urinary bladder following inflammation. Neuroreport 7: 1141-1144, 1996.
78.
Wakabayashi Y, Tomoyoshi T, Tooyama I, Kitahama K, Kim SU, and
Maeda T. Low-affinity nerve growth factor receptor immunoreactivity in the human
urinary bladder. Neurosci Lett 186: 9-12, 1995.
79.
Wang W, Dow KE, Riopelle RJ, and Ross GM. The common neurotrophin
receptor p75NTR enhances the ability of PC12 cells to resist oxidative stress by a trkAdependent mechanism. Neurotox Res 3: 485-499, 2001.
80.
Wehrman T, He X, Raab B, Dukipatti A, Blau H, and Garcia KC. Structural
and mechanistic insights into nerve growth factor interactions with the TrkA and p75
receptors. Neuron 53: 25-38, 2007.
201
81.
Woolf CJ, Allchorne A, Safieh-Garabedian B, and Poole S. Cytokines, nerve
growth factor and inflammatory hyperalgesia: the contribution of tumour necrosis factor
alpha. Br J Pharmacol 121: 417-424, 1997.
82.
Wright DE and Snider WD. Neurotrophin receptor mRNA expression defines
distinct populations of neurons in rat dorsal root ganglia. J Comp Neurol 351: 329-338,
1995.
83.
Yoshimura N, Bennett NE, Hayashi Y, Ogawa T, Nishizawa O, Chancellor
MB, de Groat WC, and Seki S. Bladder overactivity and hyperexcitability of bladder
afferent neurons after intrathecal delivery of nerve growth factor in rats. J Neurosci 26:
10847-10855, 2006.
84.
Yoshimura N and de Groat WC. Increased excitability of afferent neurons
innervating rat urinary bladder after chronic bladder inflammation. J Neurosci 19: 46444653, 1999.
85.
Yoshimura N, Seki S, Chancellor MB, de Groat WC, and Ueda T. Targeting
afferent hyperexcitability for therapy of the painful bladder syndrome. Urology 59: 6167, 2002.
86.
Zvara P, Kliment J, Jr., DeRoss AL, Irwin BH, Malley SE, Plante MK, and
Vizzard MA. Differential expression of bladder neurotrophic factor mRNA in male and
female rats after bladder outflow obstruction. J Urol 168: 2682-2688, 2002.
87.
Zvara P and Vizzard MA. Exogenous overexpression of nerve growth factor in
the urinary bladder produces bladder overactivity and altered micturition circuitry in the
lumbosacral spinal cord. BMC Physiol 7: 9, 2007.
202
88.
Zvarova K, Murray E, and Vizzard MA. Changes in galanin immunoreactivity
in rat lumbosacral spinal cord and dorsal root ganglia after spinal cord injury. J Comp
Neurol 475: 590-603, 2004.
203
Chapter 5: Summary and Conclusions
CYP-induced bladder inflammation is an important model that allows the study of
the effects of acute and chronic bladder inflammation. The results of experiments done
in CYP-treated animals may have relevance to human conditions that involve bladder
inflammation, including IC/PBS (Westropp and Buffington, 2002). CYP cystitis results
in many changes in urinary bladder reflex pathways and many are not understood. The
overall goal for this dissertation was to further understand and characterize the changes
associated with bladder inflammation and specifically, the roles that both
cyclooxygenase-2 (COX-2) and the neurotrophin receptor p75Neurotrophin receptor (NTR) play.
Using the CYP model of bladder inflammation, we first examined COX-2
expression in the bladder tissues of control rats and of rats with varying duration of CYPinduced cystitis. By separating the detrusor from the urothelium and suburothelium and
using Western blot analysis, we showed that COX-2 expression is significantly increased
in both compartments, and also that COX-2 expression increased with a greater fold
change in the urothelium/suburothelium than in the detrusor smooth muscle. Upon
further examination with immunostaining, COX-2 expression was indeed found to be
upregulated in the urothelium, as well as in inflammatory infiltrates and nerve fibers in
the suburothelial plexus with acute and chronic cystitis. Inflammatory infiltrates were
also present in the detrusor smooth muscle. These results identify possible cellular
targets for COX-2 inhibitors that have been used to attenuate bladder hyperreflexia with
CYP in previous studies, and also identify the localization of COX-2 upregulation
204
reported previously (Hu et al., 2003; Wheeler et al., 2001). These results suggest that
COX-2 activation contributes to bladder inflammation in acute and chronic cystitis and,
more specifically, may have its effect on the production of prostaglandins in urothelium,
and nerve fibers and macrophages in the suburothelial plexus. Prostaglandins are known
to modulate the basal tone of the detrusor and influence detrusor contraction as well as
target primary bladder afferents, thus influencing the micturition reflex (Angelico et al.,
2006; Maggi, 1992). Application of prostaglandins to the detrusor stimulates the
micturition reflex (Maggi et al., 1984). However, the story of CYP-induced bladder
inflammation goes beyond COX enzymes and prostaglandins; COX-2 expression can be
stimulated in part by growth factors and inflammatory cytokines.
Since NGF and its receptor TrkA have been implicated in the progression of
CYP-induced urinary bladder inflammation, the next step of this project was to explore
the expression of the pan-neurotrophin receptor p75NTR in rat urinary bladder sensory
neurons and spinal cord with CYP-induced cystitis. p75NTR expression was examined
using immunohistochemistry in lumbosacral spinal cord and DRG. p75NTR was present in
control and significantly increased in spinal cord dorsal horn at lumbosacral levels known
to be involved in micturition reflexes in rats (L1-L2; L6-S1), suggesting that p75NTR
could be involved in central processing of afferent information. p75NTR immunoreactivity
was also noted in control lumbosacral DRG cell bodies and staining surrounding neuronal
cell bodies. This staining was increased with acute, intermediate and chronic CYP
treatment. Upon examination with confocal microscopy, pericellular p75NTR staining did
not co-label with GFAP, suggesting that this staining is more likely associated with the
205
neuronal cell membrane, and not of glial origin. p75NTR mRNA expression increased
with acute, intermediate and chronic CYP treatment in L6 DRG. The upregulation of
p75NTR mRNA and protein expression in whole DRG could suggest p75NTR upregulation
in the afferents of other organs as well, including colon and urogenital structures, which
also have afferents in lumbosacral DRG. It is interesting to note that cross-talk can occur
between these visceral organs, with convergence of sensory information occurring in the
dorsal root ganglia, spinal cord and brain (Malykhina, 2007). This cross-talk can result in
cross-sensitization between visceral organs and may contribute to chronic pain
experienced in both bladder, urogenital organs and colon (Malykhina, 2007). Crosssensitization may be a factor in the co-morbidity of such conditions as Irritable Bowel
Syndrome and Interstitial Cystitis/Painful Bladder Syndrome.
A retrograde dye-tracing technique with Fastblue was used to determine p75NTR
expression in bladder-projecting primary afferents. Bladder-projecting afferent cells
constitutively expressed p75NTR and expression was also significantly increased with
acute, intermediate and chronic CYP treatment, suggesting a role for this receptor in
normal bladder afferent signaling, and possibly in mediating the effects of bladder
inflammation. Overall, these results demonstrated constitutive expression of p75NTR in
micturition reflexes and modification of this expression by bladder inflammation. The
functional significance of p75NTR in bladder reflexes remained to be determined.
Upon examination of p75NTR expression in the urinary bladder, we have detected
p75NTR immunoreactivity in urothelial cells, in nerve fibers in the suburothelial plexus,
and in nerve fibers associated with the vasculature. No upregulation of this staining was
206
obvious with immunohistochemical techniques because of the large amount of
overlapping structures expressing p75NTR expression in the urinary bladder, but Western
blot analysis of whole bladder expression of p75NTR did show a significant increase in
p75NTR protein expression after acute, intermediate, and chronic CYP cystitis.
Blockade of p75NTR in rat urinary bladder was achieved by intravesical infusion of
anti-p75NTR monoclonal antibody as well as intravesical infusion of PD90780, a
compound that specifically blocks NGF binding to p75NTR (Colquhoun et al., 2004; Hefti
et al., 2006; Spiegel et al., 1995). p75NTR blockade was done in both control and CYP
(48 hour)-treated rats. Bladder function was then studied using conscious cystometry
with continuous intravesical infusion of saline. Infusion with each compound
demonstrated a significant increase in voiding frequency (decreased inter-contraction
interval, decreased void volume) in both control and CYP-treated rats. Changes in
voiding frequency are suggestive of changes in the afferent limb of the micturition reflex.
Changes in both threshold pressure and number of non-voiding contractions were seen
with infusion of PD90780 in control and CYP-treated rats, suggestive of possible changes
in the afferent pathway. Increased micturition pressure was also noted, indicating an
effect on the efficiency of the efferent branch of the micturition reflex pathway with this
treatment.
