Cerebral Cortex August 2007;17:1821--1829
doi:10.1093/cercor/bhl091
Advance Access publication October 18, 2006
Constitutive Expression of Functionally
Active Cyclin-Dependent Kinases and Their
Binding Partners Suggests Noncanonical
Functions of Cell Cycle Regulators in
Differentiated Neurons
Neurodegeneration in Alzheimer’s disease and various experimental lesion paradigms are associated with an unscheduled upregulation of cell cycle--related proteins, indicating a link between cell
cycle reactivation and neuronal death. Recent evidence, however,
suggests that at least some of the canonical cell cycle regulators
are constitutively expressed in differentiated neurons of the adult
brain. Systematic investigations on the constitutive expression of
cell cycle regulators in differentiated neurons in vivo, providing the
basis for further insights into their potential role under pathological
conditions, however, have not been carried out. Here, we
demonstrate a constitutive neuronal expression of Cdks 1, 2, and
4; their activators cyclins D, A, B, and E; and their inhibitors
p15Ink4b, p16Ink4a, p18Ink4c, p19Ink4d, p21Waf1/Cip1, p27Kip1, and
p57Kip2 within the neocortex of adult mice by western blot and
immunocytochemistry. Expression was verified by single-cell reverse transcriptase--polymerase chain reaction applied to individual
microscopically identified neurons captured with laser dissection.
Immunoprecipitation and in vitro kinase assays revealed that Cdks
1, 2, and 4 are properly complexed to cyclins and exhibit kinase
activity. This physiological expression of positive cell cycle
regulators in adult neurons is clearly not related to neuronal
proliferation. Taken together, our findings demonstrate a constitutive expression of functionally active cyclin-dependent kinases and
their regulators in differentiated neurons suggesting a noncanonical
role of cell cycle regulators potentially linked to neuronal plasticity
and/or stability.
Stefanie Schmetsdorf, Ulrich Gärtner and Thomas Arendt
Paul Flechsig Institute for Brain Research, Department of
Neuroanatomy, University of Leipzig, 04109 Leipzig, Germany
Stefanie Schmetsdorf and Ulrich Gärtner contributed equally
to this work
conditons, their expression might play a role in apoptotic or
necrotic events, associated with neurodegenerative diseases,
seizure, ischemia, or stress (Freeman et al. 1994; Arendt et al.
1996; Li, Meyer, and Donoghue 1997; McShea et al. 1997; Nagy
et al. 1997; Shirvan, Ziv, Barzilai, et al. 1997; Shirvan, Ziv,
Machlin, et al. 1997; Arendt, Holzer, and Gärtner 1998; Arendt,
Holzer, Gärtner, and Brückner 1998; Busser et al. 1998; JordanSciutto et al. 1999; Timsit et al. 1999; Fischer et al. 2001; Ino and
Chiba 2001; Katchanov et al. 2001; Liu and Greene 2001; Becker
and Bonni 2004). Several studies, however, have reported the
expression of cyclins, Cdks, and Cdkis under normal conditions
in mature neurons, and an involvement in physiological functions beyond cell cycle regulation, including transcription,
neuronal morphogenesis, and plasticity, has been proposed
(Ross and Risken 1994; Yan and Ziff 1995; Ross et al. 1996;
Xiong et al. 1997; Huard et al. 1999; Richter 2001; Becker and
Bonni 2005). Still, it remains obscure whether Cdks and cyclins
form active complexes in differentiated neurons giving rise to
kinase activity under normal conditions. Therefore, in the
present study, we analyzed the expression of Cdks, cyclins,
and Cdk inhibitors both at the protein and mRNA level by
immunocytochemistry and single-cell reverse transcriptase-polymerase chain reaction (RT-PCR) applied to individual
microscopically identified neurons captured with laser dissection. Immunoprecipitation and in vitro kinase assays were
applied to analyze whether Cdks are properly complexed to
cyclins and exhibit kinase activity.
Keywords: cyclin-dependent kinase inhibitors, cyclins, mice,
neocortex, plasticity
Materials and Methods
Introduction
Once neurons are terminally differentiated, they lose their
ability to proliferate. Maintenance of mitotic quiescence is
essential for the functional stability of the complexly wired
neuronal system. At the same time, however, terminally differentiated neurons retain a remarkable dynamic plasticity, which
provides the basis for a lifelong structural adaptation of
neuronal networks to meet functional needs. It had traditionally
been assumed that the majority of molecules that regulate
activation and orderly progression through the cell cycle are
repressed in the mitotically quiescent G0 state. Although
neurons are terminally differentiated and lack the ability to
divide, the expression of potential cell cycle regulators such as
cyclins D, A, B, and E as well as Cdks1, 2, and 4 in the adult brain
has repeatedly been reported (see Fig. 1 for the role of cell cycle
regulatory proteins in cell division cycle) (Tamaru et al. 1993;
Miyajima et al. 1995; Li, Chopp, and Powers 1997; Small et al.
1999, 2001; Timsit et al. 1999; Matsunaga 2000; Gärtner et al.
2003; Schmetsdorf et al. 2005). Under pathophysiological
Ó The Author 2006. Published by Oxford University Press. All rights reserved.
For permissions, please e-mail: [email protected]
Animals
Brains were obtained from 6 adult NMRI mice. In addition, 3 mouse
embryonic brains (embryonal day 14, E14) were used for immunoprecipitation-based kinase assays. The animals were strictly treated following the guidelines set by the Panel on Euthanasia and the Guide for the
Care and Use of Laboratory Animals. Protocols were approved by the
Ethical Committee of Leipzig University. We made all efforts to minimize
the number of animals used and their suffering.
Tissue Preparation and Immunocytochemistry
Mice were overdosed with carbon dioxide and perfused transcardially
with ice-cold saline. Animals were then fixed by perfusion with 0.1 M
phosphate-buffered saline containing 4% formaldehyde (pH 7.4). The
removed brains were postfixed in the same solution for 3 days at 4 °C
and cryoprotected in 30% saccharose. Blocks of mouse brain were cut in
the coronal plane at 30 lm on a freezing microtome. Sections were
incubated in 0.1 M Tris-buffered saline (TBS, pH 7.4) containing 1%
H2O2 (30 min) to quench endogen peroxidase activity. For antigen
retrieval, sections were pretreated with citrate buffer (pH 6.0) for 10
min in a microwave oven. Nonspecific binding sites were masked by
incubation with blocking solution containing 0.3% fat-free dried milk
and 0.1% gelatine. Subsequently, tissue was immunoreacted with one of
the primary antisera listed in Table 1 overnight at 4 °C. Section-bound
antibodies were revealed with biotinylated donkey anti-rabbit antiserum
(1:1000, 1 h, Amersham; Buckinghamshire, UK) or donkey anti-goat antiserum (1:1000, 1 h, Jackson, Suffolk, UK), ExtrAvidinÒ-peroxidase
conjugate (1:1000, 1 h, Sigma, Munich, Germany) and 3,39-diaminobenzidine (DAB)/NiNH4SO4 as chromogen.
