International Immunology, Vol. 13, No. 9, pp. 1185–1192
© 2001 The Japanese Society for Immunology
Distinct requirements for IL-6 in polyclonal
and specific Ig production induced by
microorganisms
Dominique Markine-Goriaynoff, Trung D. Nguyen2, Geoffroy Bigaignon2,
Jacques Van Snick1 and Jean-Paul Coutelier
Unit of Experimental Medicine, 1Ludwig Institute for Cancer Research, Christian de Duve Institute of
Cellular Pathology and 2Microbiology Unit, Cliniques Universitaires Saint-Luc, Université Catholique de
Louvain, Avenue Hippocrate 74, 1200 Bruxelles, Belgium
Keywords: cytokine, IL-6, antibody isotype, lactate dehydrogenase-elevating virus, lipopolysaccharide,
Toxoplasma gondii
Abstract
The role of IL-6 in Ig production induced in the mouse by lactate dehydrogenase-elevating virus
(LDV), Toxoplasma gondii or lipopolysaccharide (LPS) was assessed. Following infection with LDV,
a strong activator of B cells, an early and transient IL-6 production was observed, that originated
predominantly from macrophages. Whereas LDV-induced B lymphocyte proliferation appeared
independent of IL-6, mice deficient for this cytokine showed a marked reduction in their total
T-dependent IgG2a production when compared to their normal counterparts. By contrast, specific
responses directed against either LDV or non-viral antigens administered at the time of infection
were not decreased in the absence of IL-6. Similarly, polyclonal, but not anti-parasite IgG2a
production triggered by T. gondii infection was strongly dependent on the presence of IL-6. Finally,
T-independent total IgG3 secretion triggered by LPS was also markedly reduced in IL-6-deficient
mice. These results suggest that IL-6 plays a major role in T-dependent and T-independent
polyclonal Ig production following B lymphocyte activation by viruses, and parasites, but not in
specific antibody responses induced by the same microorganisms.
Introduction
Infection of mice by some microorganisms including viruses,
parasites and bacteria, or inoculation of products such as
lipopolysaccharide (LPS), induce, in addition to secretion
of specific antibodies, a strong B lymphocyte polyclonal
activation resulting in hypergammaglobulinemia (1–4). The
isotypic distribution of these Ig depends on the stimulus
involved: LPS induces a response that is dominated by IgM
and IgG3 (4–6); responses induced by parasites such as
Plasmodium chabaudi, Trypanosoma cruzi and Toxoplasma
gondii are restricted to the IgG2a subclass (7–10); a similar
IgG2a preponderance has been reported after infection with
viruses like lactate dehydrogenase-elevating virus (LDV),
mouse hepatitis virus, murine adenovirus, lymphocytic choriomeningitis virus and murine cytomegalovirus (1,6,11–14). The
enhanced production of natural antibodies resulting from
such B cell polyclonal activation may play an important role
in the defense against infections, especially at the early
times after invasion of the host by viruses or bacteria, when
specific responses have not yet matured (15). However, the
mechanisms leading to this type of immune response are not
fully understood. In many cases, a T lymphocyte-independent
proliferation of B cells (1,14,16) results probably from a direct
interaction of a microorganism product with some receptor
expressed on these cells (17–20). In contrast, Ig switch and
secretion by these activated B lymphocytes are more likely
regulated by Th cell-dependent mechanisms involving interaction with cytokines (1,13,21–24).
Among the cytokines capable to stimulate B lymphocytes,
it has been reported that IL-6, in synergy with IL-1, induces
B cell proliferation and secretion of large amounts of IgM by
those cells (25). Moreover, the production of other Ig isotypes,
such as IgA and IgG, by B lymphocytes already committed
to their secretion is enhanced by IL-6 (26,27). In addition,
IL-6 is a potent in vitro and in vivo growth factor for murine
plasmacytomas (28–30). Therefore, it is plausible to
hypothesize that IL-6 could play a role in microorganism-
Correspondence to: D. Markine-Goriaynoff
Transmitting editor: A. Radbruch
Received 2 November 2000, accepted 15 June 2001
1186 Ig regulation by IL-6
triggered Ig production, including that following B lymphocyte
polyclonal activation, especially since the secretion of this
molecule has been shown to be induced by both LPS and
parasitic and viral infection (31–38). Our results indicate that,
at least in some mouse strains, IL-6 is indeed required for
hypergammaglobulinemia induced by microorganisms and
derived products, but not for the secretion of specific antibodies, suggesting that specific or polyclonal B lymphocyte
activations are differentially regulated by this cytokine.
IL-6 assay
IL-6 was assayed as described in (42) by incubation of
serial sample dilutions with the mouse IL-6-dependent
B cell hybridoma 7TD1 (2000 cells/microwell) in 0.2 ml
Iscove’s medium containing 10% FSC, and supplemented
with 0.24 mM L-asparagine, 0.55 mM L-arginine, 1.5 mM Lglutamine, 0.05 mM 2-mercaptoethanol, 0.1 mM hypoxanthine
and 0.016 mM thymidine. Cells were counted 4 days later by
hexosaminidase determination (43). Results, expressed in
U/ml, were defined as the concentration producing halfmaximal growth of the cells.
Methods
Antibody determination
Mice
Isolator-reared 129/Sv female mice and SPF BALB/c mice
were produced at the Ludwig Institute for Cancer Research
by Dr G. Warnier and used when 8–12 weeks old. B6,129IL6tm1Kopf mice and their controls, B6129F2/J animals (39),
were obtained from the Jackson Laboratory (Bar Harbor, ME).
