Genetic Variants of Thiazide-Sensitive NaCl-Cotransporter
in Gitelman’s Syndrome and Primary Hypertension
Olle Melander, Marju Orho-Melander, Kristina Bengtsson, Ulf Lindblad, Lennart Råstam,
Leif Groop, U. Lennart Hulthén
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
Abstract—Gitelman’s syndrome is an autosomal recessive disorder characterized by electrolyte disturbances and low blood
pressure. The disease is caused by homozygous or compound heterozygous inactivating mutations in the thiazidesensitive NaCl-cotransporter gene leading to reduced renal sodium reabsorption. We report 4 patients with Gitelman’s
syndrome from southern Sweden, all in whom we identified compound heterozygous mutations in the thiazide-sensitive
NaCl-cotransporter gene (Gly439Ser, Gly731Arg, Gly741Arg, Thr304Pro, and 2745insAGCA), of which the latter 2
have not been described before. We hypothesized that such mutations in their heterozygous form protect against primary
hypertension in the general population and that the gene may also harbor activating mutations that increase the risk for
primary hypertension. Accordingly, the gene was screened for mutations in 20 patients with primary hypertension and
in 20 normotensive subjects by single-strand conformation polymorphism and direct DNA sequencing. The Arg904Gln,
Gly264Ala, and C1420T variants, found in the mutation screening of subjects without Gitelman’s syndrome, were
studied further. Population genotype frequencies were determined in 292 unrelated patients with primary hypertension
and 264 unrelated normotensive subjects from southern Sweden. Gln904 homozygotes were overrepresented in
hypertensive patients compared with normotensive subjects (5 of 292 versus 0 of 264; P⫽0.03). In conclusion, we
confirm that Gitelman’s syndrome is caused by mutations in the thiazide-sensitive NaCl-cotransporter gene. Our results
further suggest that subjects homozygous for the Gln904 variant have an increased risk for development of
primary hypertension. (Hypertension. 2000;36:389-394.)
Key Words: DNA 䡲 genes 䡲 sodium channels 䡲 hypertension, genetic
P
rimary hypertension is a multifactorial and polygenic
disease with unknown cause.1 During the past years, the
molecular genetic defects have been described for 3 monogenic forms of hypertension2– 4 and for 3 monogenic diseases
characterized by salt wasting and low blood pressure.5–9 All
these genetic defects involve abnormal renal sodium reabsorption. The amiloride-sensitive epithelial sodium channel
gene has been of particular interest as a model of genetic
blood pressure regulation, since activating mutations in this
gene cause sodium retention and hypertension (Liddle’s
syndrome)2,10 whereas inactivating mutations cause salt wasting and hypotension (pseudohypoaldosteronism type 1).9
Gitelman’s syndrome (the predominant subset of patients
who were earlier referred to as having “Bartter’s syndrome”)
is an autosomal recessive disease characterized by sodium
wasting, low blood pressure, secondary hyperaldosteronism,
hypokalemia, alkalosis, hypomagnesemia, and hypocalciuria.7,11–13 The patients may have fatigue, joint pains, and
neuromuscular symptoms. These features closely resemble
those of the adverse effects of thiazide diuretics. Gitelman’s
syndrome has been shown to be caused by mutations in the
gene coding for the thiazide sensitive NaCl-cotransporter
(TSC),7,14 –17 which is the target for the thiazide diuretic class
of antihypertensive drugs. These mutations are believed to
reduce the capability of the TSC to reabsorb salt in the distal
renal tubules, where the cotransporter is specifically
expressed.7,18
In the general population, it is likely that the individual
blood pressure level is influenced by several different genetic
variants, some of which increase and some of which lower
blood pressure. Sodium sensitivity, that is, raised blood
pressure after a sodium load, is believed to reflect decreased
ability of the kidney to excrete sodium and could be an
important factor in the development of primary hypertension
in a subset of patients.19 Genetic variation in genes encoding
proteins involved in renal sodium reabsorption are therefore
likely to be of importance in determining the individual blood
pressure level. Inheritance of one inactivating TSC mutation
from each parent severely reduces sodium reabsorption and is
required for the autosomal recessive Gitelman’s syndrome to
manifest.7 Compared with the monogenic forms of hypertension,2– 4 Gitelman’s syndrome appears to be relatively com-
Received January 17, 2000; first decision February 10, 2000; revision accepted April 15, 2000.
From the Department of Endocrinology (O.M., M.O.M., L.G., U.L.H.) and the Department of Community Medicine (K.B., U.L., L.R.), Lund
University, Malmö, Sweden.
Correspondence to Olle Melander, MD, Department of Endocrinology, Malmö University Hospital MAS, S-205 02 Malmö, Sweden. E-mail
[email protected]
© 2000 American Heart Association, Inc.
