Essential Role of Apelin Signaling During Lymphatic
Development in Zebrafish
Jun-Dae Kim, Yujung Kang, Jongmin Kim, Irinna Papangeli, Hyeseon Kang, Jingxia Wu,
Hyekyung Park, Emily Nadelmann, Stanley G. Rockson, Hyung J. Chun, Suk-Won Jin
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Objective—Apelin and its cognate receptor Aplnr/Apj are essential for diverse biological processes. However, the function
of Apelin signaling in lymphatic development remains to be identified, despite the preferential expression of Apelin and
Aplnr within developing blood and lymphatic endothelial cells in vertebrates. In this report, we aim to delineate the
functions of Apelin signaling during lymphatic development.
Approach and Results—We investigated the functions of Apelin signaling during lymphatic development using zebrafish
embryos and found that attenuation of Apelin signaling substantially decreased the formation of the parachordal vessel and
the number of lymphatic endothelial cells within the developing thoracic duct, indicating an essential role of Apelin signaling
during the early phase of lymphatic development. Mechanistically, we found that abrogation of Apelin signaling selectively
attenuates lymphatic endothelial serine–threonine kinase Akt 1/2 phosphorylation without affecting the phosphorylation
status of extracellular signal–regulated kinase 1/2. Moreover, lymphatic abnormalities caused by the reduction of Apelin
signaling were significantly exacerbated by the concomitant partial inhibition of serine–threonine kinase Akt/protein kinase
B signaling. Apelin and vascular endothelial growth factor-C (VEGF-C) signaling provide a nonredundant activation of
serine–threonine kinase Akt/protein kinase B during lymphatic development because overexpression of VEGF-C or apelin
was unable to rescue the lymphatic defects caused by the lack of Apelin or VEGF-C, respectively.
Conclusions—Taken together, our data present compelling evidence suggesting that Apelin signaling regulates lymphatic
development by promoting serine–threonine kinase Akt/protein kinase B activity in a VEGF-C/VEGF receptor
3–independent manner during zebrafish embryogenesis. (Arterioscler Thromb Vasc Biol. 2014;34:338-345.)
Key Words: apelin protein ◼ APJ receptor ◼ lymphatic vessels ◼ zebrafish
L
ymphatic vessels have essential roles in maintaining the
homeostasis of interstitial body fluid and facilitating
immune responses in vertebrates.1–3 In addition, lymphatic
vessels have been associated with progression of diverse diseases in humans, including tumor metastasis and obesity.4,5
Malformation or obstruction of lymphatic vessels cause an
accumulation of interstitial fluid resulting in the swelling of
extremities, pathological conditions collectively categorized
as lymphedema, which affect >140 million people worldwide.6–9 During development, lymphatic endothelial cells
(LECs), the main component of lymphatic vessels, first appear
around E10 in mice, embryonic week 6 to 7 in humans, and
3 days postfertilization (dpf) in zebrafish.10–13 Lineage tracing
and in vivo time lapse analyses in mouse and zebrafish support the model proposed by Florence Sabin that the LECs may
originate from ECs in the cardinal vein.12,14,15
Apelin and its receptor Aplnr/Apj regulate a wide range
of developmental and physiological processes.16–19 Although
Apelin is widely expressed during development, the expression of Aplnr/Apj is more restricted.16 In mouse, Apj is
strongly expressed within the cardiovascular system as early
as E8.0.20 Similarly, aplnra and b are specifically expressed
in developing ECs and cardiomyocytes in zebrafish.17,19
Consistent with the expression pattern, Apj knockout mice
display various cardiovascular defects and are embryonic
lethal in certain genetic background.20–22 Zebrafish have 2
Apelin receptors, aplnra and aplnrb.17,19 Although aplnra and
b are broadly expressed in areas including heart primordial
cells and lateral plate mesoderm during early development,
their expression gradually become restricted to blood vessel
in late development.19,23 After 24 hours postfertilization, only
venous ECs in the trunk region express detectable levels of
aplnra,23 suggesting that Apelin signaling may be essential
for blood ECs (BECs) and LECs. Mutations in aplnrb cause
similar developmental defects in zebrafish.17,19 Despite its
See accompanying editorial on page 239
Received on: July 16, 2013; final version accepted on: November 8, 2013.
From the Yale Cardiovascular Research Center, Section of Cardiovascular Medicine, Department of Internal Medicine, Yale University School of
Medicine, New Haven, CT (J.-D.K., Y.K., I.P., H.K., J.W., H.P., E.N., H.J.C., S.-W.J.); Department of Life Systems, Sookmyung Women’s University,
Seoul, Korea (J.K.); and Department of Medicine, Stanford University, School of Medicine, CA (S.G.R.).
The online-only Data Supplement is available with this article at http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.113.302785/-/DC1.
Correspondence to Hyung J. Chun, MD, Yale Cardiovascular Research Center, Section of Cardiovascular Medicine, Department of Internal Medicine, Yale
University School of Medicine, New Haven, CT 06511. E-mail [email protected] or Suk-Won Jin, PhD, Yale Cardiovascular Research Center, Section
of Cardiovascular Medicine, Department of Internal Medicine, Yale University School of Medicine, New Haven, CT 06511. E-mail [email protected]
© 2013 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
338
DOI: 10.1161/ATVBAHA.113.302785
Kim et al Apelin Function in Lymphatic Development 339
Nonstandard Abbreviations and Acronyms
AKT
BEC
dpf
ERK1/2
hLEC
ISV
LEC
siRNA
VEGF-C
serine–threonine kinase Akt/protein kinase B
blood endothelial cell
days postfertilization
extracellular signal–regulated kinase 1/2
human lymphatic endothelial cell
intersegmental vessel
lymphatic endothelial cell
small interfering RNA
vascular endothelial growth factor-C
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
proposed role in cardiovascular development, current analyses on Apelin signaling predominantly aim to address its role
in vascular physiology,16,24–26 and consequently, the function
of Apelin signaling in the development of lymphatic vessels
remains largely unknown.
