Genetics: Published Articles Ahead of Print, published on June 18, 2008 as 10.1534/genetics.108.090233
1
Sequence divergence impedes crossover more than noncrossover events during
mitotic gap repair in yeast
Caroline Welz-Voegele and Sue Jinks-Robertson
Department of Molecular Genetics and Microbiology, Duke University Medical Center,
Durham, NC 27710
This paper is dedicated to the memory of Caroline Welz-Voegele, Ph.D., who died of
inflammatory breast cancer on September 12, 2007. During her 10 years with the JinksRobertson group, Caroline made numerous experimental and intellectual contributions,
she was generous with her time and knowledge, and she served as a mentor and role model
for all who passed through the lab. Caroline is greatly missed and fondly remembered by
her friends and colleagues at Emory University and Duke University.
2
Running head: Sequence divergence and recombination
Key words: mismatch repair, recombination fidelity, helicase, gap repair, yeast
Corresponding author:
Dr. Sue Jinks-Robertson
Department of Molecular Genetics and Microbiology
DUMC 3020
228 Jones Bldg, Research Drive
Durham, NC 27710
Phone: 919-681-7273
Fax: 919-684-2790
[email protected]
3
Abstract
Homologous recombination between dispersed repeated sequences is important in
shaping eukaryotic genome structure, and such ectopic interactions are affected by repeat size
and sequence identity. A transformation-based, gap-repair assay was used to examine the effect
of 2% sequence divergence on the efficiency of mitotic double-strand break repair templated by
chromosomal sequences in yeast. Because the repaired plasmid could either remain autonomous
or integrate into the genome, the effect of sequence divergence on the crossover-noncrossover
(CO-NCO) outcome was also examined. Finally, proteins important for regulating the CO-NCO
outcome and for enforcing identity requirements during recombination were examined by
transforming appropriate mutant strains. Results demonstrate that the basic CO-NCO outcome is
regulated by the Rad1-Rad10 endonuclease and the Sgs1 and Srs2 helicases; that sequence
divergence impedes CO to a much greater extent than NCO events; that an intact mismatch
repair system is required for the discriminating identical and nonidentical repair templates; and
that the Sgs1 and Srs2 helicases play additional, anti-recombination roles when the interacting
sequences are not identical.
4
Introduction
Recombination is a high-fidelity process that copies information from one DNA duplex
to repair single- or double-strand discontinuities in another DNA duplex (reviewed by KROGH
and SYMINGTON 2004). Repair events involve either the unidirectional transfer of information
between duplexes or the reciprocal exchange of information, which will be referred to here as
noncrossover (NCO) and crossover (CO) events, respectively. In classic models of homologous
recombination, NCO and CO events derive from alternative cleavage of a common intermediate
known as a Holliday junction, which corresponds to the point where the single strands of the
interacting duplexes switch pairing partners. In more recent recombination models, however,
some NCO events proceed through an intermediate that cannot be processed into a CO. The
template for recombinational repair is typically a homologous chromosome or sister chromatid,
but because recombination is a homology-driven process, it also can engage repetitive sequences
dispersed throughout the genome. Such ectopic interactions are important for shaping genome
structure, with NCO events likely driving the concerted evolution of multigene families and COs
leading to various types of genome rearrangements. In mitotic studies using model
recombination substrates in the yeast Saccharomyces cerevisiae, the rate of ectopic interactions
is directly proportional to repeat size (AHN et al. 1988; HAYDEN and BYERS 1992; INBAR et al.
2000; JINKS-ROBERTSON et al. 1993) and inversely proportional to the level of sequence
divergence (CHEN and JINKS-ROBERTSON 1998; DATTA et al. 1997).
The major barrier to recombination between diverged sequences in yeast derives from
anti-recombination activity of the mismatch repair (MMR) system (reviewed in SURTEES et al.
2004), which is best known for its roles in removing DNA replication errors and repairing
5
mismatches in meiotic recombination intermediates (reviewed in HARFE and JINKS-ROBERTSON
2000; KUNKEL and ERIE 2005). There are three major yeast complexes involved in mismatch
removal and in anti-recombination: MutSα, MutSβ, and MutLα comprised of Msh2-Msh6,
Msh2-Msh3 and Mlh1-Pms1, respectively. MutSα and MutSβ bind directly to mismatches,
while MutLα couples MutSα/β-mediated mismatch recognition to the appropriate downstream
processing steps, the precise mechanism(s) of which remain obscure. Additional proteins
implicated in the repair of mismatches include the Rad1-Rad10 endonuclease (KIRKPATRICK and
PETES 1997), the Exo1 exonuclease (TISHKOFF et al. 1997) and the PCNA sliding clamp
(JOHNSON et al. 1996; UMAR et al. 1996). Rad1-Rad10 and Exo1 also are important in antirecombination (NICHOLSON et al. 2000), but PCNA plays little, if any, role in this process
(STONE et al. 2008). In contrast, the helicase Sgs1 is important in anti-recombination (MYUNG et
al. 2001; SPELL and JINKS-ROBERTSON 2004), but has no known role in the repair of mismatches.
Thus, although there are similarities in the MMR-directed editing of replication and
recombination intermediates, there are genetic and presumably mechanistic differences as well.
In yeast, chromosomal sequences can serve as a template for the faithful repair of a
linear, gap-containing plasmid and such gap-repair reactions were instrumental in the
development of the double-strand break (DSB) repair model of recombination (SZOSTAK et al.
1983). Of particular significance was the observation that the repaired plasmid either remains
autonomous or integrates into the host genome (ORR-WEAVER and SZOSTAK 1983), outcomes
presumed to reflect cleavage of a Holliday junction intermediate to generate NCO or CO
products, respectively. Subsequent studies have confirmed that plasmid-based repair assays
generally recapitulate the genetic requirements and features of DSB-initiated chromosomal
recombination (BARTSCH et al. 2000), and hence are a useful model for studying basic
6
recombination processes. In the experiments reported here, a gap-repair assay was used to
examine the regulation of mitotic recombination fidelity, with an emphasis on how sequence
divergence affects the CO-NCO decision in different genetic backgrounds. These studies
support roles for the Srs2 and Sgs1 helicases, the Rad1-Rad10 endonuclease and MutSβ in
regulating the CO-NCO outcome; confirm that the regulation of recombination fidelity depends
on activity of the MMR machinery; and demonstrate that sequence divergence impedes CO
events to a much greater extent than NCO events.
7
Materials and Methods
Media and growth conditions: Yeast strains were grown nonselectively in YEP (1%
Bacto-yeast extract, 2% Bacto-peptone) supplemented with 2% glucose and 500 µg/ml adenine
hemisulfate (YEPD). For selection of strains containing the kan or hph marker, YEPD was
supplemented to 200 µg/ml with Geneticin or to 300 µg/ml with hygromycin B, respectively.
For selective growth, synthetic complete (SC; SHERMAN 1991) medium contained 2% glucose
and all but the one relevant amino acid or base (e.g., SC-his for the selection of His+
recombinants). Canavanine-resistant colonies were selected on SC-arg medium supplemented
with 60 µg/ml L-canavanine. Ura- segregants were selected on SC plates supplemented with
0.1% 5-flouroorotic acid (US Biological). All growth was at 30o.
Plasmids: A 938 bp fragment containing the 663 bp HIS3 ORF together with 199 bp of
upstream and 76 bp of downstream sequence was PCR-amplified from pSR22, a pUC7
derivative containing a 1.7 kb BamHI genomic HIS3 fragment. Following treatment with T4
DNA polymerase and T4 kinase, the fragment was inserted at the SmaI site of the LEU2-CEN
vector pRS315 (SIKORSKI and HIETER 1989). The resulting plasmids pSR515 and pSR516
contain the HIS3 gene in the opposite and same orientation, respectively, as the vector lacZ gene.
The HIS3 gene of these plasmids contains less than 10 bp of identity to the his3∆200 allele at the
endogenous HIS3 locus.
