University of Iowa
Iowa Research Online
Theses and Dissertations
Fall 2009
Involvement of purinergic P2X and P2Y2 receptors
in urinary bladder sensation
Xiaowei Chen
University of Iowa
Copyright 2009 Xiaowei Chen
This dissertation is available at Iowa Research Online: http://ir.uiowa.edu/etd/343
Recommended Citation
Chen, Xiaowei. "Involvement of purinergic P2X and P2Y2 receptors in urinary bladder sensation." PhD (Doctor of Philosophy) thesis,
University of Iowa, 2009.
http://ir.uiowa.edu/etd/343.
Follow this and additional works at: http://ir.uiowa.edu/etd
Part of the Neuroscience and Neurobiology Commons
INVOLVEMENT OF PURINERGIC P2X AND P2Y2 RECEPTORS IN URINARY
BLADDER SENSATION
by
Xiaowei Chen
An Abstract
Of a thesis submitted in partial fulfillment
of the requirements for the Doctor of
Philosophy degree in Neuroscience
in the Graduate College of
The University of Iowa
December 2009
Thesis Supervisor: Professor Emeritus G. F. Gebhart
1
ABSTRACT
Interstitial cystitis (IC)/painful bladder syndrome (PBS) is a functional
visceral disorder characterized by increased bladder activity and chronic pelvic
pain in the absence of a pathobiological condition. Enhanced sensory
transduction of peripheral bladder afferents is hypothesized to contribute to the
pain and mechanical hypersensitivity of IC/PBS patients. The aim of this thesis is
to test the hypothesis that purinergic receptors, including ionotropic P2X and
metabotropic P2Y, are important for sensory transmission in bladder afferent
neurons and may be involved in bladder hypersensitivity after bladder tissue
insults. Electrophysiological, single cell RT-PCR and immunohistochemistry
techniques were performed in bladder afferent neurons from naïve and bladder
inflamed mice to test the hypothesis.
In Chapter 2, I characterized the distribution and function of P2X receptors
in thoracolumbar (TL) and lumbosacral (LS) dorsal root ganglia (DRG) neurons
innervating the urinary bladder, and found that LS and TL bladder neurons have
differential purinergic signaling and distinct membrane electrical properties. In
Chapter 3, I examined the sensitization of bladder afferent neurons and the
plasticity of P2X receptor function in a mouse model of chemical induced bladder
inflammation. P2X-mediated signals in LS and TL bladder neurons after bladder
inflammation were enhanced compared with those in saline-treated controls,
suggesting the importance of P2X in bladder hypersensitivity associated with
cystitis. In Chapter 4, the modulation of P2Y on P2X function and the colocalization of P2Y and P2X were examined in bladder sensory neurons. It has
been found that P2Y2 receptor enhances bladder sensory neuron excitability and
2
facilitates the response of homomeric P2X2 receptor to the purinergic agonist
(ATP). The present study provides evidence that LS and TL mouse bladder
sensory neurons exhibit distinct P2X signaling, and the function of P2X receptors
could be facilitated during bladder inflammation and modulated by activation of
P2Y2 receptor, indicating an involvement of P2X and P2Y2 receptors as
mechano- and chemosensors in bladder sensory transmission under normal
conditions and in bladder hypersensitivity associated with inflammation.
Abstract Approved: ________________________________________________
Thesis Supervisor
_________________________________________________
Title and Department
_________________________________________________
Date
INVOLVEMENT OF PURINERGIC P2X AND P2Y2 RECEPTORS IN URINARY
BLADDER SENSATION
by
Xiaowei Chen
A thesis submitted in partial fulfillment
of the requirements for the Doctor of
Philosophy degree in Neuroscience
in the Graduate College of
The University of Iowa
December 2009
Thesis Supervisor: Professor Emeritus G. F. Gebhart
Graduate College
The University of Iowa
Iowa City, Iowa
CERTIFICATE OF APPROVAL
__________________________
PH.D. THESIS
____________
This is to certify that the Ph.D. thesis of
Xiaowei Chen
has been approved by the Examining Committee
for the thesis requirement for the Doctor of Philosophy
degree in Neuroscience at the December 2009 graduation.
Thesis Committee: _______________________________
G. F. Gebhart, Thesis Supervisor
_______________________________
Christopher Benson
_______________________________
Timothy Brennan
_______________________________
Michael O’Donnell
_______________________________
Yuriy M. Usachev
ACKNOWLEDGMENTS
I would like to express my thanks to many people who provided
assistance in numerous ways to make this thesis possible. It is difficult to
overstate my gratitude to my mentor Dr. Gerald F. Gebhart for his invaluable
research guidance and friendly support during my graduate study. I greatly
appreciated his inspiring input on research and scientific training on my thoughts.
With his enthusiasm, his inspiration, and his sense of humor, he has taught me
not only science but also a positive attitude to life. To me, he serves as a model
of being an outstanding scientist and virtuous person.
I would like to thank all the members of the Gebhart Laboratory who
provided a great research environment and valuable advice on my research. I
wish to thank Khoa Dang, Jun-ho La, Pablo Brumovsky, Masamichi Shinoda and
Dave Robinson for assistance with patch-clamp technique, immunostaining,
histological assessment and MPO assay. I would like to thank Dr. Derek Molliver
for his sound advice on my research project and providing P2Y2 knockout mice
used in the experiments described in Chapter 4. I wish to thank Dr. Michael Gold
and Liming Fan for their assistance with single cell RT-PCR, Dr. Julie
Christianson for her help with MPO assay, Joanne Hirt for secretarial assistance
and Michael Burcham for preparation of the figures. Without the help of the
people mentioned above, I am not able to complete this thesis.
I am grateful to members of the Pain Interest Group at the University of
Iowa and the Center for Pain Research at the University of Pittsburgh for their
intellectual contribution to work described in this thesis and my scientific
ii
development. Interactions with these intelligent people have improved my
knowledge in the field of pain research as well as the experimental design and
interpretation of experimental results. The members of my thesis committee have
provided extensive support and effect on my project and their suggestions helped
me greatly improve my research work.
Lastly, I want to express my gratitude to my husband, Qiyun. I am
indebted to him for his understand and sacrifice. His encouragement and comfort
helped me through the anxiety and frustration when experiments were not going
well. I also wish to thank my family for their selfless love and support of my
dream. Without the courage they gave me, I would not be able to pursuit a Ph.D.
degree abroad. To them I dedicate this thesis.
iii
ABSTRACT
Interstitial cystitis (IC)/painful bladder syndrome (PBS) is a functional
visceral disorder characterized by increased bladder activity and chronic pelvic
pain in the absence of a pathobiological condition. Enhanced sensory
transduction of peripheral bladder afferents is hypothesized to contribute to the
pain and mechanical hypersensitivity of IC/PBS patients. The aim of this thesis is
to test the hypothesis that purinergic receptors, including ionotropic P2X and
metabotropic P2Y, are important for sensory transmission in bladder afferent
neurons and may be involved in bladder hypersensitivity after bladder tissue
insults. Electrophysiological, single cell RT-PCR and immunohistochemistry
techniques were performed in bladder afferent neurons from naïve and bladder
inflamed mice to test the hypothesis.
In Chapter 2, I characterized the distribution and function of P2X receptors
in thoracolumbar (TL) and lumbosacral (LS) dorsal root ganglia (DRG) neurons
innervating the urinary bladder, and found that LS and TL bladder neurons have
differential purinergic signaling and distinct membrane electrical properties. In
Chapter 3, I examined the sensitization of bladder afferent neurons and the
plasticity of P2X receptor function in a mouse model of chemical induced bladder
inflammation. P2X-mediated signals in LS and TL bladder neurons after bladder
inflammation were enhanced compared with those in saline-treated controls,
suggesting the importance of P2X in bladder hypersensitivity associated with
cystitis. In Chapter 4, the modulation of P2Y on P2X function and the colocalization of P2Y and P2X were examined in bladder sensory neurons. It has
been found that P2Y2 receptor enhances bladder sensory neuron excitability and
iv
facilitates the response of homomeric P2X2 receptor to the purinergic agonist
(ATP). The present study provides evidence that LS and TL mouse bladder
sensory neurons exhibit distinct P2X signaling, and the function of P2X receptors
could be facilitated during bladder inflammation and modulated by activation of
P2Y2 receptor, indicating an involvement of P2X and P2Y2 receptors as
mechano- and chemosensors in bladder sensory transmission under normal
conditions and in bladder hypersensitivity associated with inflammation.
v
TABLE OF CONTENTS
LIST OF TABLES .................................................................................................ix
LIST OF FIGURES ............................................................................................... x
CHAPTER 1: GENERAL INTRODUCTION .......................................................... 1
The urinary bladder sensation......................................................... 1
A functional bladder disorder of visceral pain: Interstitial
cystitis/ painful bladder syndrome ................................................... 5
Contribution of purinergic signaling to bladder sensation and
pain ................................................................................................. 7
Ionotropic P2X receptors .................................................... 8
Metabotropic P2Y receptors ............................................. 11
Thesis objectives........................................................................... 13
CHAPTER 2: CHARACTERIZATION OF PURINERGIC P2X RECEPTORS
IN LUMBOSACRAL (LS) AND THORACOLUMBAR (TL)
BLADDER SENSORY NEURONS .............................................. 14
Introduction ................................................................................... 14
Results .......................................................................................... 16
Cell density and size distribution of bladder sensory
neurons............................................................................. 16
Characterization of bladder sensory neuron
responses to purinergic receptor agonists ........................ 17
Characterization of P2X receptor subtypes in bladder
sensory neurons ............................................................... 18
Electrophysiological properties of LS and TL bladder
sensory neurons ............................................................... 20
P2X receptor expression in bladder sensory neurons ...... 21
Discussion..................................................................................... 23
Differences between LS and TL bladder sensory
neurons............................................................................. 23
CHAPTER 3: PURINERGIC P2X SIGNALING IN BLADDER SENSORY
NEURONS AFTER BLADDER INFLAMMATION.......................... 29
Introduction ................................................................................... 29
Results .......................................................................................... 31
Bladder inflammation and tissue damage after CYP
treatment .......................................................................... 31
Bladder sensory neuron excitability increases after
CYP treatment .................................................................. 32
P2X receptor mediated currents after CYP treatment ...... 32
vi
P2X receptor expression in bladder sensory neurons
after CYP treatment .......................................................... 34
Discussion..................................................................................... 36
CYP treatment induces moderate bladder
inflammation ..................................................................... 36
Bladder sensory neurons exhibit increased cell
excitability after bladder inflammation............................... 37
P2X function in bladder afferent neurons is enhanced
after bladder inflammation ................................................ 38
P2X expression in bladder sensory neurons after
bladder inflammation ........................................................ 41
CHAPTER 4: EFFECT OF METABOTROPIC P2Y2 RECEPTOR ON
BLADDER SENSORY NEURON EXITABILITY AND P2X
RECEPTOR FUNCTION............................................................... 43
Introduction ................................................................................... 43
Results .......................................................................................... 45
UTP increases bladder sensory neuron excitability .......... 45
Effect of UTP on purinergic agonist-evoked responses.... 47
Metabotropic P2Y2 receptor mediates the effect of
UTP .................................................................................. 51
P2X and P2Y receptor expression in bladder sensory
neurons............................................................................. 52
Discussion..................................................................................... 54
CHAPTER 5: GENERAL CONCLUSIONS AND DISCUSSION ......................... 59
Overview of experiment results ..................................................... 59
Differential purinergic signaling in LS and TL bladder sensory
neurons ......................................................................................... 59
Contribution of P2X2 and P2X3 receptors to bladder sensory
transmission .................................................................................. 61
Contribution of P2Y2 receptor to bladder sensory
transmission .................................................................................. 64
Future directions ........................................................................... 65
CHAPTER 6: MATERIALS AND METHODS...................................................... 67
Animals ......................................................................................... 67
Bladder neuron retrograde labeling............................................... 67
Cell dissociation and culturing....................................................... 67
Whole cell current- and voltage-patch clamp recording ................ 68
Urinary bladder inflammation ........................................................ 69
Bladder myeloperoxidase (MPO) assay........................................ 70
Histological examination of bladder inflammation ......................... 70
Single cell RT-PCR ....................................................................... 71
vii
Multiplex PCR and gene specific nested PCR .............................. 71
Immunohistochemistry .................................................................. 72
Data and statistical analysis .......................................................... 73
REFERENCES ................................................................................................. 134
viii
LIST OF TABLES
Table 1. Purinergic currents in LS and TL bladder sensory neurons from
naïve mice............................................................................................ 75
Table 2. Properties of purinergic currents in LS and TL bladder sensory
neurons from naive mice ...................................................................... 76
Table 3. Passive and active electrical properties of LS and TL bladder
sensory neurons................................................................................... 77
Table 4. Summary of P2X3 immunoreactivity in LS and TL bladder DRG
neurons from naïve, saline- and CYP-treated mice.............................. 78
Table 5. Passive and active electrical properties of LS and TL bladder
neurons from saline- and CYP-treated mice ........................................ 79
Table 6. Purinergic currents in LS and TL bladder sensory neurons from
saline- and CYP-treated mice ............................................................. 80
Table 7. Properties of purinergic currents in LS and TL bladder sensory
neurons from saline- and CYP-treated mice ........................................ 81
Table 8. Passive and active electrical properties of LS bladder neurons in
the absence and the presence of UTP or UTP and suramin (SUR)
application ............................................................................................ 82
Table 9. Summary of contribution of P2X and P2Y receptors to mouse
bladder sensation ................................................................................. 83
Table 10. External and internal primers for mouse P2X2, P2X3, P2Y2,
P2Y4 and GAPDH cDNA ..................................................................... 84
ix
LIST OF FIGURES
Figure 1. The density of bladder pelvic and hypogastric innervations in
cultured lumbosacral (LS) and thoracolumbar (TL) mouse DRG
neurons .............................................................................................. 85
Figure 2. Comparison of cell size (capacitance) of LS and TL mouse
bladder sensory neurons .................................................................... 87
Figure 3. Examples of principal purinergic currents in LS and TL bladder
sensory neurons in response to ATP (30μM) and αβ-Met ATP
(30μM) ................................................................................................ 89
Figure 4. Antagonism of purinergic agonist-evoked sustained currents ............. 91
Figure 5. Antagonism of purinergic agonist-evoked slow desensitizing
currents .............................................................................................. 93
Figure 6. Antagonism of purinergic agonist-evoked fast desensitizing
currents .............................................................................................. 95
Figure 7. Examples of principal purinergic current in P2X3-/- mice .................... 97
Figure 8. Examples of bladder sensory neuron responses to current
injection and agonist application......................................................... 99
Figure 9. Single cell nested RT-PCR of P2X2 and P2X3 receptor
subunits in LS and TL bladder neurons ............................................ 101
Figure 10. Immunohistochemistry of P2X3 subunit in bladder sensory
neurons from naïve mice .................................................................. 103
Figure 11. Bladder weight and bladder myeloperoxidase (MPO) activity in
naïve saline- and CYP-treated mice ................................................. 105
Figure 12. Histological assessment of bladder inflammation in saline- and
CYP- treated mice ............................................................................ 107
Figure 13. Examples of responses of bladder sensory neurons to current
injection and agonist application in saline- and CYP- treated
mice.................................................................................................. 109
Figure 14. Single cell nested RT-PCR of P2X2 and P2X3 receptor
subunits in LS and TL bladder neurons from saline- and CYPtreated mice...................................................................................... 111
x
Figure 15. Immunohistochemistry of P2X3 subunit in bladder sensory
neurons from saline-treated and CYP-treated mice.......................... 113
Figure 16. UTP increases the excitability of bladder sensory neurons ............. 115
Figure 17. Examples of the effect of UTP on LS bladder neuron
responses to ATP ............................................................................. 117
Figure 18. Recovery kinetics of ATP-evoked sustained, slow and fast
currents in LS bladder neurons ........................................................ 119
Figure 19. The effect of UTP on ATP-evoked sustained, slow and fast
currents in LS and TL bladder neurons ............................................ 122
Figure 20. The effect of repeated ATP application without UTP on ATPevoked sustained, slow and fast currents in LS and TL bladder
neurons ............................................................................................ 124
Figure 21. The dose-response relationship of ATP evoked-sustained
currents in response to UTP in LS bladder neurons ......................... 126
Figure 22. The facilitatory effect of UTP on ATP-evoked sustained
currents but not fast currents is mediated by G protein-coupled
P2Y2 receptor through a PKC dependent pathway. ......................... 128
Figure 23. The effect of UTP/ATP on bladder sensory neurons containing
intracellular GDP-β-S, in presence of PKC inhibitor and from
P2Y2 knockout mice......................................................................... 130
Figure 24. Single cell nested RT-PCR of P2X2, P2X3, P2Y2 and P2Y4
receptor subunits in LS and TL bladder neurons.............................. 132
xi
1
CHAPTER 1: GENERAL INTRODUCTION
The urinary bladder sensation
The urinary bladder is a hollow, muscular and distensible organ for
temporary storage and periodic elimination of urine(Alvarez et al., 2008). The
sensory input of urinary bladder is requisite for conscious bladder control and
normal bladder function, harmonizing compliance and excitation during the urine
storage phase and the voiding reflex. Sensory information from urinary bladder
travels to the central nervous system through two distinct pathways: the
hypogastric/lumbar splanchnic nerves (LSN) and the pelvic nerves (PN).
Retrograde tracing studies revealed thoracolumbar (hypogastric) and
lumbosacral (pelvic) dorsal root ganglia (DRG) as the primary source of the
bladder afferent innervation (Applebaum et al., 1980). These two sensory
pathways are suggested to have some similar, but also different functions.
Anatomically, the urinary bladder is divided into body and trigone (base)
region, consisting of several layers: serosa, muscularis, submucosa (lamina
propria), and mucosa (urothelium). Immunohistochemical staining of sensory
neuronal markers in the bladder, e.g., calcitonin gene-related peptide (CGRP),
substance P (SP) and TRPV1, has demonstrated that the bladder afferent fibers
are distributed throughout the bladder wall and the trigone region, and project
into the suburothelial lamina propria, urothelium, and detrusor smooth muscle
(Gabella and Davis, 1998;Uemura et al., 1975;Uemura et al., 1973) [for review,
see (Andersson, 2002)]. It is suggested that the hypogastric and the pelvic
bladder afferent nerve terminals may not distribute uniformly in the bladder.
2
According to a series studies in the cat, the pelvic nerve axons are evenly
distributed throughout the body and trigone regions, whereas axons from the
lumbar innervations are more abundant in the trigone region (Uemura et al.,
1973;Uemura et al., 1975). A recent study using single-fiber recording technique
on bladder-never preparation provides comparable outcomes in the mouse that
the pelvic mechanoceptive endings are distributed throughout the bladder,
whereas those of hypogastric nerves are concentrated at the base of the bladder
(Xu and Gebhart, 2008).
The bladder afferents have been revealed to consist of small myelinated
Aδ- and unmyelinated C-fiber afferents identified in both PN and LSN by
microscopy studies, and the unmyelinated C-fibers are the predominant afferent
fibers innervating the bladder (Gabella and Davis, 1998;Uvelius and Gabella,
1998;Floyd and Lawrenson, 1979;Floyd et al., 1976). Three major functional
types of bladder afferents have been reported, including mechanosensitive,
chemosensitive and silent afferents. The majority (~60%) of bladder pelvic
afferents are mechanoreceptors sensing bladder distension (Shea et al., 2000),
and their firing activities are correlated with the extent and duration of bladder
distension (Andersson and Wein, 2004;Habler et al., 1993). Compared with the
mechanosensitive afferents, the bladder chemoreceptive afferents that respond
to hypertonic solution, purinergic agonist α,β-methylene ATP, or capsaicin are
rare (<10%) in the pelvic nerves (Shea et al., 2000;Moss et al.,
1997;Zagorodnyuk et al., 2007). A population (~30%) of bladder afferents that do
not respond to either mechanical or chemical stimuli under normal conditions are
3
identified as the silent afferent in pelvic nerves (Shea et al., 2000), but the silent
fibers could be activated by irritant chemical stimuli or during bladder
inflammation (Habler et al., 1990;Yoshimura and de Groat, 1999). Therefore, the
bladder silent afferents are presumed to play an important role in bladder afferent
hyperexcitability and bladder overactivity associated with urinary urgency,
frequency and pain.
Although information about the functional properties of hypogastric/lumbar
splanchnic bladder afferents is inadequate relative to pelvic bladder afferents,
previous studies suggest that bladder hypogastric/lumbar splanchnic and pelvic
afferents may be functionally distinct. Moss et al. found that a large proportion of
hypogastric bladder afferents are chemosensitive, whereas a smaller proportion
of hypogastric bladder afferent fibers than pelvic afferents are mechanoreceptors
(Moss et al., 1997). Mitui et al. reported that signal transduction through bladder
hypogastric pathway is necessary in micturition hyperreflexia induced by noxious
chemical irritation in conscious rats. These findings suggest that
hypogastric/lumbar splanchnic afferents differ from pelvic afferents and may
signal bladder sensory information of noxious distension and/or chemical
irritation to central nervous system.
To date, the mechanisms of bladder mechanosensory transmission via PN
and LSN afferents are still not well understood. Currently, two main types of
mechanosensory transduction have been hypothesized. The direct mechanism
relies on activation of mechanically gated ion channels located on afferent
terminals. However, the molecular identity of mechanically gated ion channels is
4
still controversial. Possible candidates may include the ENaC/ASIC/degenerin
Na+ channels and transient receptor potential (TRP) channels. The indirect
mechanism relies on activation of ionotropic receptors (e.g., P2X3 receptor)
expressed on peripheral nerve terminals by chemical mediators (e.g., ATP)
released from urothelial or detrusor muscle cells in response to mechanical
stimuli. There are abundant reports that the urothelial cells release chemical
mediators such as ATP, NO and prostanoids in response to mechanical and
chemical stimulations (Birder, 2005;Birder and de Groat, 2007). To date,
numerous receptors are identified in bladder sensory neurons and afferent nerve
fibers, including TRP channels (TRPV1, TRPA1, and TRPM8), neurotrophic
factor receptors (TrkA, TrkB, and GDNF receptor), α and β estrogen receptors,
nicotinic and muscarinic receptors, and purinergic receptors (P2X2, P2X3 and
P2Y). Activation of these receptors, especially the TRP channels and the
purinergic receptors, has been proved to play an essential role in bladder afferent
activity, neurotransmitter release and micturition reflex (Bennett et al.,
1996;Bennett et al., 2003;Everaerts et al., 2008;Forrest and Keast, 2008;Zhong
et al., 2003).
Growing evidence on bladder mechano- and chemo-sensation indicates
that sensory mechanisms in the urinary bladder are likely to be complicated and
involve a coordination of a variety of chemical and mechanical signaling
pathways.
5
A functional bladder disorder of visceral pain:
Interstitial cystitis/ painful bladder syndrome
Acute pain that we have commonly experienced from environmental
stimuli, such as the heat of an iron or the prick of a sewing need, is essential for
human body protection. Painful inputs generate conscious and unconscious
withdrawal reflexes to avoid sever injury. However, chronic pain that persists
longer than the temporal course of natural healing severs no protective function,
and is usually associated with a particular type of injury or disease process
(Porreca et al., 2002;Shipton and Tait, 2005).