In this report, we examined the function of Apelin signaling
in developing LECs and found that Apelin signaling provides
a nonredundant function to induce serine–threonine kinase
Akt/protein kinase B (AKT) activation, therefore serving as
an essential signaling input to promote lymphatic development. Abrogation of Apelin signaling caused severe defects
of the lymphatic structure in zebrafish embryos by substantially decreasing the phosphorylation of AKT1/2, independent
of vascular endothelial growth factor-C (VEGF-C) signaling.
Our data presented here support the idea that Apelin signaling
is essential for proper lymphatic development.
mCherry+ BECs (appearing as yellow in the merged figures)
and nEGFP+/mCherry− LECs. Although the developing thoracic duct, located between the dorsal aorta and the cardinal
vein, was clearly visible in 4 dpf control morpholino–injected
embryos, similar structures were absent in aplnra morpholino–injected embryos (Figure 1B). In addition, the number of nEGFP+/mCherry− LECs within the thoracic duct in
aplnra morpholino–injected embryos was greatly decreased
(Figure 1C), suggesting that LECs are more sensitive to attenuated level of Apelin/Aplnr signaling activity. Similarly, the
number of VEGFR3+ LECs in the diaphragm of Apj−/− mice
was significantly reduced (Figure IE and IF in the online-only
Data Supplement), suggesting that the role of Apelin/Aplnr
signaling on lymphatic development may be conserved within
vertebrate species.
We next determined whether the attenuation of the cognate
ligand of Aplnr, Apelin, would cause comparable defects in
lymphatic development. To ensure that the lymphatic defects
found in apln morpholino–injected embryos are not secondary
to the previously reported cardiac defects,17,19 the amount of
morpholino was titrated. Injection of 2.7 or 5.4 ng per embryo
effectively blocked the normal splicing of apln transcript
(Figure IIA in the online-only Data Supplement) without
causing obvious morphological defects in axis formation, rate
of heartbeat, or blood vessel formation (Figure IIB and IIC in
the online-only Data Supplement). In contrast, the formation
of parachordal vessels (arrows), which give rise to the presumptive LECs, was severely affected by partial knockdown
Materials and Methods
Materials and Methods are available in the online-only Supplement.
Results
Apelin Signaling Modulates the Proper Lymphatic
Vessel Formation During Zebrafish Development
To delineate the roles of Apelin signaling in vascular development of zebrafish, we first attenuated the level of Aplnra
by morpholino-mediated knockdown of aplnra (Figure IA–ID
in the online-only Data Supplement). Because proper circulation is essential for lymphatic development, a suboptimal dose
of aplnra morpholino was injected (1.8 ng/embryo) to avoid
the early cardiac abnormalities that have been previously
reported17,19 and assess the role of Apelin signaling specifically in lymphatic development (Figure ID in the online-only
Data Supplement). The general morphology and the rate of
heartbeat at 4 dpf in embryos injected with 1.8 ng of aplnra
morpholino were comparable with those of control morpholino–injected embryos (Figure 1A and Figure IB and IC in
the online-only Data Supplement). In addition, patterning of
intersegmental vessels (ISVs), the dorsal aorta, and the cardinal vein was not affected in 4 dpf embryos injected with 1.8
ng of aplnra morpholino (Figure 1A).
Although the vasculature was unaffected in aplnra morpholino–injected embryos, these embryos did contain profound defects in lymphatic vessels (Figure 1B and 1C). To
visualize developing LECs, we used Tg(fli1a:nEGFP);Tg(kd
rl:mCherry) double transgenic lines, which contain nEGFP+/
Figure 1. Lack of aplnra activity causes lymphatic vessel defects.
A, Gross morphology (top) and vascular structures (bottom) in
4 days postfertilization (dpf) aplnra morpholino (MO)–injected
embryos. B, The loss of lymphatic endothelial cells (LECs) in thoracic duct (white arrows) in 4 dpf aplnra MO–injected embryos.
C, Quantification of the number of LECs in control and aplnra
MO–injected embryos. LECs within the thoracic duct between 8th
and 15th somites were counted. All embryos shown have Tg(fli1a:
nEGFP);Tg(kdrl:mCherry) double transgenic background to visualize blood ECs (shown as yellow) and LECs (shown as green). CV
indicates cardinal vein; DA, dorsal aorta; and ISV, intersegmental
vessel. Scale bars, 400 μm (A) and 50 μm (B). **P<0.01.
340 Arterioscler Thromb Vasc Biol February 2014
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 2. Apelin is required for zebrafish lymphatic vessel formation. A, The loss of parachordal vessel (PaCV; white arrows) in 3 days
postfertilization (dpf) apln morpholino (MO)–injected embryos in Tg(fli1a:nEGFP) transgenic background. B, Quantification of the formation
of PaCV at 3 dpf. C, Representative images of 4 dpf apln MO–injected embryos in the trunk region. White arrows point to lymphatic endothelial cells (LECs) within the thoracic duct. The deficit in the number of LECs progressively worsened as the dose of apln MO increases.
D, Quantification of the number of LECs in control and apln MO–injected embryos at 4 dpf. LECs located between 8th and 15th somites
were counted. Each dot represents an individual set of experiments. Total number of embryos are as follows: control MO=96; apln MO
0.9 ng=26; 1.8 ng=30; 2.7 ng=37; 3.6 ng=19; and 5.4 ng=29. E, The loss of venous intersegmental vessels (vISVs; red arrows) in 4 dpf
embryos injected with a high dose of apln MO. F, Quantification of the number of vISVs in control and apln MO–injected embryos. Each
dot represents an individual set of experiments. Total number of embryos are as follows: control MO=103; apln MO 0.9 ng=26; 1.8 ng=30;
2.7 ng=48; 3.6 ng=19; and 5.4 ng=27. G, Overexpression of synthetic apln mRNA can rescue lymphatic defects in apln MO–injected
embryos. White arrows point to LECs in embryos coinjected with synthetic apln mRNA and apln MO. H, Quantification of the number of
LECs at 4 dpf in embryos injected with apln MO alone and in embryos coinjected with apln MO and synthetic apln mRNA. CV indicates
cardinal vein; DA, dorsal aorta; and N.S., not significant. Scale bars, 50 μm. *P<0.05; **P<0.01; ***P<0.001.
of apln (Figure 2A and 2B). At 3 dpf, embryos injected with
2.7 ng of apln morpholino completely lacked parachordal
vessel. Consistent with the defects in parachordal vessels, we
found that the number of LECs in 4 dpf apln morpholino–
injected embryos was decreased in a dose-dependent manner
(Figure 2C and 2D). Consistent with these findings, microlymphangiography demonstrated that embryos with a reduced
level of Apelin signaling do not develop proper lymphatic
vessels (Figure III in the online-only Data Supplement).