Based on previous results showing that blockade of Trk signaling with k252a
attenuated the bladder hyperreflexia observed with CYP-induced cystitis, we had
hypothesized that p75NTR blockade in the urinary bladder would also decrease bladder
207
blockade
Figure 1: p75NTR blockade leads to increased bladder activity
Cyclophosphamide-induced bladder inflammation results in increased NGF expression in the
urinary bladder. NGF signaling through TrkA results in a number of inflammatory effects,
including the sensitization of bladder afferents. This in turn results in increased overall bladder
activity. We have used anti-p75NTR monoclonal antibody and PD90780, a compound that
specifically blocks NGF binding to p75NTR , to block NGF signaling through p75NTR . This
resulted in increased bladder voiding activity in both control and CYP-treated rats. We
hypothesize that blockade of p75NTR increases the amount of NGF available to bind TrkA, thus
increasing NGF-TrkA signaling and increasing inflammatory effects and sensitization of bladder
afferents.
hyperreflexia with cystitis. This hypothesis was based on data that demonstrated a role
for p75NTR in enhancing TrkA binding NGF, thus increasing NGF-TrkA signaling,
meaning that p75NTR and TrkA would have complementary roles (Allen and Dawbarn,
2006). In this model, increased NGF-TrkA signaling would result in a cascade of
inflammatory effects, including sensitization of bladder afferents (Fig. 1) (Chuang et al.,
2001b). The upregulation of p75NTR in bladder afferents with cystitis is more widespread
208
than the upregulation of TrkA expression after cystitis; TrkA was only upregulated in L1
and L6 DRG, and not with all durations of CYP treatment (Qiao and Vizzard, 2002). The
upregulation of TrkA in bladder afferents could occur as a result of an increase in NGF
levels in the urinary bladder with cystitis (Vizzard, 2000b), and could be evidence of
increased NGF-TrkA signaling that contributes to the inflammatory effects and bladder
hyperreflexia associated with cystitis. In Chapter 3, we presented evidence that p75NTR is
upregulated in bladder afferents with cystitis, and in Chapter 4, we showed that blockade
of NGF-p75NTR actually increases voiding frequency in control rats and further increases
bladder hyperreflexia in rats with CYP-induced cystitis. This suggests that NGF-p75NTR
signaling in the urinary bladder may actually serve to modify bladder activity in an
opposite way to NGF-TrkA signaling, thereby reducing inflammation-related
hyperreflexia or to maintain reflex function under control conditions as well. p75NTR has
long been considered as a binding partner to TrkA, with cooperation between the two
resulting in NGF binding TrkA with greater affinity. However, p75NTR might also bind
NGF on its own, therefore sequestering NGF and leaving less to bind to TrkA, and
therefore less NGF-TrkA signaling. Furthermore, the upregulation of p75NTR in urinary
bladder afferents seen with acute, intermediate and chronic durations of cystitis may
serve as a compensatory mechanism of signaling, in order to attenuate inflammationrelated bladder hyperreflexia.
Future Directions
This dissertation research leads to many questions for further study. The study of
bladder function in p75NTR –null mice is an obvious next step for further deciphering the
209
function of p75NTR in micturition reflexes. Appendix A contains some preliminary data
obtained for this dissertation project in p75NTR –null and in mice hemizygous for the
p75NTR null gene. Even with preliminary results, it seems as though these mice present a
complex phenotype of bladder function, some with bladder hyperreflexia and others with
urinary incontinence. p75NTR transgenic mice have much to offer in the way of future
research. It would also be interesting to see the effects of over-expression of the p75NTR
receptor, perhaps in a model of p75NTR –over-expressing mice. Based on our current
data, it would be hypothesized that p75NTR over-expression would increase NGF binding
p75NTR, sequestering NGF away from TrkA. This would then result in less NGF-TrkA
signaling and decrease bladder activity or hyperreflexia.
We hypothesize that blockade of NGF- p75NTR signaling actually leads to more
NGF available to bind TrkA, thus more NGF-TrkA signaling and bladder hyperreflexia
(Fig. 1). We could test this by trying a combination experiment that includes blockade of
p75NTR as well as antagonism of TrkA. If blockade of TrkA rescued the bladder
hyperreflexia seen with p75NTR blockade, this would support our hypothesis and
demonstrate that NGF signaling through TrkA is important for the increased bladder
voiding shown with blockade of p75NTR shown in this dissertation.
It would also be interesting to try to determine the precise location of the action of
the p75NTR blockade shown in this dissertation. It would be interesting to apply a p75NTR
–neutralizing agent exclusively to the detrusor smooth muscle, perhaps by a mini osmotic
pump as described in Zvara and Vizzard, 2007 in order to determine the importance of
the smooth muscle to p75NTR signaling. Pre-treatment of experimental animals with
210
resiniferatoxin could also be used to desensitize many bladder afferent fibers. This could
be done before CYP treatment or before intravesical infusion of antibody or PD90780,
and might help determine the role that afferents may play in the NGF- p75NTR signaling.
The present study of intravesical p75NTR blockade examined bladder function only
after 48 hours of CYP treatment. Previous studies involving COX-2 inhibition have
examined bladder function after 4 and 48 hour CYP treatment (Hu et al., 2003). It would
be interesting, and perhaps more clinically relevant, to examine bladder function using
cystometry after the induction of chronic bladder inflammation as well.
This dissertation examined the importance of p75NTR signaling in the urinary
bladder by blocking p75NTR in the urinary bladder itself. To examine the role of p75NTR
in the central micturition reflex processing, intrathecal application of either anti-p75NTR
monoclonal antibody or PD90780 at the level of lumbosacral spinal cord in experimental
rats might be used. This could be done in control and CYP-treated rats as well.
Finally, it is unknown what the intracellular signaling pathway(s) of NGF- p75NTR
in the urinary bladder might be. Further research into the fate of NGF after binding
p75NTR in the bladder and subsequent signal transduction would be useful in
understanding the function of p75NTR in the micturition reflex pathways. While some
p75NTR signaling pathways are known, such as induction of apoptosis through activation
of the mitogen-activated protein kinase (MAPK) c-Jun N-terminal kinases (JNK), and
induction of cell survival effects via the transcription factor NF-κB, this information may
or may not be applicable to p75NTR signaling in the urinary bladder. It would be
interesting to know whether or not internalization of p75NTR after NGF signaling would
211
result in lysosomal degradation of p75NTR, or in possible recycling of the receptor at the
cell membrane, or in downstream signaling effects.
212
Comprehensive Bibliography
Abramoff MD, Magelhaes PJ, Ram SJ. 2004. Image processing with ImageJ.
Biophotonics International 11(7):36-42.
Abrams PH, Sykes JA, Rose AJ, Rogers AF. 1979. The synthesis and release of
prostaglandins by human urinary bladder muscle in vitro. Invest Urol 16(5):346348.
Ahluwalia A, Maggi CA, Santicioli P, Lecci A, Giuliani S. 1994. Characterization of the
capsaicin-sensitive component of cyclophosphamide-induced inflammation in the
rat urinary bladder. Br J Pharmacol 111(4):1017-1022.
Ahmadi S, Lippross S, Neuhuber WL, Zeilhofer HU. 2002. PGE(2) selectively blocks
inhibitory glycinergic neurotransmission onto rat superficial dorsal horn neurons.
Nat Neurosci 5(1):34-40.
Allen SJ, Dawbarn D. 2006. Clinical relevance of the neurotrophins and their receptors.
Clin Sci (Lond) 110(2):175-191.
Allington C, Shamovsky IL, Ross GM, Riopelle RJ. 2001. Zinc inhibits p75NTRmediated apoptosis in chick neural retina. Cell Death Differ 8(5):451-456.
Aloe L. 2004. Rita Levi-Montalcini: the discovery of nerve growth factor and modern
neurobiology. Trends Cell Biol 14(7):395-399.
Andersson KE, Arner A. 2004. Urinary bladder contraction and relaxation: physiology
and pathophysiology. Physiol Rev 84(3):935-986.
213
Andersson KE, Wein AJ. 2004. Pharmacology of the lower urinary tract: basis for current
and future treatments of urinary incontinence. Pharmacol Rev 56(4):581-631.
Angelico P, Guarneri L, Velasco C, Cova R, Leonardi A, Clarke DE, Testa R. 2006.
Effect of cyclooxygenase inhibitors on the micturition reflex in rats: correlation
with inhibition of cyclooxygenase isozymes. BJU Int 97(4):837-846.
Barker PA. 2004. p75NTR is positively promiscuous: novel partners and new insights.
Neuron 42(4):529-533.
Barker PA. 2007. High affinity not in the vicinity? Neuron 53(1):1-4.
Bautista DM, Jordt SE, Nikai T, Tsuruda PR, Read AJ, Poblete J, Yamoah EN, Basbaum
AI, Julius D. 2006. TRPA1 mediates the inflammatory actions of environmental
irritants and proalgesic agents. Cell 124(6):1269-1282.
Bennett DL, Averill S, Clary DO, Priestley JV, McMahon SB. 1996. Postnatal changes in
the expression of the trkA high-affinity NGF receptor in primary sensory neurons.
Eur J Neurosci 8(10):2204-2208.
Bielefeldt K, Lamb K, Gebhart GF. 2006. Convergence of sensory pathways in the
development of somatic and visceral hypersensitivity. Am J Physiol Gastrointest
Liver Physiol 291(4):G658-665.
Birder LA. 2005. More than just a barrier: urothelium as a drug target for urinary bladder
pain. Am J Physiol Renal Physiol 289(3):F489-495.
Birder LA. 2006. Role of the urothelium in urinary bladder dysfunction following spinal
cord injury. Prog Brain Res 152:135-146.
214
Birder LA, de Groat WC. 1992. Increased c-fos expression in spinal neurons after
irritation of the lower urinary tract in the rat. J Neurosci 12(12):4878-4889.
Birder LA, de Groat WC. 1993. Induction of c-fos expression in spinal neurons by
nociceptive and nonnociceptive stimulation of LUT. Am J Physiol 265(2 Pt
2):R326-333.
Birder LA, Wolf-Johnston A, Griffiths D, Resnick NM. 2007. Role of urothelial nerve
growth factor in human bladder function. Neurourol Urodyn 26(3):405-409.
Blok BF, Holstege G. 2000. The pontine micturition center in rat receives direct
lumbosacral input. An ultrastructural study. Neurosci Lett 282(1-2):29-32.
Bon K, Lichtensteiger CA, Wilson SG, Mogil JS. 2003. Characterization of
cyclophosphamide cystitis, a model of visceral and referred pain, in the mouse:
species and strain differences. J Urol 170(3):1008-1012.
Bothwell M. 1995. Functional interactions of neurotrophins and neurotrophin receptors.
Annu Rev Neurosci 18:223-253.
Braas KM, May V, Zvara P, Nausch B, Kliment J, Dunleavy JD, Nelson MT, Vizzard
MA. 2006. Role for pituitary adenylate cyclase activating polypeptide in cystitisinduced plasticity of micturition reflexes. Am J Physiol Regul Integr Comp
Physiol 290(4):R951-962.
Brading AF. 1997. A myogenic basis for the overactive bladder. Urology 50(6A
Suppl):57-67; discussion 68-73.