Interstitial cystitis (IC), also termed as painful bladder syndrome (PBS), is
one of the most perplexing chronic pain condition. It is characterized by chronic
pain, pressure and discomfort felt in the lower pelvis or bladder over 6 months
and often accompanies with daytime frequency and nocturia in the absence of a
urinary tract damage or inflammation. Clinical IC/PBS diagnosis is based on
histological examination, cystoscopic observation, and physiologic testing by
exclusion of other diseases with similar symptoms (Kusek and Nyberg,
2001;Abrams et al., 2006). Although prevalence of IC/PBS is generally
underestimated because it is a symptomatic diagnosis and many patients
suffering from urinary frequency, urgency and pain may not be diagnosed with IC,
a significant number of adult women patients is estimated to up to 20 million
according to a recent study in U.S. population (Ibrahim et al., 2007). IC/PBS
patients experience substantial chronic pain, depression and significant
impairment of personal quality of life, and consequently associated with an
6
enormous socioeconomic costs. The direct medical costs attributable to IC in the
U.S. healthcare system have been estimated to over $100 million annually(Held
et al., 1990). Moreover, the treatment of IC/PBS is based on anecdotal
experience and a few controversial clinical trials, and only a part of IC/PBS
patients are beneficial from traditional oral medicine and intravesical
administration.
IC/PBS is referred to a functional visceral disorder along with chronic
lower pelvic pain and an alteration of urodynamics in absence of gross pathology.
The pathogenesis of IC/PBS is still unclear, and a combination of psychological,
physiological and genetic factors has been suggested to contribute to IC/PBS
pathogenesis. IC is ten times more commonly diagnosed in women than in men,
suggesting a role of sex hormones in epidemiology of IC. It has also been
reported that IC patients have a higher incidence of other co-morbid diseases,
including allergies (50% of IC patients) (Koziol et al., 1993), inflammatory bowel
disease (IBD), irritable bowel syndrome (IBS; 50% of IC patients) (Alagiri et al.,
1997), migraine (Theoharides et al., 2008), and fibromyalgia (Erickson et al.,
2001). Additionally, some studies have presented that stress, diet habit and
smoking can exaggerate the IC/PBS symptoms, indicating that IC/PBS may
actually be a systemic disorder with bladder syndromes being the main
manifestation (Lutgendorf et al., 2000;Kennedy et al., 2006). There may also be
a genetic involvement in interstitial cystitis. First-degree relatives of IC patients
have a higher prevalence of IC than people in the general population (Warren et
7
al., 2004), consistent with an other genetic study showing a greater concordance
of IC among monozygotic than dizygotic twins (Warren et al., 2001).
Although IC/PBS patients do not display a robust low urinary tract infection
or inflammation(Al-Hadithi et al., 2005), microscopic changes have been
described recently in bladder biopsies from IC/PBS patients. The changes
include increased number of bladder nerve ending expressing neuropeptide
substance P (Pang et al., 1995), increased number of activated bladder mast
cells (Sant et al., 2007) and damage of the urothelial protective layer (Parsons et
al., 1991). However, the mechanism of IC/PBS pathogenesis is still poorly
understood. Therefore, a further explore of IC is essential in improving
management of this perplex syndrome.
Contribution of purinergic signaling to bladder
sensation and pain
Known as the intracellular energy source that is essential for all living cells,
ATP can also be released into the extracellular space as a neurotransmitter from
nerve terminals or as a signaling molecule from non-neuronal cells, including
epithelial, glia and smooth muscle cells (North, 2002). ATP concentration in
extracellular environment is maintained and regulated by membrane-bounded or
soluble ectonucletidases that hydrolyze ATP into ADP, AMP or cAMP
(Zimmermann, 2006).
The role of ATP on transduction of sensory information is first
demonstrated by Holton et al. in 1950s, showing a release of ATP from sensory
nerves during vasodilation in the rabbit artery(Holton and Holton, 1954;Holton,
8
1959;North, 2002). Increasing study indicates a potential role of ATP signaling in
neural transmission, especially in nociception and urinary bladder function. Direct
application of ATP on skin or into skeletal muscle causes pain-related behavior in
human subjects (Hamilton et al., 2000;Hilliges et al., 2002;Mork et al., 2003). It
has been demonstrated that ATP can be released from urothelial cells in
response to bladder distension (Ferguson et al., 1997;Wang et al., 2005). An in
vivo study also shows intravesical administration of ATP induces bladder
overactivity in conscious rats (Pandita and Andersson, 2002), suggesting a
potential role of ATP in afferent control of bladder function via acting on primary
afferent terminals.
Numerous studies have established that extracellular ATP plays an
important role in nociception and bladder sensory transduction via activating
ATP-sensitive P2 superfamily, consisting of the ionotropic P2X receptors and the
metabotropic P2Y receptors coupled with G-protein (Burnstock, 2006;Burnstock,
2007;North, 2002;von Kugelgen, 2006).
Ionotropic P2X receptors
P2X receptors are non-selective cation channels permeable to Ca2+, Na+
and K+, and they are reported to be involved in the transduction of various
sensory signals including taste, hearing, pain, chemical and visceral sensation
(Burnstock, 2006;Burnstock, 2007;Surprenant and North, 2008). P2X mRNA
transcripts and proteins are abundantly distributed throughout the body, including
neurons, glia, epithelium, bone marrow and muscle cells. To date, seven
mammalian P2X receptor subunits (P2X1-7) have been identified. They share
9
about 40% of sequence identity at the peptide level. Each member of P2X family
has intracellular NH2 and COOH termini containing binding sites of protein
kinases. Two hydrophobic trans-membrane motifs are involved in channel gating
and formation of the ion pore, and separated by a large extracellular loop
containing an ATP-binding site. A modulation site is located close to the pocket
of ion pore for binding other cations, including Mg2+, Ca2+, Zn+ and H+, to regulate
channel activities. Functional P2X receptors are either homomultimers or
heteromultimers composed of three identical or different P2X receptor subunits,
and the composition difference contributes to the pharmacological and kinetic
variances among P2X receptors.
Among seven members of P2X subunits, P2X2 and P2X3 subunits are
proposed to have a key role in mediating the nociceptive effect of ATP.
Immunohistochemical studies have shown that P2X2 and P2X3 subunits are
predominately localized on small-to-medium size sensory neurons within dorsal
root ganglia (DRG) and other sensory ganglia (Brady et al., 2004;Vulchanova et
al., 1997;Dunn et al., 2001), on peripheral afferent terminals innervating the
urinary bladder(Cockayne et al., 2000), and on central afferent terminals
projecting to the dorsal horn of the spinal cord (Nakatsuka and Gu,
2001;Nakatsuka et al., 2003;Vulchanova et al., 1998). Numerous studies
demonstrate that homomeric P2X3 and heteromeric P2X2/3 receptor antagonists
can block pain-related behaviors in animal models of long-lasting, chronic
neuropathic and inflammatory pain (Honore et al., 2002b;Jarvis et al.,
2001;Jarvis et al., 2002;McGaraughty et al., 2003;Ueno et al., 2003;Wu et al.,
10
2004). In addition, reduction of P2X2 and/or P2X3 subunit expression by RNA
interference (Barclay et al., 2002;Dorn et al., 2004;Honore et al., 2002a) or
genetic elimination (Cockayne et al., 2005;Souslova et al., 2000) has a
comparable effect as P2X antagonists on attenuation of pain-related behaviors,
indicating the importance of P2X signaling in chronic pain syndromes.
P2X receptors have also been revealed to participate in mechanosensory
regulation of urinary bladder function. P2X3 immunoreactivity has been identified
in primary afferent terminals as well as urothelial cells (Cockayne et al.,
2000;Zhong et al., 2003). P2X antagonists abolish the bladder overactivity either
induced by intravesical infusion of P2X agonist α, β-methylene ATP (Pandita and
Andersson, 2002), or in lower urinary tract obstructed rats (Cova et al.,
1999;Velasco et al., 2003) in vivo. A previous in vitro study using bladder-nerve
preparation in the rat also showed a comparable inhibitory effect of P2X
antagonist on bladder afferent hypersensitivity either induced by ATP or after
bladder inflammation (Yu and de Groat, 2008). Transgenic mice have provided
instrumental evidence further establishing the role of P2X receptors in bladder
function. P2X2 knockout, P2X3 knockout and P2X2/P2X3 double knockout mice
exhibit bladder hyporeflexia and decreased afferent nerve activities in response
to bladder distension while the ATP release from urothelium during bladder
distension in knockout mice is not different compared with wild-type mice
(Cockayne et al., 2000;Cockayne et al., 2005;Vlaskovska et al., 2001). These
studies indicate the potential role of ATP and P2X receptors in afferent control of
bladder function.
11
Metabotropic P2Y receptors
To date, eight G-protein coupled P2Y receptors (P2Y1, P2Y2, P2Y4 P2Y6,
P2Y11, P2Y12, P2Y13, and P2Y14) have been cloned. They are characterized
by seven transmembrane-spanning regions that form the ligand binding pocket
and share a high level of sequence homology between transmembrane regions.
Each P2Y receptor has an extracellular NH2 terminus and intracellular COOH
terminus that contains a binging site of protein kinases. The intracellular loops
and COOH terminus among P2Y subtypes display great variation that may
contribute to coupling different G-proteins.
P2Y receptors can be activated by endogenous purine nucleotides (ATP,
ADP) and/or pyrimidine nucleotides (UTP, UDP) based on their differential
pharmacological properties. Once activated by ligands, P2Y1, P2Y2, P2Y4,
P2Y6 and P2Y11 receptors that are coupled to Gq signal pathway, trigger
phospholipase C (PLC) activation, induce the release of endogenous Ca2+
produce, and finally initiate protein kinase C pathway. On the contrary, P2Y12,
P2Y13 and P2Y14 receptors that are coupled to Gi pathway have been reported
to inhibit adenylate cyclase (von Kugelgen, 2006).
The contribution of the metabotropic P2Y receptors to sensory
transmission has been less well examined compared with P2X receptors.
However, the expression of P2Y1, P2Y2, P2Y4 and P2Y6 mRNA transcripts has
been detected in dorsal root ganglia neurons, implicating a potential role of P2Y
receptors in peripheral sensory transduction. Of eight members in P2Y family,
P2Y1 and P1Y2 receptors are more abundantly expressed in sensory neurons
12
and therefore attract greater attention than other P2Y receptors. P2Y1 receptor
has been reported to contribute to innocuous mechanosensory transmission in
frog sensory nerve fibers (Nakamura and Strittmatter, 1996). UTP (P2Y2 and
P2Y4 agonist) can activate cutaneous afferents, sensitize sensory neurons and
induce CREB phosphorylation through the P2Y2 receptor (Molliver et al.,
2002;Stucky et al., 2004). P2Y receptors also play an essential role in the
enhancement of intracellular calcium and a subsequent CGRP release in
response to ATP in sensory neurons (Song et al., 2007;Sanada et al., 2002).
These results suggest that metabotropic P2Y receptors are involved in
transduction of primary sensory information.
In addition, P2Y receptors have been implicated to play an indirect role in
mechanosensation and nociception by modulating other receptors or channels.
Immunohistochemistry studies have revealed that P2Y1 receptor is co-localized
with P2X3 and TRPV1 receptors in rat dorsal root ganglia neurons (Gerevich et
al., 2005). Activation of P2Y1 receptor can influence currents through N-type
calcium channels (Cav 2.2) and P2X3 receptor in dorsal root ganglia neurons
(Gerevich et al., 2004;Gerevich et al., 2005). TRPV1 channel is thought to be
important in mechanosensation and nociception (Clapham, 2003). Genetic
elimination of TRPV1 causes reduced thermal hypersensitivity and impaired
bladder function (Birder et al., 2002;Caterina et al., 2000). It has been shown that
P2Y2 receptor potentiates TRPV1 response and reduces its thermal threshold in
peripheral afferent neurons (Moriyama et al., 2003;Tominaga et al., 2001).
Therefore, the role of P2Y receptors in sensitization of sensory afferents and
13
other ion channels implicates an involvement of P2Y signaling in visceral
hypersensitivity and chronic pain associated with IC.
Thesis objectives
The hypothesis of this thesis is that the purinergic signaling mediated by
P2X and P2Y receptors plays a role in bladder sensation under normal and
pathological conditions, The hypothesis was examined in sensory afferent
neurons innervating the urinary bladder from naïve mice or chemical inducedbladder inflamed mice. Majority of previous studies on mechanisms of bladder
sensation have been performed on pelvic nerve afferent pathways. Therefore,
one aim of this thesis is to characterize purinergic sensitivity in both lumbar
splanchnic and pelvic sensory pathway under normal condition (Chapter 2) and
in the presence of bladder inflammation (Chapter 3). Chapter 4 examined the
influence of metabotropic P2Y2 receptor on the excitability of bladder sensory
neurons and the function of P2X receptors. These results provide a substantial
support for a peripheral sensory effect of P2X and P2Y2 receptors on bladder
function and a contribution of purinergic receptors to bladder hypersensitivity and
pain.
14
CHAPTER 2: CHARACTERIZATION OF
PURINERGIC P2X RECEPTORS IN
LUMBOSACRAL (LS) AND THORACOLUMBAR (TL)
BLADDER SENSORY NEURONS
Introduction
Sensory information from the urinary bladder is conveyed to the spinal
cord via lumbar splanchinic and pelvic pathways (Vera and Nadelhaft,
1992;Uemura et al., 1975;Uemura et al., 1973). The cell bodies of these afferent
pathways are located, respectively, in thoracolumbar (TL) and lumbosacral (LS)
dorsal root ganglia (Andersson, 2002;Applebaum et al., 1980). A variety of
mechanical and chemical stimuli can activate the peripheral terminals of sensory
neurons innervating the urinary bladder, including distension/contraction of the
bladder, chemical irritants in urine, endogenous signal molecules released from
urothelial cells, and inflammatory mediators produced during tissue insults.
However, bladder sensation studies principally focus on the pelvic afferent
pathway whereas the contribution of lumbar splanchnic innervation to bladder
function is not well investigated.
A unique feature of visceral innervation is that each organ is innervated by
two nerves (Gebhart and Bielefeldt, 2008), which have some similar but also
different functions. For example, the mechanosensitivity and location of receptive
endings of the pelvic and lumbar splanchnic innervations of the urinary bladder
(Xu and Gebhart, 2008) and colon (Brierley et al., 2005) in the mouse have been
directly compared and documented as significantly different. Other studies that
15
have examined cell bodies in dorsal root or nodose ganglia of different nerves
innervating the same organ have similarly revealed significant differences in
gastric (Dang et al., 2005b;Sanada et al., 2002;Sugiura et al., 2005), airway
(Undem et al., 2004;Kwong et al., 2008), colon (Brierley et al., 2005) and urinary
bladder (Dang et al., 2005a;Xu and Gebhart, 2008) sensory neurons. The
importance of these findings relates to resolution of potential mechanisms that
may underlie functional visceral disorders (e.g., irritable bowel syndrome,
interstitial cystitis [IC], etc.), all of which are characterized by discomfort and pain
in the absence of gross pathology.
Among potential endogenous mediators of bladder sensation and
discomfort, adenosine triphosphate (ATP) and ionotropic purinergic (P2X)
receptors have been identified as important in the regulation of micturition and
sensation arising from the bladder. ATP is released from bladder urothelium
during distension or chemical stimulation (Ferguson et al., 1997;Birder et al.,
2003). The micturition reflex in normal conscious animals can be initiated by
intravesical ATP application (Pandita and Andersson, 2002); correspondingly,
P2X receptor antagonists applied into bladder lumen significantly reduce the
bladder contraction and voiding reflex in both normal and bladder obstructed rats
(Cova et al., 1999;Velasco et al., 2003). In addition, P2X2, P2X3 and P2X2/P2X3
double knockout mice exhibit reduced bladder reflexes and decreased afferent
nerve activity in response to bladder distension (Cockayne et al., 2000;Cockayne
et al., 2005;Vlaskovska et al., 2001). Therefore, in this chapter I examined the
purinergic sensitivity in bladder sensory neurons and compared the differences
16
between the lumbar splanchnic and pelvic innervations of the mouse urinary
bladder by study of their cell bodies in TL and LS dorsal root ganglia.
Results
Cell density and size distribution of bladder sensory
neurons
To estimate the proportion of bladder sensory neurons contained in LS
and TL DRG, I randomly chose 4 LS DRG and 4 TL DRG coverslips from 4 mice,
respectively. Each coverslip was divided into four quadrants. Numbers of DiI
labeled cells and total cells were counted in a randomly selected viewing field
(10X objective) in each quadrant under differential-interference contrast (DIC)
mode (Figure 1A) and fluorescence mode (Figure 1B). DiI-labeled cells
represented 6.0±0.4% (77/1276) of L6-S2 DRG cells, a proportion significantly
greater than the 2.4±0.2% (40/1635) of DiI-labeled T13-L2 DRG cells (Figure 1C).
These proportions do not differ from similar data collected in the rat (Dang et al.
2005).
Unlike in the rat, however, where TL bladder neuron capacitance was
significantly greater than LS bladder neuron capacitance, mean whole cell
capacitance (as an index of cell size) did not differ between mouse LS (31.1±1.0
pF) and TL (32.3±1.1 pF) bladder sensory neurons (Figure 2A). The distributions
of cell size (Figure 2B) also did not differ; most cells (LS: 71.9%; TL: 69.2%) were
medium in size (20-45 pF), as in the rat (Dang et al. 2005). However, in the rat,
the proportion of small sized (<20 pF) bladder sensory neurons was significantly
17
greater and the number of large sized (>45 pF) cells significantly less in LS than
TL DRG (Dang et al, 2008).
Characterization of bladder sensory neuron
responses to purinergic receptor agonists
A total of 205 bladder sensory neurons from naïve mice were studied.
ATP (30 μM) was applied to cells as a non-selective P2X receptor agonist; α,βmethylene ATP (α,β-met ATP, 30 μM) was employed as a P2X3 receptorselective agonist (homomeric P2X3 and heteromeric P2X2/3). Agonists were
applied for 4 sec at 2 min intervals. Overall, 93.0% (106/114) of LS and 76.9%
(70/91) of TL bladder neurons responded to ATP (LS vs TL, P< 0.01); 83.3%
(95/114) of the same LS and 76.9% (70/91) of the same TL bladder neurons also
responded to α,β-met ATP (Table 1). Among responsive bladder neurons, the
overwhelming majority of LS (89.6%, 95/106) and TL (74.3%, 52/70, LS vs TL,
P< 0.05, Table 1) bladder sensory neurons exhibited slowly desensitizing
currents in response to both ATP and α,β-met ATP (Figure 3A, 3C). The
remaining LS bladder neurons (10.4%, 11/106) demonstrated a sustained current
without an obvious desensitizing phase during agonist application. Sustained
currents in LS bladder neurons were evoked only by ATP and not by α,β-met
ATP (Figure 3B). Neither ATP nor α,β-met ATP generated sustained currents in
TL bladder sensory neurons; instead, both agonists produced rapidly activating,
rapidly inactivating fast currents (25.7%, 28/70, Figure 3D). No correlation
between bladder neuron size (whole-cell capacitance) and type of purinergic
currents was observed.
18
Table 2 summarizes the properties of purinergic agonist-evoked currents
in LS and TL bladder sensory neurons from naïve mice. Both agonists produced
slowly desensitizing currents in LS and TL neurons. The activation (time to peak)
and desensitization (desensitizing time constant) kinetics of these slow currents
were not different between LS and TL bladder neurons. However, the current
density (current amplitude normalized by whole cell capacitance) of the slow
current in LS bladder neurons was significantly greater than in TL neurons in
response to ATP (P<0.01) or α,β-met ATP (P<0.05). A sustained current was
produced only in LS bladder neurons and a fast current was produced only in TL
neurons, suggesting significant differences in P2X receptor subunit composition
between LS and TL bladder sensory neurons.
Characterization of P2X receptor subtypes in bladder
sensory neurons
There are seven ionotropic P2X receptor family subunits (P2X1 to P2X7)
that have been reported and cloned to date (North, 2002;Surprenant and North,
2008). The P2X2 and P2X3 subunits predominate in dorsal root ganglia and can
form functional homomeric P2X2 receptors, heteromeric P2X2/3 receptors or
homomeric P2X3 receptors each of which has a distinct pharmacological
character (Nicke et al., 1998;Gever et al., 2006). To examine which P2X receptor
subunit(s) mediate purinergic currents in mouse bladder sensory neurons, I
applied the P2X1, P2X3 and P2X2/3 receptor-selective antagonist 2′,3′-O-(2,4,6trinitrophenyl) adenosine 5′-triphosphate (TNP-ATP, 0.1 μM) or the non-selective
P2X receptor antagonist pyridoxal-phosphate-6-azophenyl-2',4'-disulfonate
19
(PPADS, 10 μM) for 30 sec before agonist application. Sustained currents
evoked by ATP were significantly attenuated by PPADS by a mean 82.0±5.6
%( Figure 4C; an example is given in Fig 4B) but not by TNP-ATP (Figure 4A),
suggesting they are mediated by a homomeric P2X2 receptor. As summarized in
Figure 5C, TNP-ATP significantly attenuated the slow currents evoked by ATP
(by a mean 55.5±2.1%; an example is given in Figure 5A) or α, β-met ATP (by a
mean 55.6±3.0%). PPADS similarly attenuated the slow currents evoked by ATP
(by a mean 77.7±3.0%; an example is given in Figure 5B) or α, β-met ATP (by a
mean 82.0±2.1%), revealing that these slow currents are mediated by
heteromeric P2X2/3 receptors. Fast currents are usually associated with
homomeric P2X3 receptors, which was confirmed using TNP-ATP (Figure 6A)
and PPADS (Figure 6B). Approximately 100% inhibition of ATP-evoked (TNPATP: 95.8±1.8%; PPADS: 95.9±0.2%, Figure 6C) and α, β-met ATP-evoked
(TNP-ATP: 97.6±0.7%; PPADS: 98.2±0.5%) fast current amplitude were
observed using the antagonists and the inhibitory effect was reversible by
washout of antagonists.
To further evaluate these currents, I applied the same purinergic agonists
and antagonists to bladder sensory neurons taken from P2X3 knockout mice. No
slow or fast currents were produced by either purinergic agonist; only a sustained
current was found. Ten of 12 (83.3%) LS bladder neurons responded to ATP with
a sustained current (an example is given in Figure 7A); none responded to α, βmet ATP. TL bladder neurons (n=8) did not respond to either ATP or α, β-met
ATP (Figure 7B). The sustained current produced by ATP in LS bladder neurons
20
from P2X3 knockout mice was attenuated similarly by TNP-ATP and PPADS as
were bladder neurons from wild-type mice (examples are given in Figure 7C, D).
These outcomes confirm that activation of homomeric P2X2 receptors is
responsible for the sustained current recorded in LS bladder sensory neurons.
Moreover, in TL bladder sensory neurons, purinergic currents are principally
mediated through heteromeric P2X2/3 receptors and homomeric P2X3 receptors.