Hypertension is available at http://www.hypertensionaha.org
389
390
Hypertension
September 2000
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
mon and, based on clinical features, the prevalence has been
estimated to be ⬇19 per million in the city of Gothenburg in
Sweden,12 suggesting a prevalence of heterozygous mutation
carriers of ⬇0.9%. However, the symptoms of the disease are
generally mild and nonspecific, and the diagnostic workup is,
in the majority of cases, initiated by incidental detection of
hypokalemia.12 The prevalence of the disease and that of
heterozygous carriers of Gitelman’s syndrome mutations are
therefore most likely underestimated. We hypothesized that
heterozygous carriers of inactivating TSC mutations may
have moderately decreased renal sodium reabsorption, which
protects them against development of hypertension. Furthermore, knowing that in the epithelial sodium channel gene
both inactivating “hypotensive” mutations and activating
“hypertensive” mutations have been described,2,9,10 we hypothesized that the TSC gene could also harbor activating
mutations that would elevate blood pressure. The aims of this
study were (1) to identify mutations in the TSC gene
responsible for Gitelman’s syndrome in 4 patients from
southern Sweden and to investigate if these mutations may
protect against primary hypertension; (2) to identify variants
in the TSC gene in individuals without Gitelman’s syndrome;
and (3) to investigate whether such genetic variants influence
the risk of developing primary hypertension.
Methods
Subjects and Phenotyping
Two siblings (patients 1 and 2) and 2 sporadic cases (patients 3 and
4) from southern Sweden were diagnosed with Gitelman’s syndrome
at the Department of Endocrinology, Malmö University Hospital,
based on the presence of hypokalemia (⬍3.5 mmol/L), hypomagnesemia (⬍0.70 mmol/L), hypocalciuria (⬍2.5 mmol/d), high
plasma renin activity (⬎1.7 ␮g/L/h in the supine position), and
hyperaldosteronemia (⬎0.28 nmol/L in the supine position). All
patients had fatigue, and one of them also had joint pain. In the
mutation screening of the TSC gene in subjects without Gitelman’s
syndrome, we included 20 unrelated patients (13 men and 7 women)
with early onset (ⱕ40 years of age) of primary hypertension, all of
whom were receiving chronic pharmacological antihypertensive
treatment. Their median (range) age was 58.5 (20.0 to 68.5) years,
body mass index 26.4 (20.7 to 31.7) kg/m2, systolic blood pressure
160 (140 to 210) mm Hg, diastolic blood pressure 91.5 (80.0 to
113) mm Hg, and the age at onset of hypertension 36.5 (20.0 to 40.0)
years. In addition, 20 healthy unrelated subjects (9 men and 11
women) who were ⱖ50 years of age and had a normal blood pressure
(systolic and diastolic blood pressure of ⱕ140 mm Hg and
ⱕ80 mm Hg, respectively) and who received no medication and had
no family history of hypertension in first-degree relatives were
included in the mutation screening. Their median (range) age was
61.8 (54.0 to 82.8) years, body mass index 24.8 (18.6 to 36.9) kg/m2,
systolic blood pressure 124 (93.0 to 138) mm Hg, and diastolic blood
pressure 72.5 (55.0 to 80.0) mm Hg. None of the 40 subjects had
diabetes mellitus, kidney disease, or secondary hypertension. The
reason for screening both hypertensive patients and normotensive
subjects for mutations in the TSC gene was that we hypothesized that
the probability of finding potentially activating mutations would be
greater in hypertensive patients, whereas potentially inactivating
mutations could be expected to be more common in normotensive
subjects.
Three of the variants found in the mutation screening were tested
for association with hypertension in a large study population consisting of 292 unrelated patients with primary hypertension and in
264 unrelated normotensive control subjects who have been described earlier.20 Two subjects from the previous study20 were
excluded because of unsuccessful genotyping. Briefly, the patients
with primary hypertension were diagnosed before the age of 60 years
and were all receiving chronic pharmacological antihypertensive
treatment. Subjects with diabetes mellitus, kidney disease, or secondary hypertension were excluded. The normotensive control
subjects were selected as follows: (1) ⱖ40 years of age; (2) systolic
and diastolic blood pressure of ⱕ150 mm Hg and ⱕ80 mm Hg,
respectively; (3) no personal history of elevated blood pressure,
diabetes mellitus, or any other chronic disease; (4) absence of
medication; and (5) no family history of hypertension in first-degree
relatives. The large association study material has been studied
earlier20 and was thus selected before the mutation screening
material. The mutation screening material was selected when the
present study was designed, with stricter inclusion criteria. The two
study materials thus represent independently selected random samples from the same pool of patients and control subjects attending or
recruited through 5 outpatient clinics in southern Sweden. Twentynine individuals (13 patients and 16 normotensive subjects) in the
mutation screening material had also been included in the large
association study material. Methods for blood pressure and anthropometric measurements have been described earlier.20 Serum potassium concentrations were measured by standard biochemical methods. All study participants had given written informed consent, and
the study was approved by the ethics committee of the Medical
Faculty of Lund University.
