Journal of General Virology (2015), 96, 3587–3597
DOI 10.1099/jgv.0.000300
Oyster viperin retains direct antiviral activity and
its transcription occurs via a signalling pathway
involving a heat-stable haemolymph protein
Timothy J. Green,1,2 Peter Speck,2 Lu Geng,3 David Raftos,1
Michael R. Beard3 and Karla J. Helbig3
Correspondence
Timothy J. Green
1
Department of Biological Sciences and Sydney Institute of Marine Science, Macquarie University,
NSW 2109, Australia
[email protected]
2
School of Biological Sciences, Flinders University, GPO Box 2100, Adelaide, SA 5001, Australia
3
School of Biological Sciences, University of Adelaide, SA 5001, Australia
Received 28 July 2015
Accepted 24 September 2015
Little is known about the response of non-model invertebrates, such as oysters, to virus
infection. The vertebrate innate immune system detects virus-derived nucleic acids to trigger the
type I IFN pathway, leading to the transcription of hundreds of IFN-stimulated genes (ISGs) that
exert antiviral functions. Invertebrates were thought to lack the IFN pathway based on the
absence of IFN or ISGs encoded in model invertebrate genomes. However, the oyster genome
encodes many ISGs, including the well-described antiviral protein viperin. In this study, we
characterized oyster viperin and showed that it localizes to caveolin-1 and inhibits dengue virus
replication in a heterologous model. In a second set of experiments, we have provided evidence
that the haemolymph from poly(I : C)-injected oysters contains a heat-stable, proteasesusceptible factor that induces haemocyte transcription of viperin mRNA in conjunction with
upregulation of IFN regulatory factor. Collectively, these results support the concept that oysters
have antiviral systems that are homologous to the vertebrate IFN pathway.
INTRODUCTION
IFNs are a class of cytokines that induce vertebrate cells
into an antiviral state (Randall & Goodbourn, 2008).
Typically, virus-infected cells secrete IFNs to alert other
cells in the body to the presence of a virus (Robertsen,
2006). IFNs induce an antiviral state by binding to IFN
receptors, which are present on all nucleated cells (Biron
& Sen, 2001). Receptor engagement activates signal transduction via the Janus kinase/signal transducer and activator
of transcription (JAK/STAT) pathway, leading to the transcription of hundreds of IFN-stimulated genes (ISGs)
(Schoggins & Rice, 2011). The products of these ISGs
exert numerous antiviral effector functions, many of
which are still not fully described (Schoggins & Rice,
2011). Viperin (virus inhibitory protein, endoplasmic reticulum-associated, IFN inducible) is one of a few ISGs that
has been shown to have direct antiviral activity against a
range of RNA and DNA viruses (Mattijssen & Pruijn,
2012), and is one of the earliest and most significantly
upregulated genes in response to viral infection in
humans (reviewed by Helbig & Beard, 2014). Viperin was
first isolated from fibroblast cells and was shown to be an
The GenBank/EMBL/DDBJ accession numbers for the four oyster
viperin sequences determined in this study are KT334231–KT334234.
000300 G 2015 The Authors
inducible cytoplasmic antiviral protein that is induced by
IFNs and human cytomegalovirus (HCMV) (Chin & Cresswell, 2001). Subsequently, viperin has been characterized in
a variety of vertebrate species and shown to be a highly
conserved evolutionary host protein (Goossens et al.,
2015; Helbig et al., 2011; Milic et al., 2015; Wang et al.,
2007; Zhang et al., 2014). Viperin localizes to the endoplasmic reticulum (ER) and lipid droplets (reviewed by
Mattijssen & Pruijn, 2012) and inhibits the release of
influenza virus and human immunodeficiency virus by
altering the formation of lipid rafts, which are the known
sites of virus budding (Nasr et al., 2012; Wang et al.,
2014b). Viperin also inhibits the replication of both hepatitis C virus and dengue virus by interacting with viral nonstructural proteins (Helbig et al., 2011, 2013).
The evolutionary origins and divergence of major immune
response pathways have generally been inferred from
comparisons between vertebrates and model invertebrate
species, such as Drosophila melanogaster, Anopheles
gambiae, Caenorhabditis elegans and Ciona intestinalis
(Robalino et al., 2004). The absence of IFN or its major
effectors from the genomes of these model invertebrates
has been used to imply that the IFN pathway is a vertebrate
innovation (Loker et al., 2004; Robalino et al., 2005).
However, non-model invertebrate species might have
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
Printed in Great Britain
3587
T. J. Green and others
antiviral systems that are homologous to the vertebrate
type I IFN response (Green & Montagnani, 2013; He
et al., 2015). In particular, transcriptome sequencing of
the Pacific oyster (Crassostrea gigas) infected with ostreid
herpesvirus type 1 (OsHV-1) has revealed an ancient IFN
pathway in the oyster genome with key components
[Toll-like receptor (TLR), Rig-like Receptor (RLR), IFN
regulatory factors (IRFs), JAK/STAT and ISGs] conserved
and highly upregulated in response to OsHV-1 infection
(He et al., 2015; Renault et al., 2011; Rosani et al., 2014;
Segarra et al., 2014b). Many of these antiviral genes are upregulated in C. gigas tissues following injection with poly(I : C)
to mimic a virus infection (Green et al., 2014a, b), and this
inducible immune response can inhibit OsHV-1 infection
(Green & Montagnani, 2013). Viperin is also reported to
be one of the earliest and most upregulated of the C. gigas
genes in response to OsHV-1 (Rosani et al., 2014 and
poly(I : C) (Green et al., 2014b), but it is unknown whether
oyster viperin has direct antiviral activity.
The concept that non-model invertebrates, such as oysters,
have a type I IFN response is still contrary to established
views in innate immunology. Many comparative immunologists are sceptical that oysters have an IFN response
because bioinformatics analysis of all fully sequenced
invertebrate genomes (including the oyster) have failed to
identify an IFN cytokine (He et al., 2015; Loker et al.,
2004). In addition, it is unknown whether invertebrate
genes that share sequence homology to vertebrate ISGs
have also retained their antiviral functions over a long evolutionary time period. Therefore, the first objective of this
study was to characterize oyster viperin and determine
whether it had direct antiviral activity. The second objective was to confirm that expression of oyster viperin is
induced via a cytokine.