Electrophysiological properties of LS and TL bladder
sensory neurons
I also examined the active and passive membrane properties of 32 LS and
30 TL bladder neurons from naïve mice by injecting currents (an example
displayed in Figure 8A) and applying agonists (examples of ATP-evoked
membrane depolarization and action potential are displayed in Figure 8B) in
whole-cell current clamp mode. Input resistance was calculated according to the
I/V relationship by injecting a series of hyperpolarizing pulses ranging from –300
to 0 pA (50 ms) in 50pA increments. Oscillation was examined as an index of
variability in the resting membrane potential (RMP). To determine rheobase, a
series of 10 ms current pulses in 20pA increments (1s apart) was injected. The
maximum current (pA) that did not evoke an action potential was taken as
rheobase. Action potential (AP) threshold was determined from the inflection
point where membrane potential started to dramatically rise and the phase plot
slope (the first derivative of membrane potential, dV/dt) reached 10 mV/ms
(Naundorf et al., 2006), AP amplitude was measured from peak RMP to the peak
of the AP, AP overshoot was the amplitude from 0 mV to the peak of the AP, AP
21
duration was determined at 50% of the AP amplitude and the AP falling rate was
the velocity of change in potential from the AP peak to RMP.
As summarized in Table 3, LS and TL bladder neurons did not differ in
input resistance, oscillation, RMP, or AP duration, amplitude, overshoot or failing
rate. However, LS neurons had a significantly more negative mean action
potential threshold (-34.1±0.5mV) than TL neurons (-28.5±0.8mV, P<0.01),
suggesting that LS neurons were generally more easily excited. When 30μM ATP
was applied, a significantly greater proportion of LS neurons fired APs than did
their TL counterparts (LS: 21/32, 67.5%; TL: 10/30, 33.3%, P<0.05), suggesting
that LS bladder neurons are more sensitive to purinergic agonists at the
concentration tested. Spontaneous activity was not observed in either LS or TL
bladder neurons before or after agonist application.
P2X receptor expression in bladder sensory neurons
Because the numbers of bladder sensory neurons contained in TL and LS
DRG are relatively few, I employed single cell RT-PCR and single cell nested
PCR to examine P2X2 and P2X3 expression in bladder sensory neurons. When
cDNA was harvested after single cell RT-PCR, the mouse GAPDH gene was
amplified by conventional PCR as an internal control. Only cells having a thick
band of GAPDH amplicon were further processed by nested PCR. Negative
results of GAPDH amplification were thought to have an unsuccessful reverse
transcription reaction and thus discarded. The remaining bladder neurons were
amplified by two rounds of PCR cycles with external primers, then internal
primers, respectively.
22
Figure 9A shows an example of positive single cell RT-PCR amplicons of
P2X2 and P2X3 mRNA. Product length corresponded with the expected size of
the targeted region. 15 LS and 15 TL bladder DRG neurons per mouse (n=3)
were collected for single cell PCR assay. The P2X2 subunit transcript was more
abundant in LS bladder neurons (88.9%±2.2%) than in TL counterparts
(53.3%±3.8%; P<0.01). It is exhibited in Figure 9B that the P2X3 subunit
transcript was abundant in both LS (93.3%±3.8) and TL bladder neurons
(97.7%±2.2%). Figure 9C shows the proportions of LS and TL bladder sensory
neurons that expressed only P2X2, only P2X3 or both P2X2 and P2X3
transcripts. Consistent with the purinergic-evoked currents in LS and TL bladder
neurons, P2X2 and P2X3 transcript co-expression were predominant in both LS
(88.9%±2.2%) and TL (51.2%±5.9%) bladder neurons. Cells only expressing
P2X2 transcripts were found exclusively in LS bladder (8.9%±2.2%), which is
consistent with observation of sustained currents in LS bladder neurons. Cells
only expressing P2X3 transcripts were more frequently detected in TL
(51.2%±5.9%) bladder neurons compared with LS counterparts (2.2%±2.2%;
P<0.05).
I also examined P2X3 immunoreactivity in bladder sensory neurons
retrogradely labeled by Alexa Fluor 488-conjugated Cholera Toxin B subunit
(CTB), a hydrophilic and membrane-permeable fluorescent tracing dye. Figure
10 shows example images of P2X3 immunostaining at LS (an example of L6
DRG displayed in Figure 10A) and TL (an example of L1 DRG displayed in
Figure 10B) DRGs from CTB labeled mice. Distribution of bladder sensory
23
neurons (green) and the immunoreactivity of P2X3 receptor subunits (red) are
displayed in the left and middle panel, respectively; combined images of double
fluorescent labeling are presented in the right panel. As summarized in Table 4,
27.2% (83/305) of LS DRG neurons exhibited P2X3 immunoreactivity, which was
significantly less than 36.4% (156/429, P<0.05) of TL cells showing P2X3
immunoreactivity. Similar with proportion of DiI positive cells, CTB-labeled cells
represented 7.2% (22/305) of LS DRG cells, a proportion significantly greater
than the 2.8% (12/429, P<0.05) of TL DRG cells. Colocalization of positive P2X3
immunoreactivity and CTB labeling was rare in LS DRG; only 5% of CTB labeled
bladder sensory neurons exhibited detectable P2X3 immunoreactivity. On the
contrary, positive P2X3 immunoreactivity was ~10 fold more frequently detected
in CTB-labeled TL bladder DRG neurons (50%, 6/12; P<0.01) than LS
counterparts.
Discussion
Differences between LS and TL bladder sensory
neurons
Previous studies suggest that the pelvic and lumbar splanchnic afferent
pathways innervating the urinary bladder may serve different functions. Bladder
afferent fibers in pelvic and lumbar splanchnic pathways are both involved in
chemo- and mechano-sensation, including noxious sensations (Andersson,
2002;Mitsui et al., 2001;Moss et al., 1997;Shea et al., 2000;Sengupta and
Gebhart, 1994;Su et al., 1997;Nazif et al., 2007). However, these two bladder
afferent pathways differentially respond to mechanical and chemical stimuli
24
(Dang et al., 2005a;Xu and Gebhart, 2008). In the present study, it was
confirmed that mouse bladder sensory neurons in the pelvic (LS) and splanchnic
(TL) pathways exhibit significantly different responses to purinergic agonists
based on kinetics of activation/inactivation and pharmacologic antagonism of the
inward currents produced.
In naïve mice, a greater proportion of LS bladder neurons responded to
purinergic agonists (~90%) than did TL bladder neurons (~75%). Three types of
purinergic currents were identified based on kinetic parameters and responses to
agonists and antagonists: homomeric P2X2 receptors (producing a ‘sustained’
current), heteromeric P2X2/3 receptors (producing a rapidly activating, ‘slow’
desensitizing current), and homomeric P2X3 receptors (producing a ‘fast’
current). The predominant current produced by both purinergic agonists in both
LS and TL bladder neurons was a heteromeric P2X2/3 slow current; the slow
current densities produced by both purinergic agonists in LS bladder neurons
were significantly greater than in TL counterparts.
I also measured active and passive membrane properties of LS and TL
bladder neurons, and found LS bladder neurons had a significantly lower (more
negative) mean action potential threshold and produced action potentials in a
greater proportion of LS than TL neurons, suggesting that pelvic bladder
afferents more tend to be easily activated by membrane depolarization or ATP
when released, for example, from urothelial cells. This interpretation further
suggests that pelvic bladder afferents are more sensitive to bladder distension
during normal urine filling, which is supported by the greater proportion of stretch
25
sensitive bladder pelvic afferent fibers than lumbar splanchnic afferent fibers, and
further distinguished by the greater dynamic response of pelvic bladder afferents
to mechanical stimulation (Xu and Gebhart, 2008).
A P2X2 homomeric sustained current was observed only in LS bladder
neurons and only in about 10% of neurons responsive to ATP. A P2X3
homomeric fast current was observed only in TL bladder neurons, occurring in
about 25% of the neurons, but produced equally by ATP and α, β-met ATP.
These outcomes suggest that [1] all mouse LS bladder neurons responding to
purinergic agonists express the P2X2 subunit, with the vast majority also
expressing the P2X3 subunit, and [2] all TL bladder neurons responding to
purinergic agonists express the P2X3 subunit with the significant majority also
expressing the P2X2 subunit. These interpretations are supported by single cell
nested PCR, which revealed that the P2X2 subunit transcript predominates in LS
bladder neurons whereas the P2X3 subunit transcript predominates in both LS
and TL bladder neurons.
These results in mice differ from those previously reported in the rat.
Dang et al (2008) compared rat LS and TL bladder neuron responses to
purinergic agonists. Based on inactivation kinetics, the predominant current in
naïve rat LS bladder neurons was a P2X2/3 heteromeric slow current evoked by
both ATP and α,β-met ATP (same concentrations as used herein) in 87% of
neurons (consistent with the present observation in mouse LS bladder neurons).
They noted no P2X2 homomeric sustained currents (present in ~10% of mouse
LS bladder neurons studied here), but did observe small percentages (6%) of
26
P2X3 homomeric fast currents and of mixed, rapidly activating and mixed
desensitizing currents (fit using a double exponential; 7%). No P2X3 homomeric
fast currents were found in mouse LS bladder neurons. The predominant (50 –
60%) purinergic-evoked current in rat TL bladder neurons was the mixed current,
which was never noted in either LS or TL mouse bladder neurons, with about
one-third of rat TL bladder neurons exhibiting a P2X2/3 heteromeric slow current
(the predominant current [75%] in mouse TL bladder neurons). Overall, more LS
than TL bladder neurons respond to purinergic agonists in both rat and mouse.
P2X2 homomeric sustained currents are present in mouse LS bladder neurons,
but not in either rat LS or TL bladder neurons, and P2X3 homomeric fast currents
are present only in mouse TL bladder neurons, but in both LS and TL rat bladder
neurons.
The expression of P2X transcripts and protein in bladder sensory neurons
reported here is consistent with other electrophysiological studies of bladder
afferents (Rong et al., 2002;Zhong et al., 2003), and immunohistochemical
localization in DRG (Vulchanova et al., 1997;Vulchanova et al., 1998), including
bladder sensory neurons (Dang et al. 2008), and nerve terminals in the
suburothelial nerve plexus (Cockayne et al., 2000;Studeny et al., 2005).
Transcription and expression of P2X receptor subunits are variable between
species, organs and ganglia (North, 2002;Burnstock, 2006;Grubb and Evans,
1999). Results from single cell nested PCR support the kinetic and
pharmacological results reported here in that some bladder neurons expressed
only P2X2 transcripts, only P2X3 transcripts, or both P2X2 and P2X3 transcripts.
27
P2X2 transcripts are expressed with greater frequency in LS than TL bladder
neurons, whereas P2X3 transcripts are highly expressed in both LS and TL
bladder neurons (>90%). The frequency of P2X receptor subunit expression in
bladder sensory neurons is consistent with the proportions of neurons exhibiting
P2X homo- or heteromeric currents based on desensitization kinetics. There is a
high frequency of colocalization of P2X2 and P2X3 subunits in both LS and TL
bladder neurons, consistent with the predominant P2X2/3 heteromeric slow
current evoked by both purinergic agonists in LS and TL bladder neurons. The
proportion of LS neurons that express only the P2X2 transcript is low, consistent
with the ~10% of LS neurons that exhibited a sustained, homomeric P2X2 inward
current to application of ATP. Similarly, the proportion of LS neurons that express
only the P2X3 transcript very low, and no P2X3 homomeric fast currents were
found in LS neurons.
Results from immunohistochemistry staining of P2X3 subunit in LS and TL
DRGs support the electrophysiological study: [1] the small proportion of LS and
TL bladder sensory in whole dorsal root ganglia; [2] a significantly greater
frequency of P2X3 in TL than LS bladder neurons. A lower proportion of bladder
sensory neurons expressing P2X3 protein than mRNA transcripts may be due to
partial translation of P2X3 mRNA into protein, internalization and degradation of
functional P2X3 receptors, or the sensitivity of immunohistochemistry staining
technique.
In conclusion, because significantly more LS responded to purinergic
agonists, and LS neurons exhibited significantly greater current density of slow
28
type (the predominant current type in bladder neurons) than the TL counterparts,
it is suggested that purinergic transmission of the urinary bladder in the normal
physiological state is principally conveyed through pelvic rather than
hypogastric/lumbar splanchnic afferents.
29
CHAPTER 3: PURINERGIC P2X SIGNALING IN
BLADDER SENSORY NEURONS AFTER BLADDER
INFLAMMATION
Introduction
Bladder inflammation, also termed as cystitis, can occur as a result of
bacteria infection, irritant chemicals in the urine, or unidentified causes (IC/PBS).
Bladder inflammation is characterized by discomfort/pain in lower pelvic region,
bladder hypersensitivity, edema, and inflammatory reaction of numerous cells in
the bladder tissue. Because activation of bladder sensory afferents plays a
substantial role in transmitting mechanical or chemical signals to central nervous
system, considerable attention has been focused on the plasticity of bladder
afferent nerves and sensory neurons induced by pathological changes.
Accumulating evidence has identified various endogenous molecules
serving as potential mediators of bladder inflammation and pain. In addition to an
essential role in bladder sensation under physiological conditions, it has been
proposed that ATP and ionotropic purinergic (P2X) receptor may also contribute
to bladder dysfunction following chronic inflammation. ATP is released from
bladder urothelium during distension or chemical stimulation (Ferguson et al.,
1997;Birder et al., 2003) and the release is increased in IC patients (Sun et al.,
2001a;Sun et al., 2001b). In animal models of cystitis, blockage of P2X receptors
can reduce bladder overactivity in vivo and hypersensitivity of bladder afferent
fibers in response to mechanical and electrical stimuli in vitro(Ito et al., 2008;Yu
and de Groat, 2008). Human studies on IC/PBS patients also suggest the
30
association between purinergic signaling and functional bladder disorders
(Tempest et al., 2004;Ray et al., 2003).
As mentioned in Chapter 1, the cell bodies of bladder pelvic and lumbar
splanchnic nerves are located in lumbosacral (LS, L6–S2) and thoracolumbar (TL,
T13–L2) DRGs. Recent studies have reported that bladder lumbar splanchnic
afferents respond more vigorously to chemical stimuli than pelvic nerve
counterparts(Moss et al., 1997;Mitsui et al., 2001) , suggesting that pelvic and
lumbar splanchnic nerves may make different contribution to signaling noxious
stimuli after bladder inflammation.
To test whether P2X plays a role in signaling the urinary bladder sensory
information in the bladder-inflamed state, systemic administration of
cyclophosphamide (CYP), was used in wild-type C57BL/6 mice. CYP can be
metabolized into bladder irritant acrolein (Cox, 1979) that causes hemorrhagic
cystitis in humans as an adverse event and produces visceral pain behaviors and
a cystitis-like syndrome, including edema, ulceration of the urothelium and
hemorrhage in rodents (Bon et al., 2003). Therefore, I used this well-established
bladder inflammation model to examine the consequences of inflammation on
characters of mouse LS and TL bladder neurons, especially the plasticity of P2X
functions. It is hypothesized that bladder inflammation changes the excitability
and the purinergic sensitivity of bladder sensory neurons.
31
Results
Bladder inflammation and tissue damage after CYP
treatment
A group of C57BL/6 mice were treated intraperitoneally with 100 mg/kg
cyclophosphamide dissolved in saline daily for 5 days. Mice treated with same
volume of vehicle (saline) were served as controls. Relative to naïve and salinetreated controls, CYP-treated bladders generally had thick walls accompanied by
visibly decreased lumen volume. Mean bladder weight (Figure 11A) after CYP
treatment was significantly greater (38.6 ± 1.3 mg, n=8) than bladders taken from
saline-treated (23.7 ±0.7mg, n=6; P<0.005) and naïve mice (22.9±1.1mg, n=6;
P<0.005).
A biochemical assay of bladder myeloperoxidase (MPO) activity was
applied on naïve, saline and CYP-treated mice to evaluate bladder inflammation
induced by CYP treatment. MPO is the most abundant protein in neutrophils and
can catalyze hydrogen peroxide (H2O2) into hypochlorous acid, which is
considered as a powerful antimicrobial agent. MPO activity assay is widely used
for quantitative assessment of neutrophil infiltration in inflammatory diseases.
However, no significant change of bladder MPO activity after CYP treatment was
detected compared with saline-treated or naïve mice (Figure 11B). The bladder
MPO activities of naïve, saline- and CYP- treated mice were all relative low.
Histological examination of bladders from CYP-treated mice revealed mild
submucosal edema and unfolding of the urothelium, neither of which was
apparent in bladders from saline-treated mice (Figure 12). Although MPO activity
32
did not differ between bladders from CYP- and saline-treated/naive mice, CYP
treatment did produce histological insult of the urinary bladder.
Bladder sensory neuron excitability increases after
CYP treatment
Using the same whole-cell current clamp protocols described in Chapter 2,
active and passive membrane properties of LS and TL bladder neurons were
examined in bladder sensory neurons taken from CYP- and saline-treated mice.
As summarized in Table 5, rheobase was significantly lower in both LS (from
144.3 ±8.7mV to 110.9 ±9.5mV; P<0.05) and TL (from 178.0 ±22.6mV to128.2
±8.5mV; P<0.05) bladder neurons from CYP-treated relative to saline-treated
mice (Figure 13A-D). The magnitude of membrane depolarization produced by
α,β-met ATP was significantly increased in LS and TL bladder neurons after CYP
treatment, but not by ATP (examples are given in Fig 13E-H). Input resistance,
AP duration, amplitude, overshoot or failing rate was not changed in both LS and
TL balder sensory neurons after inflammation. No bladder neurons from CYPtreated mice exhibited spontaneous activity.
P2X receptor mediated currents after CYP treatment
As presented in Table 6, 93.3% of LS bladder neurons from CYP-treated
mice responded to ATP, similar to the 96.9% of LS neurons from saline-treated
mice that responded. However, the proportions of LS bladder neurons that
exhibited sustained and slow currents to application of ATP were significantly
different in CYP- treated relative to saline-treated mice. A significantly greater
proportion (P<0.01) of LS neurons from CYP-treated mice (42.9%) exhibited
33
sustained currents than did LS neurons taken from saline-treated mice (9.7%).
Correspondingly, the proportion of LS neurons from CYP-treated mice that gave
slow currents (57.1%) was significantly reduced (P<0.01) relative to the 90.3%
observed in saline-treated mice. α, β-met ATP evokes only slow currents in LS
bladder neurons and the proportion of LS neurons from CYP-treated mice
(53.3%) that responded to α, β-met ATP was also significantly decreased relative
to saline-treated mice (87.5%; P<0.01). The activation (time to peak) and
desensitization (desensitizing time constant) kinetics of the slow currents evoked
by ATP/α, β-met ATP were not different between neurons from saline- and CYPtreated mice. The current densities of both the sustained and slow currents in LS
neurons from CYP-treated mice exhibited a trend to increase, but not significantly
greater than those of saline controls (Table 7). These results suggest that the
subunit composition of functional P2X receptors is altered by bladder
inflammation, with a greater contribution made by homomeric P2X2 receptors in
pelvic nerve LS neurons after inflammation.
The effect of bladder inflammation on TL bladder neurons was less
remarkable than on their LS counterparts. The proportions of TL bladder neurons
that responded to either of the purinergic agonists were not significantly different
between CYP- and saline-treated mice (Table 6). Although the proportions of
responses did not differ, the current density of the fast current evoked by
agonists was greater in neurons from CYP-treated mice while current density of
the slow response to agonists was significantly less in neurons from CYP-treated
mice (both relative to saline-treated mice; Table 7).
34
P2X receptor expression in bladder sensory neurons
after CYP treatment
Because the numbers of bladder sensory neurons contained in TL and LS
DRG are relatively few, I employed single cell RT-PCR and single cell nested
PCR to examine P2X2 and P2X3 expression in bladder sensory neurons, as
described in Chapter 2.
Figure 14A shows an example of positive single cell RT-PCR amplicons of
P2X2 and P2X3 mRNA. Product length corresponded with the expected size of
the targeted region. 15 LS and 15 TL bladder DRG neurons per mouse were
collected for single cell PCR assay. Both saline- and CYP-treated group
consisted of 45 cells taken from 3 mice. The P2X2 subunit transcript was more
abundant in LS bladder neurons from saline-treated animals (91.1%±2.2%) than
in TL counterparts (46.7%±6.7%; P<0.01). The frequencies of P2X2 transcript
expression in TL bladder neurons from CYP-treated mice (73.3%±6.7%)
significantly increased relative to saline-treated mice (46.7%±6.7%; P<0.05). The
P2X3 subunit transcript was abundant in both LS (saline: 91.1%±5.8%; CYP:
83.7%±10.4%) and TL bladder neurons (saline: 93.3%±3.8%; CYP: 100%). The
frequencies of P2X3 transcript expression did not differ between cells taken from
CYP- and saline-treated mice (Figure 14A).
Figure 14B shows the proportions of LS and TL bladder sensory neurons
that expressed only P2X2, only P2X3 or both P2X2 and P2X3 transcripts.
Consistent with the purinergic-evoked currents in LS and TL bladder neurons
from bladder inflamed and naïve mice, P2X2 and P2X3 transcript co-expression
35
were predominant in both LS (saline: 82.2%±2.2%; CYP: 76.8%±9.8%) and TL
saline: 51.1%±8.0%; CYP: 73.3%±6.7%) bladder neurons. Cells only expressing
P2X2 transcripts were found in LS bladder sensory neurons from saline(6.7%±3.8%) and CYP-treated (14.0%±7.3) mice. Cells only expressing P2X3
transcripts were more frequently detected in TL (saline: 49.0%±8.0%; CYP:
26.7%±6.7%) bladder neurons compared with LS counterparts (saline:
4.5%±2.2%; CYP: 4.6%±2.3%; both P<0.05). The frequencies of P2X2/P2X3
transcript expression did not differ between cells taken from CYP- and salinetreated mice.
P2X3 immunoreactivity in CTB-labeled bladder sensory neuron from CYPand saline-treated mice was also examined, as shown in Figure 15. Distribution
of bladder sensory neurons (green) and the immunoreactivity of P2X3 receptor
subunits (red) are displayed in the left and middle panel, respectively; combined
images of double fluorescent labeling are presented in the right panel. As
summarized in Table 4, 23.6% (164/696) of LS DRG neurons from saline-treated
mice (Figure 15A) and 19.7% (104/529) of LS DRG neurons from CYP-treated
mice (Figure 15C) exhibited positive P2X3 immunoreactivity, which was
significantly less than the proportion of TL bladder sensory neurons expressing
P2X3 receptor subunits (saline: 36.3% [64/696], Figure 15B; CYP: 37.0%
[181/489], Figure 15D, both P<0.05). No significant change of P2X3 expression
was detected after CYP treatment relative to saline controls. Consistent with the
frequency of bladder sensory neurons detected in naïve mouse DRG, 8.0%
(56/696) of LS and 2.3% (11/470) of TL DRG neurons were identified as CTB-
36
labeled bladder sensory neurons from saline-treated mice; 6.6% (35/529) of LS
and 2.0% (10/489) TL DRG neurons were recognized as bladder neurons from
CYP-treated mice. Co-localization of positive P2X3 immunoreactivity and CTB
labeling was rare in LS DRG; only 3.5% and 2.8% of CTB labeled bladder
sensory neurons from saline- and CYP-treated mice exhibited detectable P2X3
immunoreactivity. On the contrary, positive P2X3 immunoreactivity was 15-25
fold more frequently detected in TL bladder neurons (saline: 63.6% [7/11]; 50%,
5/10; both P<0.01) than LS counterparts. These results revealed that P2X3
expression was not greatly changed in protein level after CYP-induced bladder
inflammation.
Discussion
CYP treatment induces moderate bladder
inflammation
After systematic treatment of CYP for 5 days, CYP-treated bladders
exhibited a significant weight increase, accompanied by edema in submucosa
area and visibly decreased lumen volume of the bladder relative to naive and
saline-treated controls. However, bladder tissues from CYP-treated mice did not
show an increase of MPO activity, suggesting no sever neutrophil infiltration
associated with CYP induced-bladder inflammation in the mice train tested.