Mutation Screening
Total genomic DNA was extracted from venous blood by standard
methods.21 Mutation screening of the 26 exons of the TSC gene was
performed with polymerase chain reaction (PCR) and single strand
conformation polymorphism techniques,22 with primers published by
Simon et al7 except for exon 17, for which primers published by
Mastroianni et al14 were used. Exon 1 was amplified in 2 fragments
(exons 1A and 1B).7 PCRs were performed with 50 ng genomic
DNA in a total volume of 20 ␮L containing 10 pmol of each primer,
2 nmol dNTPs, and 0.5 U Taq polymerase (Pharmacia Biotech) in
either the PCR buffer recommended by the manufacturer (Pharmacia
Biotech) (exons 1B, 2, 4, 6, 12, 14 to 15, 17 to 18, 20 to 21, and 24)
or in 1⫻(NH4)2SO4-buffer (16 mmol/L (NH4)2SO4; 67 mmol/L Tris
pH 8.8; 0.01% Tween) (exons 1A, 3, 5, 7 to 11, 13, 16, 19, 22 to 23,
and 25 to 26). Reactions were performed with 1.5% formamide and
0.05 ␮L [␣-32P]dCTP (3.000 Ci/mmol) (Amersham, Sweden AB) in
either 1.5 mmol/L MgCl2 (exons 1 to 10, 12 to 17, and 19 to 26) or
3.0 mmol/L MgCl2 (exons 11 and 18). PCR conditions were as
follows: initial denaturation at 94°C for 5 minutes, followed by 30
cycles of denaturation (94°C for 30 seconds), annealing (60°C for
exons 8, 10, and 15; 62°C for exons 1A, 3, 7, 16 to 17, 19, 22, and
25 to 26; 64°C for exons 1B, 2, 5, 13 to 14, 18, and 23 to 24 and 66°C
for exons 4, 6, 9, 11 to 12, and 20 to 21; for 30 seconds), and
extension (72° for 30 seconds), with the final extension at 72° for 10
minutes. Reactions were diluted 1:1 with 95% formamide buffer,
denatured for 5 minutes at 90°C, cooled, and electrophoresed on
glycerol-free (35 W for 3.5 hours at 4°C) and 5% glycerol (8 W for
13 hours at room temperature), nondenaturing 5% polyacrylamide
gels (acrylamide/bisacrylamide 49:1). When differences in band
pattern were observed, the PCR products were sequenced bidirectionally with the Thermo Sequenase II dye terminator cycle sequencing kit (Pharmacia Biotech) in an ABI PRISM 373 automated DNA
Sequencer (Perkin Elmer).
Restriction Fragment Length Polymorphism
Restriction fragment length polymorphism methods were created for the
Thr304Pro, Gly439Ser, Ala728Thr, Gly731Arg, Gly741Arg, 2745insAGCA, Arg904Gln, Gly264Ser, and C1420T variants to confirm them
and to simplify their detection. The same primers and conditions as in
the mutation screening were used to perform nonradioactive PCRs of
the exons containing the different variants, except for the Gly741Arg,
Ala728Thr, and C1420T variants, for which the forward primers were
replaced by (5⬘-AATGAAGCCCAACATTCTGGTGCTT), (5⬘ACCCCTATCCCCTGGCAGGGC) and (5⬘-CGGCTGGCATCTTCGGGGCGAC), respectively, containing nucleotide mismatches (underlined) to create restriction enzyme cleavage sites. The Gly264Ala
Melander et al
TABLE 1. Mutations Found in Patients With Gitelman’s
Syndrome (nⴝ4)
Mutation at
Nucleotide
Predicted Effect on Protein
Patient
Thr304Pro
1, 2
1340G3A (exon 10)
Gly439Ser
2207G3A (exon 18)
2216G3A (exon 18)
2246G3A (exon 18)
(exon 23)
391
TABLE 2. Variants Found in Mutation Screening of
Hypertensive (nⴝ20) and Normotensive (nⴝ20) Individuals
Without Gitelman’s Syndrome (nⴝ40)
935A3 C (exon 7)
2745insAGCA
TSC, Gitelman’s Syndrome, and Hypertension
Predicted Effect on Protein
HT (n)
NT (n)
816G3 C (exon 6)
Gly264Ala
1
2
3
2402G3A (exon 20)
Val793Met
0
1
Ala728Thr*
1, 2
2736G3A (exon 23)
Arg904Gln
4
2
Gly731Arg
1, 2
391A3G (exon 2)
Ala122Ala
0
2
Gly741Arg
3, 4
1420C3T (exon 11)
Thr465Thr
10
1
frameshift introducing a
premature stop codon
4
1909G3A (exon 15)
Ser628Ser
4
2
6 codons downstream
*Represents a common polymorphism, not regarded as functional (see
Results section).