The HIS3-18 allele of pSR612 contains 18 silent, randomly distributed mutations (see
Supplemental Figure 1) and is 98%-identical to the standard HIS3 gene. The mutations were
introduced by subjecting pSR515 to sequential rounds of site-directed mutagenesis using the
8
ChameleonTM Double-stranded, Site-Directed Mutagenesis Kit (Stratagene). All mutations were
confirmed by sequencing, and pSR612 was able to fully complement the His- phenotype of a
his3∆200 strain.
pSR800 contains a 3′-truncated, but otherwise wild-type (WT), his3 allele inserted into
the CAN1 coding sequence. Because this allele contains no polymorphisms, it is referred to as
his3-0,∆3′ in order to distinguish it from the similarly truncated allele that contains the
engineered silent changes (his3-18,∆3′). The can1::his3∆3′ allele was constructed as follows.
First, the smallest KpnI fragment of pSR515 was deleted, thereby truncating HIS3 at an internal
KpnI site and eliminating the last 11 amino acids of the encoded protein. An 834 bp BamHIKpnI fragment from the resulting plasmid (pSR798) was then treated with T4 DNA polymerase
and inserted at the MscI site of pSR797. pSR797 is a pUC9 derivative containing an 1122 bp
CAN1 fragment (+21 to +1141 of the 1773 nt CAN1 ORF) inserted at the SmaI site of the vector
polylinker. The resulting plasmid pSR800 contains the his3-0,∆3′ allele in an orientation
opposite to that of the CAN1 sequences. pSR801 contains the can1:: his3-18,∆3′ allele and was
constructed in the same manner as pSR800, but starting from pSR612.
pSR840 contains the his3∆Bgl allele and was used as the template for producing the
linear “gapped vector” PCR fragment for transformation assays. pSR840 was derived by first
inserting a SacI-SalI fragment containing the full length HIS3 gene (from pSR516) into
SacI/SalI-digested pRS306, an integrating URA3 vector (SIKORSKI and HIETER 1989). The
internal 60 bp BglII fragment was then deleted to generate the his3∆Bgl allele. Finally, a
Klenow-treated HinfI-EcoO109 fragment containing the ARS4 replication origin of pRS315
(SIKORSKI and HIETER 1989) was ligated to AatII-digested plasmid that had been treated with T4
DNA polymerase.
9
Yeast strains: Transformation with PstI/PvuII-digested pSR800 or pSR801 was used to
replace the CAN1 allele in SJR328 (MATα ade2-101oc his3∆200 ura3-Nhe lys2∆RV::hisG leu2R Gal+; CHEN and JINKS-ROBERTSON 1999) with the can1::his3-0,∆3′ or can1::his3-18,∆3′
allele, respectively. Following selection of transformants on SC-arg+CAN, replacements were
confirmed by PCR. SJR1500 contains the can1::his3-0,∆3′ allele, while SJR1501 contains the
can1::his3-18,∆3′ allele.
Repair-defective derivatives of SJR1500 and SJR1501 were constructed by targeted gene
deletion. The MSH2 gene was deleted by one step-gene replacement using AatII/XbaI-digested
p∆msh2 (msh2∆::hisG-URA3-hisG plasmid; EARLEY and CROUSE 1998). Following the
selection of Ura+ transformants, YEPD-purified colonies were patched to 5-FOA medium to
select for loss of URA3 and one copy of hisG. SJR1476 and SJR1477 are the resulting
msh2∆::hisG derivatives of SJR1500 and SJR1501, respectively. msh6∆::hisG (SJR2047 and
SJR2048), msh3∆::hisG (SJR2054 and SJR2055), or rad1::hisG derivatives (SJR2111 and
SJR2112) of SJR1500 and SJR1501 were similarly constructed using SacI/EcoRI-digested
pBUH-msh6::hisG-URA3 (KRAMER et al. 1996), EcoRI-digested pEN33 (DATTA et al. 1996) or
SalI/EcoRI-digested pR1.6 (HIGGINS et al. 1983), respectively. The pms1∆ derivatives of
SJR1500 and SJR1501 (SJR2147 and SJR2148, respectively) were constructed by standard twostep allele replacement using BstXI-digested pJH523 (KRAMER et al. 1989). The
mlh1∆::kanMX4 (SJR2156 and SJR2157), sgs1∆::kanMX4 (SJR2122 and SJR2163) and
srs2∆::kanMX4 (SJR2123 and SJR2160) derivatives of SJR1500 and SJR1501 were constructed
by transformation with PCR deletion cassettes generated using pFA6-kanMX4 (WACH et al.
10
1994) as a template. Presence of the relevant mutant allele and absence of the corresponding
WT allele were confirmed by PCR.
Gap-repair experiments: The fragment used for gap-repair assays was produced by
PCR amplification of pSR840. Primers HisBglIIF (5′CTCTTGCGAGATGATCCCGC) and
HisBglIIR (5′-ACCACCGCTCTGGAAAGTGCC), which anneal directly adjacent to the single
BglII site that marks the 60-bp deletion, were used to amplify a 5.7 kb fragment with Taq Plus
Precision polymerase (Stratagene). After the PCR reaction, the template pSR840 DNA was
destroyed using the methylation-sensitive enzyme DpnI. To correct for variation in
transformation efficiency, the PCR product was mixed with uncut control plasmid (pRS315, a
CEN-LEU2 vector; SIKORSKI and HIETER 1989) in a 20:1 weight ratio.
A high-efficiency transformation protocol was used (GIETZ and WOODS 2002), with the
following modifications. To minimize the culture-to-culture variation seen with some of the
repair-defective strains, five colonies were pooled to inoculate 5 ml of liquid YEPD. After
overnight growth, 1 ml was transferred to a prewarmed flask containing 50 ml YEPD, and the
flask was incubated on a rotary shaker at 200 rpm for 3 h. Cells were harvested by
centrifugation at room temperature, washed twice, and resuspended in 360 µl of H2O. 25 µl
samples of the cell suspension were pelleted by centrifugation, the supernatant was removed, and
120 µl of PEG 3350 (50%, w/v) were layered over the pellets. 60 µl of freshly prepared
transformation mix (18 µl of 1M LiAc; 5 µl of 10 mg/ml boiled salmon sperm carrier DNA; 17
µl H2O; 20 µl of a gapped vector/ control plasmid mix [40ng+2ng]) were added and the tubes
were vortexed for 1 min. Following incubation at 42° for 1 h, cells were pelleted, resuspended in
550 µl of sterile water and vortexed for 1 min. 100-µl aliquots were plated on SC-his plates to
11
select recombinants and on SC-leu plates to determine transformation efficiency. For each
experiment, four replicates of each transformation were performed and each experiment was
repeated at least once. Colonies were counted after 3 days of growth on the selective media and
gap-repair frequency was calculated as the ratio of His+ transformants to Leu+ transformants.
The proportions of NCOs and COs among the gap repair events in each strain were
determined by directly patching approximately 50 His+ transformants from each of at least 5
independent transformations onto YEPD. Patches were replica plated to 5-FOA medium and
those with full growth after 2 days were scored as NCO events; patches with no growth or only a
few papillae were scored as CO events. Random genomic DNAs were analyzed by PCR to
confirm the accuracy of the NCO-CO assignment.
12
Results
A gap-repair system for assaying homologous and homeologous recombination: The
goal of the current study was to determine whether sequence divergence has similar inhibitory
effects on mitotic crossover (CO) and noncrossover (NCO) events, and if so, to identify the gene
products involved in this regulation. Because our earlier studies demonstrated that a single
potential mismatch is sufficient to trigger the mitotic anti-recombination activity of the yeast
mismatch repair (MMR) system (DATTA et al. 1997), it was essential to use 100%-identical
sequences as a control against which to gauge the effects of sequence divergence. Genetic
assays designed to simultaneously detect both NCO and CO events typically rely on the transfer
of wild-type (WT) sequence to correct an auxotrophic allele, thereby precluding absolute identity
between the interacting sequences. Such identity was achieved in the current study by using a
transformation-based, gap-repair assay in which the template for the gap-filling reaction is a
truncated, but otherwise WT, allele. Recombination between the two mutant alleles extrachromosomal gapped and chromosomal truncated - produces a selectable, WT allele on the
plasmid. If the gapped plasmid is furthermore capable either of autonomous replication or of
integrating into the genome, it is straightforward to distinguish NCO from CO events,
respectively (ORR-WEAVER and SZOSTAK 1983).