All incubation steps were separated by intense washing with TBS. For
double-fluorescence immunostaining, sections were reacted first with
anti-Cdk antisera, followed by visualization with Cy2-tagged donkey
anti-rabbit antiserum (1:500, 1 h, Jackson ImmunoResearch Inc.). In
a second step, after reapplying blocking, tissue was incubated with anticyclin antisera, and fluorescent detection was performed by using Cy3conjugated donkey anti-rabbit antiserum (1:500, 1 h, Jackson ImmunoResearch Inc.). The specificity of labeling was tested by omitting
primary antisera. After such incubation, tissue was devoid of immunoreactivity as expected (Fig. 4). Finally, the sections were coverslipped
with EntellanÒ (Merck, Darmstadt, Germany). Images were captured
with the digital microscope camera AxioCamHRC running on the
AxioVision 3.1 Software (both Carl Zeiss Vision) and processed with
AdobeÒ PhotoshopÒ 7.0 (Adobe Systems, Mountain View, CA).
Electrophoresis and Immuno --Western Blotting
The total protein fraction (50 lg per lane, Bradford assay) of neocortical
homogenates was separated by 12% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and subsequently transferred onto
polyvinylidene fluoride membrane (Polyscreen, DuPont-New England
Nuclear, Boston, MA), using a semidry blot system (TransBlotä, BioRad,
Hercules, Canada). Equal amount of the protein loaded on the gel was
controlled by Coomassie staining. For immunodetection of cyclins, Cdks,
and Cdkis, membranes were incubated in 2% bovine serum albumin (in
TBS) and probed with primary antisera (Table 1; 1 h, dilution 1:500) at
room temperature. After washing in TBS/0.1% Tween-20, blots were
incubated with biotinylated donkey anti-rabbit antiserum (1 h, 1:1000,
Amersham) or anti-goat antiserum (1 h, 1:1000, Jackson), respectively.
Immunodetection was visualized with ExtrAvidinÒ-peroxidase conjugate
(1 h, 1:1000, Sigma) and DAB/NiCl2/0.015% H2O2.
Figure 1. Schematic illustration of the involvement of cell cycle regulatory proteins in
cell division. During the cell division cycle, expression and activity of Cdks and cyclins,
the positive regulatory subunits of Cdks, are regulated in a phase-dependent manner.
The activity of cyclin--Cdk complexes is negatively controlled by inhibitors of the Ink4
family (p15Ink4b, p16Ink4a, p18Ink4c, p19Ink4d) and of the Cip/Kip family (p21Waf1/Cip1,
p27Kip1, p57Kip2). G0, stationary phase; G1, first gap phase; R, restriction point; S, DNA
synthesis phase; G2, second gap phase; M, mitosis phase.
Table 1
List of primary antisera used in this study
Antibody specificity
Dilution
Antibody specificity
Dilution
Cyclin A (H-432)
Cyclin A (C-19)
Cyclin B1 (H-433)
Cyclin B1 (H-20)
Cyclin D3 (H-292)
Cyclin D3 (C-16)
Cyclin E (M-20)
Cyclin E (H-145)
Cdk1 (H-297)
Cdk1 (C-19)
Cdk2 (H-298)
1:800
1:800
1:800
1:800
1:500
1:500
1:1000
1:1000
1:500
1:500
1:500
Cdk2 (M2)
Cdk4 (H-303)
Cdk4 (C-19)
p15Ink4b (C-20)
p16Ink4a (M-156)
p18Ink4c (C-19)
p19Ink4d (M-20)
p21Waf1/Cip1 (M-19)
p27Kip1 (C-19)
p57Kip2 (C-19)
1:500
1:800
1:800
1:500
1:500
1:500
1:500
1:1000
1:1000
1:500
Note: Host species of all antisera is rabbit, except p18Ink4c (C19) and p57Kip2 (C-19), which are
from goat. All antisera were obtained from Santa Cruz Biotechnology, Inc., Heidelberg, Germany.
RNA Isolation and Reverse Transcription
Single pyramidal neurons of layer V (200 cells per trial) were dissected
from freshly prepared Nissl-stained frozen sections (30 lm) of adult
mouse somatosensory cortex (Fig. 2) using laser microdissection and
pressure catapulting technology (PALMÒ MicroBeam system, P.A.L.M.
Microlaser Technologies AG, Bernried, Germany). RNA of collected
cells was extracted with RNeasyä Mini Kit (Quiagen, Hilden, Germany)
according to the manufacturer’s instructions.
First strand synthesis was conducted by incubating 8 lL RNA, 1 lL
Random Hexamere, and 1 lL 29-deoxynucleoside 59-triphosphate for
5 min at 65 °C followed by rapid cooling on ice. To each mixture, the
following was added: 2 lL 103 reverse transcriptase (RT) buffer, 1 lL 25
mM MgCl2, 2 lL 0.1 M dithiothreitol (DTT), and 1 lL RNase inhibitor.
This cocktail was incubated for 2 min at 25 °C before 1 lL SuperScript II
RT was added. The mixture was then incubated for 10 min at 25 °C and
subsequently heated for a further 50 min at 42 °C. The reaction was
stopped by heating at 70 °C for 15 min and terminated by incubation
with 1 lL RNase H for 20 min at 37 °C. All cDNA samples were stored at
–20 °C until analysis.
Real-Time RT-PCR
Real-time RT-PCR was performed on Rotor-Geneä 2000 (Corbett
Research, Sydney, Australia). For each marker, 3 independent experiments were performed. In each experiment, duplicates of a standard
dilution series of specific polymerase chain reaction (PCR) fragments
for each cell cycle protein and cDNA (total RNA equivalent) of unknown
Figure 2. Photomicrographs of a coronal frozen Nissl-stained section before (A) and after (B) laser microdissection of single layer V pyramidal neurons. Corresponding cell locations
are indicated by arrow heads. Bar in (B) (also refers to A): 50 lm.
1822 Cell Cycle Regulators in Differentiated Neurons
d
Schmetsdorf et al.
samples were amplified in a 25-lL reaction mixture containing
AccuPrimeä Taq Polymerase (Invitrogenä Life Technologies, Karlsruhe,
Germany) in 13 PCR buffer, 50 pM forward and reverse primers
(sequences of primers are given in Table 2), SYBRÒ Green I nucleic
acid stain (1:2000; Cambrex Bio Science Rockland, Inc., Verviers,
Belgium), and nuclease-free water. The thermal profile consisted of 1
cycle at 95 °C for 3 min followed by 45 cycles at 95 °C for 30 s then 60--64
°C for 1 min. Product specificity was confirmed in initial experiments by
agarose gel electrophoresis and routinely by melting curve analysis.