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
(the cleaved variant italics) variant was cleaved with BsrD1 (New
England Biolabs), Thr304Pro with Sau96I (New England Biolabs),
Gly439Ser with HaeIII (New England Biolabs), Ala728Thr with HhaI
(Pharmacia Biotech), Gly731Arg and Gly741Arg with DdeI (New
England Biolabs), Arg904Gln with AvaI (New England Biolabs),
C1420T with HinfI (New England Biolabs), and the 2745insAGCA with
MwoI (New England Biolabs), which cleaves the fragment if the
AGCA-insertion is present. The buffers and digestion conditions recommended by the manufacturers were used. The fragments were
separated on agarose gels and visualized under ultraviolet light after
staining with ethidium bromide.
Statistics
A BMDP statistical package (Biomedical Data Processing, version
1.1) was used for the statistical analyses. Frequency differences were
calculated with ␹2 test or Fisher’s exact test where appropriate.
Differences in continuous variables were calculated with a t test and
ANOVA or Mann-Whitney and Kruskal-Wallis tests where appropriate. Data are given as mean⫾SD if nothing else is mentioned.
Results
Mutation Screening of TSC Gene in Patients With
Gitelman’s Syndrome
Mutation at Nucleotide
2167C3T (exon 17)
Ala714Ala
3
3
2686A3T (exon 23)
Arg887Arg
10
17
*HT indicates hypertensive; NT, normotensive.
variant was found to be relatively common in both the 292
patients with primary hypertension (Ala728Ala, n⫽282;
Ala728Thr, n⫽8; and Thr728Thr, n⫽2) and in the 264
normotensive control subjects (Ala728Ala, n⫽259;
Ala728Thr, n⫽4; and Thr728Thr, n⫽1) (P⫽0.54). The 3
subjects homozygous for the Thr728 allele all had normal
serum potassium values (3.9, 4.1, and 4.2 mmol/L), and none
of them had symptoms of Gitelman’s syndrome.
None of the 292 patients with primary hypertension carried
any of the Thr304Pro, Gly439Ser, Gly731Arg, Gly741Arg,
or 2745insAGCA mutations, whereas 3 (1.1%) of the 264
normotensive control subjects were heterozygous for 2 of
these mutations (Gly741Arg, n⫽2, and Gly439Ser, n⫽1)
(P⫽0.11). There was no significant difference in systolic
blood pressure (125⫾11.0 mm Hg versus 125⫾12.9 mm Hg;
P⫽0.99), diastolic blood pressure (70.7⫾7.0 mm Hg versus
71.6⫾7.1 mm Hg; P⫽0.66), or serum potassium concentrations (4.1⫾0.56 mmol/L versus 4.2⫾0.25 mmol/L; P⫽0.59)
between the 3 heterozygous mutation carriers compared with
the other 261 normotensive control subjects.
Mutation Screening of TSC Gene in Subjects
Without Gitelman’s Syndrome
We identified compound heterozygous mutations in all 4
patients with Gitelman’s syndrome (Table 1). Two of these,
Thr304Pro and 2745insAGCA, have not been reported before. The insertion mutation 2745insAGCA is due to duplication of the last 4 nucleotides of exon 23 (AGCA), which
introduces a frameshift after codon 906Glu. This frameshift
leads to a premature stop codon 7 codons downstream
(906Glu-907Gln-908Ala-909His-910Gln-911Glu-912Val-913Stop). The
missense mutations Thr304Pro, Gly439Ser, Gly731Arg, and
Gly741Arg all change amino acids, which are strictly conserved through evolution.18 Patients 1 and 2 with the
Thr304Pro and Gly731Arg mutations were also carriers of an
Ala728Thr variant (Table 1), which has been reported earlier
in patients with Gitelman’s syndrome.7,14 This variant is not
conserved through evolution18 and represents a common
polymorphism in Swedes (see below).
In the 20 patients with early onset of primary hypertension and
the 20 normotensive subjects who were screened for TSC
mutations, we found 5 silent polymorphisms and 3 variants
leading to amino acid substitutions (Table 2). We focused our
further studies in the large study population on 3 variants: (1)
The Arg904Gln variant was selected because it was common
and changes the amino acid sequence of the TSC. (2) The
Gly264Ala variant was selected because it changes a conserved
amino acid18 just like the identified Gitelman’s syndrome missense mutations, which most likely are functional. This suggested that the Gly264 allele could be of importance for normal
TSC function and that the Ala264 allele could alter TSC
function. (3) We screened for the C1420T variant because the
T1420 allele was present in 10 of 20 patients with primary
hypertension but in only 1 of 20 normotensive subjects participating in the mutation screening (P⫽0.001) (Table 2).