RESULTS
activity of this protein) of viperin was highly conserved
between vertebrates and C. gigas (Fig. 1). The amphipathic
helix in the N-terminal region of human viperin allows it
to tether to the ER and lipid droplets. However, an amphipathic helix could not be predicted in C. gigas viperin
(Amphipaseek, https://prabi.ibcp.fr/htm/pbil_ibcp_Amphipaseek.html), although it does retain the radical S-adenosyl
methionine (SAM) domain (Conserved Domains search,
http://www.ncbi.nlm.nih.gov).
dsRNA induces oyster viperin expression
Mammalian viperin is rapidly induced (within 2 h) in
response to viruses, IFN and bacterial by-products, such
as dsRNA and lipopolysaccharide (LPS) (reviewed by
Helbig & Beard, 2014). We chose to investigate oyster
viperin expression in response to poly(I : C), which is a
synthetic dsRNA molecule. The use of synthetic dsRNA
in place of a replicating virus allowed a full analysis of a cellular response to dsRNA in the absence of any interference
that may occur via specific viral proteins. In contrast to
vertebrates, injection of poly(I : C) in the oyster’s adductor
muscle resulted in the delayed expression of viperin
(Fig. 2a). Haemocyte expression of oyster viperin remained
stable at 3 and 9 h p.i. (Pw0.05, Fig. 2a) and then increased
rapidly to peak at 27 p.i. (Fig. 2a, Pv0.05). At 27 h p.i.,
viperin mRNA was also elevated in adductor muscle, gill
and mantle tissues (Pv0.05) but not in digestive gland
or gonad tissues (Fig. 2b, Pw0.05).
Stimulation of primary haemocyte cell cultures with different concentrations of poly(I : C) or LPS revealed a dose
threshold for C. gigas viperin expression (Fig. 3). Expression
of haemocyte viperin was induced by poly(I : C) at a concentration of 24.0 mg ml21 (Pv0.05) but not at 2.4 and
0.24 mg ml21 (Pw0.05). Stimulation of haemocytes with
three different concentrations of LPS failed to induce the
expression of C. gigas viperin (Fig. 3, Pw0.05).
Sequence analysis of oyster viperin
Utilizing the oyster genome database (http://www.oysterdb.
com), primers were designed to amplify the complete
coding sequence of C. gigas viperin. The full-length coding
sequence of oyster viperin was amplified and sequenced
from four individual oysters and confirmed to be 1050 bp,
encoding 350 aa. Comparison of these four nucleotide
sequences revealed a single 3 bp insertion in the N terminus
and 13 single-nucleotide polymorphisms (SNPs) in the C
terminus of C. gigas viperin. Only two of these SNPs were
associated with amino acid substitutions at aa 250 and
273. In the vertebrate phylum, viperin amino acid sequences
are highly conserved. A comparison of C. gigas viperin with
human (Homo sapiens; GenBank accession no. NP_542388),
fish (Danio rerio; GenBank accession no. NP_001020727),
chicken (Gallus gallus; GenBank accession no. ACA83729)
and lancelet (Branchiostoma floridae; GenBank accession no.
EEN65148) viperin revealed 62–64 % amino acid identity.
The C-terminal region (essential for some of the antiviral
3588
Haemolymph protein/peptide induces haemocyte
viperin expression
Our results demonstrated that injection of poly(I : C) into
the oyster adductor muscle resulted in elevated viperin
expression in the majority of tissue compartments. Three
possibilities exist for the systemic expression of oyster
viperin: (i) cells within the adductor muscle secrete a cytokine; (ii) poly(I : C) diffuses from the site of injection to
other tissue compartments; or (iii) stimulated haemocytes
are migrating from the adductor muscle to other tissue
compartments. We therefore undertook a series of experiments to show that cells within the adductor muscle are
secreting a cytokine. First, adult C. gigas were induced
into an antiviral state by intramuscular injection with
poly(I : C) or seawater (control). The circulating haemocytes from oysters injected with poly(I : C) had elevated
expression levels of many genes in the IFN pathway,
including TLR, retinoic acid inducible gene I-like helicase
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
Journal of General Virology 96
Oyster viperin has direct antiviral activity
Homo sapiens
Danio rerio
Gallus gallus
Branchiostoma
Crassostrea gigas
Homo sapiens
Danio rerio
Gallus gallus
Branchiostoma
Crassostrea gigas
Homo sapiens
Danio rerio
Gallus gallus
Branchiostoma
Crassostrea gigas
Homo sapiens
Danio rerio
Gallus gallus
Branchiostoma
Crassostrea gigas
Homo sapiens
Danio rerio
Gallus gallus
Branchiostoma
Crassostrea gigas
Homo sapiens
Danio rerio
Gallus gallus
Branchiostoma
Crassostrea gigas
Homo sapiens
Danio rerio
Gallus gallus
Branchiostoma
Crassostrea gigas
Homo sapiens
Danio rerio
Gallus gallus
Branchiostoma
Crassostrea gigas
Fig. 1. Viperin has remarkably high evolutionary conservation in animals. C. gigas viperin (GenBank accession no. KT334231)
has 68 % amino acid identity to viperin sequences isolated from human (Homo sapiens; GenBank accession no. NP_542388),
fish (Danio rerio; GenBank accession no. NP_001020727), chicken (Gallus gallus; GenBank accession no. ACA83729) and
lancelet (Branchiostoma floridae; GenBank accession no. EEN65148). The viperin amino acid sequences were aligned by
CLUSTAL W using the phylogenetic software package MEGA v.6.06. The radical SAM domain is underlined. Asterisks indicate
conserved amino acids.
(RLH), IRF, JAK, STAT5A, STAT6, suppressor of cytokine
signalling (SOC), protein kinase R (PKR) and viperin
(Fig. 4a, Pv0.05). The acellular fraction of the haemolymph was retained from C. gigas injected with poly(I : C)
http://jgv.microbiologyresearch.org
[stimulated cell-free haemolymph (CFH)] or seawater
(non-stimulated CFH) as a culture medium for primary
haemocyte cultures. The second group of experiments using
primary haemocyte cultures revealed that a component of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
3589
T. J. Green and others
(a)
(b)
40
Seawater
Poly(l : C)
c
10
bc
5
ab
ab
a a
a a
3
9
a
a
27
54
2–ΔΔCT viperin
2–ΔΔCT viperin
15
0
Haemocytes (H)
Branchia (B)
Mantle (M)
Adductor (Ad)
Digestive gland (DG)
Gonad (G)
30
20
10
0
0
H
M
Ad DG
Tissue (27 h)
B
Time (h)
G
Fig. 2. Normalized expression of C. gigas viperin in response to poly(I : C) injection. (a) Viperin was significantly upregulated
in haemocytes at 27 and 54 h post-injection. Different lower-case letters denote significant changes in viperin expression
compared with the seawater control (P,0.05). (b) At 27 h post-injection, viperin was significantly upregulated in haemocytes
(H), branchia (B), mantle (M) and adductor tissue (Ad) (P,0.05) but was not induced in digestive gland (DG) and gonad (G)
tissue (P.0.05). Asterisks denote significant differences compared with controls (*P,0.05).
To determine the localization of oyster viperin, we performed a number of expression studies using the Huh-7
cell line, which is known to have prominent lipid droplet
formation, making viperin’s potential localization to this
organelle easier to observe. To assess the ability of both
oyster and human viperin to localize to lipid droplets, we
co-transfected FLAG-tagged oyster and human viperin
into Huh-7 cells in conjunction with MCherry conjugated
3590
b
10
ab
a
5
a
a
a
a
l –1
μg
m
l –1
m
LP
S
0.
40
2.
S
LP
24
S
LP
24
μg
m
0
.0
.2
)0
C
I:
Po
ly(
l –1
l –1
μg
μg
4
μg
m
l –1
m
m
)2
I:
ly(
Po
I:
C
C
)2
4.