For each run, data acquisition and analysis were done by Rotor-Geneä
2000 system software. The relative number of molecules of each
transcript was determined by interpolating the cycle threshold values
of the unknown samples to each standard curve.
PCR products were separated by flatbed electrophoresis in 2%
agarose gels (100 V for 30--40 min), stained with ethidium bromide,
and visualized under an UV transilluminator. Gel images were captured
using Phoretixä Grabber software version 2.0 (NonLinear Dynamics,
Newcastle upon Tyne, UK).
Preparation of Cell Extracts and Immunoprecipitation
Freshly prepared neocortical tissue was homogenized in NP-40 lysis
buffer (0.5% Nonidet P-40 in 20 mM Tris-HCL, pH 7.2, containing 100
mM NaCl, 2 mM MgCl2, 5 mM NaF, 1 mM Na3VO4, 1 mM DTT, and 100
lg/mL phenylmethylsulphonylfluoride [PMSF] and 2 lg/mL Leupeptin).
After a 1-h incubation at 4 °C, lysates were cleared by centrifugation at
15 000 3 g for 30 min and the supernatant was frozen.
For immunoprecipitation, undiluted primary antisera (anti-Cyclin D3, Cyclin A, -Cyclin B, and -Cyclin E; anti-Cdk1, -Cdk2, and -Cdk4) or normal rabbit antiserum (control) were preincubated for 1 h with 10 lL
DynabeadsÒ protein A solution (Dynal, Hamburg, Germany) at 4 °C.
DynabeadsÒ protein A--antibody complexes were washed 3 times with
bead buffer (20 mM Tris-HCL, pH 7.2, 2 mM MgCl2, 0.5% NP-40, 0.15 M
NaCl, 1 mM DTT, 100 lg/mL PMSF, 2 lg/mL Leupeptin) and resuspended
in bead buffer. Aliquots of NP-40 extracted proteins were incubated with
DynabeadsÒ protein A--antibody complexes and shaken gently overnight
at 4 °C. Immunoprecipitates (IPs) were washed 3 times with bead buffer.
To test for coimmunoprecipitation, the precipitated pellets were
separated by SDS-PAGE and immunoblotted using antisera against
relevant binding partners.
mRNA level. Immunocytochemical detection of cell cycle
markers was verified by single-cell RT-PCR applied to individual
microscopically identified neurons captured with laser dissection. Immunoprecipitation and in vitro kinase assays were used
to analyze whether cyclin-dependent kinases are properly
complexed to cyclins and exhibit kinase activity.
Western Blotting and Immunocytochemistry
A panel of antibodies was used both on western blots and
immunocytochemical preparations to detect Cdks1, 2, and 4
and their binding partners such as cyclins D, A, B, and E as well
as the inhibitors p15Ink4b, p16Ink4a, p18Ink4c, p19Ink4d, p21Waf1/Cip1,
p27Kip1, and p57Kip2 (Figs 3 and 5). On western blots, signals
at the appropriate molecular weight were obtained with
at least 2 different antibodies for each protein (Fig. 3).
Immunocytochemical detection of each protein was performed with at least 2 different antisera that gave rise to
identical staining patterns. Control sections that were not
incubated with primary antibody remained unstained (Fig. 4).
In general, there was no definite evidence for glial expression of
any of the analyzed cell cycle--related proteins (Fig. 5). A
Immunoprecipitation-Based In Vitro Kinase Assays
IPs (anti-Cyclin D3, -Cyclin A, -Cyclin B, -Cyclin E) were washed in kinase
buffer (20 mM Tris-HCL, pH 7.2, 10 mM MgCl2, 1 mM DTT, 60 mM
b-Glycerophosphate, and 100 lg/mL PMSF and 2 lg/mL Leupeptin) and
resuspended in 50 mL kinase buffer containing 0.5 mg of histone H1, 10
lCi of [c-32P]-ATP, and 20 lM ATP. All reaction mixtures were incubated
for 1 h at 30 °C and stopped by boiling for 5 min in 43 Laemmli sample
buffer. Then, equal amounts of protein (10 lg per lane) were resolved on
12% SDS gels. Histone H1 was separated from free [c-32P]-ATP on 12%
polyacrylamide gels. Phosphorylated histone H1 was detected by autoradiography (Kodak X-Omat film, Rochester, NY). Control incubations were
performed in the absence of histone. In addition, IPs from incubation
with normal rabbit serum (NRS) were used as a further control.
Results
Neuronal expression of cell cycle regulatory proteins in the
neocortex of adult mice were analyzed both at the protein and
Table 2
List of primers used for real-time RT-PCR
Transcripts to
be detected
Primer forward
Primer reverse
Size (bp)
Cyclin D3
Cyclin A
Cyclin B
Cyclin E
Cdk1
Cdk4
Neurofilament H
Glial fibrillary acidic protein
59gctccaaccttctcagttgc39
59acctgccttcactcattgct39
59cagttgtgtgcccaagaaga39
59caccactgagtgctccagaa39
59ctcggctcgttactccactc39
59ctggtaccgagctcctgaag39
59agcccaaggactctacagca39
59agaaaaccgcatcaccattc39
59agctaagcagcaagcaaagc39
59ttgactgttgggcatgttgt39
59ctacggaggaagtgcagagg39
59ccacatttgctcacaaccac39
59tccacttgggaaaggtgttc39
59ttgtgcaggtaggagtgctg39
59gccttggtgtcttctgcttc39
59tcacatcaccacgtccttgt39
208
176
216
176
203
357
176
184
Figure 3. Detection of cell cycle--related proteins by western blot. Crude homogenate
of neocortical tissue was separated by 12% SDS-PAGE, transferred to polyvinylidene
fluoride membrane, and probed with the primary antisera listed in Table 1. Noncropped
western blots of cyclins B and E are provided to evaluate significance of dendritic
staining. Control incubations in the absence of primary antisera show no labeling (at
the right bottom).
Cerebral Cortex August 2007, V 17 N 8 1823
synopsis of characteristics of neuronal immunostaining is given
in Table 3. Immunoreactivity for cyclins D, A, B, and E was
clearly detectable in neocortical neurons. It was most prominent in pyramidal cells that were most intensely stained in layer
V. Apart from nuclear localization, cyclins D and A were also
present in the perinuclear cytoplasm and in dendrites of these
neurons. In contrast to this, immunostaining of cyclins E and B
was more pronounced in dendrites but present in nuclei to
a lesser extent (Fig. 5).
Similar to cyclins, immunoreactivity for Cdk1 and Cdk4 is
found in pyramidal neurons within layers II/III and V (Fig. 5).
The expression of these proteins is preferentially detected in
the nuclear compartment. In contrast to these kinases, Cdk2 is
present only in the perinuclear cytoplasm of neurons (Fig. 5).