Because only subtle changes and no obvious inflammatory process are identified
in IC/PBS patients, systematic CYP administration in C57BL/6 mice may sever
as a feasible animal model to study the human bladder functional disorders.
37
Interestingly, the ability of CYP to produce moderate bladder edema
without significant bladder inflammation in the mouse contrasts with results of
previous work in the rat. In present study, 100mg/kg CYP administration in mice
daily for five continuous days did not induce bladder hemorrhage or enhance
MPO activity significantly, except the edema in suburothelial region. However,
rats treated by a same dosage of CYP for three times in day1, 3 and 5 exhibited
great hemorrhage, edema, partial loss of urothelium of the bladders
accompanied with a significant increase of bladder MPO activity (Dang et al.,
2008). A study of CYP-induced visceral pain in multiple mouse strains also
reported differences of pain behavior between mouse strains after CYP treatment.
The source of the species and strains variation in the extent of CYP-induced
bladder pathology is unclear. It might be as a result of different distribution and/or
expression of functional mechano- and chemo-sensors and different
transmission pattern of bladder sensory information among species and strains.
Bladder sensory neurons exhibit increased cell
excitability after bladder inflammation
Sensory information from the bladder is transmitted to central nerves
system through either the paired pelvic or the lumbar splanchinic nerves, with
their cell bodies located in LS and TL DRGs. The active and passive membrane
properties of sensory afferent neurons innervating the bladder have been
described previously in Chapter 2 using whole-cell current-clamp technique. In
general, LS bladder sensory neurons have a significantly more negative action
potential threshold and a significantly greater proportion of firing action potential
38
in response to the purinergic agonist, suggesting that LS bladder neurons were
generally more easily excited and more sensitive to purinergic agonists
compared with the TL counterparts. Therefore, the present study was performed
to determine whether LS and TL bladder sensory neurons had enhanced cell
excitability and purinergic responses after tissue insult.
After bladder inflammation induced by CYP, LS and TL bladder neuron
excitability increased, as evidenced by a significant decrease in rheobase, and
an increased membrane depolarization in responses to the purinergic agonist α,
β-methylene ATP, suggesting inflammation-produced alteration in cell excitability
and the subunit composition of P2X receptors. These results are consistent with
a similar previous study in the rat (Dang et al., 2008), CYP-induced rat bladder
inflammation significantly decreased the rheobase and action potential threshold ,
increased proportions of bladder neuron with spontaneous action potential firing,
and also had greater membrane depolarization and more action potential in
responses to purinergic agonists in both LS and TL bladder sensory neurons.
These results indicate that purinoceptive bladder sensory neurons will be
sensitized under conditions of bladder insults and relay sensory information to
the spinal cord and higher nervous centre of viscerosensation.
P2X function in bladder afferent neurons is enhanced
after bladder inflammation
As described in Chapter 2, Three types of purinergic currents were
identified: ‘sustained’ (homomeric P2X2) currents were detected only in LS
neurons, rapidly activating, ‘slow’ deactivating (heteromeric P2X2/3) currents
39
predominated in both LS and TL neurons, and ’fast‘ activating/de-activating
(homomeric P2X3) currents were detected only in TL neurons. Relative to TL
bladder neurons, current density of slow current evoked by either ATP or α, βmethylene ATP was greater in LS neurons than the TL neurons. In addition, a
greater proportion of LS (93%) than TL (77%) bladder neurons responded to
purinergic agonists, suggesting that LS bladder neurons were generally more
sensitive to purinergic agonists. However, there is no related study on purinergic
signals in mouse bladder afferent neurons from both pelvic and lumbar
splanchinic pathway. Therefore, inflammation-produced alteration of P2X
currents in LS and TL mouse bladder neurons were examined by whole-cell
voltage clamp technique.
In LS bladder neurons, more than 40% exhibited P2X2 homomeric
sustained currents after CYP treatment relative to ~10% of neurons from salinetreated mice. There was a corresponding decrease in the proportion of LS
bladder neurons exhibiting P2X2/3 heteromeric slow currents (from 90% to 57%).
There were no P2X3 homomeric currents in LS neurons from saline-treated (or
naïve) mice and none were observed after bladder inflammation. In TL bladder
neurons, in contrast, there were no changes in proportions of purinergic-evoked
currents after CYP treatment relative to saline treatment; the P2X3 fast current
density, however, was significantly increased after bladder inflammation.
These results in mice differ from those previously reported in the rat.
Dang et al (2008) compared rat LS and TL bladder neuron responses to
purinergic agonists after CYP treatment for 3 days. After bladder inflammation in
40
the rat, the only current evoked by either ATP or α, β-met ATP in LS bladder
neurons was a P2X2/3 heteromeric slow current (increasing from 87% to 100%
of neurons studied); fast and mixed currents noted in naïve and saline-treated
mice were absent. In rat TL bladder neurons, the proportion of neurons
exhibiting P2X3 homomeric fast currents evoked by α, β-met ATP increased
significantly from 22% (saline) to 43% after CYP treatment whereas P2X2/3
heteromeric slow currents evoked by both agonists were reduced by about 50%.
In the present study, no significant change was observed in purinergic-evoked
currents in mouse TL bladder neurons; the principal post-CYP change was a four
fold increase in the proportion of LS bladder neurons exhibiting a P2X2
homomeric sustained current, a current not seen in rat LS or TL bladder neurons.
The significant increase in P2X2 homomeric currents in LS bladder
neurons after CYP treatment suggests that a homomeric P2X2 receptor is
involved in sensitization of pelvic nerve bladder afferents, consistent with reduced
urinary bladder reflexes, decreased pelvic nerve afferent responses to bladder
distension, and decreased nociceptive responses to intraplantar formalin in P2X2
knockout mice (Cockayne et al., 2005). With respect to P2X3, the amplitude of
the P2X3 homomeric fast current was significantly enhanced and its
desensitizing time constant decreased in TL bladder neurons after CYP
treatment, suggesting a role in sensitization of the splanchnic pathway,
consistent with reduced urinary bladder reflexes in P2X3 knockout mice
(Cockayne et al., 2005).
41
P2X expression in bladder sensory neurons after
bladder inflammation
The proportion of LS neurons from saline-treated mice that express only
the P2X2 transcript is low, consistent with the ~10% of LS neurons that exhibited
a sustained, homomeric P2X2 inward current to application of ATP, and doesn’t
increase significantly after CYP treatment. Similarly, the proportion of LS
neurons that express only the P2X3 transcript very low, and no P2X3 homomeric
fast currents were found in LS neurons. P2X2 gene transcription in TL bladder
neurons was significantly increased after CYP treatment, suggesting enhanced
purinergic (e.g., P2X2/3) signaling at the transcriptional level.
Expression of P2X3 subunit by the immunohistochemistry staining of LS
and TL DRGs from saline- and CYP-treated mice showed a consistent result with
the study on naïve mice. Positive P2X3 immunoreactivity in mouse bladder
neurons was not significantly altered by CYP treatment, which contrasts with the
outcome of P2X3 immunohistochemistry staining in the rat (Dang et al., 2008).
Bladder inflammation significantly increased the fraction of rat TL (from 40% to
68%) but not the LS DRG neurons (from 83% to 89%) that exhibited P2X3
immunoreactivity. Because of the very high proportion of P2X mRNA detected
and unchanged P2X3 expression in bladder neurons after bladder inflammation,
post-transcriptional modulation of P2X receptor function and/or interaction with
other molecules/signaling pathways may be important in bladder neurons and
sensitization of bladder afferents.
42
In summary, the kinetic, pharmacological, and expression profiles of
purinergic signals in mice bladder neurons under pathological states, in addition
to the differences of purinergic transmission between the rat and mouse, suggest
a great role of the lumbar splanchinic(TL) and pelvic(LS) sensory pathways in
bladder hypersensitivity in the pathological states. Targeting the altered subunit
composition of purinergic receptors might be useful for management of bladder
inflammation or functional disorders (e.g., internal cystitis).
43
CHAPTER 4: EFFECT OF METABOTROPIC P2Y2
RECEPTOR ON BLADDER SENSORY NEURON
EXITABILITY AND P2X RECEPTOR FUNCTION
Introduction
Interstitial cystitis (IC)/painful bladder syndrome is characterized by urge
and increased urination frequency accompanied by chronic pelvic pain in the
absence of a pathobiological condition to explain symptoms (Burkman,
2004;Nickel, 2004). One of the potential endogenous mediators of bladder
discomfort and pain is adenosine triphosphate (ATP), which is released from
bladder urothelium during distension or chemical stimulation (Ferguson et al.,
1997;Birder et al., 2003) and an increased release of ATP is detected in IC
patients (Sun et al., 2001a;Sun et al., 2001b).
Both ionotropic P2X and metabotropic P2Y receptors could be activated
by extracellular ATP (Ralevic and Burnstock, 1998). To date, seven P2X subunits
(P2X1-P2X7) have been reported (North, 2002); among these P2X receptor
subtypes, P2X2 and P2X3 subunits are widely expressed in peripheral neurons
and are thought to play an important role in the transduction of both bladder
sensory information and of nociceptive signals (Dunn et al., 2001;Burnstock,
2006). The P2Y receptor family has eight members (P2Y1, 2, 4, 6, 11-14) to date;
They respond to endogenous purine and pyrimidine nucleotides (ATP, ADP, UTP,
UDP) released from various tissues (von Kugelgen, 2006;Lazarowski and
Boucher, 2001;Lazarowski and Harden, 1999). There is growing evidence that
44
metabotropic P2Y receptors are involved in neural signal transduction and
modulation.
P2Y receptors in sensory neurons have been reported to contribute to
innocuous mechanosensory transmission (Nakamura and Strittmatter, 1996),
activate cutaneous afferents (Stucky et al., 2004), and mediate internal Ca2+
release, CREB phosphorylation, and release of CGRP (Molliver et al.,
2002;Sanada et al., 2002;Song et al., 2007). P2Y receptors also potentiate
TRPV1 channel signaling gated by capsaicin or acid and reduce its thermal
threshold in peripheral afferent neurons (Moriyama et al., 2003;Tominaga et al.,
2001). Therefore, P2Y signaling is likely to play a role in mechanosensation
and/or nociception under normal or pathological conditions.
Two different pathways, lumbar splanchnic and pelvic nerve afferent
pathways, convey sensory information from the bladder to the spinal cord (Vera
and Nadelhaft, 1992;Uemura et al., 1975;Uemura et al., 1973). The cell bodies of
these pathways are located, respectively, in thoracolumbar (TL) and lumbosacral
(LS) dorsal root ganglia (Andersson, 2002;Applebaum et al., 1980). Based on
their differential responses to multiple mechanical and chemical stimuli, these
different bladder nerves have some similar but also different functions,
suggesting they may exert different influences in the regulation of bladder
function under normal or pathological conditions (Dang et al., 2005a;Xu and
Gebhart, 2008). In the present report, I examined the effect of the P2Y agonist
UTP on bladder neuron excitability and the interaction between P2X and P2Y
45
receptors in bladder sensory neurons from both lumbar splanchnic and pelvic
pathways.
Results
A total of 194 LS and 118 TL bladder neurons were studied. Consistent
with Chapter 2, the majority of LS and TL bladder neurons responded to P2X
receptor agonists. Three types of purinergic currents were identified: (1)
sustained currents, mediated through homomeric P2X2 receptors, were detected
only in ~10% of LS purinoceptive neurons; (2) rapidly activating, ‘slow’
deactivating currents, mediated through heteromeric P2X2/3 receptors,
predominated in both LS (~90%) and TL (~75%) purinoceptive neurons; and
(3) ’fast‘ activating/de-activating currents, mediated through homomeric P2X3
receptors, were detected only in ~25% of TL purinoceptive neurons. Sustained
currents were evoked by the purinergic agonist ATP, but not α,β-methylene ATP,
whereas slow and fast deactivating currents were produced by both ATP and
α,β-methylene ATP. I found that the effects of UTP were essentially restricted to
LS bladder neurons; TL bladder neurons were not greatly affected. Accordingly,
data presented here were mainly collected from LS bladder neurons unless
indicated otherwise.
UTP increases bladder sensory neuron excitability
I examined the active membrane properties of 24 LS bladder neurons
from naïve mice by injecting currents before and after UTP application (1μM, 40s)
in whole-cell current clamp mode (Table 8). Input resistance was calculated
according to the I/V relationship by injecting a series of hyperpolarizing pulses
46
ranging from –300 to 0 pA (30 ms) in 50pA increments. To determine rheobase,
a series of 10 ms current pulses in 20pA increments (1s apart) were injected. The
maximum current (pA) that did not evoke an action potential was taken as
rheobase. Action potential (AP) threshold was determined from the inflection
point where membrane potential started to dramatically rise and the phase plot
slope (the first derivative of membrane potential, dV/dt) reached 10 mV/ms
(Naundorf et al., 2006). AP amplitude was measured from resting membrane
potential (RMP) to the peak of the AP, AP overshoot was the amplitude from 0
mV to the peak of the AP, AP duration was determined at 50% of the AP
amplitude between the rising and falling phases and the AP falling rate was the
velocity of change in potential from the AP peak to RMP.
As summarized in Table 8, UTP application (1μM, 40s) depolarized LS
bladder neurons; the RMP (-63.9±0.9 mV before UTP treatment) was
significantly less negative (-55.6±1.5; P<0.005) after UTP. The rheobase was
also significantly lower after UTP application relative to control (from 142.4±11.6
pA to 82.2±5.2 pA; P<0.01) in bladder sensory neurons (Figure 16A-B). Current
injection (2x rheobase, 500 ms) depolarized and evoked AP firing in bladder
sensory neurons. UTP significantly increased the number of action potentials in
response to 2x rheobase current injection (Figure 16D) relative to before UTP
(Figure 16C). In addition, about one-half of the bladder neurons tested (10/21)
exhibited sustained spontaneous activity after UTP application (Figure 16E). UTP
did not induce changes in input resistance, AP threshold, duration, amplitude,
overshoot or falling rate (Table 8).
47
To further investigate the effect of UTP on bladder neuron excitability, I
applied suramin (50μM), a nonselective P2 antagonist, on total 15 LS bladder
DRG neurons 2 minutes before and during UTP application. Suramin prevented
the effects of UTP on bladder sensory neuron excitability; the data are
summarized in Table 8. Suramin blocked the UTP-produced reduction in
membrane depolarization of LS bladder, the decrease in rheobase and the
increase in number of action potentials in response to 2x rheobase current
injection (all P<0.01). In addition, the spontaneous AP firing of bladder sensory
neurons induced by UTP was completely inhibited by suramin (0/15). As UTP
does not act as an ionotropic P2X agonist (Burnstock, 2007;von Kugelgen, 2006),
these outcomes suggest a role of P2Y receptors in bladder sensory neuron
hypersensitivity.
Effect of UTP on purinergic agonist-evoked responses
Because endogenous ATP could activate both P2X and P2Y receptors
(principally P2Y2 and P2Y4 receptors), I hypothesized that there is an interaction
between P2X and P2Y receptors in response to purinergic agonists. To examine
the contribution of P2Y receptors to purinergic responses in mouse bladder
sensory neurons, I applied the P2X/Y agonist ATP or P2X-selective agonist α, βmethylene ATP (30μM, 4s) followed by a 2-minute washout period, then applied
external solution containing UTP (1μM) or nothing (control) for 40 sec before
repeating the ATP or α, β-methylene ATP application. After another 2-minute
washout period, currents induced by a third exposure to ATP or α, β-methylene
ATP were recorded. Because ~10% of LS bladder neurons exhibiting ATP
48
evoked-sustained currents do not respond to the P2X-selective agonist α, βmethylene ATP, which activates homomeric P2X3 and heteromeric P2X2/3
receptors, and no effective P2X2 agonist is available, I used ATP as a
homomeric P2X2 receptor agonist in the following experiments. In addition, ATP
application was limited to a relative short duration (4 sec) and immediately
followed by a bath solution washout to minimize possible activation of P2Y
receptors.
I examined the passive membrane properties of bladder neurons in
response to P2X agonists after UTP in whole-cell current clamp mode. UTP
application did not produce statistically significant differences in the magnitude of
membrane depolarization produced by ATP or α, β-methylene ATP, or frequency
of bladder neuron AP firing in response to ATP or α, β-methylene ATP (Table 8).
However, purinergic responses of some bladder neurons (8/21) were sensitized
by UTP. They either exhibited AP firing during application of UTP (Figure 17A) or
an increased frequency of APs (Figure 17B) during purinergic agonist application
compared with responses before UTP application. Other neurons (13/21) did not
exhibit significant changes (Figure 17C-D). Because the P2 antagonist suramin
also greatly inhibits P2X responses (data not shown), membrane properties of
bladder neurons in response to ATP or α, β-met ATP after suramin treatment can
not be examined.
I also examined the effect of UTP on P2X agonist-evoked inward currents
in whole-cell voltage clamp mode. Because the effect of UTP was evaluated by
comparison between first and second application of purinergic agonist, I first
49
calculated the recovery kinetics from desensitization of P2X currents. The
application interval between two purinergic agonist applications was increased
stepwise. The current amplitude of the second application was standardized to
the first application and plotted against time using a single-exponential fit. The
sustained current evoked by ATP recovered extremely rapidly and did not show
obvious decay (Figure 18A-B), whereas the slow current required around 40s for
complete recovery (Figure 18C-D) and fast current required a even longer period
(~120s) for recovery than slow current (Figure18E-F). Based on the results of
curve fitting, the recovery time constant of the ATP-evoked slow current was
16.8s (Figure 18G) and of ATP-evoked fast current was 70.3s (Figure 18H). The
time constant of the sustained current could not be determined because the data
were not fit to the single exponential equation. All data were collected in LS
bladder neurons, except that data of fast currents were collected in TL bladder
neurons because no fast currents were observed in LS neurons. The recovery
kinetics of the slow and fast current evoked by α, β-methylene ATP was similar to
slow current evoked by ATP presented above.
UTP application (0.3μM) for 40s significantly facilitated ATP-evoked
sustained currents (Figure 19A) and fast currents (Figure 19C), but not ATPevoked slow currents (Figure 19B), suggesting that metabotropic P2Y receptors
enhanced the responses of homomeric P2X2 and P2X3 receptors in bladder
sensory neurons. However, this effect could instead be due to the repetitive
application of ATP because ATP is also an agonist at P2Y receptors, although
the application period of ATP (4S) was relatively short. Therefore, I repeated ATP
50
applications (30μM, 4s) three times using the same protocol described above but
without UTP application. ATP-evoked sustained (Figure 20A) and slow (Figure
20B) currents did not significantly change after repetitive ATP application.
However, I still observed a facilitatory effect on the fast current evoked by second
ATP application comparing with the current evoked by first ATP application in the
same neuron (Figure 20C). Figures 19D and 20D summarize the effect of UTP
and repetitive ATP application on ATP-evoked sustained, slow in LS bladder
sensory neurons and fast currents in TL bladder sensory neurons. There was no
significant effect of UTP application on α, β-met ATP-evoked slow currents in LS
bladder neurons.
To further confirm the facilitatory effect of UTP on ATP-evoked sustained
currents, I determined the dose-response relationship for UTP, increasing UTP
concentrations from 30nM to 10μM. To eliminate the variation in current
amplitude, I normalized P2X currents under different UTP concentrations to
those associated with application of 30nM UTP. As an example given in Figure
21A, the effect of UTP on ATP-evoked sustained currents was concentrationdependent. The EC50 and 95% confidence interval for UTP was 0.52μM (0.131.97μM; n=7, Figure 21B). Because there was no significant effect of UTP on
slow currents, I did not determine the dose-response relationship of UTP on slow
currents evoked by ATP or α, β-met ATP. These outcomes confirmed that UTP
application facilitates homomeric P2X2-mediated sustained currents.
51
Metabotropic P2Y2 receptor mediates the effect of
UTP
UTP is an agonist at P2Y2 and P2Y4 receptors, which are coupled to Gq
and activate the phospholipase C (PLC)/protein kinase C (PKC) signaling
pathway (von Kugelgen, 2006). To confirm that the UTP effect was mediated via
G-protein coupled receptors, an internal solution containing GDP-β-S (100μM), a
global G-protein blocker inhibiting all G-protein-mediated events in the cytoplasm,
was applied using the same repetitive ATP/UTP application protocol as above.
As shown in Figure 22A and 23A, GDP-β-S repressed the facilitatory effect of
UTP on the purinergic sustained current, but not the fast current. In addition, the
facilitatory effect of repeated ATP on the fast current was also not inhibited by
intracellular GDP-β-S, whereas the trend towards increasing sustained currents
by repetitive ATP application was absent in the presence of GDP-β-S (Figure
22B and 23B). These outcomes suggest that the effect of UTP on homomeric
P2X2 sustained currents in bladder sensory neurons is dependent on a G
protein-coupled pathway, but the effects of UTP and ATP on homomeric P2X3
fast currents are not related with G protein-coupled receptors, consistent with
previous studies reporting that P2X3 receptor can be sensitized by triphosphate
nucleotides (ATP, UTP and GTP) via activation of the ecto-PKC phosphorylation
site in the extracellular loop of P2X3 receptor subunit (Stucky et al., 2004;Wirkner
et al., 2005).
I also applied a PKC inhibitor (myristoylated Protein Kinase C Inhibitor 2028, 10μM) to LS bladder neurons to further examine whether the effect of UTP on
52
P2X2 sustained current is PKC dependent. As shown in Figure 22C and 23C, the
facilitation of sustained current by UTP was significantly inhibited by the PKC
blocker, but the slow current amplitude after UTP application was not affected by
the PKC blocker. Because most P2Y receptor antagonists presently available
(e.g., PPADS, suramin, reactive blue, etc.) also block P2X receptors, I applied
ATP and UTP as above to bladder sensory neurons taken from P2Y2 knockout
mice to confirm whether P2Y2 mediates the facilitatory effect of UTP on P2X
currents. Figure 23D shows significant decreases of both ATP-evoked sustained
and slow currents after UTP application in LS bladder neurons from P2Y2
knockout mice. Comparison of sustained currents after UTP between wild type
and knockout mice (Figure 22D) also revealed a significant facilitatory effect of
UTP on purinergic currents in neurons from wild type but not P2Y2 knockout
mice, indicating that P2Y2 is required for P2X2 receptor modulation by UTP.
P2X and P2Y receptor expression in bladder sensory
neurons
Because the numbers of bladder sensory neurons contained in LS and TL
DRG are relatively few, I employed single cell RT-PCR and single cell nested
PCR to examine P2X and P2Y receptor expression in bladder sensory neurons.
When cDNA was harvested after single cell RT-PCR, the mouse GAPDH gene
was amplified by conventional PCR as an internal control. Only cells positive for
GAPDH amplicon were further processed by nested PCR. Negative results of
GAPDH amplification were thought to have an unsuccessful reverse transcription
reaction or a failed collection and thus discarded. The remaining bladder neurons
53
were amplified by two rounds of PCR with external primers, then internal primers,
respectively.