Because LECs emerge from venous ISVs,12 it is possible
that a decrease in Apelin signaling activity may limit the
number of forming venous ISVs and indirectly influence the
number of LECs. To evaluate this possibility, we examined
the effects of Apelin signaling on the formation of venous
ISVs by counting the number of ISVs that were directly connected to the cardinal vein (venous ISV connections) at 4 dpf.
Although the number of LECs was substantially decreased
by injecting a low concentration of apln morpholino (0.9 and
1.8 ng/embryo), the number of venous ISV connections was
largely unaffected (Figure 2E and 2F), suggesting that Apelin
signaling is likely to directly regulate lymphatic development
in zebrafish embryos.
To further confirm that the lymphatic defects in apln morpholino–injected embryos are directly caused by the attenuation
of Apelin signaling, we attempted a phenotypic rescue of apln
morpholino–injected embryos by injecting synthetic apln mRNA.
Because apln mRNA injection can cause cardiac defects,17 the
amount of mRNA was titrated. Although a high dose of apln
mRNA caused severe cardiac defects, injection of 8 pg apln mRNA
per embryo did not cause any phenotypic defects (Figure IVA and
IVB in the online-only Data Supplement). When coinjected, 8 pg
apln mRNA successfully restored the number of LECs in apln
morpholino–injected embryos (Figure 2G and 2H), suggesting
that the reduction in the number of LECs in apln morpholino–
injected embryos was not a secondary effect of general developmental delays caused by morpholino injection. Taken together,
our data suggest that proper activity of Apelin/Aplnra signaling is
essential for lymphatic development in zebrafish embryos.
Apelin Signaling Modulates AKT Activity
in Human and Zebrafish LECs
It has been reported that Apelin promotes the migration of
BECs and LECs in cell culture.25 Consistent with the previous report, knockdown of APLNR in human LECs (hLECs)
Kim et al Apelin Function in Lymphatic Development 341
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
adversely affected the migration of hLECs. In a scratch wound
assay, APLNR small interfering RNA (siRNA)–treated hLECs
displayed a significantly attenuated migratory behavior compared with control siRNA–treated hLECs (Figure 3A and 3B).
The migration defect of APLNR siRNA–treated hLECs was
likely caused by a reduced level of Apelin signaling because
addition of exogenous Apelin 13 was not able to alleviate the migration defects in APLNR siRNA–treated hLECs
(Figure 3A and 3B).
To identify the downstream effectors of Apelin signaling
in LECs, we examined the level of phospho-AKT1/2 and
phospho–extracellular signal–regulated kinase 1/2 (ERK1/2)
in APLNR siRNA–treated hLECs (Figure 3C). Because
it has been reported that ERK1/2 and AKT, which function as downstream effectors for several G protein–coupled
receptors including APLNR,16,27,28 are essential for modulating the development of lymphatic vessels,1,3 it is tempting to speculate that ERK1/2 and AKT may be involved in
downstream of Apelin signaling during lymphatic development. Although the level of phospho-ERK1/2 did not change
in APLNR siRNA–treated hLECs compared with control
siRNA–treated cells, the level of phospho-AKT1/2 was significantly decreased on APLNR depravation (Figure 3C–3E).
Moreover, stimulation with Apelin ligand in hLECs led to
an increased level of phospho-AKT1/2 in a dose-dependent
manner (Figure V in the online-only Data Supplement).
Similarly, attenuation of Apelin signaling by morpholino
injection drastically reduced the level of phospho-AKT1/2 in
developing zebrafish. Although phospho-AKT1/2 is strongly
detected within ECs in the dorsal aorta and cardinal vein
of 48-hour postfertilization control morpholino–injected
embryos, it is largely absent in apln morpholino–injected
embryos (Figure 3F). Therefore, it seems that Apelin signaling may function as a major stimulus for AKT1/2 phosphorylation in both cell culture and in vivo. Previously, Aplnrs have
been reported to function independent of Apelin ligand.18
Therefore, we also examined the level of phospho-AKT1/2
in apln morpholino–injected embryos and found that phospho-AKT1/2 was substantially reduced in these embryos,
Figure 3. Apelin signaling is essential for human lymphatic endothelial cell (hLEC) migration and maintenance of phospho–serine–
threonine kinase Akt 1/2 (p-AKT1/2). A, Representative images of scratch wound healing assay using hLEC. Black lines demarcate the
boundaries of scratch wounds. The recovery of the wound was substantially attenuated in APLNR small interfering RNA (siRNA)–treated
hLECs compared with control siRNA–treated hLECs. B, Quantification of the migration of hLECs. C, Lack of Apelin signaling selectively
attenuated the level of p-AKT1/2 in hLECs grown in complete growth medium 3 days after siRNA treatment. Experiments were performed as triplicates. D, Quantification of the relative levels of p-AKT1/2 and total AKT (tAKT) in control or APLNR siRNA–treated hLECs.