Virus, parasite, LPS and antigen
In vivo infection was performed by i.p. injection of ~2⫻107
50% infectious doses (ID50) of LDV (Riley strain; ATCC,
Rockville, MD) (6). Mice were infected with the weakly virulent
Beverley strain of T. gondii by i.p. inoculation with 5 cyst
parasites, as described previously (10). LPS from Escherichia
coli (055:B5; Difco, Detroit, MI) was injected i.p. (25 µg in
500 µl saline per mouse). Immunization with keyhole limpet
hemocyanin (KLH) (Calbiochem, San Diego, CA) was performed by i.p. injection of 100 µg antigen in 500 µl saline.
Antibody
Anti-CD4 mAb GK1.5 (40) was made available by Dr F.
W. Fitch (Chicago) and obtained through the courtesy of
Dr H. R. MacDonald (Epalinges sur Lausanne, Switzerland).
Spleen cell cultures
As described previously (6), 25⫻106 spleen cells were
cultured in 5 ml Iscove’s medium containing 10% FCS
and supplemented with 0.24 mM L-asparagine, 0.55 mM Larginine, 1.5 mM L-glutamine and 0.05 mM 2-mercaptoethanol. Supernatants were collected 24 h after initiation
of cultures.
Cell purification
Cell subpopulations were purified by magnetic cell sorting
(MACS; Miltenyi Biotec, Bergisch Gladbach, Germany) as
described previously (20,41). Briefly, cells were incubated
with biotinylated mAb specific for subpopulation surface
markers (Thy-1, B220 and MAC-1), followed with fluorescein–
streptavidin and MACS–biotin microbeads. Cells were loaded
in a magnetic cell sorter on a cooled B2 column through a
22-gauge needle, washed with PBS containing 1% BSA
through a 21-gauge needle, followed by a 19-gauge needle
and eluted with 40 ml PBS with BSA. The purity of the
cell preparations was checked by means of biotinylated
antibodies, followed by alkaline phosphatase streptavidin and
naphtol-AS-MX-phosphate or by flow cytometry analysis.
Total IgG subclasses were determined by direct ELISA, as
described previously (1). The binding of IgG subclasses to
insolubilized mouse IgG isotype-specific rabbit antibody or
to insolubilized mouse IgG isotype-specific rat mAb was
measured with peroxidase-labeled anti-mouse Ig rat (obtained
from H. Bazin, Brussels) or donkey antibody. Standards were
mAb of the appropriate isotype. All IgG2a allotypes were
recognized by the IgG2a-specific assay.
Specific antibody IgG2a was assayed by ELISA as
described previously (10,24), by using plates coated with
appropriate antigens and standard curves of selected antiDNP mAb.
RNA extraction and PCR amplification
Gene expression was analyzed by RT-PCR as described
previously (44). Cells were lysed in Trizol reagent (BRL,
Gaithersburg, MD). Total RNA was first extracted with chloroform, then precipitated with isopropanol, washed in ethanol
and finally resuspended in 50–100 µl water. Oligo(dT)-primed
cDNA was prepared from ~5 µg RNA using 200 U MMLV
reverse transcriptase (BRL) according to the manufacturer’s
instructions. cDNA was amplified by PCR with DyNAzyme
DNA polymerase (Finnzymes, Espoo, Finland) for actin and
with a Gene Amp kit (Perkin-Elmer Cetus, Norwalk, CT) for
IL-6 in a Thermal Reactor (Hybaid, Middlesex, UK). The
primers were as follows: actin: AGGCATTGTGATGGACTCC
and GCTGGAAGGTGGACAG-TGAG; IL-6: ATGAAGTTCCTCTCTGCA and GTTTGCCGAGTAGATCTC.
The post-PCR products were analyzed in 1% agarose gels
containing ethidium bromide. Semi-quantitative results were
obtained after blotting of the PCR products on Zeta-Probe
membranes (BioRad, Hercules, CA) and hybridization overnight at 42°C in Denhardt’s solution with internal probes
labeled with 32P. The radioactivity was quantitated with a
PhosphorImager (Molecular Dynamics, Sunnyvale, CA), and
the ratios between IL-6 and actin messages were calculated
after subtraction of non-specific background and shown as
arbitrary units. The sequence of the probes was: actin:
TATGAGCTGCCTGACGGCCA; IL-6: GACCTGTCTATACCACTTCAC.
Results
IL-6 secretion in mice infected with LDV
Although it has been shown that many viruses trigger IL-6
secretion, little is known so far on the production of this
Ig regulation by IL-6 1187
Table 1. LDV-induced IL-6 production after anti-CD4 treatment
LDV infectiona
Anti-CD4 treatmentb
Serum IL-6 (U/ml)c
⫺
⫹
⫹
⫺
⫺
⫹
⬍10
328 ⫾ 83
483 ⫾ 116
aFour
129/Sv mice per group.
of 500 µl ascitic fluid containing GK1.5 anti-CD4 mAb,
12 h before infection.
cMeasured by bioassay in sera obtained 24 h after LDV infection
(mean ⫾ SE).
bAliquot
Fig. 1. IL-6 expression and production after LDV infection. (A) IL-6
levels were measured by bioassay in the serum of 10 129/Sv mice
at different times after LDV infection. (B) Expression of IL-6 message
was analyzed by RT-PCR in spleen and peritoneal cells obtained
from groups of three 129/Sv mice at different times after LDV infection.
cytokine after LDV infection. To analyze the role of IL-6 in
LDV-induced Ig production, we first determined whether this
virus triggered secretion of the cytokine. Thus, IL-6 was
bioassayed in the serum of 129/Sv animals at different times
post-infection (p.i.). As shown in Fig. 1(A) for one experiment
among four performed, a transient peak of serum IL-6 was
detected during the first day p.i. At later times p.i., no IL-6
was found by this method (data not shown). These results were
confirmed by RT-PCR analysis of IL-6 message expression in
spleen and peritoneal cells from 129/Sv mice. A strong, but
transient IL-6 message was induced by the virus (Fig. 1B,
shown for one of three experiments performed). This IL-6
expression peaked at 24 h p.i. in spleen cells while it was
already nearly at its maximum at 6 h p.i. in peritoneal cells.