Figure 24A shows an example of positive single cell RT-PCR amplicons of
P2X2, P2X3, P2Y2 and P2Y4 mRNA. Product length corresponded to the
expected size of the targeted region. Fifteen LS and fifteen TL bladder DRG
neurons per mouse (total 3 animals) were collected for single cell PCR. The
expression pattern of P2X2 and P2X3 subunit transcript has been discussed in a
Chapter 2. The P2Y2 transcript was more abundant in LS (46.7±10.1%) and TL
(37.8±2.3%) bladder neurons than the P2Y4 transcript (LS: 22.2±5.8%; TL:
13.3±3.8%). The frequencies of P2Y2 and P2Y4 transcript expression did not
differ significantly between LS and TL bladder neurons (Figure 24B). The
expression of P2Y2 and P2Y4 was also examined in saline- and CYP-treated
mice. CYP treatment didn’t change the P2Y receptor expression in bladder
sensory neurons compared with saline controls.
Figure 24C and 24D shows the proportions of P2Y transcripts in P2X
transcript-positive bladder sensory neurons. In P2X2 transcript-positive bladder
neurons (Figure 24C), 51.2% of LS and 52.4% of TL bladder neurons also
expressed P2Y2 mRNA, whereas only 22.0% of LS and 19.1% of TL bladder
neurons expressed P2Y4 mRNA. 17.1% of LS and 14.3% of TL bladder neurons
expressing P2X2 mRNA were found to express both P2Y2 and P2Y4 transcripts.
Similarly, in P2X3 transcript-positive bladder neurons (Figure 24D), 51.2% of LS
and 40.5% of TL bladder neurons also expressed P2Y2 mRNA, whereas 24.4%
of LS and 14.3% of TL bladder neurons expressed P2Y4 mRNA. 19.5% of LS
54
and 9.5% of TL P2X3 mRNA-positive neurons also expressed P2Y2 and P2Y4
transcripts. The frequencies of P2Y2/P2Y4 transcript expression in P2X2/P2X3
transcript-positive cells did not differ between LS and TL bladder sensory
neurons.
Discussion
In the present study, I demonstrate that extracellular UTP sensitizes
bladder sensory neurons and increases cell excitability by depolarizing resting
membrane potential, decreasing rheobase and inducing action potentials. Our
results extend previous findings that UTP evokes action potentials in isolated
DRG neurons and identified nociceptors (Molliver et al., 2002;Stucky et al., 2004).
About half of bladder sensory neurons are more sensitive to purinergic agonists
after UTP application. Furthermore, UTP also facilitates the sustained currents
mediated by homomeric P2X2 receptors through metabotropic P2Y2 receptors in
LS bladder sensory neurons. Finally, P2Y2 transcripts are expressed in ~50% of
LS and ~40% of TL bladder sensory neurons, with similar frequency in P2Xpositive LS and TL bladder sensory neurons, whereas P2Y4 transcripts are
expressed in ~20% of LS and ~10% of TL bladder sensory neurons. These
outcomes suggest that ATP or UTP released in an extracellular environment can
sensitize primary afferent neurons and enhance responses of ionotropic P2X
receptors to their endogenous purinergic agonists (e.g., ATP) via P2Y receptors.
Both ATP and UTP are released into the extracellular environment under
normal conditions, and their release is enhanced when cells are injured or
damaged (Cook and McCleskey, 2002;Lazarowski and Harden, 1999),
55
suggesting that endogenous purines and pyramidines act as signaling molecules
in response to environmental stimuli and play a role in nociceptive transduction
(Burnstock, 2006;North, 2002). The present study shows that application of UTP
sensitizes bladder sensory neurons via the P2Y2 receptor, which is consistent
with other studies that UTP and ATP excite sensory neurons and activate
cutaneous afferent fibers by evoking sustained action potential firing or reducing
mechanical response thresholds (Lechner and Lewin, 2009;Molliver et al.,
2002;Stucky et al., 2004). Our results also indicate that activation of metabotropic
P2Y receptors by relatively low concentrations and prolonged application of
agonist (e.g., UTP), which does not induce an obvious inward current, can
facilitate ionotropic P2X receptor-mediated responses to subsequent purinergic
agonist administration. These results suggest that exposure to UTP/ATP in a low
concentration may prime subsequent purinergic signaling via metabotropic P2Y
receptors and elevate the sensitivity of ionotropic P2X receptors.
Studies using P2X2 knockout and P2X2/P2X3 double knockout mice
indicate that both P2X2 and P2X3 play important roles in the transduction of
noxious sensation from the bladder and in the regulation of normal bladder
function (Cockayne et al., 2005). Purinergic currents mediated by different P2X
receptor subtypes were previously characterized in Chapter 2. I found in the
present study that only homomeric P2X2-mediated sustained currents in LS
bladder sensory neurons were facilitated by UTP. The heteromeric P2X2/3mediated slow currents in both LS and TL bladder sensory neurons were not
significantly affected by UTP application. This suggests a selective effect of UTP
56
on a prolonged, sustained P2X2 current. In Chapter 3, I found that the frequency
of sustained homomeric P2X2 currents increases about 4 fold (from 10% to 40%)
in LS bladder sensory neurons from cyclophosphamide-induced bladder inflamed
mice, implying that the effect of P2Y activation on P2X2 signaling could be
dramatically amplified in pathological bladder disorders such as IC/PBS.
Collectively, these findings suggest that homomeric P2X2 receptor contributes to
purinergic signal transduction and sensitization of bladder sensory neurons.
I examined the effect of UTP on both LS and TL bladder neurons because
there is increasing evidence that pelvic and lumbar splanchnic sensory pathways
innervating pelvic organs contribute differentially to visceral function and
disorders (Brierley et al., 2005;Dang et al., 2005a;Xu and Gebhart, 2008;Sanada
et al., 2002;Sugiura et al., 2005). I found a greater effect of UTP on LS than TL
bladder neurons, suggesting a role in sensitization of the pelvic pathway
innervating the bladder, consistent with increased activity of pelvic afferents by
purinergic agonists in bladder-inflamed rat (Yu and de Groat, 2008).
Among the P2Y receptor family, P2Y1, P2Y2, P2Y4, P2Y6 and P2Y11 are
coupled to the Gq signal pathway, which activates phospholipase C and induces
the release of intracellular Ca2+ stores and protein kinase C activation; P2Y11
can also activate adenylate cyclase but is not expressed in rodents. On the other
hand, P2Y12, P2Y13 and P2Y14 are coupled to Gi and inhibit adenylate cyclase
(von Kugelgen, 2006). Additionally, P2Y1, P2Y2, P2Y4 and P2Y6 receptors are
detected in peripheral sensory neurons located in dorsal root and nodose ganglia
(Ruan and Burnstock, 2003;Gerevich and Illes, 2004). Because only P2Y2 and
57
P2Y4 receptors are activated by UTP, I only examined expression of P2Y2 and
P2Y4 in LS and TL bladder sensory neurons. A previous study on distribution of
P2Y2 by in situ hybridization demonstrated that P2Y2 mRNA is expressed ~90%
of small size rat DRG neurons and only one third of large DRG neurons (Molliver
et al., 2002); a similar study reported that 24% of rat DRG neurons expressed
P2Y2 mRNA (Kobayashi et al., 2006). I found in the present study that ~50% of
bladder sensory neurons, which are small-to medium in size according to the
analysis of cell size described in Chapter 2 but represent only about 5% of the
neurons in their respective DRG, expressed P2Y2 mRNA. The P2Y4 receptor is
less widely expressed than P2Y1 or P2Y2 receptors (Ruan and Burnstock,
2003;Kobayashi et al., 2006), which is consistent with our finding that 10%-20%
of bladder neurons express P2Y4 mRNA.
The present study established that the effect of UTP on ATP-evoked
currents is mediated by P2Y2 receptors because the facilitatory effect of UTP is
absent in P2Y2 knockout mice. Additional support for a role of P2Y2 over P2Y4
is that the effect of UTP was blocked by suramin, which is an antagonist at P2Y2
but not P2Y4 receptor. Other studies in P2Y2 knockout mice exhibit decreased
calcium flux induced by UTP, reduced TRPV1 function and impaired thermal
nociception (Malin et al., 2008). P2Y2 knockout mice also exhibit an altered
osmotic reabsorption of water which influences volume and concentration of the
urine stored in urinary bladder (Zhang et al., 2008), suggesting P2Y2 receptor is
involved in regulation of urination mechanism. Interestingly, I found UTP
application had an inhibitory effect on both slow and sustained purinergic
58
currents in P2Y2 knockout mice, suggesting that UTP may be involved in a
P2Y2-independent mechanism to inhibit P2X signaling in the absence of P2Y2.
Under normal conditions, ATP released from urothelial cells in response to
bladder distension activates P2X receptors in bladder afferents. Activation of
P2X3-expressing sensory afferents contributes to bladder reflexes as well as
sensation. In the present report, I describe a role for the ATP/UTP-gated receptor
P2Y2 in the regulation of bladder neuron excitability and identify an interaction
between P2X and P2Y receptors that leads to enhanced P2X signaling.
Hyperexcitability and increased firing of bladder afferents are associated with
urinary urgency, frequency and pain, all of which are features of interstitial cystitis
(Nazif et al., 2007). These findings provide a new dimension to the role of
nucleotide signaling in bladder function that may contribute to the
pathophysiology of bladder inflammation and injury.
59
CHAPTER 5: GENERAL CONCLUSIONS AND
DISCUSSION
Overview of experiment results
The objective of this thesis is to test the hypothesis that the ionotropic P2X
(principally P2X2 and P2X3) and the metabotropic P2Y2 receptors contribute to
bladder sensory transmission. The present study of peripheral sensory neurons
innervating mouse bladder provides evidence that LS and TL mouse bladder
sensory neurons exhibit distinct purinergic signaling, which changes after bladder
inflammation and can be modulated by activation of metabotropic P2Y2 receptor
(a summary represented in Table 10). These outcomes support the role of P2X
and P2Y2 receptors as mechano- and chemo-sensors in peripheral afferent
neurons in bladder hypersensitivity following tissue insults. Therefore, some
subtypes of purinergic receptor family are able to serve as potential targets for
therapeutic intervention in human bladder disorders, e.g. interstitial
cystitis/painful bladder syndrome.
Differential purinergic signaling in LS and TL
bladder sensory neurons
The pelvic and lumbar splanchinic innervations of the urinary bladder have
some different features in anatomy and function. It has been reported that pelvic
nerve axons are uniformly distributed throughout the urinary bladder, whereas
axons from the lumbar innervations are more numerous in the trigone region. In
this thesis, I injected fluorescent dye (DiI or CTB) in the neck of the bladder
(trigone area) and found twice as many DRG neurons projecting through the
60
pelvic nerves (PN) as the lumbar splanchnic nerves (LSN). Although it could
cause an underestimation of bladder innervations that the bladder was not
entirely labeled with retrograde tracing dye, a significantly higher density of the
pelvic than the lumbar splanchnic innervation even in the trigone region suggests
a greater contribution of pelvic pathway to bladder sensory transmission than
lumbar splanchnic pathway.
The pelvic and lumbar splanchinic innervations of the urinary bladder may
also exert different functions. Recent reports have implicated the importance of
P2X receptor in bladder function by in vivo and in vitro methods (Cockayne et al.,
2000;Cockayne et al., 2005;Pandita and Andersson, 2002;Velasco et al.,
2003;Vlaskovska et al., 2001;Yu and de Groat, 2008). In Chapter 2, I compared
the P2X function in mouse bladder sensory neurons in the pelvic (LS) and
splanchnic (TL) pathways, including the kinetics of activation/inactivation and
pharmacologic antagonism of the inward currents evoked by purinergic agonists.
In addition to similarities, I found that, in naïve mice, [1] a greater proportion of
LS bladder neurons responded to purinergic agonists than did TL bladder
neurons; [2] although the predominant current produced by both purinergic
agonists in both LS and TL bladder neurons was a heteromeric P2X2/3 slow
current, the slow current densities produced by both purinergic agonists in LS
bladder neurons were significantly greater than in TL counterparts; [3]
homomeric P2X2 sustained current was only detected in LS bladder neurons,
whereas homomeric P2X3 fast current was only detected in TL bladder neurons.
61
The electrical properties of LS and TL bladder sensory neurons are also
different, based on their active and passive membrane properties in response to
current injection and agonist application. LS bladder neurons have a significantly
lower action potential threshold than the TL counterparts and a greater proportion
of LS neuron raise action potentials in response to ATP than TL neurons do,
suggesting that PN bladder afferents more tend to be easily activated by
membrane depolarization or ATP when released from urothelial cells, and
therefore are more sensitive to bladder distension during the urine filling stage. A
previous electrophysiological study of mouse bladder afferent fibers (Xu and
Gebhart, 2008) provides comparable results showing a greater proportion of
stretch sensitive bladder pelvic afferent fibers than lumbar splanchnic afferent
fibers, and a greater dynamic response of PN afferents to mechanical stimulation.
In conclusion, the outcomes of the present study supplement the
fundamental knowledge of afferent signaling from the urinary bladder in the
mouse using electrophysiological approach based on directly comparing the
basic properties and purinergic responses of bladder afferent neurons in the
pelvic and lumbar splanchnic sensory pathway.
Contribution of P2X2 and P2X3 receptors to
bladder sensory transmission
It has been revealed that P2X2 and P2X3 receptors play a significant role
in visceral mechanosensory transduction and hypersensitivity. The findings in
knockout mice provide instrumental evidence in support of the importance of P2X
receptors in bladder mechanosensation. P2X2, P2X3 and P2X2/P2X3 double
62
knockout mice exhibit micturition hyporeflexia and hyposensitivity of bladder
afferent nerves in response to bladder distension whereas the ATP release from
the urothelial cells evoked by bladder distension is not significantly changed
compared with wild type mice (Cockayne et al., 2000;Cockayne et al.,
2005;Vlaskovska et al., 2001).
Electrophysiological studies indicate that P2X2 and P2X3 subunits
account for virtually all ATP-mediated responses in peripheral sensory neurons
(Cockayne et al., 2005), and the predominant P2X receptor(s) in dorsal root
ganglia neurons are heteromeric P2X2/3 and homomeric P2X3 receptors
(Burgard et al., 1999). Consequently, the great majority of bladder
mechanosensation studies on purinergic signaling focus on the heteromeric
P2X2/3 and homomeric P2X3 receptors. P2X3 antagonist TNP-ATP, which is a
1000-fold more potent in inhibiting homomeric P2X3 and heteromeric P2X2/3
receptors than homomeric P2X2 receptor, abolishes the bladder overactivity
induced by intravesical infusion of ATP in conscious rats (Pandita and Andersson,
2002). TNP-ATP is also effective in inhibiting ATP or α, β-methylene ATP
induced facilitation of bladder afferent never activity in the rat and mouse (Rong
et al., 2002;Yu and de Groat, 2008). Consistent with previous findings, it has
been shown in this thesis that the majority of LS and TL mouse bladder neurons
exhibit heteromeric P2X2/3 mediated currents in response to ATP or α, βmethylene ATP. In addition, the responses of homomeric P2X3 receptor to ATP
and α, β-methylene ATP, which are identified only in TL bladder neurons, is
facilitated after bladder inflammation, suggesting that P2X3 receptor is important
63
in mechano-hypersensitivity of sensory afferents under pathological conditions of
the bladder.
Compared with the dominance of heteromeric P2X2/3 and homomeric
P2X3 receptors in dorsal root ganglia, homomeric P2X2 receptor is found in a
small percentage (~10%) of dorsal root ganglia neurons by patch-clamp studies
in P2X3 knockout mice (Cockayne et al., 2005). Our findings of bladder sensory
neurons from lumbosacral dorsal root ganglia show a consistent result that the
purinergic responses of ~10% of purinoceptive LS bladder dorsal root ganglia
neurons are mediated by homomeric P2X2 receptor. Although the homomeric
P2X2 receptor is not the predominate P2X receptor in naïve mice, the proportion
of LS bladder neurons exhibiting P2X2 receptor mediated-sustained currents
dramatically increased 4 fold to ~40% in bladder inflamed mice, indicating a
substantial role of P2X2 receptor in mediating mechanosensory transduction
during bladder inflammation. Additionally, the activity of homomeric P2X2
receptor can be facilitated by metabotropic P2Y2 receptor through PKC pathway.
In consideration of an increased ATP release from urothelium reported in
interstitial cystitis patients (Sun et al., 2001a;Sun et al., 2001b) and the ability of
ATP to activate both P2X and P2Y receptors, the positive interaction between
P2X2 and P2Y2 receptors implies that the function of homomeric P2X2 receptor
can be enhanced by the elevated concentration of ATP and modulation via P2Y2
receptor in pathological states of the urinary bladder.
In a summary, the present study supports an important role for both P2X2
and P2X3 in viscerosensory transmission by exerting potentially different but also
64
overlapping functions. Given the interest in investigating P2X antagonists for
conditions of bladder inflammation or functional bladder disorders as interstitial
cystitis, the findings in the thesis suggest that selective antagonists of homomeric
P2X2 and P2X3 receptors may have therapeutic potential in the treatment of
these conditions.
Contribution of P2Y2 receptor to bladder sensory
transmission
In comparison to P2X2 and P2X3 receptors, the contribution of the
metabotropic P2Y2 receptor to bladder sensory transduction has not been well
examined. Previous studies implicated that P2Y2 may have an indirect effect on
bladder sensation by modulation of other receptors, ion channels or signal
molecules. It has been reported that P2Y2 receptor potentiates TRPV1 channel
activity and reduces its thermal threshold in peripheral afferent neurons
(Moriyama et al., 2003;Tominaga et al., 2001), and TRPV1 channel is thought to
be an important mediator of bladder mechanosensitivity (Birder et al.,
2002;Cockayne et al., 2005;Tominaga et al., 2001). P2Y2 receptor in sensory
neurons has also been implicated to mediate the Ca2+ release from internal
stores, CREB phosphorylation, and the release of CGRP (Molliver et al.,
2002;Sanada et al., 2002), suggesting P2Y2 signaling is likely to play a role in
visceral mechanosensation and/or nociception under normal or pathological
conditions.
In this thesis, UTP is shown to have an ability to increase cell excitability
of bladder sensory neurons. Of the identified pyrimidine-binding P2Y receptors,
65
P2Y2 and P2Y4 are potently activated by UTP as well as ATP. The possibility
that P2Y4 mediates the effect of UTP on bladder sensory neurons is ruled out by
demonstrating that P2Y2 antagonist suramin could completely block the UTPinduced increased bladder neuron excitability. Examination of P2Y2 and P2Y4
expression further revealed a more widespread distribution of P2Y2 mRNA than
P2Y4 mRNA. Therefore, the actions of UTP on bladder neuron activity are
presumably mediated by P2Y2 receptor, suggesting P2Y2 receptor may be
involved in bladder overactivity and hyperreflexia in functional bladder disorder
and cystitis. In addition, electrophysiological studies in knockout mice reveal that
P2Y2 receptor potentiates the homomeric P2X2 receptor responses, and the
potentiation is G protein dependent and requires PKC activation.
In a conclusion, whether direct or indirect, the contribution of P2Y2
receptor to bladder neurons excitability and purinergic signals extends the
current understanding of P2Y receptors in bladder sensory transmission,
indicating the potential of metabotropic P2Y receptors in visceral
mechanosensation.
Future directions
In this thesis, I have shown that the differential purinergic signaling
pathways of bladder pelvic and lumbar splanchnic innervations and the
contribution of P2X and P2Y2 receptors to bladder sensory transduction by
electrophysiological, single cell RT-PCR and immunohistochemistry methods.
The facilitation of purinergic signaling in bladder sensory neurons after bladder
inflammation and the influences of P2Y2 receptor on bladder neuron excitability
66
and P2X2 function, suggest that P2X and P2Y2 may be the potentially important
mediators for bladder mechanosensation and hypersensitivity. Further
experiments will identify the expression of P2X and P2Y2 subunit in bladder
afferent terminals projecting into urothelium under both physiological and bladder
inflammatory conditions, examine P2X and P2Y2 contribution to bladder function
by behavior methods in naïve, P2X knockout or knockdown mice by RNA
interfering technique, and confirm the facilitatory effect of P2Y2 receptor on
activity of bladder afferent nerves using bladder-nerve preparation. These studies
will help to elucidate the mechanism of P2X and P2Y2 in peripheral neurons
innervating mouse bladder and the role they play in chronic pain and functional
disorder (e.g., IC/PBS) in human.
67
CHAPTER 6: MATERIALS AND METHODS
Animals
Male C57BL/6 mice (6-8 weeks; Taconic Labs, Germantown, NY) were
used for most experiments; P2X3 and P2Y2 knockout mice were also used [see
refs in Cockayne et al., 2002 and Malin et al., 2008 for initial characterization of
knockouts].. Mice were housed in polypropylene cages with ad libitum access to
food and water. All protocols were reviewed and approved by the Institutional
Animal Care & Use Committee, the University of Pittsburgh.
Bladder neuron retrograde labeling
Mice were anesthetized with 2% inhaled isoflurane (Hospira Inc., Lake
Forest, IL), the bladder exposed via a lower abdominal incision ~5 mm in length
and 10 ul of 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate
(DiIC18(3); Molecular Probes, Eugene, OR; 0.2mg/ml in DMSO) was injected into
3-4 sites within the bladder wall and the base around the trigone using a 30
gauge needle. Sterile cotton-tipped applicators were applied to injection sites to
absorb any DiI that leaked from injection sites. The incision was closed (6.0 silk,
Ethicon Inc., Somerville, NJ) and post-operative analgesia provided after surgery
(buprenorphine, 0.05mg/kg, i.p.; Bedford labs, Bedford, OH).
Cell dissociation and culturing
Lumbosacral (LS; L6-S2) and thoracolumbar (TL; T13-L2) DRG were
harvested for electrophysiological whole cell recordings two weeks after
retrograde labeling. After dissection of DRG, the pelvic area around the bladder
was examined for evidence of DiI leakage; leakage was rarely noted and DRG
68
from mice with evidence of leakage were not used. LS and TL DRG were
incubated at 37°C, 5% CO2 for 45 min in DMEM media containing 1%
penicillin/streptomycin (Gibco, Invitrogen Corp. Grand Island, NY), 1 mg/ml type
4 collagenase and 1 mg/ml neutral protease (Worthington Biochemical Corp.,
Lakewood, NJ). Tissue was gently triturated and collected after 5 min
centrifugation at 120 X g, washed 3 times and re-suspended in DMEM media
containing 0.5 mM L-glutamine, 1% penicillin/streptomycin and 10% fetal bovine
serum. The cells were plated on poly-D-lysine-coated coverslips (Becton
Dickinson Labware, Bedford, MA) and incubated at 37°C, 5% CO2 for 14-16 hrs.
Only DiI positive bladder sensory neurons were studied. All recordings were
performed within 24 hours after plating.
Whole cell current- and voltage-patch clamp
recording
Coverslips were transferred to a recording chamber perfused with an
external solution (in mM) consisting of NaCl 140, KCl 5, MgCl2 1, CaCl2 2,
glucose 10, and HEPES 10 at pH 7.4, 310 mOsm. Glass micropipette tips were
heat-polished to resistances ~ 2-3 MΩ and filled with an internal solution (in mM)
consisting of KCl 130, NaCl 4, CaCl2 0.2, HEPES 10, EGTA 10, MgATP 2, and
NaGTP0.5 at pH 7.25, 300 mOsm. After establishing the whole-cell configuration,
membrane voltage was clamped at -70 mV using an Axopatch 200B amplifier
(Axon Instruments, Union City, CA), digitized at 1 kHz (Digidata 1350; Axon
Instruments), and controlled by Clampex software (pClamp 9; Axon Instruments).