E, Quantification of the levels of phospho–extracellular signal–regulated kinase 1/2 (p-ERK1/2) and total ERK1/2 (t-ERK1/2) in control or
APLNR siRNA–treated hLECs. F, Confocal image showing a transverse section of 48 hours postfertilization control morpholino (MO; top),
apln MO (middle), or aplnra MO (bottom) injected Tg(fli1a:nGFP) embryos. Developing ECs within dorsal aorta (DA) and cardinal vein (CV)
contain a high level of p-AKT1/2 (arrowheads). Lack of Apelin signaling selectively abrogated the presence of p-AKT1/2 in ECs without
affecting the p-AKT1/2 in nearby blood cells (arrowhead). Scale bar, 10 μm. N.S. indicates not significant. ***P<0.001.
342 Arterioscler Thromb Vasc Biol February 2014
suggesting that phosphorylation of AKT1/2 is dependent on
Apelin/Aplnr signaling (Figure 3F).
Apelin and AKT Activity Functionally Cooperate
for Zebrafish Lymphatic Vessel Formation
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
To further substantiate the link between AKT activity and
Apelin signaling in LECs, we manipulated the level of AKT
activity in zebrafish embryos and examined the effects on
developing LECs. Because manipulation of AKT activity
at earlier developmental stages may compromise the specification of arterial and venous ECs,29–31 we used previously
reported chemical antagonists of AKT to induce temporal
AKT inhibition. Treatment with either 10 μmol/L LY294002
(phosphoinositide 3-kinase inhibitor)32 or 2 μmol/L Torin1
(mammalian target of rapamycin complex 1 and 2 inhibitor),33 both of which inhibit AKT phosphorylation, drastically reduced the number of LECs in 4 dpf zebrafish embryos
(Figure 4A–4D). Moreover, the lymphatic defects caused by a
partial reduction of Apelin signaling activity were significantly
exacerbated by administering a suboptimal dose of the aforementioned chemical antagonists of AKT (Figure 4E–4G).
Although embryos injected with 0.9 ng of apln morpholino
or treated with 5 μmol/L of LY294002 contained an average
of 5.6±0.65 and 6.2±0.79 LECs, respectively, embryos that
were injected with 0.9 ng of apln morpholino and treated
with 5 μmol/L of LY294002 had significantly fewer LECs
(3.8±1.11), representing a further ≈40% reduction the in number of LECs compared with single manipulations (Figure 4E
and 4F). Similar effects were also observed in embryos that
were injected with 0.9 ng of apln morpholino and treated with
1 μmol/L of Torin1 (≈40% reduction; Figure 4E and 4G).
Apelin and VEGF-C Signal Independently
in Zebrafish Lymphatic Development
Previously, it has been reported that AKT activity within
ECs can be induced by VEGF-C signaling,34–36 which is the
key stimulus for lymphatic development.37,38 We next tested
whether Apelin and VEGF-C signaling converge at the level
of AKT or function redundantly to promote differentiation
and maintenance of LECs. Attenuation of Apelin signaling
did not influence the expression of VEGF-C signaling components, including expression of vegfc or its receptor flt4 (Figure
VIA in the online-only Data Supplement). Similarly, inhibition of VEGF-C signaling activity did not affect the expression of apln, aplnra, or aplnrb (Figure VIB in the online-only
Data Supplement). However, coinjection of apln and vegfc
morpholino with suboptimal doses exacerbated the lymphatic
phenotypes (Figure 5A and 5B), indicating that Apelin and
VEGF-C signaling may synergistically promote lymphatic
development. We next examined whether Apelin signaling is
Figure 4. Apelin and serine–threonine kinase Akt/protein kinase B (AKT) cooperate to promote lymphatic development in zebrafish. A, The
number of lymphatic endothelial cells (LECs; white arrows) was substantially decreased in embryos treated with a chemical inhibitor of
phosphoinositide 3-kinase (LY294002) between 48 hours postfertilization (hpf) and 4 days postfertilization (dpf), therefore, with an attenuated level of AKT activity. B, Quantification of the number of LECs in 4 dpf dimethyl sulfoxide (DMSO)– or 10 μmol/L ­LY294002-treated
embryos. C, The number of LECs (white arrows) in embryos treated with Torin1 between 48 hpf and 4 dpf, a chemical antagonist against
another upstream regulator of AKT, mammalian target of rapamycin complex 1 and 2, was significantly decreased. D, Quantification of the
number of LECs in 4 dpf DMSO- or 2 μmol/L Torin1-treated embryos. E, Apelin and AKT may function within the same pathway. Treating
embryos injected with a low dose of apln morpholino (MO) with a suboptimal dose of LY294002 (5 μmol/L) or Torin1 (1 μmol/L) exacerbated the effects of apln MO on the number of LECs (arrows). F, Quantification of the number of LECs in control or apln MO–injected
embryos treated with either DMSO or LY294002. G, Quantification of the number of LECs in control or apln MO–injected embryos treated
with either DMSO or Torin1. CV indicates cardinal vein; and DA, dorsal aorta. Scale bars, 50 μm. *P<0.05; **P<0.01; ***P<0.001.
Kim et al Apelin Function in Lymphatic Development 343
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 5. Apelin and vascular endothelial growth factor-C (Vegfc) signaling are not redundant but functionally synergize to facilitate lymphatic development in zebrafish. A, Apelin and Vegfc signaling may synergistically promote lymphatic development. Four days postfertilization (dpf) embryos coinjected with low doses of apln and vegfc morpholinos (MOs) contained a substantially decreased number of
lymphatic endothelial cells (LECs; arrows) compared with control or single MO–injected embryos. B, Quantification of the number of LECs.
C, Apelin signaling may have a nonredundant role with Vegfc signaling during LEC development. Overexpression of Apelin by mRNA injection did not alleviate lymphatic defects in 4 dpf vegfc MO–injected embryos. D, Quantification of the number of LECs. E, Representative
images for the lymphatic vessel phenotype in 4 dpf Tg(fli1a:nEGFP);Tg(kdrl:mCherry) embryos injected with apln and vegfc MOs and vegfc
mRNA. vegfc mRNA injection at 1 to 2 cell stage only rescues the defects caused by Vegfc knockdown, but not Apln knockdown. F, Quantification of LECs. CV indicates cardinal vein; DA, dorsal aorta; and N.S., not significant. Scale bars, 50 μm. *P<0.05; **P<0.01; ***P<0.001.
sufficient to compensate for the loss of VEGF-C signaling.