Screening for Gitelman’s Syndrome Mutations in
Hypertensive Patients and Normotensive
Control Subjects
Screening of Arg904Gln, Gly264Ala, and C1420T
Variants in Hypertensive Patients and
Normotensive Control Subjects
In contrast to the Thr304Pro, Gly439Ser, Gly731Arg,
Gly741Arg, and 2745insAGCA mutations, the Ala728Thr
The genotype frequency distributions of the Arg904Gln,
Gly264Ala, and C1420T variants (Table 3) were similar to
392
Hypertension
September 2000
TABLE 3. Genotype Frequency Distribution of Arg904Gln, Gly264Ala, and C1420T Variants and Blood
Pressure and Serum Potassium Values According to Different Genotypes
Variable
Hypertensive Patients (n⫽292)
Genotype
Arg904Arg
Arg904Gln
n (%)
239 (81.9)
SBP, mm Hg
152⫾18.1
DBP, mm Hg
85.8⫾9.8
86.9⫾10.9
Normotensive Control Subjects (n⫽264)
Gln904Gln
Arg904Arg
Arg904Gln
Gln904Gln
48 (16.4)
5 (1.7)
153⫾19.1
162⫾14.7
210 (79.5)
54 (20.5)
0 (0)
125⫾12.9
124⫾12.7
83.8⫾8.3
䡠䡠䡠
71.6⫾6.8
71.4⫾8.0
䡠䡠䡠
S-K⫹
4.1⫾0.36
4.1⫾0.30
4.5⫾0.75
4.2⫾0.25
4.2⫾0.26
䡠䡠䡠
Genotype
C1420C
C1420T
T1420T
C1420C
C1420T
T1420T
n (%)
194 (66.4)
86 (29.5)
12 (4.1)
195 (73.9)
65 (24.6)
4 (1.5)
SBP, mm Hg
153⫾18.3
150⫾17.9
145⫾17.6
125⫾13.2
126⫾12.1
124⫾10.8
DBP, mm Hg
86.4⫾9.7
85.7⫾9.9
80.3⫾12.8
71.5⫾7.2
71.8⫾6.8
69.5⫾6.0
S-K⫹
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
4.1⫾0.36
4.1⫾0.36
4.2⫾0.48
4.2⫾0.27
4.2⫾0.21
4.3⫾0.19
Genotype
Gly264Gly
Gly264Ala
n (%)
265 (90.8)
26 (8.9)
Ala264Ala
Gly264Gly
Gly264Ala
Ala264Ala
1 (0.3)
247 (93.6)
16 (6.1)
1 (0.4)
SBP, mm Hg
153⫾18.6
149⫾13.8
DBP, mm Hg
86.0⫾9.9
86.0⫾10.4
86.0
4.1⫾0.36
4.0
S-K⫹
4.1⫾0.36
140
125⫾13.0
126⫾11.5
71.6⫾7.1
70.3⫾6.7
4.2⫾0.25
4.1⫾0.29
136
80.0
4.0
⫹
SBP indicates systolic blood pressure; DBP, diastolic blood pressure; S-K , serum potassium concentration.
Data are mean⫾SD.
those expected from the allele frequencies according to the
Hardy-Weinberg equilibrium. The genotype frequency distribution of the Arg904Gln variant differed between the patients
with primary hypertension and the normotensive control
subjects (P⫽0.05) (Table 3). Five of the patients with
primary hypertension (1.7%) were homozygous for the
Gln904 allele, whereas no Gln904Gln homozygotes could be
found among the normotensive control subjects (P⫽0.03)
(Table 3). The genotype frequency distribution of the
Gly264Ala variant did not differ significantly between the
patients with primary hypertension and the normotensive
control subjects (Table 3). The frequency of the T1420 allele
was significantly higher in patients with primary hypertension compared with normotensive control subjects (C1420,
81.2% and T1420, 18.8% versus C1420, 86.2% and T1420,
13.8%; P⫽0.02), whereas the difference in genotype frequency distribution between the 2 groups was not significant
(P⫽0.06) (Table 3). The Arg904Gln and C1420T variants
were not in linkage disequilibrium (data not shown). If the 29
subjects who appeared in both the association study material
and in the mutation screening material were excluded, the
Gln904Gln genotype was still significantly more common in
patients with primary hypertension than in control subjects
(5/279 versus 0 of 248; P⫽0.03), whereas the frequency
difference of the T1420 allele did not remain significant
(18.6% versus 14.3%; P⫽0.06). There was no statistically
significant difference in blood pressure or serum potassium
levels between the different genotype carriers of either of the
Arg904Gln, Gly264Ala, or C1420T variants neither among
the patients with primary hypertension, who were all on
antihypertensive treatment, nor among the normotensive
control subjects (Table 3), although the 5 Gln904Gln ho-
mozygotes had slightly higher serum potassium concentrations (P⫽0.14) than the other patients with primary hypertension (Table 3).