Cdks and their corresponding cyclins are colocalized in neurons
(Fig. 6).
The expression of Cdk inhibitors is distributed equally
throughout cortical layers. The Ink4 inhibitors p15Ink4b and
p18Ink4c are present in dendrites but not in nuclei. P16Ink4a
immunoreactivity, on the other hand, is found only in neuronal
nuclei (Fig. 5). Staining for p21Waf1/Cip1 and p27Kip1 proteins is
present both in the nuclear and in the cytoplasmic compartment.
Moreover, p21Waf1/Cip1 immunoreactivity is also detectable in
pyramidal cell dendrites. The inhibitor p57Kip2 is exclusively seen
in the cytoplasmic compartment of pyramidal cells (Fig. 5).
Single -Cell mRNA Analysis by Laser Microdissection and
Real-Time RT-PCR
Immunohistochemical findings indicate the occurrence of
a variety of cell cycle markers in layer V pyramidal cells of adult
mice. To rule out any false-positive results arising through
potential cross-reactivity of antibodies, we verified these findings with an additional independent method and analyzed the
expression of corresponding transcripts at the single-cell level
by PCR after laser microdissection of individual neurons
identified under the microscope.
We were able to obtain PCR products specific for cyclins D3,
A, B, and E and Cdks 1 and 4 as well as p27Kip1, amplified from
cDNA templates prepared from individual layer V neurons.
Simultaneous detection of neurofilament H message but not of
glial fibrillary acidic protein mRNA ensured that only neurons
but not glial cells were included in the analysis. The presence of
single products of the expected size was verified by gel
electrophoresis (Fig. 7).
Physical and Functional Interactions between Cyclins
and Cdks
The pattern of immunohistochemical labeling (see Figs 5 and 6)
suggests the neuronal coexpression of cell cycle--related
proteins. In order to determine whether Cdks and corresponding cyclins interact physically, IPs of cyclin D3, cyclin A, cyclin B,
and E as well as Cdk1, Cdk2, and Cdk4 were immunoblotted
with antisera to the physiologically relevant binding partners.
The following proteins have been shown to be reciprocally
coimmunoprecipitated, strongly indicating their physical association: cyclin D3 with Cdk4, cyclins A and E with Cdk2, and
cyclin B with Cdk1 (Fig. 8).
Beyond the characterization of physical interactions, the
functional relevance of cyclin--Cdk complexes at different
developmental stages was tested by an immunoprecipitationbased in vitro kinase assay. Incubation of histone H1 with antiCyclin D3, -Cyclin A, -Cyclin B, or -Cyclin E IPs clearly resulted in
phosphorylation of the substrate, although to a lesser extent
compared with incubation with IPs obtained from embryonic
lysates. No activity was found when NRS IPs were assayed (Fig. 9).
Discussion
The findings of the present study demonstrate the constitutive
neuronal expression of numerous cell cycle--related proteins in
the adult mouse neocortex. Cell cycle regulators were found in
the perikaryal cytoplasm, in dendrites, and also in nuclei of
differentiated neurons. As a potential cross-reactivity of antisera
with other proteins cannot entirely be ruled out, neuronal
expression, detected on immunohistochemical preparations
and western blot, for a selected number of cell cycle regulators
was verified at the single-cell mRNA level. In addition, biochemical data demonstrate that cyclins are adequately complexed with Cdks, resulting in catalytic kinase activity. Because
immunhistochemical data do not suggest the presence of
significant cyclin and Cdk levels in the glial population, biochemical activity is likely attributed to neurons.
Present data provide direct evidence for the constitutive
expression of cyclins D, A, B, and E in postmitotic neurons
within the cerebral cortex suggesting a function for these
proteins beyond the regulation of activation and progression
of the cell cycle. These observations are consistent with
previous evidence from several groups, including our own, to
indicate that cyclins D, A, B, and E in particular are expressed in
mature neurons of the neocortex and hippocampus under
Figure 4. Control sections of adult brain incubated in the absence of primary antisera showed no immunostaining. ( A) anti-rabbit antiserum, (B) anti-goat antiserum. Bar in (B) (also
refers to A): 50 lm.
1824 Cell Cycle Regulators in Differentiated Neurons
d
Schmetsdorf et al.
Figure 5. Immunohistochemical localization of cyclins, Cdks, and Cdkis in the somatosensory cortex of adult mouse brain at 2 different magnifications thereby zooming in on layer V
neurons. Bar at bottom of third column (also refers to first column): 200 lm. Bar at bottom of fourth column (also refers to second column): 25 lm.
physiological conditions (Tamaru et al. 1993; Miyajima et al.
1995; Oka et al. 1996; Van Lookeren Campagne and Gill 1998a;
Small et al. 1999, 2001; Timsit et al. 1999; Matsunaga 2000;
Hoozemans et al. 2002; Gärtner et al. 2003; De Falco et al. 2004;
Schmetsdorf et al. 2005). This constitutive expression of cyclins
in differentiated neurons, however, has not been investigated
systematically, and their functional binding to cyclin-dependent
kinases had not been reported previously. In proliferative cells,
cyclins localized to the cytoplasm are proteolytically degraded
by ubiquination and destruction in proteasomes (Sudakin et al.
1995; Clurman et al. 1996; Klotzbucher et al. 1996; Udvardy
1996; Diehl et al. 1997, 1998). However, cytoplasmic sequestration
Cerebral Cortex August 2007, V 17 N 8 1825
of cyclins, for example, of cylin E and cyclin D1, might be
characteristic for postmitotic neurons and may be associated
with a physiological role other than regulation of the cell
cycle (Matsunaga 2000; Sumrejkanchanakij et al. 2003; De
Falco et al. 2004). As has been shown for cyclin D1,
cytoplasmic compartmentalization is determined by interaction
with proteins such as glycogen synthase kinase-3b and specific
exportins (Diehl et al. 1998). It is thus tempting to speculate
that in differentiated neurons, cyclins might have alternative
binding partners that prevent degradation and assist in
mediating non-cell cycle--related functions.