Ectopic activation of Apelin signaling by synthetic mRNA
injection was unable to alleviate the lymphatic defects in
vegfc morpholino–injected embryos (Figure 5C and 5D). In
a similar manner, ectopic expression of Vegfc by synthetic
mRNA injection was unable to restore the lymphatic abnormalities caused by reduced Apelin signaling (Figure 5E and
5F). The inability of apln mRNA to alleviate the defects of
vegfc morpholino–injected embryos and vegfc mRNA to apln
morpholino–injected embryos collectively suggest that Apelin
and Vegfc signaling may function in a nonredundant manner
in lymphatic development.
Considering that both Apelin and Vegfc signaling can activate AKT to induce lymphatic development, but seem to have
nonredundant functions, it is possible that Vegfc and Apelin
signaling may have distinct functions; although Vegfc may
potentiate presumptive LECs within venous vascular beds,
Apelin signaling may successively promote differentiation of
LECs in later developmental stages. Alternatively, it is possible
that Apelin and Vegfc signaling may induce AKT activity in
a temporally distinct manner. To examine this possibility, we
analyzed the expression of apln, aplnra, vegfc, and vegfr3
within the first 5 days of development in zebrafish embryos
(Figure 6A). Although the expression level of vegfc gradually
increased and then stabilized, the expression level of vegfr3
precipitously dropped by 2 dpf, indicating that the activity of
Vegfc-Vegfr3 signaling may reduce to the basal level when
LECs emerge from venous ISVs (Figure 6A). In contrast, the
expression of apln and aplnra continuously increased during
the first 5 days of development (Figure 6A and Figure VIC
in the online-only Data Supplement), suggesting functions of
Apelin signaling may be required later in development than
Vegfc signaling.
Discussion
Considering the expression pattern of Apelin signaling components during development, and their role during lymphatic
regeneration,16,25,26 it is likely that Apelin signaling provides
344 Arterioscler Thromb Vasc Biol February 2014
Figure 6. Apelin and vascular endothelial
growth factor-C (Vegfc) signaling is temporally separated for lymphatic vessel formation in zebrafish. A, Expression profiles of
apln, aplnra, vegfc, and vegfr3 during the
first 5 days of zebrafish development, normalized to actb1. The expression of apln
and aplnra gradually increased over time,
whereas the expression of vegfc and vegfr3
is either constant or attenuated. B, Schematic working model. Apelin and Vegfc
signaling seem to have nonoverlapping
functions during lymphatic development.
Although functionally redundant in activating
serine–threonine kinase Akt/protein kinase
B (AKT), Apelin and Vegfc signaling may be
temporally separated and seem to activate
specific sets of downstream effectors. dpf
indicates days postfertilization; and ERK1/2,
extracellular signal–regulated kinase 1/2.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
key regulation during lymphatic development. In this report,
we have demonstrated that Apelin signaling–induced AKT
activity is essential for differentiation of LECs during development. AKT activity has been implicated in both developmental and pathological lymphangiogenesis.34,37,38 For instance,
targeted deletion of Akt1, Akt2, or Akt3 in mouse caused a
significant reduction in the number of developing LECs and
led to defects in lymphatic valve formation.37,39 In addition,
Kaposi’s sarcoma associated herpesvirus activates AKT to
induce ectopic lymphatic structures.40,41 Although AKT can
be activated by diverse signaling inputs,42,43 attenuating Apelin
signaling substantially decreased the phosphorylation of
AKT in LECs, both in cell culture and developing zebrafish
embryos. Therefore, it seems that Apelin signaling may function as a main inducer of AKT activity within LECs. Moreover,
our data suggest that Apelin signaling may coordinate with
VEGF-C signaling, an essential prolymphangiogenic signaling pathway,34,36,39 to maintain the proper level of AKT activity in LECs. During development, components of Apelin and
Vegfc signaling seem to be expressed at distinct stages, suggesting that these 2 prolymphangiogenic signaling pathways
may activate the same downstream effectors, but their activity
may be temporally separated during development (Figure 6B).
Although Apelin signaling is required for AKT activation in
LECs and the disruption of the Apelin-AKT signaling cascade
drastically reduced the number of LECs in zebrafish, ectopic
AKT activation by chemical agonists (data not shown), and
ectopic expression on Vegfc (Figure 5E) were not sufficient to
restore the number of LECs in zebrafish embryos with compromised Apelin signaling. Therefore, it is likely that the prolymphangiogenic role of Apelin signaling may be transduced
by additional effectors. ERK1/2, which are known to be activated by Vegfc signaling in LECs,35,36 do not seem to mediate
Apelin signaling in LECs because lack of Apelin signaling
did not affect the phosphorylation status of ERK1/2 in hLECs
(Figure 3C). Ongoing work in the laboratory is examining
the role of other serine–threonine kinases, including ERK5,
Raf, and protein kinase A, as potential downstream mediators of Apelin signaling in LECs. Convergence of Apelin and
VEGF-C at AKT, as well as divergent signaling pathways
activated by these distinct signaling cascades, likely provide
the necessary cues that ensure proper lymphatic development.
Acknowledgments
We thank Drs Victoria Bautch, Anne Eichmann, and Mike Simons
for their discussion and critical reading of the manuscript, Drs Elke
A. Ober and Ian C. Scott for providing transgenic lines, members of
Jin and Chun laboratories for helpful discussion, Jose Cardona-Costa
for excellent fish care, and Tyler Ross for image analyses. We also
thank the Korea Zebrafish Organogenesis Mutant Bank (ZOMB) for
providing zebrafish lines.
Sources of Funding
This work has been supported by grants from the National Institutes
of Health to S.-W. Jin (HL090960 and HL119345) and to H.J. Chun
(HL095654 and HL113005) and an American Heart Association
postdoctoral fellowship to J.-D. Kim (11POST7440010).