Discussion
We have identified compound heterozygous mutations in the
TSC gene, 2 of which have not been reported before
(Thr304Pro and 2745insAGCA), in 4 patients with Gitelman’s syndrome (Table 1). The 4-bp insertion at the end of
exon 23 (2745insAGCA) causes a frameshift leading to a
premature stop codon in exon 24. This truncation of a large
portion of the C-terminal part of the protein corresponding to
exons 24 to 26 is likely to interfere with the function of the
protein as 2 potential protein kinase phosphorylation sites,
predicted at Thr908 and Ser953,18 are destroyed. Amino acid
sequence alignment of the human, rat, and winter flounder
TSC as well as of the related bumetanide-sensitive Na-K-2Cl
cotransporter from human, rat, rabbit, and shark has shown
that the amino acid residues corresponding to the Thr304,
Gly439, Gly731, and Gly741 of the human TSC are strictly
conserved through evolution,18 indicating that these amino
acid residues are essential for the function of the protein. The
substitutions of these residues in our patients with Gitelman’s
syndrome (Table 1) are therefore likely to be pathogenic,
although definite proof would require functional studies. The
2 siblings with Gitelman’s syndrome (patients 1 and 2)
carried 3 different variants (Table 1). Of them, the Ala728Thr
variant, which has been described in patients with Gitelman’s
syndrome before,7,14 may not be pathogenic for the following
2 reasons: (1) Unlike all the other missense mutations in the
patients with Gitelman’s syndrome (Table 1), the Ala728
amino acid residue is not conserved through evolution.18 (2)
Melander et al
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
Three of the 556 individuals screened for the Ala728Thr
variant were homozygous for the 728Thr allele but had no
symptoms of Gitelman’s syndrome, and all had normal serum
potassium values.
We speculated that Gitelman’s syndrome is underdiagnosed and that heterozygous carriers of such mutations are
relatively common in the population and could be protected from primary hypertension. The mutations that we
regarded as pathogenic in the patients with Gitelman’s
syndrome were rare in our study population. They were not
found in patients with primary hypertension, as compared
with a frequency of 1.1% of heterozygous carriers in
normotensive control subjects; however, the difference
was not statistically significant (P⫽0.11). Several mutations have been described in the TSC gene in patients with
Gitelman’s syndrome.7,14 –17 In our large study population
from southern Sweden, there may well be other inactivating TSC mutations than those found in the 4 patients with
Gitelman’s syndrome (Table 1) and in the 40 subjects
without Gitelman’s syndrome (Table 2) who were screened
for mutations in the TSC gene. Apparently a larger number
of study subjects and a broader spectrum of Gitelman’s
syndrome mutations need to be studied to be able to
convincingly show if heterozygotes for such mutations are
protected from primary hypertension.
It is known that activating mutations of the amiloridesensitive epithelial sodium channel gene cause hypertension
(Liddle’s syndrome),2,10 whereas inactivating mutations in
the same gene cause hypotension (pseudohypoaldosteronism
type 1).9 An activating variant of the TSC gene would be
expected to give rise to the phenotype opposite to that of
Gitelman’s syndrome, with hypertension and relatively high
serum potassium concentrations. The finding of 5 subjects
homozygous for the Gln904 allele of the TSC gene in the
patients with primary hypertension as compared with none in
the normotensive control subjects (P⫽0.03) (Table 3) suggests that the Arg904Gln variant may represent such an
activating variant, which contributes to elevated blood pressure. There was no significant difference in the number of
Arg904Gln heterozygotes between the patients with primary
hypertension and the normotensive control subjects (Table 3),
suggesting that 2 Gln904 alleles are required to increase the
risk of hypertension. However, because more than 1 variant
was tested for association with hypertension, some caution in
the interpretation of the data is warranted.
Interestingly, Gordon’s syndrome (pseudohypoaldosteronism type II) displays a phenotype of inheritable hyperkalemic
hypertension with acidosis that is reversible by thiazides,23,24
thus being the opposite of the Gitelman’s syndrome phenotype. However, activating mutations of the TSC gene as the
cause of Gordon’s syndrome has not been supported by
linkage studies, which have instead mapped the disease to 2
other chromosomal loci, 1q31-42 and 17p11-q21.25 Thiazides
could be expected to be more effective in lowering blood
pressure in subjects homozygous for the Gln904 allele.