.4
0
00
Se
μg
aw
at
er
l –1
0
ly(
Many viperin molecules to date have been shown to localize
to lipid droplets and/or the ER, including murine, human,
crocodile and fish viperin (Helbig et al., 2011; Hinson &
Cresswell, 2009b; Milic et al., 2015; Wang et al., 2014a),
and in most cases this has been attributed to the amphipathic helix of the N terminus of viperin (reviewed by
Helbig & Beard, 2014). Oyster viperin has a considerably
shorter N terminus than human viperin, and our analysis
of oyster viperin suggested that it is unlikely to form an
amphipathic helix in its N terminus (see above).
15
2–ΔΔCT viperin
Oyster viperin localizes to caveolin-1 but not to
lipid droplets
to adipocyte differentiation-related protein (MCherry–
ADRP), which is a resident lipid droplet marker. As can
be seen in Fig. 5(a), human viperin co-localized extensively
with the lipid droplet; however, oyster viperin expression
appeared more cytoplasmically punctate in nature and did
not co-localize with ADRP. Due to the punctate nature of
oyster viperin, we analysed its potential co-localization with
a number of organelle markers displaying a similar localization pattern, including those for lysosome (LAMP1), early
Po
stimulated CFH activated expression of IRF, JAK, STAT6
and viperin (Fig. 4b, Pv0.05). The upregulation of RLH in
Fig. 4(b) is an anomaly: RLH was only upregulated in one
experiment, whereas IRF, JAK, STAT6 and viperin were
consistently upregulated in three independent experiments.
Fig. 4(c) demonstrates that the haemolymph compound
that induces viperin expression must be potent because diluting stimulated CFH (20 %, v/v) did not reduce viperin
expression in primary haemocytes (Pw0.05). Furthermore,
this haemolymph component appeared to be a heat-stable,
protease-susceptible factor because the ability of the stimulated CFH to induce viperin expression was retained after
digestion with RNase A or heat inactivation (Fig. 4c,
Pw0.05), but was eliminated by proteinase K digestion
(Fig. 4c, Pw0.05).
Fig. 3. Poly(I : C) but not LPS is responsible for inducing haemocyte expression of C. gigas viperin. Primary cell cultures of
C. gigas haemocytes were established from individual oysters
and exposed to three different concentrations of poly(I : C) and
LPS. Different lower-case letters denote significant changes in
viperin expression compared with seawater control (P,0.05).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
Journal of General Virology 96
Oyster viperin has direct antiviral activity
(c)
viperin
30
In vitro
30
20
a
a
20
ab
ab
10
b
10
b
FH
C
C
FH
N
S
%
.C
20
TL
R
RL
H
ST
IN
G
IR
F
ST JAK
AT
5
ST A
AT
6
SO
C
PK
Vi R
pe
rin
FH
0
0
°C
RN
As
e
Pr
ot
.K
CT
TL
R
RL
ST H
IN
G
IR
F
ST JAK
AT
5
ST A
AT
6
SO
C
PK
Vi R
pe
rin
0
2–ΔΔ
CT
2–ΔΔ
20
Stim. CFH
NS CFH
40
60
40
In vitro
85
(b) 50
St
im
Poly(l : C)
Seawater
CT
In vivo
2–ΔΔ
(a) 80
Fig. 4. Evidence that haemolymph from oysters injected with poly(I : C) induces the expression of viperin and IRF in haemocytes from naı̈ve oysters. (a) In vivo injection with poly(I : C) results in the upregulation of IFN-related genes in C. gigas
haemocytes. The cell-free haemolymph (CFH) was retained and used as a culture medium for primary haemocyte cell
cultures. (b) Viperin, JAK, STAT6 and IRF are upregulated in naı̈ve haemocytes cultured using poly(I : C)-stimulated haemolymph (Stim. CFH). NS, Not stimulated. (c) Viperin induction was retained when haemolymph was treated with RNase A or
heat treated at 85 8C, but was eliminated when digested with proteinase K (Prot. K). Poly(I : C)-stimulated haemolymph
retained activity when diluted (20 %, v/v). Asterisks in (a, b) and different lower-case letters (c) denote significant differences
compared with controls (*P,0.05).
and late endosomal compartments (Rab5 and -7), mitochondria (Cox IV) and the peroxisome (pex19); however, no colocalization was observed (data not shown). Interestingly,
oyster viperin was observed to co-localize with caveolin-1
in Huh-7 cells (Fig. 5b). Caveolin-1 is a marker of caveolae,
a specialized form of lipid raft (Parton & Simons, 2007).
To examine the divergent localizations of human and
oyster viperin in vitro, we co-expressed human viperin–
GFP in conjunction with FLAG-tagged oyster viperin in
Huh-7 cells. Fig. 5(c) shows that the two viperin molecules
displayed extensive co-localization to putative lipid droplets, as well as to punctate cytoplasmic loci. Human viperin
has been shown to dimerize previously (Hinson & Cresswell,
2009b), independent of its N terminus, and, given the
inability of oyster viperin to localize to lipid droplets in
the absence of human viperin expression (Fig. 5a), we can
presume that oyster viperin maintains the ability to dimerize, and is able to do so with human viperin, relocalizing
to lipid droplets in vitro.
Oyster viperin inhibits dengue virus replication
Cell lines for marine bivalves do not exist (Yoshino et al.,
2013), and the methodology to culture OsHV-1 in primary
cells isolated from C. gigas has not yet been developed.
Therefore, we utilized a heterologous model to investigate
whether oyster viperin directs antiviral activity. Human
viperin restricts the replication of a number of human
viral pathogens, including dengue virus (DENV-2; Helbig
et al., 2013). We compared the ability of oyster and
human viperin to restrict DENV-2 replication in Huh-7
cells. Cells were transiently transfected with either FLAG
expression control vector, FLAG-tagged oyster viperin or
a FLAG-tagged human viperin expression plasmid, and
http://jgv.microbiologyresearch.org
then infected with DENV-2 at 24 h post-transfection.
Both oyster and human viperin were able to restrict
DENV-2 replication at 24 h post-infection (p.i.) by 60
and 54 % respectively (Fig. 6, Pv0.05). No significant
difference was observed between the ability of oyster and
human viperin to restrict DENV-2 replication in vitro.
The ability of oyster viperin to restrict DENV-2 replication
demonstrated that the lack of an amphipathic helix in the
N terminus of this protein did not inhibit its anti-DENV
activity.
DISCUSSION
A growing body of evidence supports the concept that
some invertebrates may have an ancient antiviral pathway
that is homologous to the vertebrate type I IFN response
(reviewed by Wang et al., 2015). Despite numerous studies
describing C. gigas genes that are homologous to vertebrate
ISGs (Green & Montagnani, 2013; He et al., 2015; Renault
et al., 2011; Rosani et al., 2014), there are outstanding
questions regarding whether these invertebrate genes have
a similar biological function and whether a C. gigas type
I IFN cytokine exists. In the current study, we showed
oyster viperin has a direct antiviral activity (Fig. 6) and
provided evidence that intramuscular poly(I : C) injection
induces a haemolymph protein/peptide (cytokine) that
induces haemocyte expression of viperin in conjunction
with upregulation of IRF and JAK/STAT (Fig. 4b).