At 36 h p.i., the IL-6 message returned to nearly normal levels
both in spleen and peritoneal cells. Similar kinetics were
observed in spleen and peritoneal cells of LDV-infected CBA
mice (data not shown).
IL-6 can be produced by different cell populations, including
macrophages and Th lymphocytes. To determine the role of
the latter cells in LDV-induced IL-6 secretion, we treated mice
with anti-CD4 GK1.5 mAb, since this treatment had been
Fig. 2. IL-6 message expression in spleen cell subpopulations after
LDV infection. IL-6 expression was analyzed by RT-PCR in cell
subpopulations enriched from pooled spleens obtained from eight to
10 129/Sv mice, 12 h after LDV infection. (A) Actin and IL-6 message
in total spleen cells (A), enriched T lymphocytes (B, containing 74%
Thy-1⫹ cells), enriched B lymphocytes (C, containing 40% B220⫹
cells) and enriched macrophages (D, containing 27% MAC-1⫹ cells).
(B) Calculated IL-6/actin message ratio in a second, independent
experiment, expressed in arbitrary units for Thy-1-, B220- and MAC1-enriched populations containing 87% T lymphocytes, 90% B
lymphocytes and 21% macrophages respectively.
previously found to deplete Th cells in vivo (40,45). No
modification in IL-6 secretion was observed after this treatment
(Table 1, results representative of two experiments). Moreover,
BALB/c nu/nu and BALB/cBy-SCID mice produced as much
IL-6 after LDV infection as their normal BALB/c counterparts
(data not shown). The cellular origin of LDV-induced IL-6 was
also analyzed by RT-PCR, after purification of spleen cell
subpopulations. At 12 h p.i., a strong IL-6 message was
detected in MAC-1-enriched cells, but not in B neither in T
lymphocytes (shown in Fig. 2 for two independent experi-
1188 Ig regulation by IL-6
Fig. 4. IL-6 control of LDV-induced total IgG2a production by spleen
cells. Total IgG2a was measured by ELISA in the supernatants of
spleen cells obtained 1 week after LDV infection of groups of three
B6129F2/J (IL-6⫹/⫹) or eight B6,129-IL6tm1Kopf (IL-6–/–) mice (means
⫾ SE).
Fig. 3. IgG levels after LDV infection of IL-6-deficient mice. (A) Total
IgG subclasses were assayed by ELISA in the serum of groups of
five B6129F2/J (IL-6⫹/⫹) or B6,129-IL6tm1Kopf (IL-6–/–) mice at 14
days after LDV inoculation. Results are expressed as means ⫾ SE.
(B) Anti-LDV IgG2a antibodies were assayed by ELISA in the serum
of groups of three to five B6129F2/J (IL-6⫹/⫹) or B6,129-IL6tm1Kopf
(IL-6–/–) mice, 28 days after LDV inoculation and immunization with
100 µg KLH. Results are expressed as means ⫾ SE.
ments). Together, these results suggest that IL-6 was
produced by macrophages, but not by T lymphocytes.
Role of IL-6 in B lymphocyte responses triggered by LDV
infection
LDV infection induces a polyclonal B lymphocyte activation
characterized by both a T-independent cell proliferation and
a T-dependent Ig secretion restricted to the IgG2a subclass
(1,24). The role of IL-6 in these effects was analyzed in
B6,129-IL6tm1Kopf mice that are deficient for this cytokine.
LDV-induced B lymphocyte proliferation, measured by
thymidine incorporation, was similar in IL-6-deficient and
normal animals (data not shown). In contrast, a strong reduction of total serum IgG2a levels following LDV infection was
observed in IL-6-deficient mice when compared to normal
counterparts (Fig. 3A, shown for one of three experiments
done). This phenomenon was not due to a delayed IgG2a
secretion, as it was found at different times after virus
inoculation (data not shown). Interestingly, a moderate,
although significant (P 艋 0.01 by Mann–Whitney test) difference was already found in basal IgG2a levels of uninfected
mice (Fig. 3A). Although LDV-induced IgG2b secretion
seemed slightly increased in IL-6-deficient mice when compared to normal infected animals, the difference was not
significant (P 艌 0.05). No IL-6-related difference was
observed for IgG3. Finally, basal IgG1 levels were slightly
higher in IL-6-deficient mice than in normal animals (P ⫽
0.03 and 艋0.01 for control and infected mice, respectively).
Despite this difference, no increase in IgG1 levels followed
LDV infection of IL-6-deficient mice. This control of LDVinduced total IgG2a secretion by IL-6 was confirmed by
spleen cell cultures. As shown in Fig. 4 for one of two
experiments performed, the production of total IgG2a by
spleen cells obtained from IL-6-deficient mice 1 week after
infection was indeed much lower than that of cells from their
normal counterparts.
Like total Ig, specific antibody responses elicited against
viral or non-viral antigens in mice infected with LDV and
concomitantly immunized with a protein antigen such as
KLH are restricted to the IgG2a subclass (11,12). However,
contrasting with total IgG2a, the production of specific IgG2a
anti-LDV antibodies was not significantly decreased in animals
deficient for IL-6 (Fig. 3B, shown for a typical experiment
among three). Similarly, the anti-KLH IgG2a antibody response
elicited in LDV-infected mice after immunization with this
antigen was not significantly lower in the absence of IL-6
(Table 2, one among two experiments done, P ⫽ 0.4 by
Mann–Whitney test).
Requirement of IL-6 for T. gondii -induced Ig responses.