Brady CM, Apostolidis AN, Harper M, Yiangou Y, Beckett A, Jacques TS, Freeman A,
Scaravilli F, Fowler CJ, Anand P. 2004. Parallel changes in bladder suburothelial
215
vanilloid receptor TRPV1 and pan-neuronal marker PGP9.5 immunoreactivity in
patients with neurogenic detrusor overactivity after intravesical resiniferatoxin
treatment. BJU Int 93(6):770-776.
Bronfman FC, Fainzilber M. 2004. Multi-tasking by the p75 neurotrophin receptor:
sortilin things out? EMBO Rep 5(9):867-871.
Buffington CA. 2004. Comorbidity of interstitial cystitis with other unexplained clinical
conditions. J Urol 172(4 Pt 1):1242-1248.
Cannon TW, Damaser MS. 2001. Effects of anesthesia on cystometry and leak point
pressure of the female rat. Life Sci 69(10):1193-1202.
Chao MV, Hempstead BL. 1995. p75 and Trk: a two-receptor system. Trends Neurosci
18(7):321-326.
Chao MV, Rajagopal R, Lee FS. 2006. Neurotrophin signalling in health and disease.
Clin Sci (Lond) 110(2):167-173.
Cheppudira BP. 2006. Characterization of hind paw licking and lifting to noxious radiant
heat in the rat with and without chronic inflammation. J Neurosci Methods.
Chien CC, Fu WM, Huang HI, Lai YH, Tsai YF, Guo SL, Wu TJ, Ling QD. 2007.
Expression of neurotrophic factors in neonatal rats after peripheral inflammation.
J Pain 8(2):161-167.
Cho HJ, Park EH, Bae MA, Kim JK. 1996. Expression of mRNAs for preprotachykinin
and nerve growth factor receptors in the dorsal root-ganglion following peripheral
inflammation. Brain Res 716(1-2):197-201.
216
Chuang YC, Chancellor MB, Seki S, Yoshimura N, Tyagi P, Huang L, Lavelle JP, De
Groat WC, Fraser MO. 2003. Intravesical protamine sulfate and potassium
chloride as a model for bladder hyperactivity. Urology 61(3):664-670.
Chuang YC, Fraser MO, Yu Y, Beckel JM, Seki S, Nakanishi Y, Yokoyama H,
Chancellor MB, Yoshimura N, de Groat WC. 2001a. Analysis of the afferent limb
of the vesicovascular reflex using neurotoxins, resiniferatoxin and capsaicin. Am
J Physiol Regul Integr Comp Physiol 281(4):R1302-1310.
Chuang YC, Fraser MO, Yu Y, Chancellor MB, de Groat WC, Yoshimura N. 2001b. The
role of bladder afferent pathways in bladder hyperactivity induced by the
intravesical administration of nerve growth factor. J Urol 165(3):975-979.
Clemow DB, Steers WD, McCarty R, Tuttle JB. 1998. Altered regulation of bladder
nerve growth factor and neurally mediated hyperactive voiding. Am J Physiol
275(4 Pt 2):R1279-1286.
Cohen SM. 1995. Role of urinary physiology and chemistry in bladder carcinogenesis.
Food Chem Toxicol 33(9):715-730.
Colquhoun A, Lawrance GM, Shamovsky IL, Riopelle RJ, Ross GM. 2004. Differential
activity of the nerve growth factor (NGF) antagonist PD90780 [7(benzolylamino)-4,9-dihydro-4-methyl-9-oxo-pyrazolo[5,1-b]quinazoline-2 carboxylic acid] suggests altered NGF-p75NTR interactions in the presence of
TrkA. J Pharmacol Exp Ther 310(2):505-511.
217
Coome GE, Elliott J, Kawaja MD. 1998. Sympathetic and sensory axons invade the
brains of nerve growth factor transgenic mice in the absence of p75NTR
expression. Exp Neurol 149(1):284-294.
Corrow KA, Vizzard MA. 2007a. Phosphorylation of Extracellular Signal-Regulated
Kinases (pERK) in Urinary Bladder in Rats with Cyclophosphamide (CYP)Induced Cystitis. Am J Physiol Regul Integr Comp Physiol.
Corrow KA, Vizzard MA. 2007b. Phosphorylation of extracellular signal-regulated
kinases in urinary bladder in rats with cyclophosphamide-induced cystitis. Am J
Physiol Regul Integr Comp Physiol 293(1):R125-134.
Cox P. 1979a. Cyclophosphamide cystitis-identification of acrolein as the causative
agent. Biochem Pharmacol 28:2045-2049.
Cox PJ. 1979b. Cyclophosphamide cystitis--identification of acrolein as the causative
agent. Biochem Pharmacol 28(13):2045-2049.
Cucchi A, Quaglini S, Guarnaschelli C, Rovereto B. 2007. Urodynamic findings
suggesting two-stage development of idiopathic detrusor underactivity in adult
men. Urology 70(1):75-79.
Cucchi A, Quaglini S, Rovereto B. 2008. Development of idiopathic detrusor
underactivity in women: from isolated decrease in contraction velocity to obvious
impairment of voiding function. Urology 71(5):844-848.
Dang K, Lamb K, Cohen M, Bielefeldt K, Gebhart GF. 2008. Cyclophosphamideinduced bladder inflammation sensitizes and enhances P2X receptor function in
rat bladder sensory neurons. J Neurophysiol 99(1):49-59.
218
Dattilio A, Vizzard MA. 2005. Up-regulation of protease activated receptors in bladder
after cyclophosphamide induced cystitis and colocalization with capsaicin
receptor (VR1) in bladder nerve fibers. J Urol 173(2):635-639.
Debus E, Weber K, Osborn M. 1983. Monoclonal antibodies specific for glial fibrillary
acidic (GFA) protein and for each of the neurofilament triplet polypeptides.
Differentiation 25(2):193-203.
Dechant G, Barde YA. 2002. The neurotrophin receptor p75(NTR): novel functions and
implications for diseases of the nervous system. Nat Neurosci 5(11):1131-1136.
Delafoy L, Gelot A, Ardid D, Eschalier A, Bertrand C, Doherty AM, Diop L. 2006.
Interactive involvement of brain derived neurotrophic factor, nerve growth factor,
and calcitonin gene related peptide in colonic hypersensitivity in the rat. Gut
55(7):940-945.
Delcroix JD, Michael GJ, Priestley JV, Tomlinson DR, Fernyhough P. 1998. Effect of
nerve growth factor treatment on p75NTR gene expression in lumbar dorsal root
ganglia of streptozocin-induced diabetic rats. Diabetes 47(11):1779-1785.
Dhanoa NK, Krol KM, Jahed A, Crutcher KA, Kawaja MD. 2006. Null mutations for
exon III and exon IV of the p75 neurotrophin receptor gene enhance sympathetic
sprouting in response to elevated levels of nerve growth factor in transgenic mice.
Exp Neurol 198(2):416-426.
Dickson A, Avelino A, Cruz F, Ribeiro-da-Silva A. 2006. Peptidergic sensory and
parasympathetic fiber sprouting in the mucosa of the rat urinary bladder in a
219
chronic model of cyclophosphamide-induced cystitis. Neuroscience 141(3):16331647.
Dinis P, Charrua A, Avelino A, Yaqoob M, Bevan S, Nagy I, Cruz F. 2004. Anandamideevoked activation of vanilloid receptor 1 contributes to the development of
bladder hyperreflexia and nociceptive transmission to spinal dorsal horn neurons
in cystitis. J Neurosci 24(50):11253-11263.
Dixon JS, Jen PY, Gosling JA. 2000. The distribution of vesicular acetylcholine
transporter in the human male genitourinary organs and its co-localization with
neuropeptide Y and nitric oxide synthase. Neurourol Urodyn 19(2):185-194.
Dmitrieva N, McMahon SB. 1996. Sensitisation of visceral afferents by nerve growth
factor in the adult rat. Pain 66(1):87-97.
Dmitrieva N, Shelton D, Rice AS, McMahon SB. 1997. The role of nerve growth factor
in a model of visceral inflammation. Neuroscience 78(2):449-459.
Donovan MK, Winternitz SR, Wyss JM. 1983. An analysis of the sensory innervation of
the urinary system in the rat. Brain Res Bull 11(3):321-324.
Dorr W. 1992. Cystometry in mice--influence of bladder filling rate and circadian
variations in bladder compliance. J Urol 148(1):183-187.
Dou W, Jiao Y, Goorha S, Raghow R, Ballou LR. 2004. Nociception and the differential
expression of cyclooxygenase-1 (COX-1), the COX-1 variant retaining intron-1
(COX-1v), and COX-2 in mouse dorsal root ganglia (DRG). Prostaglandins Other
Lipid Mediat 74(1-4):29-43.
220
Du Y, Fischer TZ, Clinton-Luke P, Lercher LD, Dreyfus CF. 2006. Distinct effects of
p75 in mediating actions of neurotrophins on basal forebrain oligodendrocytes.
Mol Cell Neurosci 31(2):366-375.
Durrenberger PF, Facer P, Casula MA, Yiangou Y, Gray RA, Chessell IP, Day NC,
Collins SD, Bingham S, Wilson AW, Elliot D, Birch R, Anand P. 2006.
Prostanoid receptor EP1 and Cox-2 in injured human nerves and a rat model of
nerve injury: a time-course study. BMC Neurol 6:1.
Elbadawi A. 1996. Functional anatomy of the organs of micturition. Urol Clin North Am
23(2):177-210.
Elsasser-Beile U, Gutzeit O, Bauer S, Katzenwadel A, Schultze-Seemann W, Wetterauer
U. 2000. Systemic and local immunomodulatory effects of intravesical BCG
therapy in patients with superficial urinary bladder carcinomas. J Urol
163(1):296-299.
Erickson DR. 1999. Interstitial cystitis: update on etiologies and therapeutic options. J
Womens Health Gend Based Med 8(6):745-758.
Erickson DR, Davies MF. 1998. Interstitial cystitis. Int Urogynecol J Pelvic Floor
Dysfunct 9(3):174-183.
Farraj AK, Haykal-Coates N, Ledbetter AD, Evansky PA, Gavett SH. 2006. Inhibition of
pan neurotrophin receptor p75 attenuates diesel particulate-induced enhancement
of allergic airway responses in C57/B16J mice. Inhal Toxicol 18(7):483-491.