As herpesviruses pose the biggest threat to the global production of Pacific oysters (Renault et al., 2014; Segarra
et al., 2010) and other marine molluscs (reviewed by
Green et al., 2015a), these results are of considerable interest in progressing novel therapeutics for the aquaculture
industry.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
3591
T. J. Green and others
Viperin
ADRP
Merge
O. viperin
Caveolin-1
Merge
O. viperin
H. Viperin
Oyster
Human
(a)
(b)
(c)
Merge
Fig. 5. C. gigas viperin co-localizes to caveolin-1 but not to lipid droplets. (a) Huh-7 cells were transfected with either
FLAG-tagged oyster viperin (O. viperin) or FLAG-tagged human viperin (H. viperin) in conjunction with MCherry–ADRP.
ADRP is a resident lipid droplet marker. No co-localization was observed between oyster viperin and ADRP. (b) FLAG-tagged
oyster viperin has considerable co-localization to caveolin-1-GFP. (c) Co-expression of FLAG-tagged oyster viperin and
GFP-tagged human viperin in Huh-7 cells revealing that human viperin molecules dimerize with oyster viperin localizing to
lipid droplets.
Viperin has been characterized from many different animals within the subphylums of Vertebrata (Goossens
et al., 2015; Helbig et al., 2013; Milic et al., 2015; Wang
et al., 2014b; Zhong et al., 2015) and Cephalochordata
(Lei et al., 2015). To the best of our knowledge, this is
the first study to characterize viperin isolated from an
animal without a notochord (non-chordates). The amino
acid sequence of C. gigas viperin has high homology
to human and teleost viperin (Fig. 1) and has a similar
3592
domain arrangement with the conserved motif of
CxxxCxxC that exists in radical SAM enzymes and a conserved C-terminal domain. However, we were unable to
predict an amphipathic helix in the N-terminal region.
Vertebrate viperin requires the amphipathic helix for its
association with the ER and its ability to localize to lipid
droplets (Hinson & Cresswell, 2009a, b). The amphipathetic helix of human viperin is important for its direct
antiviral activity against hepatitis C virus (Helbig et al.,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
Journal of General Virology 96
Oyster viperin has direct antiviral activity
mediated within the C-terminal 17 aa. The C-terminal
region of human viperin was shown to restrict early
DENV-2 RNA production/accumulation by interacting
with DENV-2 capsid, non-structural protein (NS3) and
viral RNA (Helbig et al., 2013). Phylogenetic analysis
revealed that human and C. gigas viperin share 88 %
amino acid identity within the C-terminal region.
Relative fold change in DENV RNA
1.5
1.0
0.5
0.0
Control
O. viperin
H. viperin
Fig. 6. C. gigas viperin has direct antiviral activity against DENV2 in a heterologous model. Huh-7 cells were transfected with
either oyster viperin (O. viperin), human viperin (H. viperin) or an
empty control vector, 24 h prior to infection with DENV-2
(m.o.i.51). Cells were harvested for RNA at 24 h p.i. and reverse
transcriptase PCR was performed to detect viral RNA levels in
comparison with the controls. C. gigas viperin had the same level
of antiviral activity as human viperin against DENV-2. Asterisks
denote a significant difference compared with control (*P,0.05).
2005) and chikungunya virus (Teng et al., 2012) but not
against DENV-2 (Helbig et al., 2013). The absence of a predictable amphipathic helix in the N terminus of C. gigas
viperin is the most likely explanation for its failure to localize with lipid droplets in Huh-7 cells (Fig. 5a). Instead,
C. gigas viperin co-localized to caveolin-1 (Fig. 5b),
which is a marker for caveolae. Caveolae are flask-shaped
indentations of the plasma membrane enriched in cholesterol, caveolin and signalling factors (Parton & Simons,
2007), and are exploited by some animal viruses as a
direct portal for endocytic entry to host cells (Smith &
Helenius, 2004). The mechanism for virus entry into molluscan cells is unknown, but other marine invertebrate
viruses, such as white spot syndrome virus, rely on caveolae-mediated endocytosis to enter crustacean cells (Duan
et al., 2014; Huang et al., 2013). Caveolae are also involved
in antiviral signalling by allowing signalling molecules to
cluster within the caveolae domain, thus facilitating protein interactions among signalling components and enhancing signal transduction (Gabor et al., 2013). Caveolin-1
serves as the scaffolding protein that recruits signalling
molecules, such an IFN receptors, to caveolae (Takaoka
et al., 2000). The role of caveolin and caveolae in molluscan
antiviral signalling and recruitment of antiviral proteins is
also unknown, but caveolin and viperin transcripts are
both highly expressed in C. gigas infected with OsHV-1
(He et al., 2015; Rosani et al., 2014). We confirmed that
C. gigas viperin has the same level of antiviral activity as
human viperin against DENV-2 (Fig. 6), although
C. gigas viperin did not localize to the same cellular compartment as vertebrate viperin. Helbig et al. (2013) confirmed that the anti-DENV effect of human viperin is
http://jgv.microbiologyresearch.org
Herpesviruses are renowned for their ability to modulate the
host’s immune response and co-opt host antiviral proteins to
facilitate the infectious process (Aresté & Blackbourn, 2009;
White et al., 2012). Both HCMV (human herpesvirus-5) and
human herpesvirus-1 [herpes simplex virus type 1 (HSV-1)]
have been shown to counteract viperin’s antiviral activities
(Seo et al., 2011; Shen et al., 2014). The HCMV vMIA protein has been demonstrated to interact with viperin, resulting
in the relocalization of viperin from the ER to the mitochondria, where it reduces cellular ATP generation, resulting in
actin cytoskeleton disruption and enhancement of HCMV
infection (Seo et al., 2011). HSV-1 does not co-opt viperin;
rather, the endoribonuclease activity of its UL41 protein has
been shown to restrict viperin mRNA accumulation and to
abolish its ability to limit HSV-1 infection (Shen et al.,
2014). It is presumed that OsHV-1 can also modulate the
immune response of C. gigas, as the viral genome encodes
four inhibitors of apoptosis that are highly expressed
during the early stages of infection (Green et al., 2015b;
Segarra et al., 2014a, b). There are fewer data available
regarding the ability of OsHV-1 to modulate the other
evolutionarily conserved antiviral proteins, such as viperin.
Interestingly, younger developmental stages of C. gigas
induce viperin to higher expression levels when infected
with OsHV-1 (unpublished data) and these earlier developmental stages also happen to be more susceptible to OsHV-1
infection (Paul-Pont et al., 2014; Peeler et al., 2012). Further
research is therefore warranted to determine whether OsHV1 diverts viperin from its antiviral role and co-opts it to
facilitate the infection process.