The HIS3 gene was used as the basis for developing the gap-repair assay, and was placed
on a vector containing the URA3 gene and an origin of replication (ARS), but no centromeric
(CEN) sequence (Figure 1). This plasmid was then used as a PCR template to generate a linear
(gapped) transformation fragment (see Material and Methods). To obtain an identical
(“homologous”) repair template, a mutant his3 allele missing the C-terminal 11 amino acids
13
(his3-0,∆3′) was inserted into the CAN1 locus of a haploid strain containing a deletion of the
endogenous HIS3 coding sequence. To obtain a 98%-identical (“homeologous”) repair template,
18 silent mutations were engineered into the coding sequence of the truncated his3 allele (his318,∆3′). The his3-0,∆3′ and his3-18,∆3′ strains (or appropriate mutant derivatives) were then
transformed in parallel using the PCR-generated fragment. Variations in transformation
efficiencies in different genetic backgrounds (BARTSCH et al. 2000; HAGHNAZARI and HEYER
2004) were corrected for by mixing an intact LEU2/ARS/CEN plasmid (pRS315; SIKORSKI and
HIETER 1989) with the linear fragment prior to transformation. His+ and Leu+ transformants
were selected separately, and the efficiency of gap repair was calculated as the ratio of His+ to
Leu+ transformants. The stability of the URA3 marker on the repaired plasmid was then assessed
by transferring His+ transformants to medium containing 5-FOA. A stable Ura+ phenotype is
diagnostic of a chromosomal URA3 gene and hence plasmid integration at the CAN1 locus (CO
event), whereas an unstable Ura+ phenotype is conferred when the URA3 gene is on an
autonomous plasmid (NCO event). The primary data obtained following the transformation of
WT, msh2, msh3, msh6, mlh1, pms1, rad1, srs2 or sgs1 strains containing either the his3-0,∆3′ or
his3-18,∆3′ allele are presented in Table 1.
Genetic control of homologous gap repair: Comparison of the gap-repair efficiency in
WT versus mutant strains containing the chromosomal his3-0,∆3′ allele allows one to ascertain
the general effects of the corresponding gene products on homologous gap repair (HGR). These
results are presented in Figure 2, where the efficiency of gap repair in each mutant background
was normalized to that obtained in the WT strain (i.e., the His+/Leu+ ratio of the WT strain was
set to 1.0). The levels of NCO versus CO events in each background were calculated by
14
multiplying the relative gap-repair efficiency by the percentage of unstable versus stable
transformants, respectively. In the WT strain, the repaired plasmid was integrated into the yeast
genome in about half of the His+ transformants (47% NCOs and 53% COs).
In terms of their effects on the total efficiency of gap repair between identical substrates,
the MMR proteins fell into two distinct groups. The efficiency was not detectably altered in the
msh6, pms1 or mlh1 background, but there was an approximately 2-fold decrease in an msh2 or
msh3 mutant. In the case of Msh3, its loss had no effect on the frequency of NCOs, but reduced
CO events 4-fold; Msh2 loss was associated with approximately 2-fold decreases in both NCO
and CO events. The NCO-CO distribution in the msh2 mutant was significantly different from
that in the msh3 mutant (P<0.001). Given that the only known function for Msh3 is as part of the
MutSβ complex with Msh2, it was surprising that msh2 and msh3 mutants did not exhibit similar
levels of NCO and CO events between identical repeats. It is possible that either Msh2 alone or
the Msh2-Msh6 complex, which might be more abundant in the absence of Msh3 (DRUMMOND
et al. 1997), has subtle effects on recombination.
The role of MutSβ during gap repair most likely reflects an accessory role during the
Rad1-Rad10 dependent processing of branched recombination intermediates (see SURTEES and
ALANI 2006). The Rad1-Rad10 complex is best known for its essential function during the
incision step of nucleotide excision repair, where it nicks at the junction of single- and doublestranded DNA (PRAKASH and PRAKASH 2000). During recombination, Rad1-Rad10 removes
nonhomologous 3′ tails from recombination intermediates (FISHMAN-LOBELL and HABER 1992),
stimulates deletion events between direct repeats (SAPARBAEV et al. 1996), facilitates “ends-in”
plasmid-chromosome CO events (SCHIESTL and PRAKASH 1988; SYMINGTON et al. 2000) and
increases the efficiency of “ends-out” targeted gene replacement (LANGSTON and SYMINGTON
15
2005). Consistent with previous results, a rad1 mutant exhibited a specific, 16-fold decrease in
COs in our gap-repair assay, which translated into a 2-fold reduction in the total gap-repair
efficiency. The requirement of Rad1, and by inference the Rad1-Rad10 complex, for >90% of
COs associated with gap repair suggests a key role for this protein in the formation of Holliday
junction-containing intermediates (see Discussion).
In addition to analyzing the roles of the MutSα, MutSβ, MutLα and Rad1-Rad10
complexes in gap repair, we also examined the effects of the Srs2 and Sgs1 helicases. While
mutants defective in either helicase exhibit a spontaneous hyper-recombination phenotype (see
FABRE et al. 2002), srs2 mutants exhibit a hypo-rec phenotype when recombination is initiated
with a DSB (AYLON et al. 2003; IRA et al. 2003). With regard to both spontaneous and DSBinitiated recombination, loss of either Srs2 or Sgs1 shifts the distribution of recombinants
towards more CO events (IRA et al. 2003; ROBERT et al. 2006). In the gap-repair assay there was
a 2-fold decrease in the overall transformation efficiency in an srs2 background, and a subtle,
25% decrease in an sgs1 mutant. While both NCO and CO events were reduced in the srs2
mutant, there was a greater reduction in NCO than in CO recombinants (3-fold and 1.7-fold,
respectively), resulting in a 2-fold bias for CO events. In the sgs1 mutant, there was a much
more striking shift in the distribution of CO relative to NCO events, with almost 90% of the gaprepaired plasmids integrating into the genome. This strong CO bias can be attributed to a 5-fold
reduction in NCOs, some of which may have been converted into CO events.
Effects of sequence divergence on gap repair in a WT background: The effects of
2% sequence divergence on gap repair in a WT background are presented in Figure 3. The
homeologous gap-repair (HeGR) efficiency was reduced 2.4-fold relative to that between
16
homologous sequences. Whereas the HGR events were evenly distributed between NCO and
CO events, only 17% of the HeGR events were of the CO type. This translates into a 7.3-fold
reduction in homeologous relative to homologous CO events, but only a 1.4-fold reduction in
NCO events. Thus, at least in the gap-repair assay used here, low levels of sequence divergence
have a strong inhibitory effect only on the maturation of recombination intermediates into CO
products. The observation that the reduction of homeologous COs was not accompanied by a
compensatory gain in NCOs suggests that not all repair events can be simply diverted from a CO
to a NCO pathway.
Regulation of homeologous gap repair: The roles of individual proteins in regulating
the fidelity of recombination, and thereby reducing interactions between diverged sequences,
were examined by transforming the gapped plasmid into an msh2, msh3, msh6, mlh1, pms1,
rad1, srs2 or sgs1 strain. To correct for nonspecific effects of a given protein on the
recombination process (e.g., its loss conferring a general hyper-rec phenotype or altering the CONCO distribution) the ratio of total HeGR to HGR was calculated in each strain background, as
well as the ratio for NCO and CO events (Figure 4). The smaller the HeGR/HGR ratio, the
greater the inhibitory effect of sequence divergence on the recombination process being
examined; a ratio of 1.0 indicates equivalent efficiencies of homologous and homeologous
recombination. For the WT strain, the baseline HeGR/HGR ratios were 0.41, 0.73 and 0.13 for
total, NCO and CO events, respectively. Relative to these baseline WT values, an increase in the
HeGR/HGR ratio in a given mutant background indicates a relaxation of homology requirements
and, therefore, a role of the corresponding protein in enforcing recombination fidelity.
17
All of the potential mismatches generated during repair of the gapped plasmid are basebase mismatches, and hence should primarily be detected by the MutSα complex. In accord with
this prediction, the total or CO HeGR/HGR ratios changed little, if any, in an msh3 mutant, but
increased to approximately 1.0 in an msh6 or mlh1 mutant. The absence of an effect of sequence
divergence on gap repair in the msh6 or mlh1 mutant is consistent with anti-recombination
activity being derived solely from the MMR machinery. In contrast to the msh6 and mlh1
mutants, the total HeGR/HGR ratio increased to 0.69 and the CO ratio to only 0.38 in an msh2
mutant; the transformation data in Table 1 indicate that these ratios indeed reflect a persistent
reduction of homeologous recombination in the absence of Msh2. We suggest that this might
reflect the role of MutSβ in stabilizing the substrate of the Rad1-Rad10 endonuclease, a role that
could become more important when the interacting sequences are not identical. Finally, it should
be noted that the HeGR/HGR ratio in the pms1 mutant was only 0.77; the data in Table 1 again
suggest a persistent inhibition of homeologous gap repair when Pms1 is absent but not when
Mlh1 is absent. One possibility is that in the absence of Pms1, Mlh1 might partner with either
Mlh2 or Mlh3 (WANG et al. 1999) to carry out a low level of anti-recombination.