FitzGerald MP, Brensinger C, Brubaker L, Propert K. 2006. What is the pain of
interstitial cystitis like? Int Urogynecol J Pelvic Floor Dysfunct 17(1):69-72.
221
FitzGerald MP, Kenton KS, Brubaker L. 2005. Localization of the urge to void in
patients with painful bladder syndrome. Neurourol Urodyn 24(7):633-637.
Fowler CJ, Griffiths D, de Groat WC. 2008. The neural control of micturition. Nature
reviews 9(6):453-466.
Fraser MO, Chuang YC, Tyagi P, Yokoyama T, Yoshimura N, Huang L, De Groat WC,
Chancellor MB. 2003. Intravesical liposome administration--a novel treatment for
hyperactive bladder in the rat. Urology 61(3):656-663.
Freund-Michel V, Frossard N. 2008. The nerve growth factor and its receptors in airway
inflammatory diseases. Pharmacol Ther 117(1):52-76.
Friedman WJ, Greene LA. 1999. Neurotrophin signaling via Trks and p75. Exp Cell Res
253(1):131-142.
Frossard N, Freund V, Advenier C. 2004. Nerve growth factor and its receptors in asthma
and inflammation. Eur J Pharmacol 500(1-3):453-465.
Fujisawa H, Nakagawa S, Ohkubo Y, Matsui M, Yamaguchi S, Kawamura M, Hatanaka
K, Kawakubo Y, Hiramoto Y, Kobayashi H, Harada Y. 2005. Local and systemic
expression of inducible nitric oxide synthase in comparison with that of
cyclooxygenase-2 in rat carrageenin-induced pleurisy. Nitric Oxide 12(2):80-88.
Geppetti P, Nassini R, Materazzi S, Benemei S. 2008. The concept of neurogenic
inflammation. BJU Int 101 Suppl 3:2-6.
Ghoniem GM, Shoukry MS, Monga M. 1996. Effects of anesthesia on urodynamic
studies in the primate model. J Urol 156(1):233-236.
222
Gillespie JI. 2005. Inhibitory actions of calcitonin gene-related peptide and capsaicin:
evidence for local axonal reflexes in the bladder wall. BJU Int 95(1):149-156.
Girard BA, Lelievre V, Braas KM, Razinia T, Vizzard MA, Ioffe Y, El Meskini R,
Ronnett GV, Waschek JA, May V. 2006. Noncompensation in peptide/receptor
gene expression and distinct behavioral phenotypes in VIP- and PACAP-deficient
mice. J Neurochem 99(2):499-513.
Guerios SD, Wang ZY, Bjorling DE. 2006. Nerve growth factor mediates peripheral
mechanical hypersensitivity that accompanies experimental cystitis in mice.
Neurosci Lett 392(3):193-197.
Guerios SD, Wang ZY, Boldon K, Bushman W, Bjorling DE. 2008. Blockade of NGF
and trk receptors inhibits increased peripheral mechanical sensitivity
accompanying cystitis in rats. Am J Physiol Regul Integr Comp Physiol.
Hannila SS, Kawaja MD. 2005. Nerve growth factor-mediated collateral sprouting of
central sensory axons into deafferentated regions of the dorsal horn is enhanced in
the absence of the p75 neurotrophin receptor. J Comp Neurol 486(4):331-343.
Hannila SS, Lawrance GM, Ross GM, Kawaja MD. 2004. TrkA and mitogen-activated
protein kinase phosphorylation are enhanced in sympathetic neurons lacking
functional p75 neurotrophin receptor expression. Eur J Neurosci 19(10):29032908.
Harmon EB, Porter JM, Porter JE. 2005. Beta-adrenergic receptor activation in
immortalized human urothelial cells stimulates inflammatory responses by PKAindependent mechanisms. Cell Commun Signal 3:10.
223
Hefti FF, Rosenthal A, Walicke PA, Wyatt S, Vergara G, Shelton DL, Davies AM. 2006.
Novel class of pain drugs based on antagonism of NGF. Trends Pharmacol Sci
27(2):85-91.
Herrera GM, Pozo MJ, Zvara P, Petkov GV, Bond CT, Adelman JP, Nelson MT. 2003.
Urinary bladder instability induced by selective suppression of the murine small
conductance calcium-activated potassium (SK3) channel. J Physiol 551(Pt 3):893903.
Holstege G. 2005. Micturition and the soul. J Comp Neurol 493(1):15-20.
Hu P, McLachlan EM. 2000. Distinct sprouting responses of sympathetic and peptidergic
sensory axons proximal to a sciatic nerve transection in guinea pigs and rats.
Neurosci Lett 295(1-2):59-63.
Hu P, McLachlan EM. 2003. Selective reactions of cutaneous and muscle afferent
neurons to peripheral nerve transection in rats. J Neurosci 23(33):10559-10567.
Hu VY, Malley S, Dattilio A, Folsom JB, Zvara P, Vizzard MA. 2003. COX-2 and
prostanoid expression in micturition pathways after cyclophosphamide-induced
cystitis in the rat. Am J Physiol Regul Integr Comp Physiol 284(2):R574-585.
Hu VY, Zvara P, Dattilio A, Redman TL, Allen SJ, Dawbarn D, Stroemer RP, Vizzard
MA. 2005. Decrease in bladder overactivity with REN1820 in rats with
cyclophosphamide induced cystitis. J Urol 173(3):1016-1021.
Huang CS, Zhou J, Feng AK, Lynch CC, Klumperman J, DeArmond SJ, Mobley WC.
1999. Nerve growth factor signaling in caveolae-like domains at the plasma
membrane. J Biol Chem 274(51):36707-36714.
224
Huber LJ, Chao MV. 1995a. Mesenchymal and neuronal cell expression of the p75
neurotrophin receptor gene occur by different mechanisms. Dev Biol 167(1):227238.
Huber LJ, Chao MV. 1995b. A potential interaction of p75 and trkA NGF receptors
revealed by affinity crosslinking and immunoprecipitation. J Neurosci Res
40(4):557-563.
Ito H, Nomoto H, Furukawa S. 2003. Growth arrest of PC12 cells by nerve growth factor
is dependent on the phosphatidylinositol 3-kinase/Akt pathway via p75
neurotrophin receptor. J Neurosci Res 72(2):211-217.
Jahed A, Kawaja MD. 2005. The influences of p75 neurotrophin receptor and brainderived neurotrophic factor in the sympathetic innervation of target tissues during
murine postnatal development. Auton Neurosci 118(1-2):32-42.
Jang J, Park EY, Seo SI, Hwang TK, Kim JC. 2006. Effects of intravesical instillation of
cyclooxygenase-2 inhibitor on the expression of inducible nitric oxide synthase
and nerve growth factor in cyclophosphamide-induced overactive bladder. BJU
Int 98(2):435-439.
Kahle P, Barker PA, Shooter EM, Hertel C. 1994. p75 nerve growth factor receptor
modulates p140trkA kinase activity, but not ligand internalization, in PC12 cells.
J Neurosci Res 38(5):599-606.
Kalb R. 2005. The protean actions of neurotrophins and their receptors on the life and
death of neurons. Trends Neurosci 28(1):5-11.
225
Karchewski LA, Bloechlinger S, Woolf CJ. 2004. Axonal injury-dependent induction of
the peripheral benzodiazepine receptor in small-diameter adult rat primary
sensory neurons. Eur J Neurosci 20(3):671-683.
Kawatani M, Takeshige C, de Groat WC. 1990. Central distribution of afferent pathways
from the uterus of the cat. J Comp Neurol 302(2):294-304.
Keast JR, Booth AM, de Groat WC. 1989. Distribution of neurons in the major pelvic
ganglion of the rat which supply the bladder, colon or penis. Cell Tissue Res
256(1):105-112.
Keast JR, De Groat WC. 1992. Segmental distribution and peptide content of primary
afferent neurons innervating the urogenital organs and colon of male rats. J Comp
Neurol 319(4):615-623.
Keast JR, Kepper ME. 2001. Differential regulation of trkA and p75 in noradrenergic
pelvic autonomic ganglion cells after deafferentation of their cholinergic
neighbours. Eur J Neurosci 13(2):211-220.
Kerzel S, Path G, Nockher WA, Quarcoo D, Raap U, Groneberg DA, Dinh QT, Fischer
A, Braun A, Renz H. 2003. Pan-neurotrophin receptor p75 contributes to neuronal
hyperreactivity and airway inflammation in a murine model of experimental
asthma. Am J Respir Cell Mol Biol 28(2):170-178.
Khanapure SP, Garvey DS, Janero DR, Letts LG. 2007. Eicosanoids in inflammation:
biosynthesis, pharmacology, and therapeutic frontiers. Curr Top Med Chem
7(3):311-340.
226
King VR, Bradbury EJ, McMahon SB, Priestley JV. 2000. Changes in truncated trkB and
p75 receptor expression in the rat spinal cord following spinal cord hemisection
and spinal cord hemisection plus neurotrophin treatment. Exp Neurol 165(2):327341.
Kirimoto T, Nakano K, Irimura K, Hayashi Y, Matsuura N, Kiniwa M, Oka T,
Yoshimura N. 2007. Beneficial effects of suplatast tosilate (IPD-1151T) in a rat
cystitis model induced by intravesical hydrochloric acid. BJU Int 100(4):935-939.
Klausner AP, Steers WD. 2004. Corticotropin releasing factor: a mediator of emotional
influences on bladder function. J Urol 172(6 Pt 2):2570-2573.
Klinger MB, Dattilio A, Vizzard MA. 2007. Expression of cyclooxygenase-2 in urinary
bladder in rats with cyclophosphamide-induced cystitis. Am J Physiol Regul
Integr Comp Physiol 293(2):R677-685.
Klinger MB, Girard B, Vizzard MA. 2008. p75NTR expression in rat urinary bladder
sensory neurons and spinal cord with cyclophosphamide-induced cystitis. J Comp
Neurol 507(3):1379-1392.
Kruttgen A, Moller JC, Heymach JV, Jr., Shooter EM. 1998. Neurotrophins induce
release of neurotrophins by the regulated secretory pathway. Proc Natl Acad Sci
U S A 95(16):9614-9619.