In vertebrates, viperin is a highly inducible gene and its
expression rapidly increases following viral infections and
treatment with poly(I : C) and LPS (reviewed by Helbig &
Beard, 2014; Mattijssen & Pruijn, 2012). We conducted
several in vitro experiments to determine which pathogenassociated ligands and sensors are responsible for inducing
C. gigas viperin. In contrast to vertebrates, C. gigas viperin
was induced by poly(I : C) but not by LPS (Fig. 3). These
results suggest that viral replication products, such as
dsRNA, are responsible for inducing viperin expression
in C. gigas haemocytes via a TLR or retinoic acid inducible
gene I-like helicase (RLH) sensor. In vivo experiments
revealed viperin expression is delayed in C. gigas haemocytes following poly(I : C)-injection when compared
with other animals from the vertebrate phylum. Vertebrate cells usually express viperin within 2 h following
a stimulus, and its expression typically peaks between 4
and 6 h following stimulation with poly(I : C) (Goossens
et al., 2015; Zhang et al., 2014), whereas haemocyte
expression of C. gigas viperin remained stable for the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
3593
T. J. Green and others
first 9 h after poly(I : C)-injection and did not peak until
27 h post-injection (Fig. 2a). Poly(I : C)-injection in the
adductor muscle also resulted in the upregulation of
C. gigas viperin in the majority of tissue compartments
(Fig. 2b). Several plausible explanations for the delayed
but systemic expression of C. gigas viperin are that: (i)
stimulated haemocytes migrate from the site of poly(I : C)
injection to other tissue compartments; (ii) poly(I : C) diffuses from the site of injection to other tissue compartments;
or (iii) poly(I : C) induces the cells within the adductor
muscle to secrete a type I IFN cytokine. We therefore devised
several experiments to indirectly test whether C. gigas has a
type I IFN response. Genes with clear homology to type I
IFNs have been identified in tetrapods (amphibians, reptiles,
birds and mammals) and fishes but not in non-vertebrate
chordates (tunicates or lancelets). This has previously been
taken to suggest that IFNs first evolved in early vertebrates
(Langevin et al., 2013). However, another interpretation is
that functionally active IFNs from other animal groups
simply lack sufficient sequence conservation with their vertebrate counterparts to be identified by homology searches.
Comparisons of mammalian and teleost IFNs reveal low
overall amino acid similarity (v25 %) and a dissimilar
gene domain architecture of type I IFNs even within the vertebrate phylum (Robertsen, 2006). Our results showed that
C. gigas injected with poly(I : C) produced a haemolymph
compound that activated viperin expression in primary
haemocyte cell cultures in conjunction with upregulation of
IRF and JAK/STAT (Fig. 4b). Furthermore, this compound(s)
is likely to be a heat-stable protein/peptide (cytokine) because
its activity was retained after digestion with RNase A and heat
inactivation (Fig. 4c) but was eliminated by proteinase
K digestion. Previous research has shown that all type I
IFNs from vertebrates are heat stable (Oritani et al., 2003).
Conclusion
In summary, our results provide further support to the
concept of an ancient type I IFN response existing in the
common metazoan ancestor. We demonstrated that
C. gigas viperin has direct antiviral activity and provided
evidence that viperin expression is induced by non-specific
dsRNA via a haemolymph protein/peptide (cytokine).
Research is currently underway to purify this haemolymph
protein/peptide(s) that activates viperin expression. The
existence of a type I IFN response in the oyster creates
exciting new possibilities for future research into novel
therapeutic treatments for viral diseases that are threatening global aquaculture production.
Primary cell culture and pathogen-associated molecular patterns (PAMP) stimulation. Experiments investigating the effects of
PAMPs on naı̈ve haemocytes were carried out using primary
haemocyte cell cultures that were established from individual oysters.
Six primary cell cultures were established from individual C. gigas
according to previously published procedures (Morga et al., 2011;
Renault et al., 2011). Briefly, haemolymph was withdrawn from
the pericardial cavity using a sterile 21-gauge needle and syringe.
Haemolymph from individual oysters was kept separate and divided
into seven replicate wells of a 24-well tissue culture plate (0.4 ml per
well). Haemocytes were allowed to adhere to the tissue culture wells
for 30 min at 22 uC before the acellular fraction of the haemolymph
was removed from each well, filtered (0.2 mm) and retained on ice.
Adhered haemocytes were washed three times with sterile seawater
before 0.4 ml acellular haemolymph with 2 % (v/v) penicillin/streptomycin was replaced as the culture medium. Three concentrations of
the PAMPs poly(I : C) and LPS (5.0, 0.5 and 0.05 mg.ml21) were
prepared in seawater and 20 ml PAMP suspension (control5seawater)
was added to each well. Haemocytes from each individual oyster were
therefore exposed to three concentrations of poly(I : C) and LPS.
Haemocytes were incubated for 6 h at 22 uC in a humid incubator and
then used for RNA extraction. This set of experiments was repeated
on two separate occasions.
Stimulation of naı̈ve haemocytes with haemolymph collected
from oysters injected with poly(I : C). Six adult oysters were
injected with either 100 ml poly(I : C) or with seawater as above.
Haemolymph from poly(I : C)-injected and control oysters was collected at 27 h post-injection using a 21-gauge needle and syringe,
pooled and filtered (0.2 mm), and the acellular fraction of the
haemolymph was retained on ice.
Primary haemocyte cultures were established from individual oysters
(n56) as described above. Pooled haemolymph from poly(I : C)- and
seawater-injected adult oysters was used as the culture medium to
determine whether a haemolymph component induced viperin expression (Fig. 7). Additional treatments included digestion of the
haemolymph from poly(I : C)-injected oysters with RNase A (3.3 mg
ml21, 37 uC, 1.5 h), proteinase K (0.1 mg ml21, 37 uC, 1.5 h) and heat
inactivation (85 uC for 15 min) before using as culture medium.
Haemolymph from poly(I : C)-injected oysters was also diluted with
haemolymph from control oysters (20 %, v/v) before being used as a
culture medium. Haemocytes were incubated for 6 h at 22 uC in a
humid incubator and then used for RNA extraction. This set of
experiments was repeated on two separate occasions.
RNA extraction and quantitative reverse transcription PCR (RTqPCR). Total RNA was purified from oyster samples using TriSure
(Bioline) and reverse transcribed using a Tetro cDNA synthesis kit
(Bioline). Quantitative real-time PCR was performed in a ViiA7
thermocycler (Applied Biosystems), as described previously, using the
primers in Table 1, which included the internal reference gene eEF1a
(Green et al., 2014b).
Oyster viperin coding sequence and synthesis. The complete
METHODS
Oyster challenge experiments. Juvenile oysters (C. gigas) had a
notch filed in their shell adjacent to their adductor muscle to allow
delivery of poly(I : C) (5 mg ml21 in seawater; Sigma) according to
previous published procedures (Green & Barnes, 2009; Green et al.,
2014b). At 0 h, oysters were injected with 50 ml poly(I : C) or seawater
(control) and placed in replicated aquariums (salinity 35 p.p.t., 19 uC,
3594
aerated). Six oysters per treatment were sampled at 0, 3, 9, 27 and 54 h
post-injection. Sampling consisted of excising oyster tissues, snap
freezing in liquid nitrogen and storage at 280 uC for RNA extraction.