Like LDV, the weakly virulent Beverley strain of T. gondii
induces an IgG2a-restricted polyclonal activation of B lymphocytes (10) and IL-6 production (37). To assess the role of the
cytokine in this polyclonal IgG2a secretion, we infected IL-6deficient mice with the parasite. As shown in Fig. 5(A) for a
typical experiment among four, the rise in total IgG2a serum
Ig regulation by IL-6 1189
Table 2. IL-6-independence of specific antibody responses
in mice infected with LDV and immunized with KLH
Micea
Anti-KLH IgG2a antibody (µg/ml)b
B6129F2/J
B6,129-IL6tm1Kopf
28 ⫾ 5
16 ⫾ 6
aGroups of
bMeasured
three mice.
by ELISA in sera obtained 28 days after LDV infection
and immunization with KLH (same animals as in Fig. 3B, means ⫾ SE).
Fig. 6. IgG subclass production after LPS administration to IL-6deficient mice. IgG subclasses were assayed by ELISA in the serum
of groups of three B6129F2/J (IL-6⫹/⫹) and B6,129-IL6tm1Kopf
(IL-6–/–) mice 7 days after administration of 25 µg LPS. Results are
shown as means ⫾ SE.
were much lower than those of IgG2a. Again, as after LDV
infection, no decrease in specific anti-T. gondii IgG2a antibodies was observed in the absence of IL-6 (Fig. 5B,
measured in one experiment).
LPS-induced B lymphocyte polyclonal activation in IL-6deficient mice.
LPS injection into normal mice is followed by rapid IL-6
secretion (46) and a strong T-independent polyclonal IgG3
production (4–6). To determine whether this IgG3 production
required IL-6, we administered LPS to IL-6-deficient mice and
measured IgG3 levels in the serum 7 days later. Our results
indicated that this T-independent polyclonal IgG3 secretion
was markedly reduced in the absence of IL-6 (Fig. 6, shown
for one of three experiments done). IgG2a and IgG2b secretion, that was moderately increased after LPS administration
to normal animals, was also strongly diminished. Finally,
although IgG1 levels were higher in untreated IL-6-deficient
mice than in control animals, LPS administration did not
trigger any increase of this isotype in these mice.
Discussion
Fig. 5. IgG production after T. gondii infection of IL-6-deficient mice.
(A) IgG subclasses were assayed by ELISA in the serum of groups
of eight B6129F2/J (IL-6⫹/⫹) and B6,129-IL6tm1Kopf (IL-6–/–) mice
before (D0) or 31 days after (D31) infection with T. gondii. Results
are shown as means ⫾ SE. (B) IgG2a anti-T. gondii antibodies
were assayed by ELISA in the serum of groups of three B6129F2/J
(IL-6⫹/⫹) and B6,129-IL6tm1Kopf (IL-6–/–) mice obtained 31 days
after infection (means ⫾ SE).
levels induced by this infection was much weaker in the
absence of IL-6, although the difference with control mice
was less dramatic than that seen with LDV. In addition, a
reduction of IgG3, but not IgG1 and IgG2b was also observed
in IL-6-deficient mice, although the levels of these subclasses
In vitro, the ability of IL-6 to enhance Ig secretion by mouse
B lymphocytes is well established (26,27). Similarly, an in vivo
effect of IL-6 on Ig secretion has been demonstrated with
mice overexpressing this cytokine (47). In the present
study, analyzing the actual involvement of IL-6 in pathological
situations characterized by an enhanced Ig production, we
showed that both T-dependent and T-independent hypergammaglobulinemia following B lymphocyte polyclonal activation
triggered by microorganisms required the presence of this
cytokine. In contrast, specific antibody responses appeared
to be IL-6-independent.
Our results indicate that, after LDV infection, a transient
production of IL-6 occurred that originated mostly from macrophages rather than from T lymphocytes. It has been suggested
previously that LDV does not trigger IL-6 production and
1190 Ig regulation by IL-6
therefore that LDV-induced immune alterations could not be
related to this cytokine (48). However, this analysis of IL-6
production was performed in chronically infected mice, which
can easily account for the difference with our results that
showed a rapid decrease of the cytokine expression 2 days
after infection. On the other hand, our data fit well with other
reports of IL-6 secretion by mouse or human macrophages
after infection with different viruses, including Newcastle
disease virus, respiratory syncytial virus and coxsackievirus
(49–51). Together with a previous report of early IL-12 expression following infection (41), our observation indicates that
LDV triggers a transient macrophage activation that may
initiate a cascade of events responsible for some of the
effects of the virus on the immune responses, such as B
lymphocyte polyclonal activation. It remains to be determined
whether this cytokine production originates only from infected
macrophages or involves also non-infected recruited cells.
Different studies have so far analyzed the role of IL-6 in
Ig production by using either anti-IL-6 antibodies or mice
deficient for this cytokine, often with apparently conflicting
results. Only moderate influence on total IgG2a serum levels
were observed after treatment with anti-IL-6 or anti-IL-6
receptor antibodies in BALB/c or NZB/W F1 mice, although
an inhibition of IgG1 responses was found (52,53). Inhibition
of total or specific Ig was reported in B6⫻129 mice deficient for
IL-6 after administration of various stimuli such as ovalbumin,
myelin oligodendrocyte glycoprotein peptide, vaccinia virus
or murine cytomegalovirus (14,54,55). Interestingly, a strong
decrease of IgG2a, IgG2b and IgG3, but not IgG1 antigenspecific antibodies was reported in these animals after
immunization with DNP–ovalbumin (56). In contrast, whereas
administration of Schistosoma mansoni eggs resulted in a
decreased specific anti-egg antigen IgG1 and IgG2a antibody secretion in IL-6-deficient mice (57), IgG production by
granuloma cells following s.c. infection with the same parasite
was not modified in the absence of the cytokine (58). Similarly,
a polyclonal IgG2a production induced by gammaherpesvirus
68 appeared to be IL-6-independent in the same B6⫻129
mice (59). In addition, independent studies performed with
IL-6-deficient mice of the 129/Sv genetic background showed,
in the absence of the cytokine, an increase of IgG2a antibodies
after immunization with ovalbumin and infection with T. gondii
(60,61). Interestingly, in contrast to the large decrease in total
IgG2a production reported here after LDV infection of IL-6deficient B6⫻129 mice, in C57BL/6 animals, LDV-induced
total IgG2a production was IL-6-independent (data not
shown), which fits well with a similar difference between
mouse strains reported after ovalbumin immunization (56).