In addition to cyclin expression, present results also clearly
showed the presence of Cdks 1, 2, and 4 in postmitotic neurons
of the neocortex. Immunohistochemical findings illustrate the
localization of Cdks both in the cytoplasmic compartment and
in the nuclei of neurons, so extending recent data on mouse
Table 3
Synopsis of subcellular distribution of cell cycle--related proteins in layer V neurons
Marker
CycD
CycE
CycA
CycB
Cdk1
Cdk2
Cdk4
p15
p16
p18
p19
p21
p27
p57
Localization
Nuc
Cyt
Dendrites
þþ
þ
þþþ
þþ
þþ
þ
þ
þþ
þþ
þ
þþþ
þþ
þþþ
þ
þþþ
þ
þþ
þþþ
þþ
þþ
þþþ
þþ
þþ
þþ
þ
þ
þþþ
þ
þþþ
þ
þ
þþ
þþþ
þþþ
þ
þþþ
Note: The number of plus symbols indicates grading of staining intensity: (þþþ) [ (þþ) [
(þ). Minus symbol denotes negligible staining. nuc, nucleus; cyt, cytoplasm.
hippocampus (Schmetsdorf et al. 2005). In addition to immunohistochemical detection, we also provide evidence for
expression of Cdk1 and Cdk4 at the single-cell mRNA level of
identified neurons and demonstrate a physical interaction
between Cdks 1, 2, and 4 and the relevant cyclins, which results
in adequate levels of kinase activity to suggest a catalytic
function. Expression of cyclin-dependent kinases has previously
been observed in a variety of differentiated neurons. In postmitotic sympathetic neurons of cervical ganglia, for example,
mRNAs encoding for Cdk4 and Cdk5 have been detected
(Freeman et al. 1994), whereas other studies have described
expression of Cdks 1 and 2 in postmitotic differentiating cells,
including neocortical neurons (Okano et al. 1993; Wood and
Zinsmeister 1993; Delalle et al. 1999; Watanabe et al. 1999).
Constitutive expression of Cdk2 and Cdk4 has also been found
in differentiated muscle and PC12 cells ( Jahn et al. 1994;
Dobashi et al. 1996).
Cellular functions of active cyclin--Cdk complexes have
previously been attributed to additional physiological effects,
such as metabolic regulation or basal transcription (Kaffman
et al. 1994; Roy et al. 1994; Rickert et al. 1996). If the dendritic
localization of cyclins is considered, the expression of Cdks and
cyclins in differentiated neurons may reflect a function in
network stabilization and/or neuroplastic mechanisms. In
neurons, Cdk1 phosphorylates microtubule-associated proteins,
including tau protein, and neurofilaments (Hisanaga et al. 1991;
Mawal-Dewan et al. 1992; Scott et al. 1993). Very recently, it was
found that Cdk2 can be activated by neuregulin, and knockdown or inhibition of Cdk2 prevents neuregulin-induced
differentiation and expression of the acetylcholine receptor
e subunit in myotubes (Lu et al. 2005). Thus, we speculate that
Cdk activity might be associated with the regulation of synaptogenesis and cytoskelatal dynamics during neuronal morphogenesis and differentiation in the adult brain.
The present immunohistochemical analysis further
demonstrates the expression of Ink4 and Cip/Kip inhibitors of
Figure 6. Double-fluorescence immunolabeling showing the cellular colocalization of cyclin D-Cdk4 (H-292, H-303), cyclin A-Cdk2 (H-432, H-298), cyclin B-Cdk1 (H-433, H-297),
and cyclin E-Cdk2 (M-20, H-298). Corresponding images are arranged in columns. Bar at bottom of fourth column: 20 lm.
1826 Cell Cycle Regulators in Differentiated Neurons
d
Schmetsdorf et al.
Figure 7. Visualization of PCR products in 2% agarose gel after staining with ethidium
bromide verifies the correct target sequence amplification. Simultaneous detection of
neurofilament H (NF-H) message but not of gilal fibrillary acidic protein (GFAP) mRNA
ensured that only neuronal cells were included in the analysis. Arrow heads point to
unspecific primer dimers.
Figure 8. Physical interactions between Cdks and cyclins. Extracted proteins from the
neocortex were subjected to immunoprecipitation with antisera to either Cyclin D3,
Cylin A, Cyclin B, or Cyclin E or with NRS (control, on the right). Precipitates were
probed for the presence of Cdks1, 2, and 4 by western blot analysis. The mobility of
molecular mass markers (M) is indicated (in kDa).
Figure 9. Immunoprecipitation-linked in vitro kinase assays to characterize the
functional relevance of cyclin--Cdk complexes. IPs (please refer to Fig. 8) obtained from
embryonic (E14) and adult (ad) lysates were assayed for kinase activity towards
histone H1. Data demonstrate the functional association of cyclins with Cdks and
suggest a persistent Cdk activity in the adult neocortex. Control incubations were
performed in the absence of histone (co) or with IPs obtained with NRS (right).
cyclin-dependent kinases in mature cortical neurons, which
confirms and extents previous findings on mouse hippocampal
neurons (Schmetsdorf et al. 2005). Neuronal expression of Cdk
inhibitors may indirectly indicate the presence of cyclins/Cdks
and might be involved in establishing and maintaining the
differentiated state of neurons and prevents them from cell
cycle reentry.
The intensity of p19Ink4d expression, for example, increases
during neural ascent from the ventricular zone to the cortical
plate along with progressive differentiation of neurons. Therefore, this inhibitor has been suggested to play a role in
maintaining neurons in the postmitotic state (Zindy et al.
1999). P19Ink4d cooperates with the Cip/Kip inhibitor p27Kip1,
and both are required to control cell cycle exit and to repress
neuronal proliferation (Lee et al. 1996; Zindy et al. 1997, 1999;
Löwenheim et al. 1999; Miyazawa et al. 2000). Accordingly,
p27Kip1 expression is high in cells exiting the proliferative phase
(Lee et al. 1996; Van Lookeren Campagne and Gill 1998b;
Delalle et al. 1999). Cortical postmitotic neurons accumulate
high levels of p27Kip1 to bind and inactivate cyclin A/E-Cdk2 and
cyclin D-Cdk4 complexes (Lee et al. 1996; Cunningham and
Roussel 2001; Sumrejkanchanakij et al. 2003). Suppression of
Cdk activity by p27Kip1 is regarded as a key determinant for
neuronal differentiation and stability (Kranenburg et al. 1995;
Cunningham and Roussel 2001).
Recently, hypoxia-ischemia--induced DNA synthesis preceding neuronal cell death was shown to be associated with
a reduction in p27Kip1 and p16Ink4a levels and, in parallel, with
an increase in Cdk2 activity (Kuan et al. 2004).
Also p21Waf1/Cip1 is induced during neuronal differentiation
and occurs in fully differentiated neurons (Van Grunsven et al.
1996; Xiong et al. 1997; Van Lookeren Campagne and Gill
1998b). Whether p21Waf1/Cip1 might be necessary per se for
neuronal differentiation and quiescence or not is controversial
(Parker et al. 1995; Van Grunsven et al. 1996). However, there is
increasing evidence that at least some Cip/Kip inhibitors may
operate in postmitotic neurons to support differentiation and
specification of distinct neuron types by regulating nuclear
transport, cell motility, and transcriptional activation (LaBaer
et al. 1997; Ohnuma et al. 1999, 2001; Dyer and Cepko 2000;
Coqueret 2003).
The present results on a constitutive expression of cell cycle
regulators in the healthy adult brain do not negate their
presumed pathogenetic role in Alzheimer’s disease. Comparing
Alzheimer’s disease brains with age-matched normal brain,
a variety of cell cycle proteins has been found at higher
expression levels, which has been conceptually linked to cell
death (Arendt et al. 1996; Vincent et al. 1996; Nagy et al. 1997).