Kullmann FA, Artim DE, Birder LA, de Groat WC. 2008. Activation of muscarinic
receptors in rat bladder sensory pathways alters reflex bladder activity. J Neurosci
28(8):1977-1987.
227
LaBerge J, Malley SE, Zvarova K, Vizzard MA. 2006a. Expression of corticotropinreleasing factor and CRF receptors in micturition pathways after
cyclophosphamide-induced cystitis. Am J Physiol Regul Integr Comp Physiol
291(3):R692-703.
Laberge J, Malley SE, Zvarova K, Vizzard MA. 2006b. Expression of corticotropin
releasing factor (CRF) and CRF receptors in micturition pathways after
cyclophosphamide (CYP)-induced cystitis. Am J Physiol Regul Integr Comp
Physiol.
Lamb K, Gebhart GF, Bielefeldt K. 2004. Increased nerve growth factor expression
triggers bladder overactivity. J Pain 5(3):150-156.
Lamb K, Zhong F, Gebhart GF, Bielefeldt K. 2006. Experimental colitis in mice and
sensitization of converging visceral and somatic afferent pathways. Am J Physiol
Gastrointest Liver Physiol 290(3):G451-457.
Lanteri-Minet M, Bon K, de Pommery J, Michiels JF, Menetrey D. 1995.
Cyclophosphamide cystitis as a model of visceral pain in rats: model elaboration
and spinal structures involved as revealed by the expression of c-Fos and Krox-24
proteins. Exp Brain Res 105(2):220-232.
Larauche M, Bradesi S, Million M, McLean P, Tache Y, Mayer EA, McRoberts JA.
2008. Corticotropin-releasing factor type 1 receptors mediate the visceral
hyperalgesia induced by repeated psychological stress in rats. Am J Physiol
Gastrointest Liver Physiol 294(4):G1033-1040.
228
Lecci A, Birder LA, Meini S, Catalioto RM, Tramontana M, Giuliani S, Criscuoli M,
Maggi CA. 2000. Pharmacological evaluation of the role of cyclooxygenase
isoenzymes on the micturition reflex following experimental cystitis in rats. Br J
Pharmacol 130(2):331-338.
Lee FS, Kim AH, Khursigara G, Chao MV. 2001. The uniqueness of being a
neurotrophin receptor. Curr Opin Neurobiol 11(3):281-286.
Lee KF, Li E, Huber LJ, Landis SC, Sharpe AH, Chao MV, Jaenisch R. 1992. Targeted
mutation of the gene encoding the low affinity NGF receptor p75 leads to deficits
in the peripheral sensory nervous system. Cell 69(5):737-749.
Lewin GR, Mendell LM. 1993. Nerve growth factor and nociception. Trends Neurosci
16(9):353-359.
Lewin GR, Winter J, McMahon SB. 1992. Regulation of Afferent Connectivity in the
Adult Spinal Cord by Nerve Growth Factor. Eur J Neurosci 4(8):700-707.
Linden DR, Sharkey KA, Ho W, Mawe GM. 2004. Cyclooxygenase-2 contributes to
dysmotility and enhanced excitability of myenteric AH neurones in the inflamed
guinea pig distal colon. J Physiol 557(Pt 1):191-205.
Lindholm D, Heumann R, Meyer M, Thoenen H. 1987. Interleukin-1 regulates synthesis
of nerve growth factor in non-neuronal cells of rat sciatic nerve. Nature
330(6149):658-659.
Liu HT, Kuo HC. 2008a. Urinary nerve growth factor level could be a potential
biomarker for diagnosis of overactive bladder. J Urol 179(6):2270-2274.
229
Liu HT, Kuo HC. 2008b. Urinary Nerve Growth Factor Levels Are Increased in Patients
with Bladder Outlet Obstruction with Overactive Bladder Symptoms and Reduced
After Successful Medical Treatment. Urology.
Liu YT, Kardosh A, Cooc J, Schonthal AH. 2006. Potential misidentification of
cyclooxygenase-2 by Western blot analysis and prevention through the inclusion
of appropriate controls. Mol Biotechnol 34(3):329-335.
Lowe EM, Anand P, Terenghi G, Williams-Chestnut RE, Sinicropi DV, Osborne JL.
1997. Increased nerve growth factor levels in the urinary bladder of women with
idiopathic sensory urgency and interstitial cystitis. Br J Urol 79(4):572-577.
Maggi CA. 1992. Prostanoids as local modulators of reflex micturition. Pharmacol Res
25(1):13-20.
Maggi CA, Evangelista S, Grimaldi G, Santicioli P, Giolitti A, Meli A. 1984. Evidence
for the involvement of arachidonic acid metabolites in spontaneous and druginduced contractions of rat urinary bladder. J Pharmacol Exp Ther 230(2):500513.
Maggi CA, Giuliani S, Conte B, Furio M, Santicioli P, Meli P, Gragnani L, Meli A.
1988a. Prostanoids modulate reflex micturition by acting through capsaicinsensitive afferents. Eur J Pharmacol 145(2):105-112.
Maggi CA, Giuliani S, Patacchini R, Conte B, Furio M, Santicioli P, Meli P, Gragnani L,
Meli A. 1988b. The effect of SC-19220, a prostaglandin antagonist, on the
micturition reflex in rats. Eur J Pharmacol 152(3):273-279.
230
Maggi CA, Lecci A, Santicioli P, Del Bianco E, Giuliani S. 1992. Cyclophosphamide
cystitis in rats: involvement of capsaicin-sensitive primary afferents. J Auton
Nerv Syst 38(3):201-208.
Maggi CA, Santicioli P, Meli A. 1986. The nonstop transvesical cystometrogram in
urethane-anesthetized rats: a simple procedure for quantitative studies on the
various phases of urinary bladder voiding cycle. J Pharmacol Methods 15(2):157167.
Malley SE, Vizzard MA. 2002. Changes in urinary bladder cytokine mRNA and protein
after cyclophosphamide-induced cystitis. Physiol Genomics 9(1):5-13.
Malykhina AP. 2007. Neural mechanisms of pelvic organ cross-sensitization.
Neuroscience 149(3):660-672.
Meller ST, Cummings CP, Traub RJ, Gebhart GF. 1994. The role of nitric oxide in the
development and maintenance of the hyperalgesia produced by intraplantar
injection of carrageenan in the rat. Neuroscience 60(2):367-374.
Micera A, Lambiase A, Stampachiacchiere B, Bonini S, Levi-Schaffer F. 2007. Nerve
growth factor and tissue repair remodeling: trkA(NGFR) and p75(NTR), two
receptors one fate. Cytokine Growth Factor Rev 18(3-4):245-256.
Michael YL, Kawachi I, Stampfer MJ, Colditz GA, Curhan GC. 2000. Quality of life
among women with interstitial cystitis. J Urol 164(2):423-427.
Miller FD, Kaplan DR. 2001. On Trk for retrograde signaling. Neuron 32(5):767-770.
231
Miller FD, Speelman A, Mathew TC, Fabian J, Chang E, Pozniak C, Toma JG. 1994.
Nerve growth factor derived from terminals selectively increases the ratio of p75
to trkA NGF receptors on mature sympathetic neurons. Dev Biol 161(1):206-217.
Million M, Wang L, Stenzel-Poore MP, Coste SC, Yuan PQ, Lamy C, Rivier J,
Buffington T, Tache Y. 2007. Enhanced pelvic responses to stressors in female
CRF-overexpressing mice. Am J Physiol Regul Integr Comp Physiol
292(4):R1429-1438.
Mitchell JA, Warner TD. 1999. Cyclo-oxygenase-2: pharmacology, physiology,
biochemistry and relevance to NSAID therapy. Br J Pharmacol 128(6):11211132.
Mohtasham L, Auais A, Piedimonte G. 2007. Nerve growth factor mediates steroidresistant inflammation in respiratory syncytial virus infection. Pediatr Pulmonol
42(6):496-504.
Morgan C, Nadelhaft I, de Groat WC. 1981. The distribution of visceral primary afferents
from the pelvic nerve to Lissauer's tract and the spinal gray matter and its
relationship to the sacral parasympathetic nucleus. J Comp Neurol 201(3):415440.
Morrison BW, Christensen S, Yuan W, Brown J, Amlani S, Seidenberg B. 1999.
Analgesic efficacy of the cyclooxygenase-2-specific inhibitor rofecoxib in postdental surgery pain: a randomized, controlled trial. Clin Ther 21(6):943-953.
232
Mousa SA, Cheppudira BP, Shaqura M, Fischer O, Hofmann J, Hellweg R, Schafer M.
2007. Nerve growth factor governs the enhanced ability of opioids to suppress
inflammatory pain. Brain 130(Pt 2):502-513.
Murakami S, Yoshida M, Masunaga K, Maeda Y, Ueda S. 2008. Change in acetylcholine
release from rat bladder with partial outlet obstruction. BJU Int 101(5):633-639.
Murray E, Malley SE, Qiao LY, Hu VY, Vizzard MA. 2004. Cyclophosphamide induced
cystitis alters neurotrophin and receptor tyrosine kinase expression in pelvic
ganglia and bladder. J Urol 172(6 Pt 1):2434-2439.
Nadelhaft I, Vera PL. 1995. Central nervous system neurons infected by pseudorabies
virus injected into the rat urinary bladder following unilateral transection of the
pelvic nerve. J Comp Neurol 359(3):443-456.
Nantel F, Denis D, Gordon R, Northey A, Cirino M, Metters KM, Chan CC. 1999.
Distribution and regulation of cyclooxygenase-2 in carrageenan-induced
inflammation. Br J Pharmacol 128(4):853-859.
Ness TJ, Powell-Boone T, Cannon R, Lloyd LK, Fillingim RB. 2005. Psychophysical
evidence of hypersensitivity in subjects with interstitial cystitis. J Urol
173(6):1983-1987.
Ng YK, de Groat WC, Wu HY. 2007. Smooth muscle and neural mechanisms
contributing to the down-regulation of neonatal rat spontaneous bladder
contractions during postnatal development. Am J Physiol Regul Integr Comp
Physiol.