These results indicate that the effect of IL-6 on B lymphocytes
may vary from one mouse strain to another, and thus that the
genetic background must be taken into consideration when
analyzing the effect of cytokines on Ig secretion.
At this point, the mechanisms by which IL-6 enhances Ig
production in vivo are not completely understood, although it
has been shown that the cytokine may directly increase B
cell growth and differentiation in vitro, especially in conjunction with IL-1 (25). Apparently conflicting results have
been reported on the ability of IL-6 to affect Th lymphocyte
differentiation (57,62). However, because T-independent
LPS-induced IgG3 production was affected by the absence
of IL-6 as well as T-dependent responses triggered by virus
and parasite, it seems reasonable to postulate that this effect
of the cytokine on B cells does not require the presence of T
lymphocytes. Although in some models IL-6 was able to
induce IgG1 responses (47), this isotype, whereas secreted
at rather low levels in our models, was not decreased in the
absence of IL-6, a finding reported by other authors as well
(56), and was even higher in control IL-6-deficient B6⫻129
mice than in their normal counterparts. In addition to a mere
stimulation of B cell Ig secretion, IL-6 might thus be able to
modulate Ig isotypic distribution, in favour to IgG2a, IgG2b
and/or IgG3.
Interestingly, in our models, IL-6 was required for the
production of total IgG subclasses, but not of IgG2a antibodies specific for viral or parasite antigens, or for proteins
that were administered at the time of infection. In addition,
we have recently reported that anti-LDV specific antibody
responses were controlled by IFN-γ, but that total Ig production
triggered by LDV or T. gondii did not require the presence of
this cytokine (24) that is produced after infection with both
infectious agents (10,63 and manuscripts in preparation).
Together, these observations strongly suggest that parasiteor virus-induced total polyclonal IgG and specific antibody
secretion originate from B lymphocytes that are differentially
regulated by cytokines. It may thus be postulated that two
distinct and successive humoral responses are triggered
by primary infections: early after invasion of the host, a
polyclonal production of IgG2a might enhance the levels of
natural antibodies recognizing microorganisms, even with a
low affinity, that will help to restrict their proliferation (15).
The nature of this polyclonal Ig response remains unsolved.
The IL-6-independence of the anti-KLH IgG2a antibody
response that developed in mice immunized at the time of
infection suggests that this cytokine does not enhance all
ongoing immune responses. However, it remains possible
that some concomitant responses directed against particular
antigens, such as carbohydrates or lipids, and/or originating
from specific B cell subpopulations, such as B1 cells, could
be increased by the virus through IL-6 secretion. Alternatively,
this enhanced antibody production may correspond to the
stimulation of long-lived plasma cells already committed to
IgG secretion (64,65). Why this response develops so fast
may be explained by its control by IL-6, which is secreted
by macrophages immediately after infection. Although other
mechanisms are certainly also involved, it is possible that
increased susceptibility of IL-6-deficient mice to various
viruses, bacteria and parasites (39,61,66) is, at least partly,
related to an impairment of this early polyclonal B cell
response. Following this early secretion of total Ig, a more
specific antibody response, involving longer recruitment of
specific antiviral or anti-parasite B lymphocytes, and controlled by IFN-γ, whose secretion requires subsequent
activation of different cell populations like NK cells or lymphocytes, but not by IL-6, will then complete and tighten the
control of the invading microorganism.
Acknowledgements
The authors are indebted to P. L. Masson and P. G. Coulie for critical
reading of this manuscript, and to M.-D. Gonzales and T. Briet for
Ig regulation by IL-6 1191
expert technical assistance. This work was supported by the Fonds
National de la Recherche Scientifique (FNRS), Fonds de la
Recherche Scientifique Médicale (FRSM), Loterie Nationale, Fonds
de Développement Scientifique (UCL), Opération Télévie, the StatePrime Minister’s Office—SSTC (interuniversity attraction poles, grant
no. 44) and the ‘Actions de recherche concertées’ from the
Communauté française de Belgique—Direction de la Recherche
scientifique (concerted actions, grant no. 99/04-239), Belgium. D. M.
is a scientific research worker and J.-P. C. is a research director with
the FNRS.
Abbreviations
KLH
LDV
LPS
p.i.
keyhole limpet hemocyanin
lactate dehydrogenase-elevating virus
lipopolysaccharide
post-infection
References
1 Coutelier, J.-P., Coulie, P. G., Wauters, P., Heremans, H. and van
der Logt, J. T. M. 1990. In vivo polyclonal B-lymphocyte activation
elicited by murine viruses. J. Virol. 64:5383.
2 Anders, E. M., Scalzo, A. A. and White, D. O. 1984. Influenza
viruses are T cell-independent B cell mitogens. J. Virol. 50:960.
3 Ortiz-Ortiz, L., Parks, D. E., Rodriguez, M. and Weigle, W. O.
1980. Polyclonal B lymphocyte activation during Trypanosoma
cruzi infection. J. Immunol. 124:121.
4 Izui, S., Eisenberg, R. A. and Dixon, F. J. 1981. Subclass-restricted
IgG polyclonal antibody production in mice injected with lipid
A-rich lipopolysaccharides. J. Exp. Med. 153:324.