However, none of the 37 patients treated with thiazides was
homozygous for the Gln904 allele. Among the 37 patients
taking thiazides, there was no difference in systolic (158⫾16
versus 159⫾16 mm Hg; P⫽0.82) or diastolic (85.0⫾10.4
TSC, Gitelman’s Syndrome, and Hypertension
393
versus 87.6⫾13.6; P⫽0.56) blood pressure between carriers
of the Arg904Arg (n⫽29) and Arg904Gln (n⫽8) genotypes,
respectively.
In conclusion, we report 5 mutations in the TSC gene that
most likely cause Gitelman’s syndrome (Gly439Ser,
Gly731Arg, Gly741Arg, Thr304Pro, and 2745insAGCA), of
which the latter two have not been described before. Furthermore, we provide data suggesting that individuals homozygous for the Gln904 allele of the TSC gene may be at
increased risk for primary hypertension.
Acknowledgments
This study was supported by grants from the Swedish Medical
Research Council, the Swedish Heart and Lung Foundation, the
Medical Faculty of Lund University, Malmö University Hospital,
Skaraborg Institute, the Skaraborg County Council, the Albert
Påhlsson Research Foundation, the Crafoord Foundation, the Ernhold Lundströms Research Foundation, and the Region Skane. We
thank Lena Rosberg for excellent technical assistance.
References
1. Lifton RP, Jeunemaitre X. Finding genes that cause human hypertension.
J Hypertens. 1993;11:231–236.
2. Shimkets RA, Warnock DG, Bositi CM, Nelson Williams C, Hansson JH,
Schambelan M, Gill JR Jr, Ulick S, Milora RV, Findling JW, Canessa
CN, Rossier BC, Lifton RP. Liddle’s syndrome: heritable human hypertension caused by mutations in the ␤-subunit of the epithelial sodium
channel. Cell. 1994;79:407– 414.
3. Mune T, Rogerson FM, Nikkila H, Agarwal AK, White PC. Human
hypertension caused by mutations in the kidney isozyme of 11␤hydroxysteroid dehydrogenase. Nat Genet. 1995;10:394 –399.
4. Lifton RP, Dluhy RG, Powers M, Rich GM, Cook S, Ulick S, Lalouel JM.
A chimaeric 11 ␤ -hydroxylase/aldosterone synthase gene causes
glucocorticoid-remediable aldosteronism and human hypertension.
Nature. 1992;355:262–265.
5. Simon DB, Karet FE, Rodriguez Soriano J, Hamdan JH, DiPietro A,
Trachtman H, Sanjad SA, Lifton RP. Genetic heterogeneity of Bartter’s
syndrome revealed by mutations in the K⫹ channel, ROMK. Nat Genet.
1996;14:152–156.
6. Simon DB, Karet FE, Hamdan JM, DiPietro A, Sanjad SA, Lifton RP.
Bartter’s syndrome, hypokalaemic alkalosis with hypercalciuria, is
caused by mutations in the Na-K-2Cl cotransporter NKCC2. Nat Genet.
1996;13:183–188.
7. Simon DB, Nelson Williams C, Bia MJ, Ellison D, Karet FE, Molina AM,
Vaara I, Iwata F, Cushner HM, Koolen M, Gainza FJ, Gitleman HJ,
Lifton RP. Gitelman’s variant of Bartter’s syndrome, inherited
hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive
Na-Cl cotransporter. Nat Genet. 1996;12:24 –30.
8. Simon DB, Bindra RS, Mansfield TA, Nelson-Williams C, Mendonca E,
Stone R, Schurman S, Nayir A, Alpay H, Bakkaloglu A, RodriguezSoriano J, Morales JM, Sanjad SA, Taylor CM, Pilz D, Brem A,
Trachtman H, Griswold W, Richard GA, John E, Lifton RP. Mutations in
the chloride channel gene, CLCNKB, cause Bartter’s syndrome type III.
Nat Genet. 1997;17:171–178.
9. Chang SS, Grunder S, Hanukoglu A, Rosler A, Mathew PM, Hanukoglu
I, Schild L, Lu Y, Shimkets RA, Nelson Williams C, Rossier BC, Lifton
RP. Mutations in subunits of the epithelial sodium channel cause salt
wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type 1.
Nat Genet. 1996;12:248 –253.
10. Schild L, Canessa CM, Shimkets RA, Gautschi I, Lifton RP, Rossier BC.
A mutation in the epithelial sodium channel causing Liddle disease
increases channel activity in the Xenopus laevis oocyte expression
system. Proc Natl Acad Sci U S A. 1995;92:5699 –5703.
11. Gitelman HJ, Graham JB, Welt LG. A new familial disorder characterized by
hypokalemia and hypomagnesemia. Trans Assoc Am Phys. 1966;79:221–235.
12. Rudin A. Bartter’s syndrome: a review of 28 patients followed for 10
years. Acta Med Scand. 1988;224:165–171.