Cell capacitance was obtained by reading the value from the Axopatch 200B
69
amplifier. In current clamp experiments, only neurons that had a resting
membrane potential more negative than -50 mV and a distinct action potential
overshoot >0 mV were studied.
Drugs were applied through a 3-barrel glass pipette placed close (~100
m) to the cell using a fast-step SF-77B superfusion system (Warner Instruments,
Hamden, CT). Agonists were applied for 4 sec at an interval of 2 min; antagonists
were superfused for 30 sec before the application of agonists. The reagents were
prepared fresh from stock solutions on the day of the experiment. ATP, α, βmethylene ATP, Guanosine-5'-triphosphate (GTP), 2′,3′-O-(2,4,6- trinitrophenyl)
adenosine 5′-triphosphate (TNP-ATP), and pyridoxal-phosphate-6-azophenyl2',4'-disulfonate (PPADS) were obtained from Sigma-Aldrich (St. Louis, MO).
UTP, suramin, guanosine- 5'- O- (2- thiodiphosphate) (GDP-β-S ) and
myristoylated Protein Kinase C Inhibitor 20-28 were purchased from Calbiochem
(La Jolla, CA All experiments were performed at room temperature (21–23°C).
Drugs were prepared fresh from stock solutions on the day of the experiment. All
experiments were performed at room temperature (21–23°C).
Urinary bladder inflammation
Two weeks after retrograde labeling, mice were treated intraperitoneally
either with saline or cyclophosphamide (CYP; 100 mg/kg, dissolved in saline;
Sigma-Aldrich Inc., St. Louis, MO) daily for 5 days; mice were sacrificed by CO2
inhalation on day 6 and the LS (L6-S2) and TL(T13-L2) dorsal root ganglia (DRG)
were removed for electrophysiological study or immunohistochemistry staining.
Systemic administration of CYP, which is metabolized to the bladder irritant
70
acrolein(Cox, 1979), can cause hemorrhagic cystitis in humans as an adverse
event and produces a cystitis-like condition in rodents (e.g., (Bon et al., 2003).
Bladder myeloperoxidase (MPO) assay
Urinary bladders were removed from CYP- and saline-treated mice deeply
anesthetized with inhaled isoflurane. Each bladder was longitudinally cut into two
parts, one part for histological examination and the other for MPO assay. For the
MPO assay, bladder tissue was rinsed with saline, patted dry and homogenized
in ice-cold 50 mM phosphate buffer containing 0.5% hexadecyltrimethylammonium bromide. After three repeated freeze (dry ice) - thaw (37°C water
bath) cycles, samples were centrifuged at room temperature for 1min at 200 X g.
10 l supernatant was diluted to 300 l in phosphate buffer containing 0.05%
hydrogen peroxide and 0.5% o-dianisidine dihydrochloride, a pH-sensitive
indicator dye. Absorbance of the diluted supernatant was measured by a
spectrophotomer (SpetraMax Plus 384, Molecular Devices, ). All drugs were
purchased from Sigma-Aldrich, Inc.
Histological examination of bladder inflammation
For histological evaluation, bladder tissue from CYP- and saline-treated
mice deeply was rinsed in saline and fixed in 4% formaldehyde, embedded in
paraffin and cut at 10 m thickness. Tissue sections were stained with 5%
hematoxylin and eosin and evaluated by a pathologist (Robert H. Garman, DVM,
DACVP, Consultants in Veterinary Pathology, Inc.).
71
Single cell RT-PCR
Bladder DRG neurons were retrogradely labeled and mice sacrificed as
described above. LS and TL DRG were removed and plated as described above
for electrophysiological study. After 14-16 hr incubation, coverslips were placed
in the patch clamp recording chamber and perfused with sterilized external
solution. DiI positive neurons were collected with glass pipettes (tip diameter ~
60-80 m) by gentle suction and expelled into 0.2 ml microcentrifuge tubes
containing 2.5 l lysis buffer consisting of 1X first-strand buffer, 2U RNaseOut, 10
M dNTP, 0.5% IGEPAL, and 0.05 g/l Oligo(dT)12-18 primer. Tubes were
incubated at 65°C for 1.5 minutes, then held at room temperature for 2 min.
Another 2.5 l of RT-PCR buffer consisting of 50 U SuperScript II reverse
transcriptase, 1X first-strand buffer, 2U RNaseOut, and 10 M dNTP was rapidly
added to each tube. Tubes were incubated at 37°C for 20 min, then at 65°C for
10 min to generate first strands of cDNA sequence. Negative controls were tubes
without labeled neurons or processed with RT-PCR buffer not containing reverse
transcriptase. Only RT-PCR products of the batches that passed tests of
negative controls underwent further PCR steps. All single cell RT-PCR reagents
were purchased from Invitrogen Inc (Carlsbad, CA).
Multiplex PCR and gene specific nested PCR
P2X2, P2X3, P2Y2 and P2Y4 genes were amplified through two rounds of PCR
(multiplex and nested PCR) from the cDNA library of individual mouse bladder
neurons. In the first round, two external primers of targeted genes were added
together into a 25 l volume PCR solution containing 1X PCR buffer, 0.2mM
72
dNTP, 1.6 M primers of each gene and 1U Taq Polymerase. In the second
round, 1l of first round PCR amplicons served as a template and two internal
primers of individual genes were added to the 25 l PCR system. Both multiplex
and nested PCR used the following PCR conditions: 1 cycle of 10 min at 95 °C;
32 cycles of 94 °C/30 sec, 52°C/30 sec, and 72 °C/30 sec before a final
extension step at 72 °C for 10 min, after which 10 l of the nested PCR products
was electrophoresed on a 2% (w/v) agarose gel at 100V for 25 min. After
electrophoresis, the gel was stained with 0.005% ethidium bromide and bands of
PCR products were visualized under UV light. Glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) served as an internal positive control. Single cell RTPCR products that failed to pass internal positive tests were eliminated from the
study. All primers were purchased from Integrated DNA Technologies, Inc.
(Coralville, IA) and are listed in table 1.
Immunohistochemistry
Alexa Fluor 488-conjugated Cholera Toxin B subunit (CTB, 2μg/ml;
Invitrogen Inc.) was injected into mouse bladder wall as described earlier for DiI
labeling. After 5 days, saline or CYP was given daily for day 1 to day 5. On day 6,
naïve, saline and CYP-treated mice were deeply anesthetized and perfused
transcardially with ice cold PBS then ice cold 4% paraformaldehyde. LS and TL
DRGs were rapidly removed, fixed in 4% paraformaldehyde for 4 h, and
cryoprotected in 30% sucrose for 3 days. Frozen DRGs were sectioned at 10 µm
using a Leica 3M 3050 cryostat; one section was selected every 50 µm to
minimize double counting. DRG sections were blocked with 2% donkey serum in
73
0.01 M phosphate-buffered saline (PBS, Sigma–Aldrich) for 2 h before incubation
in primary antibody (rabbit anti-mouse, 1:2000; Neuromics, Edina, MN) for 24 h,
4°C, after which the primary antibody was aspirated and sections were washed
three times for 15 min with 0.01 M PBS. Secondary antibody, Rhodamine Red Xconjugated conjugated to donkey anti-rabbit IgG (Jackson Immuno Research,
West Grove, PA), was applied for 4 h and washed three times for 15 min with
0.01 M PBS. Sections were mounted with Fluorescence Mount (Sigma–Aldrich
Inc.) and viewed with Olympus confocal microscope B211 equipped with
separate fluorescence filters. Images were captured and processed by Fluoview
Software. All cells positive for CTB fluorescence were counted as bladder
sensory neurons and the immunoreactivity of P2X3 subunit protein was
quantified. For control experiments, the incubation of primary antibody was
omitted. No labeling was observed (data not shown).
Data and statistical analysis
Data are presented as means ± SE. Analyses were performed using the
software package GraphPad Prism 5 (GraphPad Software, San Diego, CA).
Dose–response curves were generated using the following equation: Y=A+ (B-A)/
(1+10^[(LogEC50-X)]), where X is the logarithm of concentration; Y is the
response and starts at A and goes to B with a standard Hill slope of 1.0.
Desensitization kinetics were fitted with a standard exponential equation: Y = K0
+ K1 x exp(–t/τ), where Y is the current amplitude at time t, K0 is the amplitude of
the sustained component, and τ is the time constant. K0 and K1 represent the
contribution to current amplitude from the fast and slow components of the
74
current, respectively. For dichotomous variables, a Fisher's exact test was used.
Unpaired two-tailed t-tests were used for parametric measures if data were
collected from different animals or cells; paired t-tests were applied when
comparing current amplitudes from the same cell. Comparison of normalized
data from independent group was carried by nonparametric Mann-Whitney U-test.
Results were considered statistically significant when P<0.05.
75
Table 1. Purinergic currents in LS and TL bladder sensory neurons from naïve
mice
ATP
α,β-met ATP
LS neurons
TL neurons
% responding
93.0%** (106/114)
76.9% (70/91)
sustained
10.4% (11/106)
na
slow
89.6%* (95/106)
74.3% (52/70)
fast
na
25.7%(28/70)
% responding
83.3% (95/114)
76.9% (70/91)
sustained
na
na
slow
100% (95/95)
74.3% (52/70)
fast
na
25.7% (28/70)
Note: *, P < 0.05, **, P < 0.01 vs. the corresponding TL current type. na, not
applicable.
76
Table 2. Properties of purinergic currents in LS and TL bladder sensory neurons
from naive mice
ATP
current
α, β-met ATP
time to desensitiz
current
desensitiz
time to
density
peak
ing tau
density
ing tau
peak (ms)
(pA/pF)
(ms)
sustained 15.5±3.0 3898±86
LS
TL
slow
(ms)
(pA/pF)
na
na
(ms)
na
na
25.7±1.9** 641±34 2790±210 11.5±1.1* 1497±124 4587±582
fast
na
na
na
na
na
na
sustained
na
na
na
na
na
na
slow
17.0±2.2
638±48 2475±184 7.4±1.3 1458±126 4280±662
fast
9.7±2.3
253±32
224±18
6.6±2.6
272±36
211±25
Note: Data are means ± SEM. *, P < 0.05, **, P<0.01 vs. the corresponding TL
current type. na, not applicable
77
Table 3. Passive and active electrical properties of LS and TL bladder sensory
neurons
LS
TL
-70.4±1.7
-70.2±1.75
Input Resistance (M)
526.1±56.0
501.9±41.4
Rheobase (pA)
147.5 ± 12.6
160 ± 14.5
AP threshold (mV)
-34.1±0.5**
-28.5±0.8
AP amplitude (mV)
117.1±4.5
115±2.3
AP duration (ms)
3.6±0.3
4.5±0.3
AP overshoot (ms)
51.4±2.6
44.8±1.4
AP falling rate (mV/ms)
19.2±1.1
19.96±1.2
Spontaneous AP (%)
0
0
Depolarization (mV)
25.5±4.9
21.5±4.6
AP firing frequency
21/32*
10/30
Depolarization (mV)
15.9±2.9
10.1±2.2
AP firing frequency
10/32
5/30
RMP (mV)
Current
injection
ATP
(30M)
α,β-met ATP
(30M)
Note: Data are means ± SEM. *, P < 0.05; **, P<0.01 vs. the corresponding TL
current type.
78
Table 4. Summary of P2X3 immunoreactivity in LS and TL bladder DRG neurons
from naïve, saline- and CYP-treated mice
LS
TL
naïve
saline
CYP
naïve
saline
CYP
27.2%*
23.6%*
19.7%*
36.4%
36.3%
37.0%
(83/305)
(164/696)
(104/529)
(156/429)
(171/470)
(181/489)
7.2%*
8.0%*
6.6%*
2.8%
2.3%
2.0%
(27/305)
(56/696)
(35/529)
(12/429)
(11/470)
(10/489)
staining
5.0%**
3.5%**
2.8%**
50.0%
63.6%
50.0%
in CTB
(1/20)
(2/56)
(1/35)
(6/12)
(7/11)
(5/10)
P2X3 in
DRG
neurons
CTB in
DRG
neurons
P2X3
neurons
Note: *, P < 0.05 vs. the corresponding TL current type.
79
Table 5. Passive and active electrical properties of LS and TL bladder neurons
from saline- and CYP-treated mice
LS
saline
-70.5±1.6
-72.1±2.7
CYP
-68.6±1.6
-66.5±2.1
saline
435.1 ± 37.3
474.4±45.1
CYP
481.7 ± 30.7
419.4±29.9
saline
144.3±8.7
178±22.6
CYP
110.9±9.5†
128.2±8.5†
AP threshold
(mV)
saline
CYP
-33.4±0.7
-35.6±0.8
-30.2±1.7
-30.9±1.1
AP amplitude
(mV)
saline
121.1±2.5
116.4±4.2
CYP
115±3
108.7±2.3
saline
4.3±0.3
4.3±1.7
CYP
4.5±0.8
4.2±1.1
AP overshoot
(ms)
saline
CYP
50.6±1.7
50.5±1.4
44.3±2.3
46.4±2.0
AP falling rate
(mV/ms)
saline
19.5±1.3
21.2±1.7
CYP
21.0±1.9
20.7±1.3
depolarization
(mV)
saline
25.8±3.8
21.0±3.1
CYP
32.8±5.4
25.0±2.4
RMP (mV)
input
resistance(M)
rheobase (pA)
current
injection
AP duration (ms)
ATP
(30M)
α,β-met
ATP
(30M)
TL
*
10/23
**
10/28
AP firing
frequency
saline
CYP
28/33
depolarization
(mV)
saline
15.0±3.0
11.5±1.8
CYP
26.5±3.1†
17.2±1.7†
AP firing
frequency
saline
7/25
3/23
CYP
8/33
5/28
19/25
Note: Data are means ± SEM. *, P <0.05, **, P<0.01 vs. TL counterparts; †, P <
0.05 vs. saline treatment.
80
Table 6. Purinergic currents in LS and TL bladder sensory neurons from salineand CYP-treated mice
ATP
αβ-metATP
saline-treated CYP-treated saline-treated CYP-treated
96.9%*
(31/32)
9.7%
(3/31)
90.3%
(28/31)
93.3%
(42/45)
42.9%††
(18/42)
57.1%††
(24/42)
87.5%
(28/32)
53.3%††
(24/45)
na
na
100%
(28/28)
100%
(24/24)
fast
na
na
na
na
% responding
78.6%
(22/28)
85.3%
(29/34)
78.6%
(22/28)
85.3%
(29/34)
sustained
na
na
na
na
72.7%
(16/22)
27.3%
(6/22)
79.3%
(23/29)
20.7%
(6/29)
72.7%
(16.22)
27.3%
(6/22)
79.3%
(23/29)
20.7%
(6/29)
% responding
sustained
LS
slow
TL
slow
fast
Note: *, P < 0.05 vs. the corresponding TL current type. †, P < 0.05, ††, P < 0.01,
vs. control (saline) treatment. na, not applicable
81
Table 7. Properties of purinergic currents in LS and TL bladder sensory neurons
from saline- and CYP-treated mice
ATP
current
Current
Treat-
type
ment
α,β-met ATP
Desensiti-
current
Desensiti-
time to
density
time to
zing tau
density
zing tau
peak (ms)
(pA/pF)
peak (ms)
(ms)
(pA/pF)
(ms)
saline
15.5±5.2
3114±759
n/a
n/a
n/a
n/a
CYP
20.9±2.7
3615±244
n/a
n/a
n/a
n/a
saline
25.2±5.6 662.3±33.4 2160±163
7.9±1.7
1493±144 5586±850
CYP
31.6±4.0 771.4±72.9 2710±402
10.7±1.7
1596±158 7873±1309
sustained
LS
slow
saline
n/a
n/a
n/a
n/a
n/a
n/a
CYP
n/a
n/a
n/a
n/a
n/a
n/a
saline
n/a
n/a
n/a
n/a
n/a
n/a
CYP
n/a
n/a
n/a
n/a
n/a
n/a
fast
sustained
TL
saline
17.4±4.0 642.3±69.6 1840±270
7.4±1.6
1683±119 7543±4190
CYP
10.9±1.6 633.9±28.1 2440±173
3.7±0.9
*
2202±199 4825±2499
saline
9.1±1.7
261.3±50.4 181.6±7.5
4.5±1.1
268.9±56.9
*
14.4±2.3
slow
202±4.1
fast
CYP
*
24.2± 5.0 242.4±15.3 128.9±6.5
*
258.0±25.6 157.9±5.0
Note: Data are means ± SEM. *, P < 0.05 vs. the corresponding saline-treated
group. na, not applicable
82
Table 8. Passive and active electrical properties of LS bladder neurons in the
absence and the presence of UTP or UTP and suramin (SUR) application
Current
Injection
No UTP
(n=39)
UTP
(n=21)
UTP+SUR
(n=15)
RMP (mV)
-63.9±0.9
-55.6±1.5***
-64.9±2.8††
Input Resistance
(M)
242.0±16.5
224.9±23.0
259.4±17.1
Rheobase (pA)
142.4±11.6
82.2±5.2**
146.2±16.5††
AP threshold (mV)
-32.6±0.6
-33.8±1.0
-32.5±1.1
AP amplitude (mV)
107.3±2.1
101.2±2.6
109.3±4.4
AP duration (ms)
4.6±0.5
4.7±0.9
4.3±0.9
AP overshoot (ms)
44.5±1.4
42.0±1.2
46.4±1.8
19.3±1.5
18.6±1.6
20.5±1.9
3.3±0.5
8.7±1.0**
3.1±0.5†††
0/39
10/21**
0/15††
Depolarization (mV)
20.3±2.6
17.6±3.4
na
Number of APs
1.1±0.4
2.3±0.8
na
Depolarization (mV)
13.3±1.7
12.9±1.1
na
Number of APs
0.8±0.5
1.1±0.6
na
AP falling rate
(mV/ms)
AP frequency, 2X
rheobase
UTP induced-AP
firing
ATP
(30 M)
α,β-met
ATP
(30 M)
Note: Data are means ± SEM. *, P < 0.05; **, P<0.01; ***, P<0.005 vs. Naïve. †,
P < 0.05; ††, P<0.01; †††, P<0.005 vs. UTP application. na, not applicable
83
Table 9. Summary of contribution of P2X and P2Y receptors to mouse bladder
sensation
LS bladder neurons
TL bladder neurons
Bladder afferent
pathway
Pelvic
Lumbar splanchnic
/hypogastric
% of DRG neurons
6%
2%
Changes after bladder
inflammation
Cell excitability ↑
Cell excitability ↑
Changes after UTP
application
Cell excitability ↑
Cell excitability ↑
Purinoceptive
neurons %
93% of LS bladder
neurons
77% of TL bladder
neurons
% expressing P2XR
transcripts
P2X2: 89% ; P2X3: 93%
P2X2: 51%; P2X3: 98%
% expressing P2YR
transcripts
P2Y2: 47%; P2Y4: 22%
P2Y2: 38%; P2Y4: 13%
P2X/P2Y transcripts
after bladder
inflammation
No change
No change
% co-expressing P2XR
and P2YR
P2Y2: ~50% of P2X cells
P2Y4: ~20% of P2X cells
P2Y2: ~45% of P2X cells
P2Y4: ~15% of P2X cells
Functional P2XR
(current type, % of
purinoceptive neurons)
P2X2
(sustained,
10%)
P2X2/3
(slow,
90%)
P2X3
(fast,
26%)
P2X2/3
(slow,
74%)
Changes of P2XR after
bladder inflammation
%↑
%↓
Function ↑
No change
Modulation by
UTP/ATP
Function ↑
No change
Function ↑
No change
Modulation by P2Y2
receptor
Yes,
Gq-PKC
pathway
No
No,
GPCR
independent
No
84
Table 10. External and internal primers for mouse P2X2, P2X3, P2Y2, P2Y4 and
GAPDH cDNA
P2X2 (NM_153400)
P2X3 (NM_145526)
P2Y2 (NM_008773)
P2Y4 (NM_020621)
GAPDH
(NM_008084)
External Forward
CTCTTCAGTAACCATGTCCACG
External Reverse
CCGGAAGACAGCTCTAATTTGG
Internal Forward
GAAGATAGGCATCTTGCTCTGG
Internal Reverse
GGGATCCTATGAGGAGTTCTGT
External Forward
GCTCCCTAGAAGAAGATGGAGA
External Reverse
CTGTGTGACCATGTTAGGGATG
Internal Forward
TGTCCTAAGAGGATCCTGTACC
Internal Reverse
GGCATCTAGCACATAGAAGTGG
External Forward
GGGAGAGTAGTGTAGCTGATGA
External Reverse
GTCCTTGAGATCATGAGGCTTG
Internal Forward
GTAGATGCCACACCTATCCAAC
Internal Reverse
CCTTGAGATCATGAGGCTTGTC
External Forward
CCCAAGAGTTGGTAGTAGACAC
External Reverse
CGTGCTCTTTGGTCTGGTAATC
Internal Forward
GTTGGTAGTAGACACAAGAGGG
Internal Reverse
CAGCCTGGTCTATAGAGTGAGT
External Forward
GCTGAGTATGTCGTGGAGTCTA
External Reverse
CATACTTGGCAGGTTTCTCCAG
85
Figure 1. The density of bladder pelvic and hypogastric innervations in cultured
lumbosacral (LS) and thoracolumbar (TL) mouse DRG neurons
Four lumbosacral DRG and four thoracolumbar DRG coverslips were
randomly chosen from four bladder retrogradely labeled mice. An example of a
selected view field (10X objective) of DRG neuron coverslip was shown under
differential-interference contrast (DIC) mode (A) and fluorescence mode (B).
6.0±0.4% (77/1276) of L6-S2 DRG and 2.4±0.2% (40/1635) of DiI-labeled T13-L2
DRG cells were recognized as DiI-positive neurons. The proportion of LS bladder
neuron was significantly greater the proportion of TL bladder neuron (C).
86
A
40 m
B
40  m
C
% of bladder ne uron
10
**
8
6
4
2
0
LS
TL
87
Figure 2. Comparison of cell size (capacitance) of LS and TL mouse bladder
sensory neurons
(A) Scatter plot of whole-cell capacitance (an index of cell size) showing
similar pattern of cell size distribution in LS and TL DRGs. (B) Frequency
distribution of whole-cell capacitance in LS and TL bladder sensory neurons.
Cells with capacitance <20pF were considered as small neurons, and ones with
capacitance >45pF were considered as larger neurons; medium size neurons
had capacitances between 20 to 45pF. No significant difference of capacitance
distribution in LS and TL bladder neurons was detected.
88
A
capacitance (pF)
70
60
50
40
30
20
10
B
LS
(N=114)
frequency (%)
100
TL
(N=91)
LS
TL
80
60
40
20
0
small
medium
large
89
Figure 3. Examples of principal purinergic currents in LS and TL bladder sensory
neurons in response to ATP (30μM) and αβ-Met ATP (30μM)
Based on current inactivation kinetics and agonist responses, three
distinct current types were identified: slow desensitizing currents predominated in
LS (~90%, A) and TL (~75%, C) neurons; (B) sustained currents without an
obvious inactivation phase were found only in LS neurons (~10%); and (D) fast
desensitizing currents were found only in TL neurons (~25%). The duration of
agonist application (4 sec) is denoted by the horizontal bar.