Disclosures
None.
References
1. Tammela T, Alitalo K. Lymphangiogenesis: molecular mechanisms and
future promise. Cell. 2010;140:460–476.
2.Alitalo K. The lymphatic vasculature in disease. Nat Med.
2011;17:1371–1380.
3. Schulte-Merker S, Sabine A, Petrova TV. Lymphatic vascular morphogenesis in development, physiology, and disease. J Cell Biol. 2011;193:607–618.
4. Achen MG, McColl BK, Stacker SA. Focus on lymphangiogenesis in
tumor metastasis. Cancer Cell. 2005;7:121–127.
5.Joyce JA, Pollard JW. Microenvironmental regulation of metastasis.
Nat Rev Cancer. 2009;9:239–252.
6. Murdaca G, Cagnati P, Gulli R, Spanò F, Puppo F, Campisi C, Boccardo F.
Current views on diagnostic approach and treatment of lymphedema. Am J
Med. 2012;125:134–140.
7. Witte MH, Dellinger MT, Papendieck CM, Boccardo F. Overlapping biomarkers, pathways, processes and syndromes in lymphatic development,
growth and neoplasia. Clin Exp Metastasis. 2012;29:707–727.
8. Rockson SG, Rivera KK. Estimating the population burden of lymphedema. Ann N Y Acad Sci. 2008;1131:147–154.
9.Brorson H, Ohlin K, Olsson G, Svensson B, Svensson H. Controlled
compression and liposuction treatment for lower extremity lymphedema.
Lymphology. 2008;41:52–63.
10. Wigle JT, Oliver G. Prox1 function is required for the development of the
murine lymphatic system. Cell. 1999;98:769–778.
11.van der Putte SC. The development of the lymphatic system in man.
Adv Anat Embryol Cell Biol. 1975;51:3–60.
12. Yaniv K, Isogai S, Castranova D, Dye L, Hitomi J, Weinstein BM. Live imaging of lymphatic development in the zebrafish. Nat Med. 2006;12:711–716.
13.Küchler AM, Gjini E, Peterson-Maduro J, Cancilla B, Wolburg H,
Schulte-Merker S. Development of the zebrafish lymphatic system
­
requires VEGFC signaling. Curr Biol. 2006;16:1244–1248.
Kim et al Apelin Function in Lymphatic Development 345
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
14. Francois M, Harvey NL, Hogan BM. The transcriptional control of lymphatic vascular development. Physiology (Bethesda). 2011;26:146–155.
15.Ny A, Koch M, Schneider M, et al. A genetic Xenopus laevis tadpole
model to study lymphangiogenesis. Nat Med. 2005;11:998–1004.
16. Kidoya H, Takakura N. Biology of the apelin-APJ axis in vascular formation. J Biochem. 2012;152:125–131.
17. Zeng XX, Wilm TP, Sepich DS, Solnica-Krezel L. Apelin and its receptor control heart field formation during zebrafish gastrulation. Dev Cell.
2007;12:391–402.
18. Scimia MC, Hurtado C, Ray S, et al. APJ acts as a dual receptor in cardiac
hypertrophy. Nature. 2012;488:394–398.
19. Scott IC, Masri B, D’Amico LA, Jin SW, Jungblut B, Wehman AM, Baier
H, Audigier Y, Stainier DY. The g protein-coupled receptor agtrl1b regulates
early development of myocardial progenitors. Dev Cell. 2007;12:403–413.
20. Sheikh AY, Chun HJ, Glassford AJ, et al. In vivo genetic profiling and cellular localization of apelin reveals a hypoxia-sensitive, ­endothelial-centered
pathway activated in ischemic heart failure. Am J Physiol Heart Circ
Physiol. 2008;294:H88–H98.
21.Charo DN, Ho M, Fajardo G, Kawana M, Kundu RK, Sheikh AY,
Finsterbach TP, Leeper NJ, Ernst KV, Chen MM, Ho YD, Chun HJ,
Bernstein D, Ashley EA, Quertermous T. Endogenous regulation of cardiovascular function by apelin-APJ. Am J Physiol Heart Circ Physiol.
2009;297:H1904–H1913.
22. Kang Y, Kim J, Anderson JP, Wu J, Gleim SR, Kundu R, McLean DL, Kim
JD, Park H, Jin SW, Hwa J, Quertermous T, Chun HJ. Apelin-APJ signaling is a critical regulator of endothelial MEF2 activation in cardiovascular
development. Circ Res. 2013;113:22–31.
23.Tucker B, Hepperle C, Kortschak D, Rainbird B, Wells S, Oates AC,
Lardelli M. Zebrafish Angiotensin II Receptor-like 1a (agtrl1a) is
expressed in migrating hypoblast, vasculature, and in multiple embryonic
epithelia. Gene Expr Patterns. 2007;7:258–265.
24. McLean DL, Kim J, Kang Y, Shi H, Atkins GB, Jain MK, Chun HJ. Apelin/
APJ signaling is a critical regulator of statin effects in vascular endothelial
cells–brief report. Arterioscler Thromb Vasc Biol. 2012;32:2640–2643.
25. Sawane M, Kidoya H, Muramatsu F, Takakura N, Kajiya K. Apelin attenuates UVB-induced edema and inflammation by promoting vessel function.
Am J Pathol. 2011;179:2691–2697.
26. Sawane M, Kajiya K, Kidoya H, Takagi M, Muramatsu F, Takakura N.
Apelin inhibits diet-induced obesity by enhancing lymphatic and blood
vessel integrity. Diabetes. 2013;62:1970–1980.
27. Li Y, Chen J, Bai B, Du H, Liu Y, Liu H. Heterodimerization of human
apelin and kappa opioid receptors: roles in signal transduction. Cell
Signal. 2012;24:991–1001.