Of note, cell cycle proteins might show alterations in their
subcellular distribution in Alzheimer’s disease where they are
found predominantly associated with neurofibrillary degeneration. Differences in compartmentation and segregation through
binding to other proteins might not only affect their function
but also modify their degradation. Potential differential effects
through postmortem autolysis, therefore, need to be evaluated.
Conclusions
Complex wiring of the mature nervous system, which in general
does not allow the effective integration of new neurons, and
the extreme morphological polarity of nerve cells themselves may be contributing factors regarding the withdrawal
Cerebral Cortex August 2007, V 17 N 8 1827
of differentiated neurons from cell cycle activity. On the other
hand, neurons are very able to undergo functional and morphological adaptations in response to changes in network activity.
The concomitance of both irreversible withdrawal from cell
cycle and a high potential for plasticity is unique to neurons in
comparison with all other cell populations. It has therefore been
hypothesized that proteins normally involved in cell cycle
machinery may assume functions in neuronal plasticity (Arendt
2003). Interestingly, in Alzheimer’s disease, suggested to be
a neuroplastic disorder, several cell cycle--related proteins have
been found to be ectopically expressed in neocortical and
hippocampal pyramidal neurons: populations with a high degree of neuroplastic capacity (Arendt, Holzer, and Gärtner 1998;
Nagy and Esiri 1998; Herrup and Arendt 2002). These facts
support the idea that the constitutive expression of cell cycle
proteins occurring predominantly in cortical pyramidal neurons
might be related to mechanisms of neuroplasticity and/or to
processes that maintain neuronal stability.
Taken together, a complex pattern of cyclins, Cdks, and Cdkis
is constitutively expressed in postmitotic neurons where it
results in functionally active Cdk--cyclin complexes suggesting
a noncanonical function of these cell cycle regulators.
Notes
This work was supported by the Interdisziplinäres Zentrum für Klinische
Forschung Leipzig at the Faculty of Medicine of the Universität Leipzig
(C1). We thank Dr Cuong Hoang-Vu and Mrs Kathrin Hammje (Experimental and Oncological Surgery Research Group, University Department
of General, Visceral, and Vascular Surgery, Martin-Luther-University,
Halle, Germany) for the opportunity to use the PALMÒ laser microdissection and pressure catapulting system and for excellent technical
support. The authors also wish to thank Dr Zoe McIvor for linguistic
revision of the manuscript. Conflict of Interest: None declared.
Address correspondence to Thomas Arendt, Paul Flechsig Institute for
Brain Research, Department of Neuroanatomy, University of Leipzig,
Jahnallee 59, 04109 Leipzig, Germany. Email: Thomas.Arendt@medizin.
uni-leipzig.de.
References
Arendt T. 2003. Synaptic plasticity and cell cycle activation in neurons
are alternative effector pathways: the ‘Dr. Jekyll and Mr. Hyde
concept’ of Alzheimer’s disease or the yin and yang of neuroplasticity. Prog Neurobiol. 71:83--248.
Arendt T, Holzer M, Gärtner U. 1998. Neuronal expression of cycline
dependent kinase inhibitors of the INK4 family in Alzheimer’s
disease. J Neural Transm. 105:949--960.
Arendt T, Holzer M, Gärtner U, Brückner MK. 1998. Aberrancies in signal
transduction and cell cycle related events in Alzheimer’s disease.
J Neural Transm Suppl. 54:147--158.
Arendt T, Rödel L, Gärtner U, Holzer M. 1996. Expression of the cyclindependent kinase inhibitor p16 in Alzheimer’s disease. Neuroreport.
7:3047--3049.
Becker EB, Bonni A. 2004. Cell cycle regulation of neuronal apoptosis in
development and disease. Prog Neurobiol. 72:1--25.
Becker EB, Bonni A. 2005. Beyond proliferation—cell cycle control of
neuronal survival and differentiation in the developing mammalian
brain. Semin Cell Dev Biol. 16:439--448.
Busser J, Geldmacher DS, Herrup K. 1998. Ectopic cell cycle proteins
predict the sites of neuronal cell death in Alzheimer’s disease brain.
J Neurosci. 18:2801--2807.
Clurman BE, Sheaff RJ, Thress K, Groudine M, Roberts JM. 1996. Turnover
of cyclin E by the ubiquitin-proteasome pathway is regulated by
cdk2 binding and cyclin phosphorylation. Genes Dev. 10:1979--1990.
Coqueret O. 2003. New roles for p21 and p27 cell-cycle inhibitors: a
function for each cell compartment? Trends Cell Biol. 13:65--70 [review].
1828 Cell Cycle Regulators in Differentiated Neurons
d
Schmetsdorf et al.
Cunningham JJ, Roussel MF. 2001. Cyclin-dependent kinase inhibitors
in the development of the central nervous system. Cell Growth
Differ. 12:387--396 [review].
De Falco M, Fedele V, De Luca L, Penta R, Cottone G, Cavallotti I,
Laforgia V, De Luca A. 2004. Evaluation of cyclin D1 expression and
its subcellular distribution in mouse tissues. J Anat. 205:405--412.
Delalle I, Takahashi T, Nowakowski RS, Tsai LH, Caviness VS Jr. 1999.
Cyclin E-p27 opposition and regulation of the G1 phase of the cell
cycle in the murine neocortical PVE: a quantitative analysis of mRNA
in situ hybridization. Cereb Cortex. 9:824--832.
Diehl JA, Cheng M, Roussel MF, Sherr CJ. 1998. Glycogen synthase
kinase-3beta regulates cyclin D1 proteolysis and subcellular localization. Genes Dev. 12:3499--3511.
Diehl JA, Zindy F, Sherr CJ. 1997. Inhibition of cyclin D1 phosphorylation on threonine-286 prevents its rapid degradation via the
ubiquitin-proteasome pathway. Genes Dev. 11:957--972.
Dobashi Y, Kudoh T, Toyoshima K, Akiyama T. 1996. Persistent activation
of CDK4 during neuronal differentiation of rat pheochromaocytoma
PC12 cells. Biochem Biophys Res Commun. 221:351--355.
Dyer MA, Cepko CL. 2000. p57(Kip2) regulates progenitor cell proliferation and amacrine interneuron development in the mouse
retina. Development. 127:3593--3605.
Fischer SJ, McDonald ES, Gross L, Windebank AJ. 2001. Alterations in
cell cycle regulation underlie cisplatin induced apoptosis of dorsal
root ganglion neurons in vivo. Neurobiol Dis. 8:1027--1035.
Freeman RS, Estus S, Johnson EM Jr. 1994. Analysis of cell cycle-related
gene expression in postmitotic neurons: selective induction of
cyclin D1 during programmed cell death. Neuron. 12:343--355.