In the HGR assay, loss of Rad1 was associated with a strong reduction in the proportion
of CO events, while loss of Sgs1 or Srs2 elevated the proportion of COs (Table 1 and Figure 2).
Additional roles for these proteins in the regulation of recombination fidelity should be revealed
as an increase in the HeGR/HGR ratio for CO events in the appropriate mutant strains. Loss of
either Sgs1 or Srs2 was associated with an increase in the HeGR/HGR ratio; there was a 3.3-fold
increase in the CO ratio in the sgs1 mutant, and a smaller, 1.9-fold increase in the srs2 mutant.
A mismatch-related anti-recombination role for Sgs1 has been previously observed in both
spontaneous and DSB-induced recombination assays (MYUNG et al. 2001; SPELL and JINKS-
18
ROBERTSON 2004; SUGAWARA et al. 2004), but this is the first indication that there may be a
similar activity associated with Srs2. In a rad1 background, there was no obvious change in the
HeGR/HGR ratio, although an effect would have been difficult to detect given the very strong
dependence of COs on the presence of Rad1. We note that this is in contrast to the clear role for
the Rad1-Rad10 complex in limiting recombination between diverged, chromosomal invertedrepeat substrates (NICHOLSON et al. 2000).
19
Discussion
The genetic regulation of mitotic recombination fidelity was examined by transforming a
gapped plasmid into strains containing either a 100%-identical “homologous” or a 98%-identical
“homeologous” chromosomal repair template. A key feature of the gap-repair system used here
is that it allows a distinction to be made between NCO and CO events; this was not possible with
the inverted-repeat (IR) assay we previously used (CHEN and JINKS-ROBERTSON 1998). An
additional advantage of a gap-repair system is that both the position and nature of the initiating
lesion are known, whereas the IR assay only detects randomly-initiated events. The major
results obtained using the gap-repair assay and discussed further below are that (1) the Rad1Rad10 endonuclease strongly promotes CO events, (2) sequence divergence affects CO much
more than NCO events, (3) the negative effect of sequence divergence on recombination requires
MutS- and MutL-like complexes to similar extents, and (4) the Sgs1 and Srs2 helicases have
roles in enforcing recombination identity requirements as well as in regulating the CO-NCO
outcome.
In discussing the implications of results reported here, it is important to consider them in
the context of current models of DSB repair (for a review, see KROGH and SYMINGTON 2004).
As shown in Figure 5, the ends of a broken or gapped molecule are first resected to produce 3′
single-stranded tails that are incorporated into Rad51 nucleoprotein filaments. Following the
invasion of a homologous duplex by a nucleoprotein filament and displacement of a D-loop, the
invading 3′ end is used to prime new DNA synthesis (step A). When DNA synthesis proceeds
past the other side of the DSB/gap, the unengaged 3′ end can be “captured” by annealing to the
displaced D-loop, generating an intermediate with a double Holliday junction (HJ; step B).
20
Double HJs are a key element of the classic DSB repair model of recombination (SZOSTAK et al.
1983), and their mode of resolution can generate either a CO or NCO product (steps D-E).
Enzymatic cleavage of both junctions in the same direction (both horizontally or both vertically)
produces NCOs (step D), while cleavage in different directions (one junction horizontally and
the other vertically) produces COs (step E). Instead of HJ resolution by direct cleavage, the two
junctions can migrate towards each other, with the resulting hemicatenated molecules being
resolved by topoisomerase activity (step F). This latter mode of resolution yields only NCO
products and is thought to require the Sgs1 helicase and Top3 in yeast (IRA et al. 2003). While
capture of the unengaged end by an intact D-loop leads to formation of a double HJ, cleavage of
the D-loop at its base results in the formation of a single HJ (step C). A partial dependence of
COs on the Rad1 endonuclease in some assays suggests that such cleavage can facilitate D-loop
capture and/or HJ formation (SYMINGTON et al. 2000). As with a double HJ, the direction of
cleaving a single HJ determines the NCO or CO outcome; cleavage of the initially exchanged or
non-exchanged strands yields a NCO or CO product, respectively. The Sgs1 helicase might also
be expected to generate NCOs by reverse branch migration of a single HJ intermediate. In
contrast to the dissolution of double HJs, however, no accompanying topoisomerase activity
would be needed to resolve a single HJ. Finally, as an alternative to second-end capture and HJ
formation, collapse of the D-loop will free the extended 3′ end to pair with the unengaged,
single-stranded tail on the other side of the DSB/gap (step G). This latter type of recombination
is referred to as synthesis-dependent strand annealing (SDSA) and yields only NCO products
(PAQUES and HABER 1999). The observed temporal separation of NCO and CO events (ALLERS
and LICHTEN 2001; IRA et al. 2003) is consistent with an SDSA pathway that does not involve
HJ resolution. In yeast, SDSA appears to be enhanced by the Srs2 helicase (IRA et al. 2003),
21
which recently has been shown to dismantle Rad51-containing D-loops in vitro (DUPAIGNE et al.
2008). Although not applicable to the current gap-repair assay, single-strand annealing (SSA) is
a final DSB repair mechanism that specifically deletes the region between direct repeats and has
been used to examine the regulation of recombination fidelity (SUGAWARA et al. 2004).
Genetic control of gap repair between identical sequences: In a WT background with
identical substrates, approximately one-half of the repaired plasmids were integrated into the
yeast genome. Neither the gap-repair efficiency nor the distribution of NCO-CO products was
altered in msh6, mlh1 or pms1 mutants, indicating that the MutSα and MutLα complexes are not
involved in recombination between identical sequences. In contrast, there was a specific, 4-fold
decrease in CO events in an msh3 mutant, implicating MutSβ in the processing of recombination
intermediates. Plasmid integration was decreased even more (16-fold) in a rad1 strain,
consistent with MutSβ playing an accessory role by stabilizing the relevant Rad1-Rad10
substrate (SURTEES and ALANI 2006). The strong dependence of COs on Rad1 is consistent with
the suggestion that Rad1-Rad10 mediated D-loop cleavage promotes second-end capture to
stabilize an HJ intermediate (SYMINGTON et al. 2000). If this is the case, then most COs in this
system likely derive from a single rather than a double HJ intermediate. Although there appears
to be a consistent role of Rad1-Rad10 in promoting COs in plasmid-based DSB/gap repair assays
(BARTSCH et al. 2000; SCHIESTL and PRAKASH 1988), it should be noted that its effect during the
repair of an HO-induced chromosomal DSB has been variable (IRA et al. 2003; NICHOLSON et al.
2006). This variability could be related to the lengths of the homology that flank the DSB,
which would limit the extent and hence stability of heteroduplex intermediates. Finally, the
decrease in the total efficiency of gap repair in msh3 or rad1 mutants suggests either that the
22
Rad1-Rad10 complex plays a role in the alternative SDSA pathway as well or that some D-loop
intermediates are dead-end products. A possible role of Rad1-Rad10 in SDSA might be in the
removal of 3′ ends that have replicated past the region of plasmid-chromosome homology, an
activity that has also been attributed to the Mus81-Mms4 complex (DE LOS SANTOS et al. 2001;
FABRE et al. 2002).