233
Nishiguchi J, Hayashi Y, Chancellor MB, de Miguel F, de Groat WC, Kumon H,
Yoshimura N. 2005. Detrusor overactivity induced by intravesical application of
adenosine 5'-triphosphate under different delivery conditions in rats. Urology
66(6):1332-1337.
Nykjaer A, Willnow TE, Petersen CM. 2005. p75NTR--live or let die. Curr Opin
Neurobiol 15(1):49-57.
Obata K, Katsura H, Sakurai J, Kobayashi K, Yamanaka H, Dai Y, Fukuoka T, Noguchi
K. 2006. Suppression of the p75 neurotrophin receptor in uninjured sensory
neurons reduces neuropathic pain after nerve injury. J Neurosci 26(46):1197411986.
Oddiah D, Anand P, McMahon SB, Rattray M. 1998. Rapid increase of NGF, BDNF and
NT-3 mRNAs in inflamed bladder. Neuroreport 9(7):1455-1458.
Okragly AJ, Niles AL, Saban R, Schmidt D, Hoffman RL, Warner TF, Moon TD,
Uehling DT, Haak-Frendscho M. 1999. Elevated tryptase, nerve growth factor,
neurotrophin-3 and glial cell line-derived neurotrophic factor levels in the urine of
interstitial cystitis and bladder cancer patients. J Urol 161(2):438-441; discussion
441-432.
Parente L, Perretti M. 2003. Advances in the pathophysiology of constitutive and
inducible cyclooxygenases: two enzymes in the spotlight. Biochem Pharmacol
65(2):153-159.
234
Park JM, Yang T, Arend LJ, Schnermann JB, Peters CA, Freeman MR, Briggs JP. 1999.
Obstruction stimulates COX-2 expression in bladder smooth muscle cells via
increased mechanical stretch. Am J Physiol 276(1 Pt 2):F129-136.
Park JM, Yang T, Arend LJ, Smart AM, Schnermann JB, Briggs JP. 1997.
Cyclooxygenase-2 is expressed in bladder during fetal development and
stimulated by outlet obstruction. Am J Physiol 273(4 Pt 2):F538-544.
Pesce C, Grattarola M, Menini S, Fiallo P. 2006. Cyclooxygenase 2 expression in vessels
and nerves in reversal reaction leprosy. Am J Trop Med Hyg 74(6):1076-1077.
Pezet S, McMahon SB. 2006. Neurotrophins: Mediators and Modulators of Pain. Annu
Rev Neurosci.
Pezet S, Onteniente B, Jullien J, Junier MP, Grannec G, Rudkin BB, Calvino B. 2001.
Differential regulation of NGF receptors in primary sensory neurons by adjuvantinduced arthritis in the rat. Pain 90(1-2):113-125.
Pioro EP, Cuello AC. 1990. Distribution of nerve growth factor receptor-like
immunoreactivity in the adult rat central nervous system. Effect of colchicine and
correlation with the cholinergic system--II. Brainstem, cerebellum and spinal
cord. Neuroscience 34(1):89-110.
Qiao LY, Vizzard MA. 2002. Cystitis-induced upregulation of tyrosine kinase (TrkA,
TrkB) receptor expression and phosphorylation in rat micturition pathways. J
Comp Neurol 454(2):200-211.
235
Qiao LY, Vizzard MA. 2004. Up-regulation of phosphorylated CREB but not c-Jun in
bladder afferent neurons in dorsal root ganglia after cystitis. J Comp Neurol
469(2):262-274.
Richardson JD, Vasko MR. 2002. Cellular mechanisms of neurogenic inflammation. J
Pharmacol Exp Ther 302(3):839-845.
Riendeau D, Charleson S, Cromlish W, Mancini JA, Wong E, Guay J. 1997. Comparison
of the cyclooxygenase-1 inhibitory properties of nonsteroidal anti-inflammatory
drugs (NSAIDs) and selective COX-2 inhibitors, using sensitive microsomal and
platelet assays. Can J Physiol Pharmacol 75(9):1088-1095.
Rothrock NE, Lutgendorf SK, Kreder KJ, Ratliff T, Zimmerman B. 2001. Stress and
symptoms in patients with interstitial cystitis: a life stress model. Urology
57(3):422-427.
Schafers M, Marziniak M, Sorkin LS, Yaksh TL, Sommer C. 2004. Cyclooxygenase
inhibition in nerve-injury- and TNF-induced hyperalgesia in the rat. Exp Neurol
185(1):160-168.
Schweigreiter R. 2006. The dual nature of neurotrophins. Bioessays 28(6):583-594.
Scott AL, Borisoff JF, Ramer MS. 2005. Deafferentation and neurotrophin-mediated
intraspinal sprouting: a central role for the p75 neurotrophin receptor. Eur J
Neurosci 21(1):81-92.
Seki S, Sasaki K, Fraser MO, Igawa Y, Nishizawa O, Chancellor MB, de Groat WC,
Yoshimura N. 2002. Immunoneutralization of nerve growth factor in lumbosacral
236
spinal cord reduces bladder hyperreflexia in spinal cord injured rats. J Urol
168(5):2269-2274.
Seki S, Sasaki K, Igawa Y, Nishizawa O, Chancellor MB, De Groat WC, Yoshimura N.
2004. Suppression of detrusor-sphincter dyssynergia by immunoneutralization of
nerve growth factor in lumbosacral spinal cord in spinal cord injured rats. J Urol
171(1):478-482.
Shaw G, Hawkins J. 1992. Identification of spinal cord polypeptides related to glial
fibrillary acidic protein (GFAP). Neuroreport 3(6):461-464.
Shefchyk SJ. 2002. Spinal cord neural organization controlling the urinary bladder and
striated sphincter. Prog Brain Res 137:71-82.
Sherer TB, Neff PS, Hankins GR, Tuttle JB. 1998a. Mechanisms of increased NGF
production in vascular smooth muscle of the spontaneously hypertensive rat. Exp
Cell Res 241(1):186-193.
Sherer TB, Neff PS, Tuttle JB. 1998b. Increased nerve growth factor mRNA stability
may underlie elevated nerve growth factor secretion from hypertensive vascular
smooth muscle cells. Brain Res Mol Brain Res 62(2):167-174.
Skoff AM, Adler JE. 2006. Nerve growth factor regulates substance P in adult sensory
neurons through both TrkA and p75 receptors. Exp Neurol 197(2):430-436.
Sobreviela T, Clary DO, Reichardt LF, Brandabur MM, Kordower JH, Mufson EJ. 1994.
TrkA-immunoreactive profiles in the central nervous system: colocalization with
neurons containing p75 nerve growth factor receptor, choline acetyltransferase,
and serotonin. J Comp Neurol 350(4):587-611.
237
Spiegel K, Agrafiotis D, Caprathe B, Davis RE, Dickerson MR, Fergus JH, Hepburn TW,
Marks JS, Van Dorf M, Wieland DM, et al. 1995. PD 90780, a non peptide
inhibitor of nerve growth factor's binding to the P75 NGF receptor. Biochem
Biophys Res Commun 217(2):488-494.
Stanzel RD, Lourenssen S, Blennerhassett MG. 2008. Inflammation causes expression of
NGF in epithelial cells of the rat colon. Exp Neurol 211(1):203-213.
Steers WD, Ciambotti J, Etzel B, Erdman S, de Groat WC. 1991. Alterations in afferent
pathways from the urinary bladder of the rat in response to partial urethral
obstruction. J Comp Neurol 310(3):401-410.
Steers WD, Mackway-Gerardi AM, Ciambotti J, de Groat WC. 1994. Alterations in
neural pathways to the urinary bladder of the rat in response to streptozotocininduced diabetes. J Auton Nerv Syst 47(1-2):83-94.
Steers WD, Tuttle JB. 2006. Mechanisms of Disease: the role of nerve growth factor in
the pathophysiology of bladder disorders. Nat Clin Pract Urol 3(2):101-110.
Stein PC, Pham H, Ito T, Parsons CL. 1996. Bladder injury model induced in rats by
exposure to protamine sulfate followed by bacterial endotoxin. J Urol
155(3):1133-1138.
Stillwell TJ, Benson RC, Jr. 1988. Cyclophosphamide-induced hemorrhagic cystitis. A
review of 100 patients. Cancer 61(3):451-457.
Streng T, Hedlund P, Talo A, Andersson KE, Gillespie JI. 2006. Phasic non-micturition
contractions in the bladder of the anaesthetized and awake rat. BJU Int
97(5):1094-1101.
238
Studeny S, Cheppudira BP, Meyers S, Balestreire EM, Apodaca G, Birder LA, Braas
KM, Waschek JA, May V, Vizzard MA. 2008. Urinary Bladder Function and
Somatic Sensitivity in Vasoactive Intestinal Polypeptide (VIP)(-/-) Mice. J Mol
Neurosci.
Teng KK, Hempstead BL. 2004. Neurotrophins and their receptors: signaling trios in
complex biological systems. Cell Mol Life Sci 61(1):35-48.
Theoharides TC. 2007. Treatment approaches for painful bladder syndrome/interstitial
cystitis. Drugs 67(2):215-235.
Thompson SW, Dray A, McCarson KE, Krause JE, Urban L. 1995. Nerve growth factor
induces mechanical allodynia associated with novel A fibre-evoked spinal reflex
activity and enhanced neurokinin-1 receptor activation in the rat. Pain 62(2):219231.
Tokuoka S, Takahashi Y, Masuda T, Tanaka H, Furukawa S, Nagai H. 2001. Disruption
of antigen-induced airway inflammation and airway hyper-responsiveness in low
affinity neurotrophin receptor p75 gene deficient mice. Br J Pharmacol
134(7):1580-1586.
Tong YC, Cheng JT. 2005. Changes in bladder nerve-growth factor and p75 genetic
expression in streptozotocin-induced diabetic rats. BJU Int 96(9):1392-1396.