Gärtner U, Brückner MK, Krug S, Schmetsdorf S, Staufenbiel M, Arendt T.
2003. Amyloid deposition in APP23 mice is associated with the
expression of cyclins in astrocytes but not in neurons. Acta Neuropathol. 106:535--544.
Herrup K, Arendt T. 2002. Re-expression of cell cycle proteins induces
neuronal cell death during Alzheimer’s disease. J Alzheimers Dis.
4:243--247.
Hisanaga S, Kusubata M, Okumura E, Kishimoto T. 1991. Phosphorylation
of neurofilament H subunit at the tail domain by CDC2 kinase dissociates the association to microtubules. J Biol Chem. 15:21798--21803.
Hoozemans JJ, Brückner MK, Rozemuller AJ, Veerhuis R, Eikelenboom P,
Arendt T. 2002. Cyclin D1 and cyclin E are co-localized with cyclooxygenase 2 (COX-2) in pyramidal neurons in Alzheimer disease
temporal cortex. J Neuropathol Exp Neurol. 61:678--688.
Huard JM, Forster CC, Carter ML, Sicinski P, Ross ME. 1999. Cerebellar
histogenesis is disturbed in mice lacking cyclin D2. Development.
126:1927--1935.
Ino H, Chiba T. 2001. Cyclin-dependent kinase 4 and cyclin D1 are
required for excitotoxin-induced neuronal cell death in vivo.
J Neurosci. 21:6086--6094.
Jahn L, Sadoshima J, Izumo S. 1994. Cyclins and cyclin-dependent
kinases are differentially regulated during terminal differentiation of
C2C12 muscle cells. Exp Cell Res. 212:297--307.
Jordan-Sciutto KL, Morgan K, Bowser R. 1999. Increased cyclin G1 immunoreactivity during Alzheimer’s disease. J Alzheimers Dis. 1:409--417.
Kaffman A, Herskowitz I, Tjian R, O’Shea EK. 1994. Phosphorylation of
the transcription factor PHO4 by a cyclin-CDK complex, PHO80PHO85. Science. 263:1153--1156.
Katchanov J, Harms C, Gertz H, Hauck L, Waeber C, Hirt L, Priller J, von
Harsdorf R, Bruck W, Hortnagel H, et al. 2001. Mild cerebral ischemia
induces loss of cyclin-dependent kinase inhibitors and activation of
cell cycle machinery before delayed neuronal cell death. J Neurosci.
21:5045--5053.
Klotzbucher A, Stewart E, Harrison D, Hunt T. 1996. The ‘destruction
box’ of cyclin A allows B-type cyclins to be ubiquitinated, but not
efficiently destroyed. EMBO J. 15:3053--3064.
Kranenburg O, Scharnhorst V, van der Eb AJ, Zantema A. 1995. Inhibiton
of cyclin-dependent kinase activity triggers neuronal differentiation
of mouse neuroblastoma cells. J Cell Biol. 131:227--234.
Kuan CY, Schloemer AJ, Lu A, Burns KA, Weng WL, Williams MT, Strauss
KI, Vorhees CV, Flavell RA, Davis RJ, et al. 2004. Hypoxia-ischemia
induces DNA synthesis without cell proliferation in dying neurons in
adult rodent brain. J Neurosci. 24:10763--10772.
LaBaer J, Garrett MD, Stevenson LF, Slingerland JM, Sandhu C, Chou HS,
Fattaey A, Harlow E. 1997. New functional activities for the p21
family of CDK inhibitors. Genes Dev. 11:847--862.
Lee MH, Nikolic M, Baptista CA, Lai E, Tsai LH, Massague J. 1996. The
brain-specific activator p35 allows Cdk5 to escape inhibition by
p27Kip1 in neurons. Proc Natl Acad Sci USA. 93:3259--3263.
Li J, Meyer AN, Donoghue DJ. 1997. Nuclear localization of cyclin B1
mediates its biological activity and is regulated by phosphorylation.
Proc Natl Acad Sci USA. 94:502--507.
Li Y, Chopp M, Powers C. 1997. Granule cell apoptosis and protein
expression in hippocampal dentate gyrus after forebrain ischemia in
the rat. J Neurol Sci. 150:93--102.
Liu DX, Greene LA. 2001. Neuronal apoptosis at the G1/S cell cycle
checkpoint. Cell Tissue Res. 305:217--228.
Löwenheim H, Furness DN, Kil J, Zinn C, Gultig K, Fero ML, Frost D,
Gummer AW, Roberts JM, Rubel EW, et al. 1999. Gene disruption of
p27(Kip1) allows cell proliferation in the postnatal and adult organ
of corti. Proc Natl Acad Sci USA. 96:4084--4088.
Lu G, Seta KA, Millhorn DE. 2005. Novel role for cyclin-dependent kinase 2
in neuregulin-induced acetylcholine receptor epsilon subunit expression in differentiated myotubes. J Biol Chem. 280:21731--21738.
Matsunaga Y. 2000. Expression of cyclin E in postmitotic cells in
the central nervous system. Kokubyo Gakkai Zasshi. 67:169--181.
Mawal-Dewan M, Sen PC, Abdel-Ghany M, Shalloway D, Racker E. 1992.
Phosphorylation of tau protein by purified p34cdc28 and a related
protein kinase from neurofilaments. J Biol Chem. 267:19705--19709.
McShea A, Harris PL, Webster KR, Wahl AF, Smith MA. 1997. Abnormal
expression of the cell cycle regulators P16 and CDK4 in Alzheimer’s
disease. Am J Pathol. 150:1933--1939.
Miyajima M, Nornes HO, Neuman T. 1995. Cyclin E is expressed in
neurons and forms complexes with cdk5. Neuroreport. 6:1130--1132.
Miyazawa K, Himi T, Garcia V, Yamagishi H, Sato S, Ishizaki Y. 2000. A
role for p27/Kip1 in the control of cerebellar granule cell precursor
proliferation. J Neurosci. 20:5756--5763.
Nagy Z, Esiri MM. 1998. Neuronal cyclin expression in the hippocampus
in temporal lobe epilepsy. Exp Neurol. 150:240--247.
Nagy Z, Esiri MM, Cato AM, Smith AD. 1997. Cell cycle markers in
the hippocampus in Alzheimer’s disease. Acta Neuropathol. 94:6--15.
Ohnuma S, Philpott A, Harris WA. 2001. Cell cycle and cell fate in the
nervous system. Curr Opin Neurobiol. 11:66--73 [review].
Ohnuma S, Philpott A, Wang K, Holt CE, Harris WA. 1999. p27Xic1, a Cdk
inhibitor, promotes the determination of glial cells in Xenopus
retina. Cell. 99:499--510.