In spontaneous recombination assays, elimination of either Sgs1 or Srs2 results in a
hyper-rec phenotype. Sgs1 is thought to reduce the accumulation of recombination-initiating
lesions (FABRE et al. 2002) while Srs2 is thought to antagonize the formation of Rad51
nucleoprotein filaments (KREJCI et al. 2003; VEAUTE et al. 2003). If the primary inhibitory role
of Srs2 derives from its ability to strip Rad51 from nucleoprotein filaments before the initial
strand invasion occurs, then it is not clear why this negative role should be limited only to
spontaneously-initiated events. An interesting possibility is that Srs2 efficiently disrupts
filaments formed within single-stranded gaps, which may initiate most spontaneous
recombination (LETTIER et al. 2006), but is relatively inefficient at removing Rad51 from the free
3′ tails formed at the ends of DSBs. This would be consistent with Srs2 “channeling” damagecontaining gaps into a post-replication repair pathway (error-prone translesion DNA synthesis or
error-free template switching) rather than into the Rad51-dependent homologous recombination
pathway (reviewed by WU and HICKSON 2006). In the case of a DSB, neither template switching
nor gap filling by the translesion synthesis pathway would be a viable repair option.
The provision of initiating DSBs has revealed additional, recombination-promoting roles
of Sgs1 and Srs2, with the corresponding mutant strains exhibiting reduced repair of
chromosomal DSBs (AYLON et al. 2003; IRA et al. 2003). Consistent with these results, we
observed 50% or 25% reductions in total gap-repair efficiency in an srs2 or sgs1 background,
23
respectively. In the case of the srs2 mutant, the reduction in total gap repair may reflect the
requirement of Srs2 for efficient recovery from checkpoint-mediated cell-cycle arrest following
successful DSB repair (VAZE et al. 2002). A final phenotype of sgs1 or srs2 mutants is an
increased mitotic CO/NCO ratio for both spontaneous (ROBERT et al. 2006) and HO-initiated
events (IRA et al. 2003; LO et al. 2006). A similar effect was evident in our gap-repair system,
where the CO/NCO ratio was 1.1, 6.7 and 2.0 in WT, sgs1 and srs2 strains, respectively (Table
1). It has been suggested that the elevated CO/NCO ratio in srs2 mutants reflects a less efficient
dismantling of D-loops (DUPAIGNE et al. 2008), and hence loss of the NCO-specific SDSA
pathway (Figure 5; IRA et al. 2003). The reduction in total gap repair in an srs2 mutant further
suggests that the SDSA pathway is not completely interchangeable with the HJ pathways; that is,
not all of the persistent D-loops necessarily lead to the formation of HJs. Finally, the occurrence
of more COs than NCOs in the srs2 mutant, where the non-SDSA pathways dominate, implies
that the cleavage of HJs does not occur randomly, but rather in manner that favors COs.
As an explanation for the elevated CO/NCO ratio in sgs1 mutants, it has been suggested
that Sgs1 promotes a topoisomerase-mediated mode of dHJ resolution that yields only NCOs
(WU and HICKSON 2003); in its absence the only option would be the enzymatic cleavage of both
HJs (see IRA et al. 2003). Because COs in the current gap-repair assay are strongly Rad1dependent, we assume that most are generated through a single HJ intermediate. The loss of
80% of the NCO events in the sgs1 mutant implies that Sgs1 might also dismantle single HJs and
that, at least in our system, the major route of generating NCOs may be via an HJ-containing
pathway rather than the SDSA pathway. Furthermore, the very high CO/NCO ratio in the sgs1
mutant again indicates that HJ cleavage in this system generates predominantly CO products.
Although there may be subtle differences, the roles of Srs2 and Sgs1 in our gap-repair assay are
24
generally consistent with those inferred previously (IRA et al. 2003), providing additional support
that transformation-associated gap repair accurately mimics the repair of chromosomal DSBs in
yeast.
Sequence divergence differentially affects CO and NCO events: One of the most
striking findings in the current study is that sequence divergence impedes CO events to a much
greater extent than NCO events. In the gap-repair system used here, 2% sequence divergence
reduced CO events approximately 7-fold, but NCOs less than 2-fold. This difference is easiest to
reconcile if sequence divergence exerts its primary effect subsequent to the initial strand invasion
step that is common to all pathways in Figure 5; otherwise, one would expect CO and NCO
events to be similarly affected. It is possible, for example, that mismatches are detected and
trigger anti-recombination only after extension of the invading 3′ end has been initiated. As long
as the end extends far enough to pair with the single-stranded tail on the other side of the
DSB/gap (a 60 bp gap in the assay used here), SDSA would not be affected. An alternative
explanation is that HJ formation (i.e., second-end capture) requires more extensive heteroduplex
formation than does SDSA, in which case CO intermediates would contain more of the
mismatches that inhibit recombination. Finally, potential mismatches may not differentially
affect the SDSA and HJ pathways, but rather may alter the mode of HJ resolution, specifically
biasing the outcome towards more NCO events. The presence of mismatches could either favor
the noncrossover mode of HJ cleavage, or could promote the dissolution of HJs by Sgs1. In
terms of biological significance, the differential control of NCO and CO events would have the
net effect of allowing a nonidentical sequence to be used as a repair template for a broken
25
chromosome, while at the same time limiting potentially deleterious rearrangements due to
interactions between dispersed repeats.
The differential effect of sequence divergence on CO and NCO events has not been
previously reported, and there are several reasons why an effect may not have been evident.
First, some assays are capable of detecting only NCO or only CO events (e.g., NICHOLSON et al.
2006), which obviously precludes the detection of differential effects. Second, there may be
inherent differences in the mismatch sensitivity of spontaneously-initiated versus DSB-induced
recombination (see below). Third, it is possible that a differential effect is evident only when
heteroduplex extension is limited by the lengths of the interacting sequences, as in the gap-repair
assay used here, or when there is some critical level of divergence between the interacting
sequences. Finally, the detection of a differential effect requires that one be able to directly
compare homologous and homeologous recombination. In virtually all other assays, the
“homologous” control substrates contain one or more potential mismatches. Exceptions include
our previous studies using IR substrates, where CO and NCO cannot be distinguished (CHEN and
JINKS-ROBERTSON 1998) and the HO-initiated system of Nicholson et al. (2006), which only
detects COs.
In our earlier studies using 350 bp chromosomal IR substrates, recombination was
exquisitely sensitive to potential mismatches, with a level of sequence divergence comparable to
that used here (2%) reducing recombination approximately 50-fold (DATTA et al. 1997). We
suggest that this reflects either a basic difference in plasmid-chromosome versus chromosomechromosome recombination (e.g., recombination may occur before the plasmid DNA becomes
organized into chromatin), a difference in the initiating event (single-strand gap versus DSB) or a
cell cycle-related timing issue (NICHOLSON et al. 2006).
26
The MMR system regulates recombination fidelity during gap repair: In the current
gap-repair assay, the CO events were not inhibited by sequence homeology in msh6 or mlh1
mutants. These data indicate that, as in other types of recombination assays (DATTA et al. 1997;
SELVA et al. 1995; SUGAWARA et al. 2004), the regulation of recombination fidelity derives
primarily from activity of the MMR system. In contrast to assays used previously, however,
where anti-recombination was only partially dependent on MutLα (CHEN and JINKS-ROBERTSON
1999; NICHOLSON et al. 2000; SPELL and JINKS-ROBERTSON 2003; SUGAWARA et al. 2004), the
contributions of MutS and MutL homologs appear to be equivalent in the gap-repair system. The
variable requirement for MutLα during mismatch-triggered anti-recombination could reflect
basic differences in the underlying recombination process and/or anti-recombination mechanism.
There are, in principle, several distinct steps at which the MMR system could exert antirecombination activity (reviewed by SURTEES et al. 2004). Mismatch detection could block or
retard strand exchange, it could interfere with branch migration that extends heteroduplex DNA,
or it could decrease the stability of recombination intermediates (e.g., trigger reverse branch
migration).
The roles of the Sgs1 and Srs2 helicases in the fidelity of gap repair: In vitro data
suggest that the primary recombination-related role of the Srs2 helicase is to dismantle Rad51
nucleoprotein filaments (KREJCI et al. 2003; VEAUTE et al. 2003) or D-loops (DUPAIGNE et al.
2008), while that of the Sgs1 is in the dissolution of Holliday junctions (see IRA et al. 2003). An
in vivo relevance of the Sgs1-mediated branch migration has been recently questioned, however,
as the helicase activity of Sgs1 does not appear to be required for the mitotic CO-NCO decision
27
in yeast (LO et al. 2006). As in previous studies using either IR substrates (MYUNG et al. 2001;
SPELL and JINKS-ROBERTSON 2004) or an HO-initiated SSA assay (SUGAWARA et al. 2004), we
observed a role for Sgs1 in limiting gap repair between diverged substrates. As in the IR assay,
the Sgs1 requirement during gap repair was only partial. Although the CO-specific effect of
sequence divergence in the gap-repair assay would be consistent with the HJs being the primary
target for Sgs1-mediated anti-recombination, HJs are not an intermediate in SSA, where the antirecombination activities of MMR proteins and Sgs1 appear to be equivalent (SUGAWARA et al.