Tsai CS, Chen FH, Wang CC, Huang HL, Jung SM, Wu CJ, Lee CC, McBride WH,
Chiang CS, Hong JH. 2007. Macrophages from irradiated tumors express higher
levels of inos, arginase-i and COX-2, and promote tumor growth. Int J Radiat
Oncol Biol Phys.
239
Vaidyanathan S, Krishnan KR, Mansour P, Soni BM, McDicken I. 1998. p75 nerve
growth factor receptor in the vesical urothelium of patients with neuropathic
bladder: an immunohistochemical study. Spinal Cord 36(8):541-547.
Verdi JM, Birren SJ, Ibanez CF, Persson H, Kaplan DR, Benedetti M, Chao MV,
Anderson DJ. 1994. p75LNGFR regulates Trk signal transduction and NGFinduced neuronal differentiation in MAH cells. Neuron 12(4):733-745.
Vizzard MA. 1997. Increased expression of neuronal nitric oxide synthase in bladder
afferent and spinal neurons following spinal cord injury. Dev Neurosci 19(3):232246.
Vizzard MA. 2000a. Alterations in spinal cord Fos protein expression induced by bladder
stimulation following cystitis. Am J Physiol Regul Integr Comp Physiol
278(4):R1027-1039.
Vizzard MA. 2000b. Changes in urinary bladder neurotrophic factor mRNA and NGF
protein following urinary bladder dysfunction. Exp Neurol 161(1):273-284.
Vizzard MA. 2000c. Up-regulation of pituitary adenylate cyclase-activating polypeptide
in urinary bladder pathways after chronic cystitis. J Comp Neurol 420(3):335-348.
Vizzard MA. 2001. Alterations in neuropeptide expression in lumbosacral bladder
pathways following chronic cystitis. J Chem Neuroanat 21(2):125-138.
Vizzard MA, Boyle MM. 1999. Increased expression of growth-associated protein (GAP43) in lower urinary tract pathways following cyclophosphamide (CYP)-induced
cystitis. Brain Res 844(1-2):174-187.
240
Wakabayashi Y, Kawakami T, Aimi Y, Okada Y. 2002. Development of growthassociated protein-43 and neurotrophin receptor immunoreactivities in the rat
urinary bladder. Anat Embryol (Berl) 205(3):255-261.
Wakabayashi Y, Maeda T, Aimi Y, Kwok YN. 1998. Increase of low-affinity
neurotrophin receptor p75 and growth-associated protein-43 immunoreactivities
in the rat urinary bladder during experimentally induced nerve regeneration. J
Urol 160(4):1513-1517.
Wakabayashi Y, Maeda T, Kwok YN. 1996. Increase of p75 immunoreactivity in rat
urinary bladder following inflammation. Neuroreport 7(6):1141-1144.
Wakabayashi Y, Tomoyoshi T, Tooyama I, Kitahama K, Kim SU, Maeda T. 1995. Lowaffinity nerve growth factor receptor immunoreactivity in the human urinary
bladder. Neurosci Lett 186(1):9-12.
Wang W, Dow KE, Riopelle RJ, Ross GM. 2001. The common neurotrophin receptor
p75NTR enhances the ability of PC12 cells to resist oxidative stress by a trkAdependent mechanism. Neurotox Res 3(5):485-499.
Wang ZY, Wang P, Merriam FV, Bjorling DE. 2008. Lack of TRPV1 inhibits cystitisinduced increased mechanical sensitivity in mice. Pain.
Watson NA, Notley RG. 1973. Urological complications of cyclophosphamide. Br J Urol
45(6):606-609.
Wehrman T, He X, Raab B, Dukipatti A, Blau H, Garcia KC. 2007. Structural and
mechanistic insights into nerve growth factor interactions with the TrkA and p75
receptors. Neuron 53(1):25-38.
241
Westropp JL, Buffington CA. 2002. In vivo models of interstitial cystitis. J Urol 167(2 Pt
1):694-702.
Wheeler MA, Yoon JH, Olsson LE, Weiss RM. 2001. Cyclooxygenase-2 protein and
prostaglandin E(2) production are up-regulated in a rat bladder inflammation
model. Eur J Pharmacol 417(3):239-248.
Wong ST, Henley JR, Kanning KC, Huang KH, Bothwell M, Poo MM. 2002. A
p75(NTR) and Nogo receptor complex mediates repulsive signaling by myelinassociated glycoprotein. Nat Neurosci 5(12):1302-1308.
Woolf CJ, Allchorne A, Safieh-Garabedian B, Poole S. 1997. Cytokines, nerve growth
factor and inflammatory hyperalgesia: the contribution of tumour necrosis factor
alpha. Br J Pharmacol 121(3):417-424.
Wright DE, Snider WD. 1995. Neurotrophin receptor mRNA expression defines distinct
populations of neurons in rat dorsal root ganglia. J Comp Neurol 351(3):329-338.
Xie W, Bao Y, Yu LJ, Chen YY. 2006. [Effect of saikosaponins on glial fibrillary acidic
protein expression in hippocampal astrocytes of pentetrazole-induced chronic
kindling rats]. Nan Fang Yi Ke Da Xue Xue Bao 26(4):452-455.
Yamashita M, Tsuji S, Nishiyama A, Myrvik QN, Henriksen RA, Shibata Y. 2007.
Differential subcellular localization of COX-2 in macrophages phagocytosing
heat-killed Mycobacterium bovis BCG. Am J Physiol Cell Physiol.
Yermakova A, O'Banion MK. 2000. Cyclooxygenases in the central nervous system:
implications for treatment of neurological disorders. Curr Pharm Des 6(17):17551776.
242
Yiangou Y, Facer P, Durrenberger P, Chessell IP, Naylor A, Bountra C, Banati RR,
Anand P. 2006. COX-2, CB2 and P2X7-immunoreactivities are increased in
activated microglial cells/macrophages of multiple sclerosis and amyotrophic
lateral sclerosis spinal cord. BMC Neurol 6:12.
Yokoyama O, Yoshiyama M, Namiki M, de Groat WC. 1997. Influence of anesthesia on
bladder hyperactivity induced by middle cerebral artery occlusion in the rat. Am J
Physiol 273(6 Pt 2):R1900-1907.
Yoshimura N, Bennett NE, Hayashi Y, Ogawa T, Nishizawa O, Chancellor MB, de Groat
WC, Seki S. 2006. Bladder overactivity and hyperexcitability of bladder afferent
neurons after intrathecal delivery of nerve growth factor in rats. J Neurosci
26(42):10847-10855.
Yoshimura N, de Groat WC. 1999. Increased excitability of afferent neurons innervating
rat urinary bladder after chronic bladder inflammation. J Neurosci 19(11):46444653.
Yoshimura N, Seki S, Chancellor MB, de Groat WC, Ueda T. 2002. Targeting afferent
hyperexcitability for therapy of the painful bladder syndrome. Urology 59(5
Suppl 1):61-67.
Yu Y, de Groat WC. 2008. Sensitization of pelvic afferent nerves in the in vitro rat
urinary bladder-pelvic nerve preparation by purinergic agonists and
cyclophosphamide pretreatment. Am J Physiol Renal Physiol 294(5):F1146-1156.
243
Yuridullah R, Corrow KA, Malley SE, Vizzard MA. 2006. Expression of fractalkine and
fractalkine receptor in urinary bladder after cyclophosphamide (CYP)-induced
cystitis. Auton Neurosci 126-127:380-389.
Zvara P, Kliment J, Jr., DeRoss AL, Irwin BH, Malley SE, Plante MK, Vizzard MA.
2002. Differential expression of bladder neurotrophic factor mRNA in male and
female rats after bladder outflow obstruction. J Urol 168(6):2682-2688.
Zvara P, Vizzard MA. 2007. Exogenous overexpression of nerve growth factor in the
urinary bladder produces bladder overactivity and altered micturition circuitry in
the lumbosacral spinal cord. BMC Physiol 7:9.
Zvarova K, Murray E, Vizzard MA. 2004. Changes in galanin immunoreactivity in rat
lumbosacral spinal cord and dorsal root ganglia after spinal cord injury. J Comp
Neurol 475(4):590-603.
Zvarova K, Vizzard MA. 2005. Distribution and fate of cocaine- and amphetamineregulated transcript peptide (CARTp)-expressing cells in rat urinary bladder: a
developmental study. J Comp Neurol 489(4):501-517.
Zweifel LS, Kuruvilla R, Ginty DD. 2005. Functions and mechanisms of retrograde
neurotrophin signalling. Nat Rev Neurosci 6(8):615-625.
244
Appendix A: Functional and sensory changes in p75NTR-/- mice
245
Introduction
The pan-neurotrophin receptor p75NTR has been implicated in many cellular
processes, including neuronal growth regulation and apoptosis (Allen and Dawbarn,
2006). In cells expressing TrkA, p75NTR also enhances the binding affinity of TrkA for
NGF (Allen and Dawbarn, 2006). p75NTR may also function to reduce NGF-TrkA
signaling by sequestering NGF, leaving less available to bind TrkA (Coome et al., 1998;
Dhanoa et al., 2006; Hannila et al., 2004; Nykjaer et al., 2005). Studies in p75NTR exon
III (p75NTRexonIII) deficient mice have shown the importance of p75NTR in regulating
injury-induced sprouting in rat dorsal horn and trigeminal ganglia and cerebellum
(Dhanoa et al., 2006; Hannila and Kawaja, 2005; Scott et al., 2005). The original
phenotypical findings in these mice include decreased sensory innervation of the footpad
skin, loss of heat sensitivity and the development of skin ulcers in distal extremities (Lee
et al., 1992). Changes were not originally seen in sympathetic innervation in sympathetic
cervical ganglia or iris (Lee et al., 1992). In examining p75NTRexonIII null mice, we
sought to (1) examine bladder function using conscious cystometry, and (2) to begin to
characterize the expression of sympathetic, parasympathetic, and sensory innervation of
the urinary bladder using immunohistochemistry. This work is preliminary and
unpublished.