Oka T, Kubo T, Enokido Y, Hatanaka H. 1996. Expression of cyclin A
decreases during neuronal apoptosis in cultured rat cerebellar
granule neurons. Brain Res Dev Brain Res. 97:96--106.
Okano HJ, Pfaff DW, Gibbs RB. 1993. RB and Cdc2 expression in brain:
correlations with 3H-thymidine incorporation and neurogenesis.
J Neurosci. 13:2930--2938.
Parker SB, Eichele G, Zhang P, Rawls A, Sands AT, Bradley A, Olson EN,
Harper JW, Elledge SJ. 1995. p53-independent expression of
p21Cip1 in muscle and other terminally differentiating cells.
Science. 267:1024--1027.
Richter JD. 2001. Think globally, translate locally: what mitotic spindles
and neuronal synapses have in common. Proc Natl Acad Sci USA.
98:7069--7071.
Rickert P, Seghezzi W, Shanahan F, Cho H, Lees E. 1996. Cyclin C/CDK8
is a novel CTD kinase associated with RNA polymerase II. Oncogene.
12:2631--2640.
Ross ME, Carter ML, Lee JH. 1996. MN20, a D2 cyclin, is transiently
expressed in selected neural populations during embryogenesis.
J Neurosci. 16:210--219.
Ross ME, Risken M. 1994. MN20, a D2 cyclin found in brain, is implicated
in neural differentiation. J Neurosci. 14:6384--6391.
Roy R, Adamczewski JP, Seroz T, Vermeulen W, Tassan JP, Schaeffer L,
Nigg EA, Hoeijmakers JH, Egly JM. 1994. The MO15 cell cycle kinase
is associated with the TFIIH transcription-DNA repair factor. Cell.
79:1093--1101.
Schmetsdorf S, Gärtner U, Arendt T. 2005. Expression of cell cyclerelated proteins in developing and adult mouse hippocampus. Int
J Dev Neurosci. 23:101--112.
Scott CW, Vulliet PR, Caputo CB. 1993. Phosphorylation of tau by
proline-directed protein kinase (p34cdc2/p58cyclinA) decreases
tau-induced microtubule assembly and antibody SMI33 reactivity.
Brain Res. 21:237--242.
Shirvan A, Ziv I, Barzilai A, Djaldeti R, Zilkh-Falb R, Michlin T, Melamed E.
1997. Induction of mitosis-related genes during dopamine-triggered
apoptosis in sympathetic neurons. J Neural Transm Suppl. 50:
67--78.
Shirvan A, Ziv I, Machlin T, Zilkha-Falb R, Melamed E, Barzilai A. 1997.
Two waves of cyclin B and proliferating cell nuclear antigen
expression during dopamine-triggered neuronal apoptosis. J Neurochem. 69:539--549.
Small DL, Monette R, Comas T, Fournier MC, Morley P. 1999. Loss of
cyclin D1 in necrotic and apoptotic models of cortical neuronal
degeneration. Brain Res. 842:376--383.
Small DL, Monette R, Fournier MC, Zurakowski B, Fiander H, Morley P.
2001. Characterization of cyclin D1 expression in a rat global model
of cerebral ischemia. Brain Res. 900:26--37.
Sudakin V, Ganoth D, Dahan A, Heller H, Hershko J, Luca FC, Ruderman
JV, Hershko A. 1995. The cyclosome, a large complex containing
cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis. Mol Biol Cell. 6:185--197.
Sumrejkanchanakij P, Tamamori-Adachi M, Matsunaga Y, Eto K, Ikeda
MA. 2003. Role of cyclin D1 cytoplasmic sequestration in the survival
of postmitotic neurons. Oncogene. 22:8723--8730.
Tamaru T, Trigun SK, Okada M, Nakagawa H. 1993. Identification of cells
expressing a D type G1 cyclin in matured brain: implication for its
role in neuronal function. Neurosci Lett. 153:169--172.
Timsit S, Rivera S, Ouaghi P, Guischard F, Tremblay E, Ben Ari Y,
Khrestchatisk M. 1999. Increased cyclin D1 in vulnerable neurons
in the hippocampus after ischemia and epilepsy: a modulator of in
vivo programmed cell death? Eur J Neurosci. 11:263--278.
Udvardy A. 1996. The role of controlled proteolysis in cell-cycle
regulation. Eur J Biochem. 240:307--313.
Van Grunsven LA, Billon N, Savatier P, Thomas A, Urdiales JL, Rudkin BB.
1996. Effect of nerve growth factor on the expression of cell cycle
regulatory proteins in PC12 cells: dissection of the neurotrophic
response from the anti-mitogenic response. Oncogene. 12:
1347--1356.
Van Lookeren Campagne M, Gill R. 1998a. Cell cycle-related gene
expression in the adult rat brain: selective induction of cyclin G1 and
p21 Waf1/Cip1 in neurons following focal cerebral ischemia.
Neuroscience. 84:1097--1112.
Van Lookeren Campagne M, Gill R. 1998b. Tumor-suppressor p53 is
expressed in proliferating and newly formed neurons of the
embryonic and postnatal rat brain: comparison with expression of
the cell cycle regulators p21Waf1/Cip1, p27Kip1, p57Kip2,
p16Ink4a, cyclin G1, and the proto-oncogene Bax. J Comp Neurol.
397:181--198.
Vincent I, Rosado M, Davies P. 1996. Mitotic mechanisms in Alzheimer’s
disease? J Cell Biol. 132:413--425.
Watanabe Y, Watanabe T, Kitagawa M, Taya Y, Nakayama K, Motoyama N.
1999. pRb phosphorylation is regulated differentially by
cyclin-dependent kinase (Cdk) 2 and Cdk4 in retinoic acidinduced neuronal differentiation of P19 cells. Brain Res. 842:
342--350.
Wood JG, Zinsmeister P. 1993. Demonstration of cdc2 kinase in mature
neuronal nuclei. Neuroreport. 4:599--601.
Xiong W, Pestell R, Rosner MR. 1997. Role of cyclins in neuronal
differentiation of immortalized hippocampal cells. Mol Cell Biol.
17:6585--6597.
Yan GZ, Ziff EB. 1995. NGF regulates the PC12 cell cycle machinery
through specific inhibition of the Cdk kinases and induction of
cyclin D1. J Neurosci. 15:6200--6212.
Zindy F, Cunningham JJ, Sherr CJ, Jogal S, Smeyne RJ, Roussel MF. 1999.
Postnatal neuronal proliferation in mice lacking Ink4d and Kip1
inhibitors of cyclin-dependent kinases. Proc Natl Acad Sci USA.
96:13462--13467.
Zindy F, Soares H, Herzog KH, Morgan J, Sherr CJ, Roussel MF. 1997.
Expression of INK4 inhibitors of cyclin D-dependent kinases
during mouse brain development. Cell Growth Differ. 8:1139--1150.
Cerebral Cortex August 2007, V 17 N 8 1829