The oysters were not fed for the duration of the experiment.
coding sequence of oyster viperin was amplified from cDNA samples
of oysters injected with poly(I : C) (n54, 27 h p.i.), using the primers
59-ACATGGCTATTACGCSGTAC-39 and 59-CCAGGATTACAAATCGAC-39. PCR amplicons were DNA sequenced at the Australian
Genome Research Facility. The N-terminal FLAG-tagged oyster
viperin was generated in two steps. The consensus nucleotide
sequence of oyster viperin was directly synthesized (GenScript USA)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
Journal of General Virology 96
Oyster viperin has direct antiviral activity
(i) Oysters stimulated with dsRNA
[poly(I : C)] or seawater (control).
(n = 6 oysters per treatment) for
24 h in aerated aquaria.
(iii) Haemocytes collected from
unstimulated oysters
(n = 6 oysters).
(ii) Haemolymph collected, pooled
and 0.2 µm filtered. Cell-free
haemolymph used as
culture medium.
(iv) Haemocytes from individual
oysters split into individual
wells and exposed to both
poly(I : C)-stimulated and
control haemolymph.
(v) Haemocytes cultured at
22 °C for 6 h. RNA
purified using TriSure.
Poly(I : C), positive control;
seawater, negative control.
Fig. 7. Methodology used to evaluate the effect of haemolymph from oysters treated with poly(I : C) or seawater (control) on
viperin expression in haemocytes from naı̈ve oysters. The acellular fraction of the haemolymph was collected from C. gigas
stimulated with poly(I : C) or seawater (control). The acellular fraction of the haemolymph was then used as a culture medium
to determine whether a haemolymph component induced haemocyte expression of viperin.
into the pUC57 vector. pUC57-viperin was PCR amplified using the
primers 59-TTATGCTAGCATGGACTACAAGGATGACGACGATAAGATGGCTATTACGCAGTACGTCAGC-39 and 59-TTATCTCGAGTTACCAATCGAGCTTCATATCGGC-39. The resulting PCR amplicon
was double digested with Nhe I and Xho I and subcloned into the
pCI-neo expression vector (Promega). Vector sequences were verified
by DNA sequencing.
Immunostaining and co-localization studies. The human hep-
atocellular carcinoma cell lineHuh-7 were cultured on gelatin-coated
glass coverslips and transiently transfected with plasmids expressing
human or oyster viperin that were FLAG tagged at their N terminus in
the vector pCI-neo. Co-transfection was performed with vectors
expressing either MCherry–ADRP or a caveolin-1–GFP. Cells were
fixed in 4 % paraformaldehyde at 24 h post-transfection (Eyre et al.,
Table 1. Primer pairs used in RT-qPCR expression analysis
The GenBank accession number is provided for each gene. STING, Stimulator of IFN genes; viperin, virus inhibitory protein, ER-associated, IFN
inducible.
Gene name
Accession no.
EFU
TLR
RLH
STING
IRF
SOC
JAK
STAT5A
STAT6
PKR
Viperin
ABI22066
–
EKC38304
EKC29965
EKC43155
EKC24772
EKC41693
EKC37809
EKC39332
EKC34807
EKC28205
http://jgv.microbiologyresearch.org
Sense primer (59R39)
Antisense primer (59R39)
GAGCGTGAACGTGGTATCAC
GCAGGACTCCACTTTCTCAC
CAACAACATGGGAAGTATGGTG
CTGCTATTGTCCGCCATC
CGAAACGCAGAAACTGTTC
CAAGAGAGAATCTGTGGGAAC
AGAACACCTACCTTCCTGTG
AGCTCAGAGTCCTCTGTG
AGCAGCAGACAGGCAACAC
GAGCATCAGCAAAGTGTTGAG
GCTTTGACCCGGAAACCAAC
ACAGCACAGTCAGCCTGTGA
GTTGGCACCCAGGTAAAGG
TCGGTCTGTTAACTGCGGAC
GAATGGGCGTGGCATACTC
ATTTGCCTTCCATCTTTTGG
GCATCTTAGCACTAATTCTCTC
TGAGCCACGTCACTTATCATC
ACACTGTTAGTCTGGATACTC
ACTGGGCTCATTTGCTGGTC
GTAGCACCAGGAGATGGTTC
TGACACCAATCCCGAACTCG
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
3595
T. J. Green and others
2007, 2014), washed in PBS and permeabilized in 1 % NP-40, before
blocking in 5 % (w/v) BSA in PBS. FLAG-tagged viperin was visualized using an anti-FLAG mouse antibody (Sigma) and either a goat
anti-mouse IgG–Alexa Fluor 488 or a goat anti-mouse IgG–Alexa
Fluor 555 (Molecular Probes) and counterstained with DAPI.
Florescence was visualized using a Nikon TiE inverted microscope
where serial Z-sections were acquired and deconvoluted using the 3D
AutoQuant Blind Deconvolution plug-in of NIS Elements AR v.3.22.
Images are single representative Z-sections.
DENV assay. Huh-7 cells were seeded in a 12-well dish and infected
24 h after seeding at an m.o.i. of 1 for 90 min at 37 uC with DENV-2
in a volume of 300 ml per well as described previously (Milic et al.,
2015). Cells were then washed with PBS three times before being
reincubated in culture medium. At 24 h p.i., the cells were harvested
for RNA purification as described above, and real-time PCR was
performed utilizing the DENV-2-specific primers 59-ATCCTCCTATGGTACGCACAAA-39 and 59-CTCCAGTATTATTGAAGCTGCTATCC-39 in combination with primers for the internal RPLPO (large
ribosomal protein) reference gene: 59-AGATGCAGCAGATCCGCAT-39 and 59-GGATGGCCTTGCGCA-39.
Goossens, K. E., Karpala, A. J., Rohringer, A., Ward, A. & Bean,
A. G. D. (2015). Characterisation of chicken viperin. Mol Immunol
63, 373–380.
Green, T. J. & Barnes, A. C. (2009). Inhibitor of REL/NF-KB is
regulated in Sydney rock oysters in response to specific doublestranded RNA and Vibrio alginolyticus, but the major immune antioxidants EcSOD and Prx6 are non-inducible. Fish Shellfish Immunol
27, 260–265.
Green, T. J. & Montagnani, C. (2013). Poly I:C induces a protective
antiviral immune response in the Pacific oyster (Crassostrea gigas)
against subsequent challenge with Ostreid herpesvirus (OsHV-1
mvar). Fish Shellfish Immunol 35, 382–388.
Green, T. J., Benkendorff, K., Robinson, N., Raftos, D. & Speck, P.
(2014a). Anti-viral gene induction is absent upon secondary
challenge with double-stranded RNA in the Pacific oyster, Crassostrea
gigas. Fish Shellfish Immunol 39, 492–497.