2004). One possibility is that mismatch-containing annealed strands are the relevant target for
Sgs1; strand annealing not only generates the key intermediate in the SSA pathway, but also is
relevant to second-end interactions during both SDSA and HJ formation. The requirement for
the helicase activity of Sgs1 in the regulation of recombination fidelity (SPELL and JINKSROBERTSON 2004), but not necessarily in HJ resolution (LO et al. 2006), also would be consistent
with a non-HJ intermediate being the primary target of the mismatch-related Sgs1 antirecombination activity.
Unexpectedly, the HeGR/HGR ratio for CO events was elevated in an srs2 mutant,
suggesting that there may be an MMR-related role for Srs2 in modulating the fidelity of
recombination in the gap-repair system. This is in contrast to the IR and SSA systems, where
elimination of Srs2 did not differentially affect homologous and homeologous recombination
(SPELL and JINKS-ROBERTSON 2004; SUGAWARA et al. 2004). While the mismatch-related antirecombination activity of Sgs1 could result from interaction with Msh6 and/or Mlh1 (PEDRAZZI
et al. 2003; PEDRAZZI et al. 2001), no interactions of Srs2 with MMR proteins have been
reported. One possibility is that the presence of MMR proteins retards the formation and/or
28
extension of the initial Rad51-dependent strand-invasion intermediate (WORTH et al. 1994),
thereby making it a more efficient target for dismantling by Srs2.
Advantages and limitations of a gap-repair assay: Results obtained using gap-repair
assays indicate that these assays faithfully recapitulate the repair of HO-induced chromosomal
DSBs. A basic question that has yet to be fully resolved, however, is whether spontaneous
mitotic recombination typically initiates with a DSB or with a single-strand nick/gap, although
recent data support the latter (LETTIER et al. 2006). The distinct fidelity differences observed
with our IR system, where most events appear to involve sister chromatids (CHEN and JINKSROBERTSON 1998), versus the gap-repair assay would be consistent with spontaneous
recombination being primarily a gap-filling process. Regardless of the lesion that normally
initiates mitotic recombination, however, it is clear that meiotic recombination initiates with
Spo11-generated DSBs (PAQUES and HABER 1999). It is possible that mitotic DSB/gap repair
systems more accurately reflect meiotic than mitotic mechanisms of recombination.
The experiments reported here have demonstrated that sequence divergence inhibits
mitotic COs to a greater extent than NCOs. Examination of the associated gene conversion tracts
may reveal why the former are more sensitive to potential mismatches. In addition, the
sequencing of recombinants derived from the transformation of MMR-defective cells, in which
heteroduplex intermediates persist, may provide an unprecedented view of DSB-repair
intermediates and how specific proteins alter recombination mechanisms. Specifically, each of
the pathways depicted in Figure 5 predicts different positions of heteroduplex DNA (hDNA).
With SDSA, hDNA should only be present on the plasmid and only on one side of the original
gap; with HJ cleavage, there should be hDNA on both sides of the gap, with a single hDNA tract
29
associated with each his3 allele; and with Sgs1-mediated HJ dissolution, there again should be
hDNA on both sides of the gap, but all hDNA should be associated with the plasmid-encoded
HIS3 allele. Finally, the production of a gapped plasmid by PCR will allow the position and/or
size of the initiating gap to be systematically varied by simply changing the positions of the PCR
primers. The position of the gap within the region of homology and/or its size could affect the
overall repair efficiency, the CO-NCO decision, or MMR-directed anti-recombination.
30
Acknowledgements
We are grateful to Tom Petes, Lucas Arguesa and members of the SJR lab for helpful
discussions and comments on the manuscript. This work was supported by grant GM038464
from the National Institutes of Health .
31
Literature cited
AHN, B.-Y., K. J. DORNFELD, T. J. FAGRELIUS and D. M. LIVINGSTON, 1988 Effect of limited
homology on gene conversion in a Saccharomyces cerevisiae plasmid recombination
system. Mol. Cell. Biol. 8: 2442-2448.
ALLERS, T., and M. LICHTEN, 2001 Differential timing and control of noncrossover and
crossover recombination during meiosis. Cell 106: 47-57.
AYLON, Y., B. LIEFSHITZ, G. BITAN-BANIN and M. KUPIEC, 2003 Molecular dissection of mitotic
recombination in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 23: 1403-1417.
BARTSCH, S., L. E. KANG and L. S. SYMINGTON, 2000 RAD51 is required for the repair of
plasmid double-stranded DNA gaps from either plasmid or chromosomal templates. Mol.
Cell. Biol. 20: 1194-1205.
CHEN, W., and S. JINKS-ROBERTSON, 1998 Mismatch repair proteins regulate heteroduplex
formation during mitotic recombination in yeast. Mol. Cell. Biol. 18: 6525-6537.
CHEN, W., and S. JINKS-ROBERTSON, 1999 The role of the mismatch repair machinery in
regulating mitotic and meiotic recombination between diverged sequences in yeast.
Genetics 151: 1299-1313.
DATTA, A., A. ADJIRI, L. NEW, G. F. CROUSE and S. JINKS-ROBERTSON, 1996 Mitotic crossovers
between diverged sequences are regulated by mismatch repair proteins in Saccharomyces
cerevisiae. Mol. Cell. Biol. 16: 1085-1093.
DATTA, A., M. HENDRIX, M. LIPSITCH and S. JINKS-ROBERTSON, 1997 Dual roles for DNA
sequence identity and the mismatch repair system in the regulation of mitotic crossingover in yeast. Proc. Natl. Acad. Sci. USA 94: 9757-9762.
32
DE LOS SANTOS,
T., J. LOIDL, B. LARKIN and N. M. HOLLINGSWORTH, 2001 A role for MMS4 in
the processing of recombination intermediates during meiosis in Saccharomyces
cerevisiae. Genetics 159: 1511-1125.
DRUMMOND, J. T., J. GENSCHEL, E. WOLF and P. MODRICH, 1997 DHFR/MSH3 amplification in
methotrexate-resistant cells alters the hMutSα/hMutSβ ratio and reduces the efficiency of
base-base mismatch repair. Proc. Natl. Acad. Sci. USA 94: 10144-10149.
DUPAIGNE, P., C. LE BRETON, F. FABRE, S. GANGLOFF, E. LE CAM et al., 2008 The Srs2 helicase
activity is stimulated by Rad51 filaments on dsDNA: Implications for crossover
incidence during mitotic recombination. Mol. Cell 29: 243-254.
EARLEY, M. C., and G. F. CROUSE, 1998 The role of mismatch repair in the prevention of base
pair mutations in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 95: 1548715491.
FABRE, F., A. CHAN, W. D. HEYER and S. GANGLOFF, 2002 Alternate pathways involving
Sgs1/Top3, Mus81/ Mms4, and Srs2 prevent formation of toxic recombination
intermediates from single-stranded gaps created by DNA replication. Proc. Natl. Acad.
Sci. USA 99: 16887-16892.
FISHMAN-LOBELL, J., and J. E. HABER, 1992 Removal of nonhomologous DNA ends in doublestrand break recombination: The role of the yeast ultraviolet repair gene RAD1. Science
258: 480-484.
GIETZ, R. D., and R. A. WOODS, 2002 Transformation of yeast by lithium acetate/single-stranded
carrier DNA/polyethylene glycol method. Methods Enzymol. 350: 87-96.
33
HAGHNAZARI, E., and W. D. HEYER, 2004 The DNA damage checkpoint pathways exert
multiple controls on the efficiency and outcome of the repair of a double-stranded DNA
gap. Nucleic Acids Res. 32: 4257-4268.
HARFE, B. D., and S. JINKS-ROBERTSON, 2000 DNA mismatch repair and genetic instability.
Ann. Rev. Genet. 34: 359-399.
HAYDEN, M. S., and B. BYERS, 1992 Minimal extent of homology required for completion of
meiotic recombination in Saccharomyces cerevisiae. Develop. Genet. 13: 498-514.