246
Materials and Methods
Genotyping
p75NTRexonIII null mice were used in this study (Lee et al., 1992). Adult male and female
p75NTR -/-, p75NTR +/+, and p75NTR +/- littermates were generated using a hemizygous
(p75NTR +/- mice) breeding strategy (Fig. 1). To determine the genotypes of progeny, tail
DNA samples were obtained from postnatal day 21 mice, digested with NucPrep, and
amplified with primers for the p75NTR transgene (p75-1: 5’CGATGCTCCTATGGCTACTA; p75-2: 5’-CCTCGCATTCGGCGTCAGCC; and
PGK: 5’-GGGAACTTCCTGACTAGGGG)
Tube Implant Surgery and Cystometry
Please refer to the Materials and Methods section of Chapter 4.
Immunohistochemistry
Bladder whole-mount preparations were prepared as described in Chapter 3. Bladder
cross sections were obtained and prepared as described in Chapter 2. Urinary bladder
sections and bladder whole-mount preparations were incubated overnight at room
temperature with rabbit anti–vasoactive intestinal polypeptide (VIP) antibody (1:2000,
Incstar, Stillwater, MN), rabbit anti-tyrosine hydroxylase (TH) antibody (1:1000, Novus
Biologicals, Littleton, CO), or rabbit anti-calcitonin gene-related peptide (CGRP)
antibody (1:1000, Phoenix Pharmaceuticals, Inc., St. Joseph, MO) in 1% goat serum and
0.1 M KPBS (Phosphate Buffer Solution with potassium), and then washed (3×15 min)
with 0.1 M KPBS, pH 7.4. Tissue was then incubated with Cy3-conjugated goat anti–
rabbit IgG (1:500; Jackson ImmunoResearch) for 2 hr at room temperature. After several
247
rinses with 0.1 M KPBS, tissues were mounted with Citifluor (Citifluor, London, UK) on
slides and coverslipped. Control tissues incubated in the absence of primary or secondary
antibody were also processed and evaluated for specificity or background staining levels.
In the absence of primary antibody, no positive immunostaining was observed.
248
Results
Cystometry in mice with the p75NTRexonIII null mutation
p75NTRexonIII null mice displayed a continuum of bladder function symptoms,
ranging from bladder hyperreflexia to complete incontinence. Incontinence involved
subtle changes in pressure during filling and continual leaking, as evidence by the
cystometrogram pressure tracing shown in Fig. 2B. Bladder function was also studied in
p75NTR +/- mice, and these mice also displayed abnormal bladder function that ranged
from hyperreflexia to incontinence (data not shown). Wild-type littermates had normal
bladder function, with regular voiding events associated with a peak in bladder pressure
followed by a decrease in bladder pressure for filling (Fig. 2A).
TH expression in mice with the p75NTRexonIII null mutation
TH was used as a marker for sympathetic innervation in bladder cryostat sections
in p75NTRexonIII null mice and in wild-type (WT) littermates (Fig. 3A, B). TH staining
appeared brighter and was more frequently observed in nerve fibers associated with the
detrusor smooth muscle in null mice (A) as opposed to WT mice (B).
VIP expression in mice with the p75NTRexonIII null mutation
VIP-immunoreactivity in bladder whole-mount preparations showed that VIP, a
marker for parasympathetic neurons, is present in nerve fibers associated with the
detrusor smooth muscle. This staining appears to be decreased in null mice (Fig. 4B)
compared to WT mice (Fig. 4A). The differences in staining intensity were most obvious
in the bladder base and urethral region.
CGRP expression in mice with the p75NTRexonIII null mutation
249
Immunostaining for CGRP, a marker for most sensory neurons, appeared to be
decreased in null mice (Fig. 5B) compared to WT mice (Fig. 5A) in the lamina propria
layer of the urinary bladder. CGRP-immunoreactivity can also be seen in nerve fibers
associated with the urothelium and in nerve fibers associated with the detrusor smooth
muscle.
250
Figures
het
homo
WT
- 317 bp
- 247 bp
Figure 1: Genotyping of p75NTRexonIII null mice, wildtype and heterozygous p75NTRexonIII mice
p75NTR –null mice display a band at 317 bp (homo). Wild-type mice display a band at
247 bp (WT). Mice heterozygous for the null mutation show a band at both 317 and 247
bp (het).
251
A
WT
Figure 2: Cystometry in
p75NTRexonIII null mice
B
KO
(constant leaking)
252
(A) Cystometrogram data
from a wild-type (WT)
littermate. (B)
p75NTRexonIII null mice
demonstrate a continuum
of bladder overactivity,
ranging from complete
incontinence to
pronounced hyperreflexia
as compared to wild-type
littermates. Panel B
illustrates an example of
subtle pressure changes
(center) not associated
with void events.
A
p75NTR-/U
M
B
WT
U
M
TH-IR
Figure 3: Tyrosine hydroxylase (TH) expression in p75NTRexonIII null mice
TH, a marker for sympathetic neurons, appears to stain more intensely and with greater
frequency in nerve fibers in the detrusor smooth muscle of the bladder in null mice (A) as
opposed to WT mice (B).
253
A
WT
B
p75NTR-/-
Figure 4: Vasoactive Intestinal Polypeptide (VIP) expression in p75NTRexonIII null mice
Whole-mount preparation showing VIP staining in detrusor smooth muscle.
Immunostaining for VIP, a marker for parasympathetic neurons, appears to be decreased
in null mice (B) as compared to WT mice (A) in nerve fibers associated with the detrusor
smooth muscle. M: detrusor smooth muscle; U: urothelium.
254
A
B
WT
p75NTR-/-
U
LP
U
LP
M
M
Figure 5: Calcitonin gene-related peptide (CGRP) expression in p75NTRexonIII null mice
Immunostaining for CGRP, a marker for most sensory neurons, appears to be decreased
in null mice (B) as compared to WT mice (A) in the lamina propria layer of the urinary
bladder wall. Staining can also be seen in nerve fibers associated with the urothelium and
in nerve fibers associated with the detrusor smooth muscle. M: detrusor smooth muscle;
U: urothelium; LP: lamina propria.
255
Discussion
Mice with the p75NTRexonIII null mutation are a valuable resource for future studies
of the functional role that p75NTR may play in micturition reflexes. So far, these mice
present a complex story of bladder activity, with some null mice displaying urinary
incontinence and some with milder bladder hyperreflexia (Fig. 2B). To determine
whether these mice exhibit variations in urinary bladder innervation, we have used
immunohistochemistry to begin to examine the expression of sympathetic,
parasympathetic and sensory neurons in the urinary bladder. Although not quantified,
there is an indication that tyrosine hydroxylase (TH) stained with greater intensity and
frequency in p75NTR-/- mice than in their wildtype littermates. An increase in sympathetic
innervation in p75NTR-/- mice has been previously reported (Hannila and Kawaja, 2005;
Scott et al., 2005). Vasoactive intestinal peptide (VIP) was used as a marker for
parasympathetic innervation and this staining appeared in nerve fibers associated with the
detrusor smooth muscle. VIP-immunoreactivity appeared to be decreased in p75NTR-/mice as compared to wildtype littermates (Fig. 4A, B). Finally, calcitonin gene-related
peptide (CGRP) was used as a marker for sensory neurons and this staining was present
in small nerve fibers in detrusor smooth muscle and associated with the urothelium (Fig.
5A, B). Changes in sensory innervation of the footpad skin in p75NTR-/- mice have been
previously documented (Lee et al., 1992).
Our cystometry studies in p75NTRexonIII-/- mice indicate possible complex changes
in bladder function with the p75NTRexonIII-/- phenotype. Changes in the urethral outlet or in
the urinary bladder could be affecting bladder function and these changes could be
256
neurogenic or myogenic. If the change in function is due to an increase in TH expression
(sympathetic innervation) in the urinary bladder, the experimental use of β-adrenergic
blocking agents might remove the inhibition and normalize function. If the changes are
due to an increase in TH expression in the urethral outlet, this could result in α-mediated
constriction and outlet obstruction. The experimental use of an α-adrenergic antagonist
could relieve and normalize function. Other future avenues for this research could
include possible future myograph studies on muscle contractility in bladder and urethra.
These preliminary results also show interesting changes in autonomic and sensory
innervation in p75NTR-/- mouse bladders. Further study into this could consist of
quantification of the immunostaining of TH, VIP and CGRP, as well as the use of
western blotting or enzyme-linked immunoassays (ELISAs) to quantify the protein
expression of parasympathetic, sympathetic or sensory neuron markers.
257
References
Allen SJ, Dawbarn D. 2006. Clinical relevance of the neurotrophins and their receptors.
Clin Sci (Lond) 110(2):175-191.
Coome GE, Elliott J, Kawaja MD. 1998. Sympathetic and sensory axons invade the
brains of nerve growth factor transgenic mice in the absence of p75NTR
expression. Exp Neurol 149(1):284-294.
Dhanoa NK, Krol KM, Jahed A, Crutcher KA, Kawaja MD. 2006. Null mutations for
exon III and exon IV of the p75 neurotrophin receptor gene enhance sympathetic
sprouting in response to elevated levels of nerve growth factor in transgenic mice.
Exp Neurol 198(2):416-426.
Hannila SS, Kawaja MD. 2005. Nerve growth factor-mediated collateral sprouting of
central sensory axons into deafferentated regions of the dorsal horn is enhanced in
the absence of the p75 neurotrophin receptor. J Comp Neurol 486(4):331-343.
Hannila SS, Lawrance GM, Ross GM, Kawaja MD. 2004. TrkA and mitogen-activated
protein kinase phosphorylation are enhanced in sympathetic neurons lacking
functional p75 neurotrophin receptor expression. Eur J Neurosci 19(10):29032908.
Lee KF, Li E, Huber LJ, Landis SC, Sharpe AH, Chao MV, Jaenisch R. 1992. Targeted
mutation of the gene encoding the low affinity NGF receptor p75 leads to deficits
in the peripheral sensory nervous system. Cell 69(5):737-749.
Nykjaer A, Willnow TE, Petersen CM. 2005. p75NTR--live or let die. Curr Opin
Neurobiol 15(1):49-57.
258
Scott AL, Borisoff JF, Ramer MS. 2005. Deafferentation and neurotrophin-mediated
intraspinal sprouting: a central role for the p75 neurotrophin receptor. Eur J
Neurosci 21(1):81-92.
259