5 Björklund, M. and Coutinho, A. 1983. Isotype commitment in the
in vivo immune responses. II. Polyclonal plaque-forming cell
responses to lipopolysaccharide in the spleen and bone marrow.
Eur. J. Immunol. 13:44.
6 Coutelier, J.-P. and Van Snick, J. 1985. Isotypically restricted
activation of B lymphocytes by lactic dehydrogenase virus. Eur.
J. Immunol. 15:250.
7 Falanga, P. B., D’Imperio Lima, M. R., Coutinho, A. and Pereira
da Silva, L. 1987. Isotypic pattern of the polyclonal B cell response
during primary infection by Plasmodium chabaudi and in immuneprotected mice. Eur. J. Immunol. 17:599.
8 D’Imperio Lima, M. R., Joskowicz, M., Coutinho, A., Kipnis, T. and
Eisen, H. 1985. Very large and isotypically atypical polyclonal
plaque-forming cell responses in mice infected with Trypanosoma
cruzi. Eur. J. Immunol. 15:201.
9 el Bouhdidi, A., Truyens, C., Rivera, M. T., Bazin, H. and Carlier, Y.
1994. Trypanosoma cruzi infection in mice induces a polyisotypic
hypergamaglobulinaemia and parasite-specific response
involving high IgG2a concentrations and highly avid IgG1
antibodies. Parasite Immunol. 16:69.
10 Nguyen, T. D., Bigaignon, G., Van Broeck, J., Vercammen, M.,
Nguyen, T. N., Delmée, M., Turneer, M., Wolf, S. F. and Coutelier,
J.-P. 1998. Acute and chronic phases of Toxoplasma gondii
infection in mice modulate the host immune responses. Infect.
Immun. 66:2991.
11 Coutelier, J.-P., van der Logt, J. T. M., Heessen, F. W. A., Warnier,
G. and Van Snick, J. 1987. IgG2a restriction of murine antibodies
elicited by viral infections. J. Exp. Med. 165:64.
12 Coutelier, J.-P., van der Logt, J. T. M., Heessen, F. W. A., Vink, A.
and Van Snick, J. 1988. Virally induced modulation of murine IgG
antibody subclasses. J. Exp. Med. 168:2373.
13 Lardans, V., Godfraind, C., van der Logt, J. T. M., Heessen, F. W.
A., Gonzalez, M. D. and Coutelier, J.-P. 1996. Polyclonal B
lymphocyte activation induced by mouse hepatitis virus A59
infection. J. Gen. Virol. 77:1005.
14 Karupiah, G., Sacks, T. E., Klinman, D. M., Fredrickson, T. N.,
Hartley, J. W., Chen, J.-H. and Morse, H. C., III. 1998. Murine
cytomegalovirus infection-induced polyclonal B cell activation is
independent of CD4⫹ T cells and CD40. Virology 240:12.
15 Ochsenbein, A. F., Fehr, T., Lutz, C., Suter, M., Brombacher, F.,
Hengartner, H. and Zinkernagel, R. M. 1999. Control of early viral
and bacterial distribution and disease by natural antibodies.
Science 286:2156.
16 Mochizuki, D., Hedrick, S., Watson, J. and Kingsbury, D. T. 1977.
The interaction of herpes simplex virus with murine lymphocytes.
I. Mitogenic properties of herpes simplex virus. J. Exp. Med.
146:1500.
17 Goodman-Snitkoff, G., Mannino, R. J. and McSharry, J. J. 1981.
The glycoprotein isolated from vesicular stomatitis virus is
mitogenic for mouse B lymphocytes. J. Exp. Med. 153:1489.
18 Gibson, M., Tiensiwakul, P. and Khoobyarian, N. 1982. Adenovirus
fiber protein (FP) functions as a mitogen and an adjuvant. Cell.
Immunol. 73:397.
19 Anders, E. M., Scalzo, A. A., Rogers, G. N. and White, D. O.
1986. Relationship between mitogenic activity of influenza viruses
and the receptor-binding specificity of their hemagglutinin
molecules. J. Virol. 60:476.
20 Coutelier, J.-P., Godfraind, C., Dveksler, G. S., Wysocka, M.,
Cardellichio, C. B., Noël, H. and Holmes, K. V. 1994. B lymphocyte
and macrophage expression of carcinoembryonic antigen-related
adhesion molecules that serve as receptors for murine
coronavirus. Eur. J. Immunol. 24:1383.
21 Björklund, M., Forni, L. and Coutinho, A. 1987. T-cell-dependent
modulation of the polyclonal B-lymphocyte responses in normal
spleen cell cultures stimulated by lipopolysaccharide. Ann. Inst.
Pasteur/Immunol. 138:181.
22 Minoprio, P., Eisen, H., Joskowicz, M., Pereira, P. and Coutinho,
A. 1987. Suppression of polyclonal antibody production in
Trypanosoma cruzi-infected mice by treatment with anti-L3T4
antibodies. J. Immunol. 139:545.
23 Spinella, S., Milon, G. and Hontebeyrie-Joskowicz, M. 1990. A
CD4⫹ Th2 cell line isolated from mice chronically infected with
Trypanosoma cruzi induces IgG2 polyclonal responses in vivo.
Eur. J. Immunol. 20:1045.
24 Markine-Goriaynoff, D., van der Logt, J. T. M., Truyens, C.,
Nguyen, T. D., Heessen, F. W. A., Bigaignon, G., Carlier, Y. and
Coutelier, J.-P. 2000. IFN-γ-independent IgG2a production in mice
infected with viruses and parasites. Int. Immunol. 12:223.
25 Vink, A., Coulie, P. G., Wauters, P., Nordan, R. P. and Van Snick,
J. 1988. B cell growth and differentiation activity of interleukinHP1 and related murine plasmacytoma growth factors. Synergy
with interleukin 1. Eur. J. Immunol. 18:607.