HIGGINS, D., S. PRAKASH, P. REYNOLDS, R. POLAKOWSKA, S. WEBER et al., 1983 Isolation and
characterization of the RAD3 gene of Saccharomyces cerevisiae and inviability of rad3
deletion mutants. Proc. Natl. Acad. Sci. USA 80: 5680-5684.
INBAR, O., B. LIEFSHITZ, G. BITAN and M. KUPIEC, 2000 The relationship between homology
length and crossing over during the repair of a broken chromosome. J. Biol. Chem. 275:
30833-30838.
IRA, G., A. MALKOVA, G. LIBERI, M. FOIANI and J. E. HABER, 2003 Srs2 and Sgs1-Top3
suppress crossovers during double-strand break repair in yeast. Cell 115: 401-411.
JINKS-ROBERTSON, S., M. MICHELITCH and S. RAMCHARAN, 1993 Substrate length requirements
for efficient mitotic recombination in Saccharomyces cerevisiae. Mol. Cell. Biol. 13:
3937-3950.
JOHNSON, R. E., G. K. KOVVALI, S. N. GUZDER, N. S. AMIN, C. HOLM et al., 1996 Evidence for
involvement of yeast proliferating cell nuclear antigen in DNA mismatch repair. J. Biol.
Chem. 271: 27987-27990.
KIRKPATRICK, D. T., and T. D. PETES, 1997 Repair of DNA loops involves DNA-mismatch and
nucleotide-excision repair proteins. Nature 387: 929-931.
34
KRAMER, W., B. FARTMANN and E. C. RINGBECK, 1996 Transcription of mutS and mutLhomologous genes in Saccharomyces cerevisiae during the cell cycle. Mol. Gen. Genet.
252: 275-283.
KRAMER, W., B. KRAMER, M. S. WILLIAMSON and S. FOGEL, 1989 Cloning and nucleotide
sequence of DNA mismatch repair gene PMS1 from Saccharomyces cerevisiae:
Homology of PMS1 to procaryotic MutL and HexB. J. Bacteriol. 171: 5339-5346.
KREJCI, L., S. VAN KOMEN, Y. LI, J. VILLEMAIN, M. S. REDDY et al., 2003 DNA helicase Srs2
disrupts the Rad51 presynaptic filament. Nature 423: 305-309.
KROGH, B. O., and L. S. SYMINGTON, 2004 Recombination proteins in yeast. Annu. Rev. Genet.
38: 233-271.
KUNKEL, T. A., and D. A. ERIE, 2005 DNA mismatch repair. Annu. Rev. Biochem. 74: 681-710.
LANGSTON, L. D., and L. S. SYMINGTON, 2005 Opposing roles for DNA structure-specific
proteins Rad1, Msh2, Msh3, and Sgs1 in yeast gene targeting. EMBO J. 24: 2214-2223.
LETTIER, G., Q. FENG, A. A. DE MAYOLO, N. ERDENIZ, R. J. REID et al., 2006 The role of DNA
double-strand breaks in spontaneous homologous recombination in S. cerevisiae. PLoS
Genet. 2: 1773-1786.
LO, Y. C., K. S. PAFFETT, O. AMIT, J. A. CLIKEMAN, R. STERK et al., 2006 Sgs1 regulates gene
conversion tract lengths and crossovers independently of its helicase activity. Mol. Cell.
Biol. 26: 4086-4094.
MYUNG, K., A. DATTA, C. CHEN and R. D. KOLODNER, 2001 SGS1, the Saccharomyces
cerevisiae homologue of BLM and WRN, suppresses genome instability and
homeologous recombination. Nature Genet. 27: 1-4.
35
NICHOLSON, A., R. M. FABBRI, J. W. REEVES and G. F. CROUSE, 2006 The effects of mismatch
repair and RAD1 genes on interchromosomal crossover recombination in Saccharomyces
cerevisiae. Genetics 173: 647-659.
NICHOLSON, A., M. HENDRIX, S. JINKS-ROBERTSON and G. F. CROUSE, 2000 Regulation of
mitotic homeologous recombination in yeast: functions of mismatch repair and nucleotide
excision repair genes. Genetics 154: 133-146.
ORR-WEAVER, T. L., and J. W. SZOSTAK, 1983 Yeast recombination: the association between
double-strand gap repair and crossing-over. Proc. Natl. Acad. Sci. USA 80: 4417-4421.
PAQUES, F., and J. E. HABER, 1999 Multiple pathways of recombination induced by doublestrand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63: 349-404.
PEDRAZZI, G., C. Z. BACHRATI, N. SELAK, I. STUDER, M. PETKOVIC et al., 2003 The Bloom's
syndrome helicase interacts directly with the human DNA mismatch repair protein
hMSH6. Biol. Chem. 384: 1155-1164.
PEDRAZZI, G., C. PERRERA, H. BLASER, P. KUSTER, G. MARRA et al., 2001 Direct association of
Bloom's syndrome gene product with the human mismatch repair protein MLH1. Nucleic
Acids Res. 29: 4378-4386.
PRAKASH, S., and L. PRAKASH, 2000 Nucleotide excision repair in yeast. Mutat. Res. 451: 13-24.
ROBERT, T., D. DERVINS, F. FABRE and S. GANGLOFF, 2006 Mrc1 and Srs2 are major actors in
the regulation of spontaneous crossover. EMBO J. 25: 2837-2846.
SAPARBAEV, M., L. PRAKASH and S. PRAKASH, 1996 Requirement of mismatch repair genes
MSH2 and MSH3 in RAD1-RAD10 pathway of mitotic recombination in Saccharomyces
cerevisiae. Genetics 142: 727-736.
36
SCHIESTL, R. H., and S. PRAKASH, 1988 RAD1, an excision repair gene of Saccharomyces
cerevisiae, is also involved in recombination. Mol. Cell. Biol. 8: 3619-3626.
SELVA, E. M., L. NEW, G. F. CROUSE and R. S. LAHUE, 1995 Mismatch correction acts as a
barrier to homeologous recombination in Saccharomyces cerevisiae. Genetics 139: 11751188.
SHERMAN, F., 1991 Getting started with yeast. Meth. Enzymol. 194: 3-20.
SIKORSKI, R. S., and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed
for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19-27.
SPELL, R. M., and S. JINKS-ROBERTSON, 2003 Role of mismatch repair in the fidelity of RAD51and RAD59-dependent recombination in Saccharomyces cerevisiae. Genetics 165: 17331744.
SPELL, R. M., and S. JINKS-ROBERTSON, 2004 Examination of the roles of the Sgs1 and Srs2
helicases in the enforcement of recombination fidelity in Saccharomyces cerevisiae.
Genetics 168: 1855-1865.
STONE, J., R. GEALY, T. PETES and S. JINKS-ROBERTSON, 2008 Role of PCNA interactions in the
mismatch repair-dependent processing of mitotic and meiotic recombination
intermediates in yeast. Genetics 178: 1221-1236.
SUGAWARA, N., T. GOLDFARB, B. STUDAMIRE, E. ALANI and J. E. HABER, 2004 Heteroduplex
rejection during single-strand annealing requires Sgs1 helicase and mismatch repair
proteins Msh2 and Msh6 but not Pms1. Proc. Natl. Acad. Sci. USA 101: 9315-9320.
SURTEES, J. A., and E. ALANI, 2006 Mismatch repair factor MSH2-MSH3 binds and alters the
conformation of branched DNA structures predicted to form during genetic
recombination. J. Mol. Biol. 360: 523-536.
37
SURTEES, J. A., J. L. ARGUESO and E. ALANI, 2004 Mismatch repair proteins: key regulators of
genetic recombination. Cytogenet. Genome Res. 107: 146-159.
SYMINGTON, L. S., L. E. KANG and S. MOREAU, 2000 Alteration of gene conversion tract length
and associated crossing over during plasmid gap repair in nuclease-deficient strains of
Saccharomyces cerevisiae. Nucleic Acids Res. 28: 4649-4656.
SZOSTAK, J. W., T. L. ORR-WEAVER, R. J. ROTHSTEIN and F. W. STAHL, 1983 The doublestrand-break repair model for recombination. Cell 33: 25-35.
TISHKOFF, D. X., A. L. BOERGER, P. BERTRAND, N. FILOSI, G. M. GAIDA et al., 1997
Identification and characterization of Saccharomyces cerevisiae EXO1, a gene encoding
an exonuclease that interacts with MSH2. Proc. Natl. Acad. Sci. USA 94: 7487-7492.