28.Hashimoto Y, Ishida J, Yamamoto R, Fujiwara K, Asada S, Kasuya Y,
Mochizuki N, Fukamizu A. G protein-coupled APJ receptor signaling induces focal adhesion formation and cell motility. Int J Mol Med.
2005;16:787–792.
29. Hong CC, Peterson QP, Hong JY, Peterson RT. Artery/vein specification
is governed by opposing phosphatidylinositol-3 kinase and MAP kinase/
ERK signaling. Curr Biol. 2006;16:1366–1372.
30. Hong CC, Kume T, Peterson RT. Role of crosstalk between phosphatidylinositol 3-kinase and extracellular signal-regulated ­kinase/mitogenactivated protein kinase pathways in artery-vein specification. Circ Res.
2008;103:573–579.
31. Ren B, Deng Y, Mukhopadhyay A, Lanahan AA, Zhuang ZW, Moodie KL,
Mulligan-Kehoe MJ, Byzova TV, Peterson RT, Simons M. ERK1/2-Akt1
crosstalk regulates arteriogenesis in mice and zebrafish. J Clin Invest.
2010;120:1217–1228.
32.Gharbi SI, Zvelebil MJ, Shuttleworth SJ, Hancox T, Saghir N, Timms
JF, Waterfield MD. Exploring the specificity of the PI3K family inhibitor
LY294002. Biochem J. 2007;404:15–21.
33. Thoreen CC, Kang SA, Chang JW, Liu Q, Zhang J, Gao Y, Reichling LJ,
Sim T, Sabatini DM, Gray NS. An ATP-competitive mammalian target of
rapamycin inhibitor reveals rapamycin-resistant functions of mTORC1.
J Biol Chem. 2009;284:8023–8032.
34.Wang Y, Nakayama M, Pitulescu ME, Schmidt TS, Bochenek ML,
Sakakibara A, Adams S, Davy A, Deutsch U, Lüthi U, Barberis A, Benjamin
LE, Mäkinen T, Nobes CD, Adams RH. Ephrin-B2 controls VEGFinduced angiogenesis and lymphangiogenesis. Nature. 2010;465:483–486.
35. Zachary I, Gliki G. Signaling transduction mechanisms mediating biological actions of the vascular endothelial growth factor family. Cardiovasc
Res. 2001;49:568–581.
36. Olsson AK, Dimberg A, Kreuger J, Claesson-Welsh L. VEGF receptor signalling - in control of vascular function. Nat Rev Mol Cell Biol. 2006;7:359–371.
37. Zhou F, Chang Z, Zhang L, Hong YK, Shen B, Wang B, Zhang F, Lu G,
Tvorogov D, Alitalo K, Hemmings BA, Yang Z, He Y. Akt/Protein kinase
B is required for lymphatic network formation, remodeling, and valve
development. Am J Pathol. 2010;177:2124–2133.
38. Morello F, Perino A, Hirsch E. Phosphoinositide 3-kinase signalling in the
vascular system. Cardiovasc Res. 2009;82:261–271.
39. Coso S, Zeng Y, Opeskin K, Williams ED. Vascular endothelial growth
factor receptor-3 directly interacts with phosphatidylinositol 3-kinase to
regulate lymphangiogenesis. PLoS One. 2012;7:e39558.
40. Aguilar B, Choi I, Choi D, et al. Lymphatic reprogramming by Kaposi sarcoma herpes virus promotes the oncogenic activity of the virus-encoded
G-protein-coupled receptor. Cancer Res. 2012;72:5833–5842.
41.Morris VA, Punjabi AS, Lagunoff M. Activation of Akt through
gp130 receptor signaling is required for Kaposi’s sarcoma-associated
herpesvirus-induced lymphatic reprogramming of endothelial cells.
­
J Virol. 2008;82:8771–8779.
42. Hers I, Vincent EE, Tavaré JM. Akt signalling in health and disease. Cell
Signal. 2011;23:1515–1527.
43. Hemmings BA, Restuccia DF. PI3K-PKB/Akt pathway. Cold Spring Harb
Perspect Biol. 2012;4:a011189.
Significance
Despite importance of Apelin/APJ signaling in diverse biological processes, its role during lymphatic development is relatively unknown. We
find that Apelin/APJ signaling is essential to induce and maintain phospho–serine–threonine kinase Akt 1/2 level in lymphatic endothelial
cells therefore, positively regulates lymphatic development. Moreover, Apelin/APJ signaling may synergize with vascular endothelial growth
factor-C signaling to promote lymphatic fate.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Essential Role of Apelin Signaling During Lymphatic Development in Zebrafish
Jun-Dae Kim, Yujung Kang, Jongmin Kim, Irinna Papangeli, Hyeseon Kang, Jingxia Wu,
Hyekyung Park, Emily Nadelmann, Stanley G. Rockson, Hyung J. Chun and Suk-Won Jin
Arterioscler Thromb Vasc Biol. 2014;34:338-345; originally published online December 5,
2013;
doi: 10.1161/ATVBAHA.113.302785
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2013 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/34/2/338
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2013/12/05/ATVBAHA.113.302785.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Supplementary Methods
MATERIALS AND METHODS
Husbandry, morpholino (MO) injection, and chemical treatment of zebrafish
Zebrafish (Danio rerio) were maintained as previously described1. The follow strains were used
in this research in addition to wild-type; Tg(fli1a:nEGFP)y7, Tg(kdrl:mCherry)s843, and
TgBAC(prox1a: KalT4-UAS:uncTagRFP)nim5. Control, apelin2, aplnra, and vegfc3 MOs were
used (Genetools). MOs were injected with phenol-red (0.1%) in zebrafish embryos at the 1~2
cell stage. The sequences of MO used were
apln MO; 5'-AACAGCCGTCACGCTCCCGACTTAC-3', aplnra MO; 5′CGCGTTGGCTTTGAGTCCTTCTTGA-3′, and vegfc MO; 5'GAAAATCCAAATAAGTGCATTTTAG -3'. For chemical inhibition of AKT activity,
LY294002 (S1105; Selleckchem), a PI3K inhibitor 4 and Torin1 (S2827; Selleckchem), an ATK
and mTORC1 inhibitor 5, were used. Embryos were treated with different amounts of
LY294002 and Torin1 dissolved in DMSO from 48hpf to 4dpf, and imaged with confocal
microscopy to evaluate the effects of treatments on developing lymphatic vessels.