ATP (30M)
ATP (30M)
A
B
LS
-Met ATP (30M)
-Met ATP (30M)
D
C
ATP (30M)
ATP (30M)
TL
-Met ATP (30M)
-Met ATP (30M)
90
91
Figure 4. Antagonism of purinergic agonist-evoked sustained currents
(A) Sustained currents evoked by ATP (30μM) were not inhibited by TNPATP (0.1μM). (B) PPADS (10μM) completely antagonized ATP-evoked sustained
currents. (C) Summary of antagonism of sustained currents. Amplitude of
sustained current was not decreased by TNP-ATP application (n=5), but was
significantly attenuated by PPADS by a mean of 82.0±5.6% (n=5). The duration
of agonist application (4 sec) is denoted by the horizontal bar.
92
B
ATP (30M)
ATP (30M) +
TNP-ATP (0.1M)
washout
ATP (30M)
ATP (30M) +
PPADS (10M)
washout
Inhibition of current amplitude
C
1.0
0.8
0.6
0.4
0.2
0.0
-0.2
-0.4
TNP-ATP
PPADS
93
Figure 5. Antagonism of purinergic agonist-evoked slow desensitizing currents
Slow desensitizing currents evoked by ATP were greatly attenuated by the
P2X3 receptor-selective antagonist TNP-ATP (A) and by the non-selective
purinergic antagonist PPADS (B). (C) Summary of antagonism of slow currents.
TNP-ATP significantly attenuated the slow currents evoked by ATP (by a mean
55.5±2.1%, n=5) or α,β-met ATP (by a mean 55.6±3.0%, n=4). PPADS also
significantly attenuated the slow currents evoked by ATP (by a mean 77.7±3.0%,
n=5) or α,β-met ATP (by a mean 82.0±2.1%, n=4). The duration of agonist
application (4 sec) is denoted by the horizontal bar.
94
B
ATP (30M)
ATP (30M) +
TNP-ATP (0.1M)
washout
ATP (30M)
ATP (30M) +
PPADS (10M)
washout
Inhibition of current amplitude
C
TNP-ATP
PPADS
1.0
0.8
0.6
0.4
0.2
0.0
ATP-evoked
 -Met ATP-evoked
95
Figure 6. Antagonism of purinergic agonist-evoked fast desensitizing currents
Fast desensitizing currents were completely inhibited by the P2X3
receptor-selective antagonist TNP-ATP (A) and by the non-selective purinergic
antagonist PPADS (B). (C) Summary of antagonism of fast currents. TNP-ATP
significantly attenuated the fast currents evoked by ATP (by a mean 55.5±2.1%,
n=4) and PPADS also attenuated the fast currents evoked by ATP (by a mean
77.7±3.0%, n=4). The duration of agonist application (4 sec) is denoted by the
horizontal bar.
96
C
washout
ATP (30M)
ATP (30M) +
PPADS (10M)
washout
Inhibition of current amplitude
B
ATP (30M)
ATP (30M) +
TNP-ATP (0.1M)
1.0
0.8
0.6
0.4
0.2
0.0
TNP-ATP
PPADS
97
Figure 7. Examples of principal purinergic current in P2X3-/- mice
Only a sustained current was evoked by ATP in LS bladder neurons (A)
which was inhibited by PPADS (C) but not TNP-ATP (D). No obvious response to
ATP or α, β-Met ATP was observed in TL bladder neurons (B). The duration of
agonist application (4 sec) is denoted by the horizontal bar.
98
LS
A
ATP (30M)
TL
B
-Met ATP (30M)
ATP (30M)
-Met ATP (30M)
83.33%
no response
(10/12)
(0/8)
C
ATP (30M)
ATP (30M) +
PPADS (10M)
D
ATP (30M)
ATP (30M) +
TNP-ATP (0.1M)
washout
washout
99
Figure 8. Examples of bladder sensory neuron responses to current injection and
agonist application.
(A) A series of current pluses (20 pA increment, 1s apart) was injected,
and an action potential in a bladder sensory neuron was evoked. The rheobase
was determined as the maximum current (pA) that did not evoke an action
potential. Action potential (AP) threshold was determined from the inflection point
where membrane potential started to dramatically rise and the phase plot slope
(the first derivative of membrane potential, dV/dt) reached 10 mV/ms. (B)
Examples of agonist (ATP) application induced- membrane depolarization (left)
and action potential (right).
100
A
AP overshoot
50mV
AP threshold
10ms
RMP
140pA
B
ATP (30M)
ATP (30M)
20mV
2s
101
Figure 9. Single cell nested RT-PCR of P2X2 and P2X3 receptor subunits in LS
and TL bladder neurons
(A) An example of positive nested single cell PCR amplification of P2X2
and P2X3 mRNA. Product length corresponded with expected size. The
frequency of P2X2 and P2X3 transcription in bladder neurons is summarized in
(B). Percentage of cells only expressing P2X2, P2X3, or both P2X2 and P2X3 is
illustrated in (C). * TL vs. LS, P<0.05; ** TL vs. LS, P<0.01.
102
P2X2
(113bp)
A
P2X3
(141bp)
200bp
100bp
100
Frequency (%)
B
LS
TL
**
80
60
40
20
0
P2X2
C
LS
TL
*
100
Frequency (%)
P2X3
80
**
60
40
20
*
0
P2X2 ONLY
P2X2/3
P2X3 ONLY
103
Figure 10. Immunohistochemistry of P2X3 subunit in bladder sensory neurons
from naïve mice
Examples of immunohistochemical staining of P2X3 receptor subunit in
bladder sensory neurons identified by the presence of Cholera Toxin B (CTB) are
shown. (A) Representative images of P2X3 immunostaining in mouse L6 DRG.
(B) Representative images of P2X3 immunostaining in mouse L1 DRG. Arrows
indicated bladder neurons with positive P2X3 immunoreactivity. The scale bar
represents 50μm.
104
A
CTB
P2X3
Merge
CTB
P2X3
Merge
LS
B
TL
105
Figure 11. Bladder weight and bladder myeloperoxidase (MPO) activity in naïve
saline- and CYP-treated mice
(A) Mean bladder weight after CYP treatment was significantly greater
(38.6 ± 1.3 mg, n=8) than that of bladders taken from saline-treated (23.7±0.7mg,
n=6; P<0.005) or naïve mice (22.9±1.1mg, n=6; P<0.005). (B) No significant
change of bladder MPO activity after CYP treatment (0.0002±0.0004 Unit/gram,
n=8) was detected compared with saline-treated (0.002±0.002 Unit/gram, n=4) or
naïve mice (0.0009±0.0009 Unit/gram, n=4).
106
A
***
Bladder weight (mg)
50
***
40
30
20
10
0
B
MPO activity (Unit/gram)
Naive
Saline
CYP
saline
CYP
0.010
0.008
0.006
0.004
0.002
0.000
Naive
107
Figure 12. Histological assessment of bladder inflammation in saline- and CYPtreated mice
Photomicrographs of representative histological specimen of bladder
tissues taken from saline- (A) and CYP- (B) treated mice. Areas identified by
boxes are enlarged sequentially from top to bottom. Mild submucosal edema
and unfolding of the urothelium were detected in bladders of CYP- but not salinetreated mice. Tissue sections were stained with H&E. Scale bar indicates 100μm.
108
109
Figure 13. Examples of responses of bladder sensory neurons to current
injection and agonist application in saline- and CYP- treated mice
The injected current required to evoke an action potential in LS and TL
bladder neurons was significantly reduced after CYP treatment (B,D) relative to
saline treatment (A,C). The magnitude of membrane depolarization in LS and TL
bladder neurons was increased after CYP-treatment compared with salinetreated controls in response to αβ-met ATP (F, H) but not to ATP (E,G).
110
A
B
saline
CYP
LS
160pA
C
120pA
D
50mV
10ms
TL
180pA
E
ATP
saline
CYP
120pA
F
-Met ATP (30M)
saline
CYP
LS
G
TL
H
10mV
2s
111
Figure 14. Single cell nested RT-PCR of P2X2 and P2X3 receptor subunits in LS
and TL bladder neurons from saline- and CYP-treated mice
The frequency of P2X2 and P2X3 transcription in bladder neurons is
summarized in (A). Percentage of cells only expressing P2X2, P2X3, or both
P2X2 and P2X3 is illustrated in (B). (* TL vs. LS, P<0.05; ** P<0.01; † saline vs.
CYP, P<0.05).
112
A
frequency (%)
100
**
LS-SAL
LS-CYP
TL-SAL
TL-CYP
†
80
60
40
20
0
P2X2
P2X3
B
frequency (%)
100
*
80
*
60
40
20
0
P2X2 ONLY
P2X2/3
P2X3 ONLY
LS-SAL
LS-CYP
TL-SAL
TL-CYP
113
Figure 15. Immunohistochemistry of P2X3 subunit in bladder sensory neurons
from saline-treated and CYP-treated mice
Examples of immunohistochemical staining of P2X3 subunit in bladder
sensory neurons identified by Cholera Toxin B (CTB) labeling were presented
here. Representative images of P2X3 immunostaining in mouse LS and TL
DRGs from saline-treated mice were shown in (A: S1 DRG) and (B: L1 DRG).
Representative images of P2X3 immunostaining in mouse LS and TL DRGs from
CYP-treated mice were shown in (C: S1 DRG) and (D: L1 DRG). The scale bar
represents 50μm.
114
115
Figure 16. UTP increases the excitability of bladder sensory neurons
Examples of responses of lumbosacral bladder neurons to current
injection before and after UTP application are shown here. (A, B) The injected
current required to evoke an action potential in bladder neurons was significantly
reduced after UTP application from142.4±11.6 pA to 82.2±5.2 pA (n=24; P<0.01).
(C, D) Current injection at 2X rheobase (500ms) evoked a significantly greater
number of APs after UTP application (8.7±1.0) relative to before UTP application
(3.3±0.5; n=24, P<0.01). (E) An example of sustained AP firing during and after
UTP application.
116
control
UTP
B
A
20mV
10ms
120pA
C
80pA
D
20mV
100ms
240pA
E
160pA
UTP 1M
20mV
5S
117
Figure 17. Examples of the effect of UTP on LS bladder neuron responses to
ATP
A fraction (8/21) of bladder neurons was sensitized by UTP, showing
evoked AP firing (A) or increased frequency of APs (B) relative to the response to
ATP before UTP application to the same cell. Other neurons (13/21) did not
exhibit changes in response to ATP after UTP application (C, D).
118
A
B
UTP (1M, 40s)
ATP
(30M)
UTP (1M, 40s)
ATP
(30M)
20mV
4s
C
ATP
(30M)
UTP (1M, 40s)
D
ATP
(30M)
UTP (1M, 40s)
119
Figure 18. Recovery kinetics of ATP-evoked sustained, slow and fast currents in
LS bladder neurons
Examples of sustained (A, B), slow (C, D) and fast (E, F) currents at
different application intervals of ATP (30μM) are shown here. Recovered current
fractions were fitted with a single exponential (E: sustained and slow current; F:
fast current). The time constant of the sustained current is not available because
it completely recovered very rapidly. The slow current recovered with a time
constant of 16.8s, and the fast current recovered with a time constant of 70.3s.
120
A
2s
B
5s
0.2nA
5s
C
5s
D
60s
0.2nA
5s
E
F
40s
0.5nA
5s
120s
121
G
normalized ATP-evoked
current
Figure 18- continued
Sustained
Slow
1.2
1.0
0.8
0.6
0.4
0
20
40
60
80
100
time (s)
H
normalized ATP-evoked
current
1.2
Fast
1 .0
0 .8
0 .6
0 .4
0.2
0.0
0
50
100
time (s)
150
200
122
Figure 19. The effect of UTP on ATP-evoked sustained, slow and fast currents in
LS and TL bladder neurons
ATP (30μM) was applied to LS or TL bladder neurons for 4 sec (the left
traces), followed by a 2-minute washout period using external solution, and then
applied external solution containing UTP (1μM) for 40 sec before repeating the
ATP application (the middle traces). After another 2-minute washout period,
currents induced by a third exposure to ATP were recorded (the right traces).
UTP significantly facilitated ATP-evoked sustained (A) and fast (C) currents but
not slow currents (B). (D) Summary of the effect of UTP on ATP-evoked
sustained (n=16), slow (n=24) and fast (n=5) currents.
123
A
UTP (0.3M, 40s)
ATP
(30M)
0.2nA
B
UTP (0.3M, 40s)
ATP
(30M)
0.2nA
UTP (0.3M, 40s)
C
ATP
(30M)
0.2nA
2s
normalized ATP-evoked current
D
1.8
1.6
1.4
ATP before UTP
ATP with UTP
*
**
1.2
1.0
0.8
0.6
0.4
0.2
0.0
sustained
slow
fast
124
Figure 20. The effect of repeated ATP application without UTP on ATP-evoked
sustained, slow and fast currents in LS and TL bladder neurons
ATP (30μM) was applied to LS or TL bladder neurons for 4 sec (the left
traces), followed by a 2-minute washout period using external solution, and then
applied nothing (a control of UTP application) for 40 sec before repeating the
ATP application (the middle traces). After another 2-minute washout period,
currents induced by a third exposure to ATP were recorded (the right traces). No
change of sustained (A) or slow (B) currents after repeated ATP application in LS
bladder sensory neurons was observed. ATP-evoked fast (C) current in TL
bladder neurons show significant differences in response to repetitive ATP
application. (D) Summary of repetitive ATP application on ATP-evoked sustained
(n=11), slow (n=20) and fast (n=5) currents.
125
A(30ATP
M)
0.5nA
B(30ATP
M)
0.2nA
C
ATP
(30M)
0.5nA
2s
normalized ATP-evoked current
D
1.8
1.6
1st ATP
2nd ATP
*
1.4
1.2
1.0
0.8
0.6
0.4
0.2
0.0
sustained
slow
fast
126
Figure 21. The dose-response relationship of ATP evoked-sustained currents in
response to UTP in LS bladder neurons
(A) An example of the influences of different concentration of UTP on ATP
evoked-sustained current in lumbosacral bladder neurons. (B) Normalized doseresponse curve of ATP evoked-sustained currents in response to UTP. The EC50
and 95% confidence interval for UTP was 0.52μM (0.13-1.97μM; n=7).
127
ATP (30M)
B
Before UTP
UTP 0.03M
UTP 0.1M
UTP 0.3M
UTP 1.0M
UTP 3.0M
UTP 10.0M
2s
normalized ATP-evoked current
0.2nA
A
2.0
1.8
1.6
1.4
1.2
1.0
0.8
-8
-7
-6
log [UTP]M
-5
128
Figure 22. The facilitatory effect of UTP on ATP-evoked sustained currents but
not fast currents is mediated by G protein-coupled P2Y2 receptor through a PKC
dependent pathway.
Although the facilitatory effect of UTP on sustained currents was blocked
by intracellular GDP-β-s (A), the increased fast currents induced by
UTP/repeated ATP application were not inhibited by GDP-β-s (A and B). No
significant change of either sustained or slow currents in response to repeated
ATP application was found in bladder neurons containing GDP-β-s compared
with controls (B). The PKC inhibitor (myristoylated Protein Kinase C Inhibitor 2028, 10μM) prevented the effect of UTP on P2X2 sustained current in lumbosacral
bladder neurons (C). No significant UTP effect on slow current was observed in
presence or absence of the PKC blocker in lumbosacral bladder neurons (C).
Neurons from P2Y2 knockout mice did not show a facilitatory effect of UTP on
sustained currents in lumbosacral bladder neurons compared with wild type
bladder neurons (D).
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
C1.6
normalized ATP-evoked current
normalized ATP-evoked current
slow
fast
slow
ATP with UTP
ATP with UTP+PKC inhibitor
sustained
*
sustained
*
ATP with UTP
ATP with UTP+GDP--S
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
D1.6
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
B
normalized ATP-evoked current
normalized ATP-evoked current
A
sustained
*
sustained
fast
slow
ATP with UTP in P2Y2+/+
ATP with UTP in P2Y2-/-
slow
2nd ATP
2nd ATP + GDP--S
129
130
Figure 23. The effect of UTP/ATP on bladder sensory neurons containing
intracellular GDP-β-S, in presence of PKC inhibitor and from P2Y2 knockout
mice.
The UTP/ATP effect was examined by comparing current amplitude
evoked by ATP before and with UTP/repeated ATP application in the same
bladder neuron. UTP (A) and repeated ATP (B) application did not elicit
significant changes of sustained (n=7 for both UTP and ATP) or slow (UTP: n=7;
ATP n=9) currents in lumbosacral bladder neurons containing GDP-β-s (100μM),
but did induce significant enhancement of fast current (n=5 for both UTP and
ATP). No significant UTP effect on sustained (n=4) or slow (n=5) current was
observed in lumbosacral bladder neurons with PKC inhibitor (C). Both ATPevoked sustained (n=6) and slow (n=10) currents were inhibited by UTP in
lumbosacral bladder neurons from P2Y2 knockout mice (D).
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
C
normalized ATP-evoked current
normalized ATP-evoked current
slow
fast
*
sustained
slow
ATP before UTP
ATP with UTP+PKC inhibitor
sustained
ATP + GDP--S
ATP with UTP+GDP--S
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
D1.6
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
B
normalized ATP-evoked current
normalized ATP-evoked current
A
slow
sustained
*
slow
*
*
fast
ATP before UTP in P2Y2-/ATP with UTP in P2Y2-/-
sustained
1st ATP + GDP--S
2nd ATP + GDP--S
131
132
Figure 24. Single cell nested RT-PCR of P2X2, P2X3, P2Y2 and P2Y4 receptor
subunits in LS and TL bladder neurons
(A) Examples of positive nested single cell PCR amplification of P2X and
P2Y mRNAs. Product length corresponded with expected size. The frequency of
P2X and P2Y transcription in bladder neurons is summarized in (B). The P2X2
subunit transcript was significantly more abundant in LS than TL bladder neurons
(P<0.01). The percentage of cells expressing P2Y2 and P2Y4 transcripts in
P2X2- (C) or P2X3- (D) positive neurons is illustrated in pie charts.
133
P2X3
P2X2
A
P2Y2
P2Y4
300bp
200bp
100bp
B
frequency (%)
100
LS
TL
**
80
60
40
20
0
P2X2
P2X3
P2
Y2
P2
Y2
P2
Y
P2X3(+) TL cells
Y4
P2
Y
4
P2X3(+) LS cells
P2Y4
P2X2(+) TL cells
P2
P2
Y4
P2
Y2
4
P2X2(+) LS cells
C
D
P2Y2
P2
Y2
134
REFERENCES
Abrams P, Baranowski A, Berger RE, Fall M, Hanno P, Wesselmann U (2006) A
new classification is needed for pelvic pain syndromes--are existing
terminologies of spurious diagnostic authority bad for patients? J Urol 175:19891990.
Al-Hadithi HN, Williams H, Hart CA, Frazer M, Adams EJ, Richmond DH, Tincello
DG (2005) Absence of bacterial and viral DNA in bladder biopsies from patients
with interstitial cystitis/chronic pelvic pain syndrome. J Urol 174:151-154.
Alagiri M, Chottiner S, Ratner V, Slade D, Hanno PM (1997) Interstitial cystitis:
unexplained associations with other chronic disease and pain syndromes.
Urology 49:52-57.
Alvarez J, Coulombe A, Cazorla O, Ugur M, Rauzier JM, Magyar J, Mathieu EL,
Boulay G, Souto R, Bideaux P, Salazar G, Rassendren F, Lacampagne A,
Fauconnier J, Vassort G (2008) ATP/UTP activate cation-permeable channels
with TRPC3/7 properties in rat cardiomyocytes. Am J Physiol Heart Circ Physiol
295:H21-H28.
Andersson KE, Wein AJ (2004) Pharmacology of the lower urinary tract: basis for
current and future treatments of urinary incontinence. Pharmacol Rev 56:581-631.
Andersson KE (2002) Bladder activation: afferent mechanisms. Urology 59:43-50.
Applebaum AE, Vance WH, Coggeshall RE (1980) Segmental localization of
sensory cells that innervate the bladder. J Comp Neurol 192:203-209.
Barclay J, Patel S, Dorn G, Wotherspoon G, Moffatt S, Eunson L, Abdel'al S, Natt
F, Hall J, Winter J, Bevan S, Wishart W, Fox A, Ganju P (2002) Functional
downregulation of P2X3 receptor subunit in rat sensory neurons reveals a
significant role in chronic neuropathic and inflammatory pain. J Neurosci
22:8139-8147.
Bennett DL, Dmietrieva N, Priestley JV, Clary D, Mcmahon SB (1996) trkA,
CGRP and IB4 expression in retrogradely labelled cutaneous and visceral
primary sensory neurones in the rat. Neurosci Lett 206:33-36.
Bennett HL, Gustafsson JA, Keast JR (2003) Estrogen receptor expression in
lumbosacral dorsal root ganglion cells innervating the female rat urinary bladder.
Auton Neurosci 105:90-100.
Birder LA (2005) More than just a barrier: urothelium as a drug target for urinary
bladder pain. Am J Physiol Renal Physiol 289:F489-F495.
135
Birder LA, Barrick SR, Roppolo JR, Kanai AJ, de Groat WC, Kiss S, Buffington
CA (2003) Feline interstitial cystitis results in mechanical hypersensitivity and
altered ATP release from bladder urothelium. Am J Physiol Renal Physiol
285:F423-F429.
Birder LA, de Groat WC (2007) Mechanisms of disease: involvement of the
urothelium in bladder dysfunction. Nat Clin Pract Urol 4:46-54.
Birder LA, Nakamura Y, Kiss S, Nealen ML, Barrick S, Kanai AJ, Wang E, Ruiz G,
de Groat WC, Apodaca G, Watkins S, Caterina MJ (2002) Altered urinary bladder
function in mice lacking the vanilloid receptor TRPV1. Nat Neurosci 5:856-860.
Bon K, Lichtensteiger CA, Wilson SG, Mogil JS (2003) Characterization of
cyclophosphamide cystitis, a model of visceral and referred pain, in the mouse:
species and strain differences. J Urol 170:1008-1012.
Brady CM, Apostolidis A, Yiangou Y, Baecker PA, Ford AP, Freeman A, Jacques
TS, Fowler CJ, Anand P (2004) P2X3-immunoreactive nerve fibres in neurogenic
detrusor overactivity and the effect of intravesical resiniferatoxin. Eur Urol
46:247-253.
Brierley SM, Carter R, Jones W, III, Xu L, Robinson DR, Hicks GA, Gebhart GF,
Blackshaw LA (2005) Differential chemosensory function and receptor
expression of splanchnic and pelvic colonic afferents in mice. J Physiol 567:267281.
Burgard EC, Niforatos W, Van BT, Lynch KJ, Touma E, Metzger RE, Kowaluk EA,
Jarvis MF (1999) P2X receptor-mediated ionic currents in dorsal root ganglion
neurons. J Neurophysiol 82:1590-1598.
Burkman RT (2004) Chronic pelvic pain of bladder origin: epidemiology,
pathogenesis and quality of life. J Reprod Med 49:225-229.
Burnstock G (2006) Purinergic signalling. Br J Pharmacol 147 Suppl 1:S172S181.
Burnstock G (2007) Physiology and pathophysiology of purinergic
neurotransmission. Physiol Rev 87:659-797.
Caterina MJ, Leffler A, Malmberg AB, Martin WJ, Trafton J, Petersen-Zeitz KR,
Koltzenburg M, Basbaum AI, Julius D (2000) Impaired nociception and pain
sensation in mice lacking the capsaicin receptor. Science 288:306-313.