UMAR, A., A. B. BUERMEYER, J. A. SIMON, D. C. THOMAS, A. B. CLARK et al., 1996
Requirement for PCNA in DNA mismatch repair at a step preceding DNA resynthesis.
Cell 87: 65-73.
VAZE, M. B., A. PELLICIOLI, S. E. LEE, G. IRA, G. LIBERI et al., 2002 Recovery from checkpointmediated arrest after repair of a double-strand break requires Srs2 helicase. Mol. Cell 10:
373-385.
VEAUTE, X., J. JEUSSET, C. SOUSTELLE, S. C. KOWALCZYKOWSKI, E. LE CAM et al., 2003 The
Srs2 helicase prevents recombination by disrupting Rad51 nucleoprotein filaments.
Nature 423: 309-312.
WACH, A., A. BRACHAT, R. POHLMANN and P. PHILIPPSEN, 1994 New heterologous modules for
classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 17931808.
38
WANG, T.-F., N. KLECKNER and N. HUNTER, 1999 Functional specificity of MutL homologs in
yeast: evidence for three Mlh1-based heterocomplexes with distinct roles during meiosis
in recombination and mismatch correction. Proc. Natl. Acad. Sci. USA 96: 13914-13919.
WORTH, L. J., S. CLARK, M. RADMAN and P. MODRICH, 1994 Mismatch repair proteins MutS
and MutL inhibit RecA-catalyzed strand transfer between diverged DNAs. Proc. Natl.
Acad. Sci. USA 91: 3238-3241.
WU, L., and I. D. HICKSON, 2003 The Bloom's syndrome helicase suppresses crossing over
during homologous recombination. Nature 426: 870-874.
WU, L., and I. D. HICKSON, 2006 DNA helicases required for homologous recombination and
repair of damaged replication forks. Annu. Rev. Genet. 40: 279-306.
39
Figure Legends
Figure 1. The gap-repair assay. The lengths of homology that flank the gap on the 5´and 3´
sides are approximately 600 bp and 160 bp, respectively. See text for further explanation of the
system.
Figure 2. The genetic control of homologous gap repair. The total gap-repair efficiency using
an identical chromosomal template (the his3-0,∆3′ allele) in each strain background was
measured as the ratio of His+ to Leu+ transformants. These ratios were then normalized to that
obtained in the WT strain. The open and gray areas within each bar correspond to the NCO and
CO efficiencies, respectively, and were obtained by multiplying the total (normalized) efficiency
by the proportion of the relevant event. The standard deviation of the total efficiency in each
strain is indicated.
Figure 3. Homologous and homeologous gap repair (HGR and HeGR, respectively) in a WT
strain. Strains containing a homologous or homeologous repair template (the his3-0,∆3′ or his318,∆3′ allele, respectively) were transformed with the gapped plasmid and the total (NCO + CO)
repair efficiency was measured as the ratio of His+ to Leu+ colonies. These ratios were
normalized to that obtained with the homologous, 100%-identical substrates; the standard
deviations of the total efficiencies are indicated. NCO and CO efficiencies were obtained by
multiplying the total (normalized) efficiency by the proportion of the relevant event. Open and
gray bars correspond to HGR and HeGR efficiencies, respectively.
40
Figure 4. Effect of sequence divergence on gap repair in different genetic backgrounds. The
HeGR efficiency (His+/Leu+) ratio was normalized to the HGR efficiency obtained in the same
genetic background. The NCO and CO efficiencies were determined by multiplying the total
repair efficiency by the proportion of the relevant event and these efficiencies were used to
calculate the corresponding HeGR/HGR ratio. If sequence divergence has no effect on repair
efficiency, then HeGR/HGR = 1. An HeGR/HRG ratio < 1 indicates that sequence divergence
inhibits repair; the smaller the ratio, the greater the inhibition. The double arrowheads to the
right of each panel indicate the magnitude of the inhibition in the WT background.
Figure 5. Models for recombinational repair of a gapped plasmid using chromosomal DNA as a
template. Plasmid and chromosomal DNA are indicated as black and red lines, respectively.
Arrowheads represent 3′ ends, and dotted lines correspond to newly-synthesized DNA. The
colors of the dotted lines correspond to that of the template. Heteroduplex DNA forms adjacent
to the original gap and is depicted as paired black and red lines. Details of the models are given
in the text.
41
Table 1. Gap-repair efficiencies using 100%- versus 98%-identical chromosomal donor
sequences in different genetic backgrounds
+
+
Relevant
Substrate
Genotype
Identity
Frequency
proportion
SJR1500
WT
100%
1.6 ± 0.08
0.53 ± 0.031
1.1
SJR1501
WT
98%
0.66 ± 0.035
0.17 ± 0.016
0.20
SJR1476
msh2
100%
0.83 ± 0.045
0.44 ± 0.054
0.79
SJR1477
msh2
98%
0.57 ± 0.085
0.24 ± 0.032
0.32
SJR2054
msh3
100%
0.97 ± 0.052
0.21 ± 0.044
0.27
SJR2055
msh3
98%
0.53 ± 0.031
0.066 ± 0.020
0.075
SJR2047
msh6
100%
1.7 ± 0.11
0.55 ± 0.029
1.2
SJR2048
msh6
98%
1.6 ± 0.089
0.56 ± 0.042
1.3
SJR2156
mlh1
100%
1.6 ± 0.032
0.61 ± 0.034
1.6
SJR2157
mlh1
98%
1.6 ± 0.092
0.54 ± 0.059
1.2
SJR2147
pms1
100%
1.6 ± 0.11
0.55 ± 0.037
1.2
SJR2148
pms1
98%
1.2 ± 0.12
0.42 ± 0.019
0.72
SJR2111
rad1
100%
1.0 ± 0.044
0.052 ± 0.018
0.053
SJR2112
rad1
98%
0.49 ± 0.017
0.020 ± 0.024
0.020
SJR2122
sgs1
100%
1.2 ± 0.065
0.87 ± 0.023
6.7
SJR2163
sgs1
98%
0.60 ± 0.018
0.76 ± 0.089
3.2
SJR2123
srs2
100%
0.75 ± 0.013
0.67 ± 0.11
2.0
SJR2160
srs2
98%
0.32 ± 0.019
0.38 ± 0.064
0.61
His /Leu
CO
Strain
CO/NCO
42
The mean and standard deviation of the ratio of His+ to Leu+ transformants and of the proportion
of CO events obtained in independent transformations is indicated. NCO = noncrossover; CO =
crossover.
Figure 1
URA3/ARS
gapped HIS3
his3-0,∆3’ (homologous)
his3-18,∆3’ (homeologous)
Select His+ transformants
Noncrossover (NCO)
Unstable
Ura+
Crossover (CO)
Stable Ura+
0
Genotype
srs2
1
sgs1
rad1
pms1
mlh1
msh6
msh3
msh2
WT
Relative gap repair
Figure 2
1.2
NCO
CO
0.8
0.6
0.4
0.2
Total
Figure 3
Relative gap-repair efficiency
1.2
HGR100%
98%
HeGR
1
0.8
0.6
0.4
0.2
0
NCO+CO
NCO
Outcome
CO
0
Genotype
srs2
sgs1
rad1
pms1
mlh1
msh6
msh3
msh2
WT
HeGR/HGR CO
srs2
sgs1
rad1
pms1
mlh1
msh6
msh3
msh2
WT
HeGR/HGR NCO
srs2
sgs1
rad1
pms1
mlh1
msh6
msh3
msh2
WT
HeGR/HGR total
1.2
Figure 4
1
0.8
0.6
2.4X
0.4
0.2
0
1.2
1
0.8
1.4X
0.6
0.4
0.2
0
1.2
1
0.8
0.6
7.3X
0.4
0.2
gap
Figure 5
Plasmid
Chromosome
(∆3′ allele)
[A] Strand invasion and
3′-end extension
[G] D-loop dismantled
by Srs2 (SDSA model)
[B] 2nd end
[C] D-loop cleavage
capture
by Rad1-10
Double HJ
Single HJ
[D]
HJ cleavage
(single or double)
NCO
NCO
[F] HJ dissolution
[E]
by Sgs1
NCO
CO