Green, T. J., Montagnani, C., Benkendorff, K., Robinson, N. & Speck,
P. (2014b). Ontogeny and water temperature influences the antiviral
response of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol
36, 151–157.
Green, T. J., Raftos, D., Speck, P. & Montagnani, C. (2015a). Antiviral
immunity in marine molluscs. J Gen Virol 96, 2471–2482.
Green, T. J., Rolland, J.-L., Vergnes, A., Raftos, D. & Montagnani, C.
(2015b). OsHV-1 countermeasures to the Pacific oyster’s anti-viral
ACKNOWLEDGEMENTS
response. Fish Shellfish Immunol 47, 435–443.
The authors acknowledge the funding provided by Macquarie University postdoctoral research scheme (MQ grant 9201300681), Australian Seafood Cooperative Research Centre (CRC project no. 2011/
758) and the Australian National Health and Medical Research
Council (NHMRC programme grant APP1053206). The authors also
acknowledge Gary Zippel, Kevin McAsh and Ewan McAsh for
providing oysters for research.
He, Y., Jouaux, A., Ford, S. E., Lelong, C., Sourdaine, P., Mathieu, M. &
Guo, X. (2015). Transcriptome analysis reveals strong and complex
antiviral response in a mollusc. Fish Shellfish Immunol 46, 131–144.
Helbig, K. J. & Beard, M. R. (2014). The role of viperin in the innate
antiviral response. J Mol Biol 426, 1210–1219.
Helbig, K. J., Lau, D. T., Semendric, L., Harley, H. A. & Beard, M. R.
(2005). Analysis of ISG expression in chronic hepatitis C identifies
viperin as a potential antiviral effector. Hepatology 42, 702–710.
REFERENCES
Aresté, C. & Blackbourn, D. J. (2009). Modulation of the immune
Helbig, K. J., Eyre, N. S., Yip, E., Narayana, S., Li, K., Fiches, G.,
McCartney, E. M., Jangra, R. K., Lemon, S. M. & Beard, M. R.
(2011). The antiviral protein viperin inhibits hepatitis C virus
system by Kaposi’s sarcoma-associated herpesvirus. Trends Microbiol
17, 119–129.
replication via interaction with nonstructural protein 5A. Hepatology
54, 1506–1517.
Biron, C. A. & Sen, G. C. (2001). Interferons and other cytokines.
Helbig, K. J., Carr, J. M., Calvert, J. K., Wati, S., Clarke, J. N., Eyre, N. S.,
Narayana, S. K., Fiches, G. N., McCartney, E. M. & Beard, M. R.
(2013). Viperin is induced following dengue virus type-2 (DENV-2)
In Fields Virology, 4th edn, pp. 321–351. Edited by D. M. Knipe,
P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman &
S. E. Straus. Philadelphia, PA: Lippincott Williams & Wilkins.
Chin, K.-C. & Cresswell, P. (2001). Viperin (cig5), an IFN-inducible
antiviral protein directly induced by human cytomegalovirus. Proc
Natl Acad Sci U S A 98, 15125–15130.
Duan, H., Jin, S., Zhang, Y., Li, F. & Xiang, J. (2014). Granulocytes of the
red claw crayfish Cherax quadricarinatus can endocytose beads, E. coli
and WSSV, but in different ways. Dev Comp Immunol 46, 186–193.
Eyre, N. S., Cleland, L. G., Tandon, N. N. & Mayrhofer, G. (2007).
Importance of the carboxyl terminus of FAT/CD36 for plasma
membrane localization and function in long-chain fatty acid
uptake. J Lipid Res 48, 528–542.
Eyre, N. S., Fiches, G. N., Aloia, A. L., Helbig, K. J., McCartney, E. M.,
McErlean, C. S. P., Li, K., Aggarwal, A., Turville, S. G. & Beard, M. R.
(2014). Dynamic imaging of the hepatitis C virus NS5A protein
during a productive infection. J Virol 88, 3636–3652.
Gabor, K. A., Stevens, C. R., Pietraszewski, M. J., Gould, T. J., Shim,
J., Yoder, J. A., Lam, S. H., Gong, Z., Hess, S. T. & Kim, C. H. (2013).
Super resolution microscopy reveals that caveolin-1 is required for
spatial organization of CRFB1 and subsequent antiviral signaling in
zebrafish. PLoS One 8, e68759.
3596
infection and has anti-viral actions requiring the C-terminal end of
viperin. PLoS Negl Trop Dis 7, e2178.
Hinson, E. R. & Cresswell, P. (2009a). The antiviral protein, viperin,
localizes to lipid droplets via its N-terminal amphipathic a-helix. Proc
Natl Acad Sci U S A 106, 20452–20457.
Hinson, E. R. & Cresswell, P. (2009b). The N-terminal amphipathic
a-helix of viperin mediates localization to the cytosolic face of the
endoplasmic reticulum and inhibits protein secretion. J Biol Chem
284, 4705–4712.
Huang, Z.-J., Kang, S.-T., Leu, J.-H. & Chen, L.-L. (2013). Endocytic
pathway is indicated for white spot syndrome virus (WSSV) entry
in shrimp. Fish Shellfish Immunol 35, 707–715.
Langevin, C., Aleksejeva, E., Passoni, G., Palha, N., Levraud, J.-P. &
Boudinot, P. (2013). The antiviral innate immune response in fish:
evolution and conservation of the IFN system. J Mol Biol 425,
4904–4920.
Lei, M., Liu, H., Liu, S., Zhang, Y. & Zhang, S. (2015). Identification and
functional characterization of viperin of amphioxus Branchiostoma
japonicum: implications for ancient origin of viperin-mediated
antiviral response. Dev Comp Immunol 53, 293–302.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
Journal of General Virology 96
Oyster viperin has direct antiviral activity
Loker, E. S., Adema, C. M., Zhang, S.-M. & Kepler, T. B. (2004).
Invertebrate immune systems – not homogeneous, not simple, not
well understood. Immunol Rev 198, 10–24.
Mattijssen, S. & Pruijn, G. J. M. (2012). Viperin, a key player in the
antiviral response. Microbes Infect 14, 419–426.
Milic, N. L., Davis, S., Carr, J. M., Isberg, S., Beard, M. R. & Helbig, K. J.
(2015). Sequence analysis and characterisation of virally induced
ostreid herpesvirus 1-positive Crassostrea gigas. Environ Microbiol,
[Epub ahead of print].
Schoggins, J. W. & Rice, C. M. (2011). Interferon-stimulated genes
and their antiviral effector functions. Curr Opin Virol 1, 519–525.
Segarra, A., Pépin, J. F., Arzul, I., Morga, B., Faury, N. & Renault, T.
(2010). Detection and description of a particular Ostreid herpesvirus
1 genotype associated with massive mortality outbreaks of Pacific
oysters, Crassostrea gigas, in France in 2008. Virus Res 153, 92–99.
viperin in the saltwater crocodile (Crocodylus porosus). Dev Comp
Immunol 51, 108–115.
Segarra, A., Faury, N., Pépin, J.-F. & Renault, T. (2014a).