26 Beagley, K. W., Eldridge, J. H., Lee, F., Kiyono, H., Everson, M. P.,
Koopman, W. J., Hirano, T., Kishimoto, T. and McGhee, J. R. 1989.
Interleukins and IgA synthesis. Human and murine interleukin 6
induce high rate IgA secretion in IgA-committed B cells. J. Exp.
Med. 169:2133.
27 Kawano, Y., Noma, T. and Yata, J. 1994. Regulation of human
IgG subclass production by cytokines. IFN-γ and IL-6 act
antagonistically in the induction of human IgG1 but additively in
the induction of IgG2. J. Immunol. 153:4948.
28 Nordan, R. P. and Potter, M. 1986. A macrophage-derived factor
required by plasmacytomas for survival and proliferation in vitro.
Science 233:566.
29 Van Snick, J., Vink, A., Cayphas, S. and Uyttenhove, C. 1987.
Interleukin-HP1, a T cell-derived hybridoma growth factor that
supports the in vitro growth of murine plasmacytomas. J. Exp.
Med. 165:641.
30 Vink, A., Coulie, P., Warnier, G., Renauld, J.-C., Stevens, M.,
Donckers, D. and Van Snick, J. 1990. Mouse plasmacytoma
growth in vivo: enhancement by interleukin 6 (IL-6) and inhibition
by antibodies directed against IL-6 or its receptor. J. Exp.
Med. 172:997.
31 Cayphas, S., Van Damme, J., Vink, A., Simpson, R. J., Billiau, A.
and Van Snick, J. 1987. Identification of an interleukin HP1-like
plasmacytoma growth factor produced by L cells in response to
viral infection. J. Immunol. 139:2965.
32 Frei, K., Leist, T. P., Meager, A., Gallo, P., Leppert, D., Zinkernagel,
R. M. and Fontana, A. 1988. Production of B cell stimulatory
factor-2 and interferon γ in the central nervous system during viral
meningitis and encephalitis. Evaluation in a murine model infection
and in patients. J. Exp. Med. 168:449.
1192 Ig regulation by IL-6
33 Ginsberg, H. S., Moldawer, L. L., Sehgal, P. B., Redington, M.,
Kilian, P. L., Chanock, R. M. and Prince, G. A. 1991. A mouse
model for investigating the molecular pathogenesis of adenovirus
pneumonia. Proc. Natl Acad. Sci. USA 88:1651.
34 Ray, A., Tatter, S. B., May, L. T. and Sehgal, P. B. 1988. Activation
of the human ‘β2-interferon/hepatocyte-stimulating factor/
interleukin 6’ promoter by cytokines, viruses, and second
messenger agonists. Proc. Natl Acad. Sci. USA 85:6701.
35 Sehgal, P. B., Helfgott, D. C., Santhanam, U., Tatter, S. B., Clarick,
R. H., Ghrayeb, J. and May, L. T. 1988. Regulation of the
acute phase and immune responses in viral disease. Enhanced
expression of the β2-interferon/hepatocyte-stimulating factor/
interleukin 6 gene in virus-infected human fibroblasts. J. Exp.
Med. 167:1951.
36 Van Damme, J., Schaafsma, M. R., Fibbe, W. E., Falkenburg,
J. H. F., Opdenakker, G. and Billiau, A. 1989. Simultaneous
production of interleukin 6, interferon-β and colony-stimulating
activity by fibroblasts after viral and bacterial infection. Eur. J.
Immunol. 19:163.
37 Hunter, C. A., Abrams, J. S., Beaman, M. H. and Remington, J.
S. 1993. Cytokine mRNA in the central nervous system of SCID
mice infected with Toxoplasma gondii: importance of T-cellindependent regulation of resistance to T. gondii. Infect. Immun.
61:4038.
38 Truyens, C., Angelo-Barrios, A., Torrico, F., Van Damme, J.,
Heremans, H. and Carlier, Y. 1994. Interleukin-6 (IL-6) production
in mice infected with Trypanosoma cruzi: effect of its paradoxical
increase by anti-IL-6 monoclonal antibody treatment on infection
and acute-phase and humoral immune responses. Infect.
Immun. 62:692.
39 Kopf, M., Baumann, H., Freer, G., Freudenberg, M., Lamers, M.,
Kishimoto, T., Zinkernagel, R., Bluethmann, H. and Köhler, G.
1994. Impaired immune and acute-phase responses in interleukin6-deficient mice. Nature 368:339.
40 Dialynas, D. P., Wilde, D. B., Marrack, P., Pierres, A., Wall, K. A.,
Havran, W., Otten, G., Loken, M. R., Pierres, M., Kappler, J.
and Fitch, F. W. 1983. Characterization of the murine antigenic
determinant, designated L3T4a, recognized by monoclonal
antibody GK1.5: expression of L3T4a by functional T cell clones
appears to correlate primarily with class II MHC antigen-reactivity.
Immunol. Rev. 74:29.
41 Coutelier, J.-P., Van Broeck, J. and Wolf, S. F. 1995. Interleukin12 gene expression after viral infection in the mouse. J. Virol. 69:
1995.
42 Van Snick, J., Cayphas, S., Vink, A., Uyttenhove, C., Coulie, P. G.,
Rubira, M. R. and Simpson, R. J. 1986. Purification and NH2terminal amino acid sequence of a T-cell-derived lymphokine with
growth factor activity for B-cell hybridomas. Proc. Natl Acad. Sci.
USA 83:9679.
43 Landegren, U. 1984. Measurement of cell numbers by means
of the endogenous enzyme hexosaminidase. Applications to
detection of lymphokines and cell surface antigens. J. Immunol.
Methods 67:379.
44 El Azami El Idrissi, M., Mazza, G., Monteyne, P., Elson, C. J.,
Day, M. J., Pfau, C. J. and Coutelier, J.-P. 1998. Lymphocytic
choriomeningitis virus-induced alterations of T helpermediated responses in mice developing autoimmune hemolytic
anemia during the course of infection. Proc. Soc. Exp. Biol.