13. Bettinelli A, Bianchetti MG, Girardin E, Caringella A, Cecconi M,
Appiani AC, Pavanello L, Gastaldi R, Isimbaldi C, Lama G, Marchesoni
C, Matteucci C, Patriarca P, Di Natale B, Setzu C, Vitucci P. Use of
calcium excretion values to distinguish two forms of primary renal
394
14.
15.
16.
17.
18.
Hypertension
September 2000
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
tubular hypokalemic alkalosis: Bartter and Gitelman syndromes.
J Pediatr. 1992;120:38 – 43.
Mastroianni N, Bettinelli A, Bianchetti M, Colussi G, De Fusco M, Sereni
F, Ballabio A, Casari G. Novel molecular variants of the Na-Cl cotransporter gene are responsible for Gitelman’s syndrome. Am J Hum Genet.
1996;59:1019 –1026.
Takeuchi K, Kure S, Kato T, Taniyama Y, Takahashi N, Ikeda Y, Abe T,
Narisawa K, Muramatsu Y, Abe K. Association of a mutation in thiazide
sensitive Na-Cl cotransporter with familial Gitelman’s syndrome. J Clin
Endocrinol Metab. 1996;81:4496 – 4499.
Lemmink HH, van den Heuvel LPWJ, van Dijk HA, Merkx GFM, Smilde
TJ, Taschner PEM, Monnens LAH, Hebert SC, Knoers NVAM. Linkage
of Gitelman syndrome to the thiazide-sensitive sodium-chloride cotransporter gene with identification of mutations in Dutch families. Pediatr
Nephrol. 1996;10:403– 407.
Lemmink HH, Knoers NVAM, Karolyi L, van Dijk H, Niaudet P,
Antignac C, Guay-Woodford LM, Goodyer PR, Carel JC, Hermes A,
Seyberth HW, Monnens LAH, van den Heuvel LPWJ. Novel mutations in
the thiazide-sensitive NaCl cotransporter gene in patients with Gitelman
syndrome with predominant localization to the C-terminal domain.
Kidney Int. 1998;54:720 –730.
Mastroianni N, De Fusco M, Zollo M, Arrigo G, Zuffardi O, Bettinelli A,
Ballabio A, Casari G. Molecular cloning, expression pattern, and chromosomal localization of the human Na-Cl thiazide-sensitive cotransporter
(SLC12A3). Genomics. 1996;35:486 – 493.
19. Weinberger MH, Miller JZ, Luft FC, Grim CE, Fineberg NS. Definitions
and characteristics of sodium sensitivity and blood pressure resistance.
Hypertension. 1986;8(suppl II):II-127-II-134.
20. Melander O, Bengtsson, K, Orho-Melander M, Lindblad U, Forsblom C,
Råstam L, Groop L, Hulthén UL. Role of the Gly460Trp polymorphism
of the ␣-adducin gene in primary hypertension in Scandinavians. J Hum
Hypertens. 2000;14:43– 46.
21. Vandenplas S, Wiid I, Grobler Rabie A, Brebner K, Ricketts M, Wallis G,
Bester A, Boyd C, Mathew C. Blot hybridisation analysis of genomic
DNA. J Med Genet. 1984;21:164 –172.
22. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of
point mutations and DNA polymorphisms using the polymerase chain
reaction. Genomics. 1989;5:874 – 879.
23. Paver WK, Pauline GJ. Hypertension and hyperpotassemia without renal
disease in a young male. Med J Aust. 1964;2:305–306.
24. Gordon RD, Geddes RA, Pawsey CG, O’Halloran MW. Hypertension
and severe hyperkalaemia associated with suppression of renin and aldosterone and completely reversed by dietary sodium restriction. Aust Ann
Med. 1970;19:287–294.
25. Mansfield TA, Simon, DB, Farfel Z, Bia M, Tucci JR, Lebel M, Gutkin
M, Vialettes B, Christofilis MA, Kauppinen-Makelin R, Mayan H, Risch
N, Lifton RP. Multilocus linkage of familial hyperkalemia and hypertension, pseudoaldosteronism type II, to chromosomes 1q31-42 and
17p11– q21. Nat Genet. 1997;16:202–205.
Genetic Variants of Thiazide-Sensitive NaCl-Cotransporter in Gitelman's Syndrome and
Primary Hypertension
Olle Melander, Marju Orho-Melander, Kristina Bengtsson, Ulf Lindblad, Lennart Råstam, Leif
Groop and U. Lennart Hulthén
Downloaded from http://hyper.ahajournals.org/ by guest on June 17, 2017
Hypertension. 2000;36:389-394
doi: 10.1161/01.HYP.36.3.389
Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2000 American Heart Association, Inc. All rights reserved.
Print ISSN: 0194-911X. Online ISSN: 1524-4563
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://hyper.ahajournals.org/content/36/3/389
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Hypertension is online at:
http://hyper.ahajournals.org//subscriptions/