Clapham DE (2003) TRP channels as cellular sensors. Nature 426:517-524.
136
Cockayne DA, Dunn PM, Zhong Y, Rong W, Hamilton SG, Knight GE, Ruan HZ,
Ma B, Yip P, Nunn P, Mcmahon SB, Burnstock G, Ford AP (2005) P2X2
knockout mice and P2X2/P2X3 double knockout mice reveal a role for the P2X2
receptor subunit in mediating multiple sensory effects of ATP. J Physiol 567:621639.
Cockayne DA, Hamilton SG, Zhu QM, Dunn PM, Zhong Y, Novakovic S,
Malmberg AB, Cain G, Berson A, Kassotakis L, Hedley L, Lachnit WG, Burnstock
G, Mcmahon SB, Ford AP (2000) Urinary bladder hyporeflexia and reduced painrelated behaviour in P2X3-deficient mice. Nature 407:1011-1015.
Cook SP, McCleskey EW (2002) Cell damage excites nociceptors through
release of cytosolic ATP. Pain 95:41-47.
Cova R, Guarneri L, Angelico P, Velasco C, Leonardi A, Testa R (1999) Effects
of infravesical suramin and PPADS on cystometrographic parameters in
conscious rats. Urodynamica 9:162-168.
Cox PJ (1979) Cyclophosphamide cystitis--identification of acrolein as the
causative agent. Biochem Pharmacol 28:2045-2049.
Dang K, Bielefeldt K, Gebhart GF (2005a) Differential responses of bladder
lumbosacral and thoracolumbar dorsal root ganglion neurons to purinergic
agonists, protons, and capsaicin. J Neurosci 25:3973-3984.
Dang K, Bielfeldt K, Lamb K, Gebhart GF (2005b) Gastric ulcers evoke
hyperexcitability and enhance P2X receptor function in rat gastric sensory
neurons. J Neurophysiol 93:3112-3119.
Dang K, Lamb K, Cohen M, Bielefeldt K, Gebhart GF (2008) Cyclophosphamideinduced bladder inflammation sensitizes and enhances P2X receptor function in
rat bladder sensory neurons. J Neurophysiol 99:49-59.
Dorn G, Patel S, Wotherspoon G, Hemmings-Mieszczak M, Barclay J, Natt FJ,
Martin P, Bevan S, Fox A, Ganju P, Wishart W, Hall J (2004) siRNA relieves
chronic neuropathic pain. Nucleic Acids Res 32:e49.
Dunn PM, Zhong Y, Burnstock G (2001) P2X receptors in peripheral neurons.
Prog Neurobiol 65:107-134.
Erickson DR, Morgan KC, Ordille S, Keay SK, Xie SX (2001) Nonbladder related
symptoms in patients with interstitial cystitis. J Urol 166:557-561.
Everaerts W, Gevaert T, Nilius B, De RD (2008) On the origin of bladder sensing:
Tr(i)ps in urology. Neurourol Urodyn 27:264-273.
137
Ferguson DR, Kennedy I, Burton TJ (1997) ATP is released from rabbit urinary
bladder epithelial cells by hydrostatic pressure changes--a possible sensory
mechanism? J Physiol 505 ( Pt 2):503-511.
Floyd K, Hick VE, Morrison JF (1976) Mechanosensitive afferent units in the
hypogastric nerve of the cat. J Physiol 259:457-471.
Floyd K, Lawrenson G (1979) Mechanosensitive afferents in the cat pelvic nerve
[proceedings]. J Physiol 290:51P-52P.
Forrest SL, Keast JR (2008) Expression of receptors for glial cell line-derived
neurotrophic factor family ligands in sacral spinal cord reveals separate targets of
pelvic afferent fibers. J Comp Neurol 506:989-1002.
Gabella G, Davis C (1998) Distribution of afferent axons in the bladder of rats. J
Neurocytol 27:141-155.
Gerevich Z, Borvendeg SJ, Schroder W, Franke H, Wirkner K, Norenberg W,
Furst S, Gillen C, Illes P (2004) Inhibition of N-type voltage-activated calcium
channels in rat dorsal root ganglion neurons by P2Y receptors is a possible
mechanism of ADP-induced analgesia. J Neurosci 24:797-807.
Gerevich Z, Illes P (2004) P2Y receptors and pain transmission. Purinergic
Signal 1:3-10.
Gerevich Z, Muller C, Illes P (2005) Metabotropic P2Y1 receptors inhibit P2X3
receptor-channels in rat dorsal root ganglion neurons. Eur J Pharmacol 521:3438.
Gever JR, Cockayne DA, Dillon MP, Burnstock G, Ford AP (2006) Pharmacology
of P2X channels. Pflugers Arch 452:513-537.
Grubb BD, Evans RJ (1999) Characterization of cultured dorsal root ganglion
neuron P2X receptors. Eur J Neurosci 11:149-154.
Habler HJ, Janig W, Koltzenburg M (1990) Activation of unmyelinated afferent
fibres by mechanical stimuli and inflammation of the urinary bladder in the cat. J
Physiol 425:545-562.
Habler HJ, Janig W, Koltzenburg M (1993) Myelinated primary afferents of the
sacral spinal cord responding to slow filling and distension of the cat urinary
bladder. J Physiol 463:449-460.
Hamilton SG, Warburton J, Bhattacharjee A, Ward J, Mcmahon SB (2000) ATP
in human skin elicits a dose-related pain response which is potentiated under
conditions of hyperalgesia. Brain 123 ( Pt 6):1238-1246.
138
Held PJ, Hanno PM, Wein AJ (1990) Epidemiology of interstitial cystitis. In:
Interstitial cystitis (P.M.Hanno, D.R.Staskin, J.R.Krane, A.J.Wein, eds), pp 29-48.
London: Springer Verlag.
Hilliges M, Weidner C, Schmelz M, Schmidt R, Orstavik K, Torebjork E,
Handwerker H (2002) ATP responses in human C nociceptors. Pain 98:59-68.
Holton FA, Holton P (1954) The capillary dilator substances in dry powders of
spinal roots; a possible role of adenosine triphosphate in chemical transmission
from nerve endings. J Physiol 126:124-140.
Holton P (1959) The liberation of adenosine triphosphate on antidromic
stimulation of sensory nerves. J Physiol 145:494-504.
Honore P, Kage K, Mikusa J, Watt AT, Johnston JF, Wyatt JR, Faltynek CR,
Jarvis MF, Lynch K (2002a) Analgesic profile of intrathecal P2X(3) antisense
oligonucleotide treatment in chronic inflammatory and neuropathic pain states in
rats. Pain 99:11-19.
Honore P, Mikusa J, Bianchi B, McDonald H, Cartmell J, Faltynek C, Jarvis MF
(2002b) TNP-ATP, a potent P2X3 receptor antagonist, blocks acetic acid-induced
abdominal constriction in mice: comparison with reference analgesics. Pain
96:99-105.
Ibrahim IA, Diokno AC, Killinger KA, Carrico DJ, Peters KM (2007) Prevalence of
self-reported interstitial cystitis (IC) and interstitial-cystitis-like symptoms among
adult women in the community. Int Urol Nephrol 39:489-495.
Ito K, Iwami A, Katsura H, Ikeda M (2008) Therapeutic effects of the putative
P2X3/P2X2/3 antagonist A-317491 on cyclophosphamide-induced cystitis in rats.
Naunyn Schmiedebergs Arch Pharmacol 377:483-490.
Jarvis MF, et al. (2002) A-317491, a novel potent and selective non-nucleotide
antagonist of P2X3 and P2X2/3 receptors, reduces chronic inflammatory and
neuropathic pain in the rat. Proc Natl Acad Sci U S A 99:17179-17184.
Jarvis MF, Wismer CT, Schweitzer E, Yu H, Van BT, Lynch KJ, Burgard EC,
Kowaluk EA (2001) Modulation of BzATP and formalin induced nociception:
attenuation by the P2X receptor antagonist, TNP-ATP and enhancement by the
P2X(3) allosteric modulator, cibacron blue. Br J Pharmacol 132:259-269.
Kennedy CM, Bradley CS, Galask RP, Nygaard IE (2006) Risk factors for painful
bladder syndrome in women seeking gynecologic care. Int Urogynecol J Pelvic
Floor Dysfunct 17:73-78.
Kobayashi K, Fukuoka T, Yamanaka H, Dai Y, Obata K, Tokunaga A, Noguchi K
(2006) Neurons and glial cells differentially express P2Y receptor mRNAs in the
rat dorsal root ganglion and spinal cord. J Comp Neurol 498:443-454.
139
Koziol JA, Clark DC, Gittes RF, Tan EM (1993) The natural history of interstitial
cystitis: a survey of 374 patients. J Urol 149:465-469.
Kusek JW, Nyberg LM (2001) The epidemiology of interstitial cystitis: is it time to
expand our definition? Urology 57:95-99.
Kwong K, Kollarik M, Nassenstein C, Ru F, Undem BJ (2008) P2X2 receptors
differentiate placodal vs. neural crest C-fiber phenotypes innervating guinea pig
lungs and esophagus. Am J Physiol Lung Cell Mol Physiol 295:L858-L865.
Lazarowski ER, Boucher RC (2001) UTP as an extracellular signaling molecule.
News Physiol Sci 16:1-5.
Lazarowski ER, Harden TK (1999) Quantitation of extracellular UTP using a
sensitive enzymatic assay. Br J Pharmacol 127:1272-1278.
Lechner SG, Lewin GR (2009) Peripheral sensitisation of nociceptors via Gprotein-dependent potentiation of mechanotransduction currents. J Physiol
587:3493-3503.
Lutgendorf SK, Kreder KJ, Rothrock NE, Ratliff TL, Zimmerman B (2000) Stress
and symptomatology in patients with interstitial cystitis: a laboratory stress model.
J Urol 164:1265-1269.
Malin SA, Davis BM, Koerber HR, Reynolds IJ, Albers KM, Molliver DC (2008)
Thermal nociception and TRPV1 function are attenuated in mice lacking the
nucleotide receptor P2Y2. Pain 138:484-496.
McGaraughty S, Wismer CT, Zhu CZ, Mikusa J, Honore P, Chu KL, Lee CH,
Faltynek CR, Jarvis MF (2003) Effects of A-317491, a novel and selective
P2X3/P2X2/3 receptor antagonist, on neuropathic, inflammatory and chemogenic
nociception following intrathecal and intraplantar administration. Br J Pharmacol
140:1381-1388.
Mitsui T, Kakizaki H, Matsuura S, Ameda K, Yoshioka M, Koyanagi T (2001)
Afferent Fibers of the Hypogastric Nerves Are Involved in the Facilitating Effects
of Chemical Bladder Irritation in Rats. J Neurophysiol 86:2276-2284.
Molliver DC, Cook SP, Carlsten JA, Wright DE, McCleskey EW (2002) ATP and
UTP excite sensory neurons and induce CREB phosphorylation through the
metabotropic receptor, P2Y2. Eur J Neurosci 16:1850-1860.
Moriyama T, Iida T, Kobayashi K, Higashi T, Fukuoka T, Tsumura H, Leon C,
Suzuki N, Inoue K, Gachet C, Noguchi K, Tominaga M (2003) Possible
involvement of P2Y2 metabotropic receptors in ATP-induced transient receptor
potential vanilloid receptor 1-mediated thermal hypersensitivity. J Neurosci
23:6058-6062.
140
Mork H, Ashina M, Bendtsen L, Olesen J, Jensen R (2003) Experimental muscle
pain and tenderness following infusion of endogenous substances in humans.
Eur J Pain 7:145-153.
Moss NG, Harrington WW, Tucker MS (1997) Pressure, volume, and
chemosensitivity in afferent innervation of urinary bladder in rats. Am J Physiol
Regul Integr Comp Physiol 272:R695-R703.
Nakamura F, Strittmatter SM (1996) P2Y1 purinergic receptors in sensory
neurons: contribution to touch-induced impulse generation. Proc Natl Acad Sci U
S A 93:10465-10470.
Nakatsuka T, Gu JG (2001) ATP P2X receptor-mediated enhancement of
glutamate release and evoked EPSCs in dorsal horn neurons of the rat spinal
cord. J Neurosci 21:6522-6531.
Nakatsuka T, Tsuzuki K, Ling JX, Sonobe H, Gu JG (2003) Distinct roles of P2X
receptors in modulating glutamate release at different primary sensory synapses
in rat spinal cord. J Neurophysiol 89:3243-3252.
Naundorf B, Wolf F, Volgushev M (2006) Unique features of action potential
initiation in cortical neurons. Nature 440:1060-1063.
Nazif O, Teichman JM, Gebhart GF (2007) Neural upregulation in interstitial
cystitis. Urology 69:24-33.
Nicke A, Baumert HG, Rettinger J, Eichele A, Lambrecht G, Mutschler E,
Schmalzing G (1998) P2X1 and P2X3 receptors form stable trimers: a novel
structural motif of ligand-gated ion channels. EMBO J 17:3016-3028.
Nickel JC (2004) Interstitial cystitis: a chronic pelvic pain syndrome. Med Clin
North Am 88:467-81, xii.
North RA (2002) Molecular physiology of P2X receptors. Physiol Rev 82:10131067.
Pandita RK, Andersson KE (2002) Intravesical adenosine triphosphate stimulates
the micturition reflex in awake, freely moving rats. J Urol 168:1230-1234.
Pang X, Marchand J, Sant GR, Kream RM, Theoharides TC (1995) Increased
number of substance P positive nerve fibres in interstitial cystitis. Br J Urol
75:744-750.
Parsons CL, Lilly JD, Stein P (1991) Epithelial dysfunction in nonbacterial cystitis
(interstitial cystitis). J Urol 145:732-735.
Porreca F, Ossipov MH, Gebhart GF (2002) Chronic pain and medullary
descending facilitation. Trends Neurosci 25:319-325.
141
Ralevic V, Burnstock G (1998) Receptors for purines and pyrimidines. Pharmacol
Rev 50:413-492.
Ray FR, Moore KH, Hansen MA, Barden JA (2003) Loss of purinergic P2X
receptor innervation in human detrusor and subepithelium from adults with
sensory urgency. Cell Tissue Res 314:351-359.
Rong W, Spyer KM, Burnstock G (2002) Activation and sensitisation of low and
high threshold afferent fibres mediated by P2X receptors in the mouse urinary
bladder. J Physiol 541:591-600.
Ruan HZ, Burnstock G (2003) Localisation of P2Y1 and P2Y4 receptors in dorsal
root, nodose and trigeminal ganglia of the rat. Histochem Cell Biol 120:415-426.
Sanada M, Yasuda H, Omatsu-Kanbe M, Sango K, Isono T, Matsuura H,
Kikkawa R (2002) Increase in intracellular Ca(2+) and calcitonin gene-related
peptide release through metabotropic P2Y receptors in rat dorsal root ganglion
neurons. Neuroscience 111:413-422.
Sant GR, Kempuraj D, Marchand JE, Theoharides TC (2007) The mast cell in
interstitial cystitis: role in pathophysiology and pathogenesis. Urology 69:34-40.
Sengupta JN, Gebhart GF (1994) Mechanosensitive properties of pelvic nerve
afferent fibers innervating the urinary bladder of the rat. J Neurophysiol 72:24202430.
Shea VK, Cai R, Crepps B, Mason JL, Perl ER (2000) Sensory Fibers of the
Pelvic Nerve Innervating the Rat's Urinary Bladder. J Neurophysiol 84:1924-1933.
Shipton EA, Tait B (2005) Flagging the pain: preventing the burden of chronic
pain by identifying and treating risk factors in acute pain. Eur J Anaesthesiol
22:405-412.
Song Z, Vijayaraghavan S, Sladek CD (2007) ATP increases intracellular calcium
in supraoptic neurons by activation of both P2X and P2Y purinergic receptors.
Am J Physiol Regul Integr Comp Physiol 292:R423-R431.
Souslova V, Cesare P, Ding Y, Akopian AN, Stanfa L, Suzuki R, Carpenter K,
Dickenson A, Boyce S, Hill R, Nebenuis-Oosthuizen D, Smith AJ, Kidd EJ, Wood
JN (2000) Warm-coding deficits and aberrant inflammatory pain in mice lacking
P2X3 receptors. Nature 407:1015-1017.
Stucky CL, Medler KA, Molliver DC (2004) The P2Y agonist UTP activates
cutaneous afferent fibers. Pain 109:36-44.
Studeny S, Torabi A, Vizzard MA (2005) P2X2 and P2X3 receptor expression in
postnatal and adult rat urinary bladder and lumbosacral spinal cord. Am J Physiol
Regul Integr Comp Physiol 289:R1155-R1168.
142
Su X, Sengupta JN, Gebhart GF (1997) Effects of opioids on mechanosensitive
pelvic nerve afferent fibers innervating the urinary bladder of the rat. J
Neurophysiol 77:1566-1580.
Sugiura T, Dang K, Lamb K, Bielefeldt K, Gebhart GF (2005) Acid-sensing
properties in rat gastric sensory neurons from normal and ulcerated stomach. J
Neurosci 25:2617-2627.
Sun Y, Keay S, De Deyne PG, Chai TC (2001a) Augmented stretch activated
adenosine triphosphate release from bladder uroepithelial cells in patients with
interstitial cystitis. J Urol 166:1951-1956.
Sun Y, Keay S, Deyne P, Chai T (2001b) Stretch-activated release of adenosine
triphosphate by bladder uroepithelia is augmented in interstitial cystitis. Urology
57:131.
Surprenant A, North RA (2008) Signaling at Purinergic P2X Receptors. Annu Rev
Physiol.
Tempest HV, Dixon AK, Turner WH, Elneil S, Sellers LA, Ferguson DR (2004)
P2X and P2X receptor expression in human bladder urothelium and changes in
interstitial cystitis. BJU Int 93:1344-1348.
Theoharides TC, Whitmore K, Stanford E, Moldwin R, O'Leary MP (2008)
Interstitial cystitis: bladder pain and beyond. Expert Opin Pharmacother 9:29792994.
Tominaga M, Wada M, Masu M (2001) Potentiation of capsaicin receptor activity
by metabotropic ATP receptors as a possible mechanism for ATP-evoked pain
and hyperalgesia. Proc Natl Acad Sci U S A 98:6951-6956.
Uemura E, Fletcher TF, Bradley WE (1975) Distribution of lumbar and sacral
afferent axons in submucosa of cat urinary bladder. Anat Rec 183:579-587.
Uemura E, Fletcher TF, Dirks VA, Bradley WE (1973) Distribution of sacral
afferent axons in cat urinary bladder. Am J Anat 136:305-313.
Ueno S, Moriyama T, Honda K, Kamiya H, Sakurada T, Katsuragi T (2003)
Involvement of P2X2 and P2X3 receptors in neuropathic pain in a mouse model
of thronic constriction injury. Drug Dev Res 59:104-111.
Undem BJ, Chuaychoo B, Lee MG, Weinreich D, Myers AC, Kollarik M (2004)
Subtypes of vagal afferent C-fibres in guinea-pig lungs. J Physiol 556:905-917.
Uvelius B, Gabella G (1998) The distribution of intramural nerves in urinary
bladder after partial denervation in the female rat. Urol Res 26:291-297.
143
Velasco C, Guarneri L, Leonardi A, Testa R (2003) Effects of intravenous and
infravesical administration of suramin, terazosin and BMY 7378 on bladder
instability in conscious rats with bladder outlet obstruction. BJU Int 92:131-136.
Vera PL, Nadelhaft L (1992) Afferent and sympathetic innervation of the dome
and the base of the urinary bladder of the female rat. Brain Research Bulletin
29:651-658.
Vlaskovska M, Kasakov L, Rong W, Bodin P, Bardini M, Cockayne DA, Ford AP,
Burnstock G (2001) P2X3 knock-out mice reveal a major sensory role for
urothelially released ATP. J Neurosci 21:5670-5677.
von Kugelgen I (2006) Pharmacological profiles of cloned mammalian P2Yreceptor subtypes. Pharmacol Ther 110:415-432.
Vulchanova L, Riedl MS, Shuster SJ, Buell G, Surprenant A, North RA, Elde R
(1997) Immunohistochemical study of the P2X2 and P2X3 receptor subunits in
rat and monkey sensory neurons and their central terminals. Neuropharmacology
36:1229-1242.
Vulchanova L, Riedl MS, Shuster SJ, Stone LS, Hargreaves KM, Buell G,
Surprenant A, North RA, Elde R (1998) P2X3 is expressed by DRG neurons that
terminate in inner lamina II. Eur J Neurosci 10:3470-3478.
Wang EC, Lee JM, Ruiz WG, Balestreire EM, von BM, Barrick S, Cockayne DA,
Birder LA, Apodaca G (2005) ATP and purinergic receptor-dependent membrane
traffic in bladder umbrella cells. J Clin Invest 115:2412-2422.
Warren JW, Jackson TL, Langenberg P, Meyers DJ, Xu J (2004) Prevalence of
interstitial cystitis in first-degree relatives of patients with interstitial cystitis.
Urology 63:17-21.
Warren JW, Keay SK, Meyers D, Xu J (2001) Concordance of interstitial cystitis
in monozygotic and dizygotic twin pairs. Urology 57:22-25.
Wirkner K, Stanchev D, Koles L, Klebingat M, Dihazi H, Flehmig G, Vial C, Evans
RJ, Furst S, Mager PP, Eschrich K, Illes P (2005) Regulation of human
recombinant P2X3 receptors by ecto-protein kinase C. J Neurosci 25:7734-7742.
Wu G, Whiteside GT, Lee G, Nolan S, Niosi M, Pearson MS, Ilyin VI (2004) A317491, a selective P2X3/P2X2/3 receptor antagonist, reverses inflammatory
mechanical hyperalgesia through action at peripheral receptors in rats. Eur J
Pharmacol 504:45-53.
Xu L, Gebhart GF (2008) Characterization of mouse lumbar splanchnic and
pelvic nerve urinary bladder mechanosensory afferents. J Neurophysiol 99:244253.
144
Yoshimura N, de Groat WC (1999) Increased excitability of afferent neurons
innervating rat urinary bladder after chronic bladder inflammation. J Neurosci
19:4644-4653.
Yu Y, de Groat WC (2008) Sensitization of pelvic afferent nerves in the in vitro rat
urinary bladder-pelvic nerve preparation by purinergic agonists and
cyclophosphamide pretreatment. Am J Physiol Renal Physiol 294:F1146-F1156.
Zagorodnyuk VP, Gibbins IL, Costa M, Brookes SJ, Gregory SJ (2007)
Properties of the major classes of mechanoreceptors in the guinea pig bladder. J
Physiol 585:147-163.
Zhang Y, Sands JM, Kohan DE, Nelson RD, Martin CF, Carlson NG, Kamerath
CD, Ge Y, Klein JD, Kishore BK (2008) Potential role of purinergic signaling in
urinary concentration in inner medulla: insights from P2Y2 receptor gene
knockout mice. Am J Physiol Renal Physiol 295:F1715-F1724.
Zhong Y, Banning AS, Cockayne DA, Ford AP, Burnstock G, Mcmahon SB (2003)
Bladder and cutaneous sensory neurons of the rat express different functional
P2X receptors. Neuroscience 120:667-675.
Zimmermann H (2006) Ectonucleotidases in the nervous system. Novartis Found
Symp 276:113-128.