Med. 218:349.
45 Coulie, P. G., Coutelier, J.-P., Uyttenhove, C., Lambotte, P. and
Van Snick, J. 1985. In vivo suppression of T-dependent antibody
responses by treatment with a monoclonal anti-L3T4 antibody.
Eur. J. Immunol. 15:638.
46 Coulie, P. G., Cayphas, S., Vink, A., Uyttenhove, C. and Van Snick,
J. 1987. Interleukin-HP1-related hybridoma and plasmacytoma
growth factors induced by lipopolysaccharide in vivo. Eur. J.
Immunol. 17:1217.
47 Suematsu, S., Matsuda, T., Aozasa, K., Akira, S., Nakano, N.,
Ohno, S., Miyazaki, J.-i., Yamamura, K.-i., Hirano, T. and Kishimoto,
T. 1989. IgG1 plasmacytosis in interleukin 6 transgenic mice.
Proc. Natl. Acad. Sci. USA 86:7547.
48 Iwata, H. and Hayashi, T. 1994. Interleukin-6 production by
macrophages from BALB/c mice with a chronic infection of lactic
dehydrogenase virus. Jikken Dobutsu 43:559.
49 Raj, N. B. K., Cheung, S. C., Rosztoczy, I. and Pitha, P. M. 1992.
Mouse genotype affects inducible expression of cytokine genes.
J. Immunol. 148:1934.
50 Becker, S., Quay, J. and Soukup, J. 1991. Cytokine (tumor
necrosis factor, IL-6, and IL-8) production by respiratory syncytial
virus-infected human alveolar macrophages. J. Immunol.
147:4307.
51 Henke, A., Mohr, C., Sprenger, H., Graebner, C., Stelzner, A., Nain,
M. and Gemsa, D. 1992. Coxsackievirus B3-induced production of
tumor necrosis factor-α, IL-1β, and IL-6 in human monocytes. J.
Immunol. 148:2270.
52 van Ommen, R., Vredendaal, A. E. C. M. and Savelkoul, H. F. J.
1994. Suppression of polyclonal and antigen-specific murine
IgG1 but not IgE responses by neutralizing interleukin-6 in vivo.
Eur. J. Immunol. 24:1396.
53 Mihara, M., Takagi, N., Takeda, Y. and Ohsugi, Y. 1998. IL-6
receptor blockage inhibits the onset of autoimmune kidney
disease in NZB/W F1 mice. Clin. Exp. Immunol. 112:397.
54 Ramsay, A. J., Husband, A. J., Ramshaw, I. A., Bao, S., Matthaei,
K. I., Koehler, G. and Kopf, M. 1994. The role of interleukin-6 in
mucosal IgA antibody responses in vivo. Science 264:561.
55 Mendel, I., Katz, A., Kozak, N., Ben-Nun, A. and Revel, M. 1998.
Interleukin-6 functions in autoimmune encephalomyelitis: a study
in gene-targeted mice. Eur. J. Immunol. 28:1727.
56 Kopf, M., Herren, S., Wiles, M. V., Pepys, M. B. and Kosco-Vilbois,
M. H. 1998. Interleukin 6 influences germinal center development
and antibody production via a contribution of C3 complement
component. J. Exp. Med. 188:1895.
57 La Flamme, A. C. and Pearce, E. J. 1999. The absence of IL-6
does not affect Th2 cell development in vivo, but does lead
to impaired proliferation, IL-2 receptor expression, and B cell
responses. J. Immunol. 162:5829.
58 Blum, A. M., Metwali, A., Elliott, D., Li, J., Sandor, M. and
Weinstock, J. V. 1998. IL-6-deficient mice form granulomas in
murine schistosomiasis that exhibit an altered B cell response.
Cell. Immunol. 188:64.
59 Sangster, M. Y., Topham, D. J., D’Costa, S., Cardin, R. D., Marion,
T. N., Myers, L. K. and Doherty, P. C. 2000. Analysis of the virusspecific and nonspecific B cell response to a persistent Blymphotropic gammaherpesvirus. J. Immunol. 164:1820.
60 Brewer, J. M., Conacher, M., Gaffney, M., Douglas, M.,
Bluethmann, H. and Alexander, J. 1998. Neither interleukin-6 nor
signalling via tumour necrosis factor receptor-1 contribute to the
adjuvant activity of alum and Freund’s adjuvant. Immunology
93:41.
61 Jebbari, H., Roberts, C. W., Ferguson, D. J. P., Bluethmann, H.
and Alexander, J. 1998. A protective role for IL-6 during early
infection with Toxoplasma gondii. Parasite Immunol. 20:231.
62 Rincon, M., Anguita, J., Nakamura, T., Fikrig, E. and Flavell, R. A.
1997. Interleukin (IL)-6 directs the differentiation of IL-4-producing
CD4⫹ T cells. J. Exp. Med. 185:461.
63 Plagemann, P. G. W., Rowland, R. R. R., Even, C. and Faaberg,
K. S. 1995. Lactate dehydrogenase-elevating virus: an ideal
persistent virus? Springer Semin. Immunopathol. 17:167.
64 Manz, R. A., Thiel, A. and Radbruch, A. 1997. Lifetime of plasma
cells in the bone marrow. Nature 388:133.
65 McHeyzer-Williams, M. G. and Ahmed, R. 1999. B cell memory
and the long-lived plasma cell. Curr. Opin. Immunol. 11:172.
66 Ramshaw, I. A., Ramsay, A. J., Karupiah, G., Rolph, M. S.,
Mahalingam, S. and Ruby, J. C. 1997. Cytokines and immunity
to viral infections. Immunol. Rev. 159:119.