Morga, B., Arzul, I., Faury, N., Segarra, A., Chollet, B. & Renault, T.
(2011). Molecular responses of Ostrea edulis haemocytes to an
Transcriptomic study of 39 ostreid herpesvirus 1 genes during an
experimental infection. J Invertebr Pathol 119, 5–11.
in vitro infection with Bonamia ostreae. Dev Comp Immunol 35,
323–333.
Nasr, N., Maddocks, S., Turville, S. G., Harman, A. N., Woolger, N.,
Helbig, K. J., Wilkinson, J., Bye, C. R., Wright, T. K. & other authors
(2012). HIV-1 infection of human macrophages directly induces
viperin which inhibits viral production. Blood 120, 778–788.
Oritani, K., Hirota, S., Nakagawa, T., Takahashi, I., Kawamoto, S.,
Yamada, M., Ishida, N., Kadoya, T., Tomiyama, Y. & other authors
(2003). T lymphocytes constitutively produce an interferonlike
cytokine limitin characterized as a heat- and acid-stable and
heparin-binding glycoprotein. Blood 101, 178–185.
Segarra, A., Mauduit, F., Faury, N., Trancart, S., Dégremont, L.,
Tourbiez, D., Haffner, P., Barbosa-Solomieu, V., Pépin, J.-F. & other
authors (2014b). Dual transcriptomics of virus-host interactions:
comparing two Pacific oyster families presenting contrasted
susceptibility to ostreid herpesvirus 1. BMC Genomics 15, 580–592.
Seo, J.-Y., Yaneva, R., Hinson, E. R. & Cresswell, P. (2011). Human
cytomegalovirus directly induces the antiviral protein viperin to
enhance infectivity. Science 332, 1093–1097.
Shen, G., Wang, K., Wang, S., Cai, M., Li, M.-L. & Zheng, C. (2014).
Herpes simplex virus 1 counteracts viperin via its virion host
shutoff protein UL41. J Virol 88, 12163–12166.
Parton, R. G. & Simons, K. (2007). The multiple faces of caveolae. Nat
Smith, A. E. & Helenius, A. (2004). How viruses enter animal cells.
Paul-Pont, I., Evans, O., Dhand, N. K., Rubio, A., Coad, P. &
Whittington, R. (2014). Descriptive epidemiology of mass mortality
Takaoka, A., Mitani, Y., Suemori, H., Sato, M., Yokochi, T., Noguchi,
S., Tanaka, N. & Taniguchi, T. (2000). Cross talk between interferon-c
Rev Mol Cell Biol 8, 185–194.
Science 304, 237–242.
due to Ostreid herpesvirus-1 (OsHV-1) in commercially farmed
Pacific oysters (Crassostrea gigas) in the Hawkesbury River estuary.
Aust Aquacult 422–423, 146–159.
Peeler, E. J., Reese, R. A., Cheslett, D. L., Geoghegan, F., Power, A. &
Thrush, M. A. (2012). Investigation of mortality in Pacific oysters
associated with Ostreid herpesvirus-1 mVar in the Republic of
Ireland in 2009. Prev Vet Med 105, 136–143.
Randall, R. E. & Goodbourn, S. (2008). Interferons and viruses: an
interplay between induction, signalling, antiviral responses and
virus countermeasures. J Gen Virol 89, 1–47.
Renault, T., Faury, N., Barbosa-Solomieu, V. & Moreau, K. (2011).
and -a/b signaling components in caveolar membrane domains.
Science 288, 2357–2360.
Teng, T. S., Foo, S. S., Simamarta, D., Lum, F. M., Teo, T. H., Lulla, A.,
Yeo, N. K., Koh, E. G., Chow, A. & other authors (2012). Viperin
restricts chikungunya virus replication and pathology. J Clin Invest
122, 4447–4460.
Wang, X., Hinson, E. R. & Cresswell, P. (2007). The interferoninducible protein viperin inhibits influenza virus release by
perturbing lipid rafts. Cell Host Microbe 2, 96–105.
Wang, B., Zhang, Y.-B., Liu, T.-K. & Gui, J.-F. (2014a). Sequence
analysis and subcellular localization of crucian carp Carassius
auratus viperin. Fish Shellfish Immunol 39, 168–177.
Suppression substractive hybridisation (SSH) and real time PCR
reveal differential gene expression in the Pacific cupped oyster,
Crassostrea gigas, challenged with Ostreid herpesvirus 1. Dev Comp
Immunol 35, 725–735.
Wang, B., Zhang, Y.-B., Liu, T.-K., Shi, J., Sun, F. & Gui, J.-F. (2014b).
Renault, T., Tchaleu, G., Faury, N., Moreau, P., Segarra, A., BarbosaSolomieu, V. & Lapegue, S. (2014). Genotyping of a microsatellite locus
Wang, P.-H., Weng, S.-P. & He, J.-G. (2015). Nucleic acid-induced
to differentiate clinical Ostreid herpesvirus 1 specimens. Vet Res 45, 3.
Fish viperin exerts a conserved antiviral function through RLRtriggered IFN signaling pathway. Dev Comp Immunol 47, 140–149.
antiviral immunity in invertebrates: an evolutionary perspective.
Dev Comp Immunol 48, 291–296.
Robalino, J., Browdy, C. L., Prior, S., Metz, A., Parnell, P., Gross, P. &
Warr, G. (2004). Induction of antiviral immunity by double-stranded
White, D. W., Suzanne Beard, R. & Barton, E. S. (2012). Immune
Robalino, J., Bartlett, T., Shepard, E., Prior, S., Jaramillo, G., Scura,
E., Chapman, R. W., Gross, P. S., Browdy, C. L. & Warr, G. W.
(2005). Double-stranded RNA induces sequence-specific antiviral
Yoshino, T. P., Bickham, U. & Bayne, C. J. (2013). Molluscan cells in
RNA in a marine invertebrate. J Virol 78, 10442–10448.
silencing in addition to nonspecific immunity in a marine shrimp:
convergence of RNA interference and innate immunity in the
invertebrate antiviral response? J Virol 79, 13561–13571.
Robertsen, B. (2006). The interferon system of teleost fish. Fish
modulation during latent herpesvirus infection. Immunol Rev 245,
189–208.
culture: primary cell cultures and cell lines. Can J Zool 91, 391–404.
Zhang, B.-C., Zhang, J., Xiao, Z.-Z. & Sun, L. (2014). Rock bream
(Oplegnathus fasciatus) viperin is a virus-responsive protein that
modulates innate immunity and promotes resistance against
megalocytivirus infection. Dev Comp Immunol 45, 35–42.
Shellfish Immunol 20, 172–191.
Zhong, Z., Ji, Y., Fu, Y., Liu, B. & Zhu, Q. (2015). Molecular
Rosani, U., Varotto, L., Domeneghetti, S., Arcangeli, G., Pallavicini, A. &
Venier, P. (2014). Dual analysis of host and pathogen transcriptomes in
characterization and expression analysis of the duck viperin gene.
Gene 570, 100–107.
http://jgv.microbiologyresearch.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 17:46:58
3597