Rescue experiment by the injection of synthetic apln mRNA
To achieve the in vitro transcription of apln mRNA, apln full length DNA was amplified from 2
dpf zebrafish cDNA and cloned into the pCS2P+ vector (Addgene; Plasmid 17095). pCS2P+
plasmid containing apln full length DNA was cut by NotI, transcribed by SP6 RNA polymerase
and purified by SP6/T7 transcription kit according to the manufacturer’s protocol (Roche).
Synthetic apln mRNA was diluted in RNase free water to make the working solution at a
concentration of 16ng/ml, and injected at the concentration of 8~16pg/embryos into control or
apln MO-injected embryos at the 1-2 cell stage. The PCR primer sequences for apln full length
DNA are as follows: Forward primer, 5'-ATGAATGTGAAGATCTTGACG-3'; Reverse primer,
5'-TGCCTTGCTGTAGAATGGCA-3'.
Semi-quantitative conventional and quantitative real-time PCR
The total RNA from wild-type, control and apln MO-injected embryos was extracted at several
developmental time points using an RNeasy mini kit (Qiagen) and reverse transcribed by High
Capacity cDNA Kit according to the manufacturer’s protocol (Life Technologies). Semiquantitative conventional and quantitative real-time PCR were conducted according to the
manufacturer’s protocol. The sequences of PCR primers used in this study are; apln forward, 5'ATGTGAAGATCTTGACGCTG-3'; apln reverse, 5'-TGCCTTGCTCAAGAATGGCA-3';
aplnra forward, 5'-GCGTCTCCTCAAAATCATC-3'; aplnra reverse, 5'AGCCTTCTTCAGATTCAGC-3'; aplnrb forward, 5'-TGGCACTCTGCAAGATCA-3'; aplnrb
reverse, 5'-CATCATACACTGTGGTGC-3'; vegfc forward, 5'-CATGCCCAAAGAATCACAG3'; vegfc reverse, 5'-GCTGTGCTTTACACACACA-3'; vegfr3/flt4 forward, 5'GCCGTGTGGTTATTCAGAA-3'; vegfr3/flt4 reverse, 5'-GCAGGTTCTCATAGGTGAA-3';
actb1 forward, 5'-ATGGAGAAGATCTGGCATC-3'; actb1 reverse, 5'CACCAGAGTCCATCACAAT-3'.
Whole mount in situ hybridization and immunohistochemistry
Whole mount in situ hybridization was performed as previously reported5. The RNA probe for
aplnra was labeled with dig using a DIG-labeling kit (Roche) by in vitro transcription method1.
For immunohistochemistry, phospho-AKT1/2 antibody (cell Signaling;#4060) was used in
cryo-sectioned embryos (10mm width per slice).
Human lymphatic endothelial cell (hLEC) culture and scratch migration assay
Human microvascular EC-dLyAd-adult human dermal lymphatic microvascular ECs (HMVECdLyAd-HDLECs; CC-2812), (hLECs), were obtained from Lonza. Cells were cultured at
36.5 °C in a 5% CO2 incubator in the growth medium EGM-2 (Lonza) containing 2% fetal
bovine serum (FBS) (Lonza). For experimental treatments, hLECs (passages 3–5) were grown
to 80–90% confluence. For gene silencing, siRNAs (Stealth siRNA, Life Technologies) were
transfected using RNAiMAX (Life Technologies) using manufacturer’s protocols.
For scratch migration assay, hLECs were incubated on 6-well plates in EGM-2 medium
overnight. hLECs were transfected with control siRNA (Life Technologies, Stealth RNAi) or
APJ siRNA (Life Technologies, HSS100324) for 48 hours and were then starved for 6 hours
with EBM-2 with 0.5% FBS medium. Monolayers of hLECs were scratched with a universal
blue pipette tip and the widths of the scratches in four fields per well were captured using a
TS100 Nikon microscope. Cells were incubated for 14 hours in starvation medium containing
PBS (Lonza) or 1µM Apelin-13 (Sigma). The same fields were captured again after migration.
Differences in the widths of scratches before and after migration were calculated. The width of
one field is an average of the widths at three different places in the same field. The means and
SEM of triplicate wells were calculated. All experiments were replicated at least three times,
with similar results.
Western blot assay
Proteins (20µg) in soluble lysate were resolved by TGX precast gel (Cat# 456-9036) from BioRad then transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad). The
membrane was blocked in 3% BSA in PBS containing 0.1% Tween-20 (PBST) overnight at
4 °C and probed with antibodies specific to phospho-Akt(Ser473) (Cat# 4060), Akt (pan) (Cat#
4691), Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cat# 4377), p44/42 MAPK (Erk1/2)
(Cat# 9102), or GAPDH (Cat# 2118) from Cell Signaling Technology. Subsequently, the
membrane was thoroughly washed in PBST, and incubated with HRP-conjugated secondary
antibody (Cat# 7074) from Cell Signaling Technology for 1 hour at room temperature. Finally,
the membrane was developed by enhanced chemiluminescence detection method (Thermo
Scientific).
Confocal Image Acquisition, Processing and Quantification
Zebrafish embryos were anesthetized, plated and oriented laterally on a glass bottom dish.
Image acquisition from zebrafish was performed using a Nikon confocal microscope and
merged Z-stack images by MBF ImageJ. Three dimensional reconstructions of confocal images
were performed by Volocity 3D Image Analysis Software (PerkinElmer). The number of LECs
in developing TDs of zebrafish embryos was individually counted from the trunk region that
presented by 7 somites, between from somite boundary 8 or 9 to 15, on Z-stacked confocal
images. For proper quantification, experiments were repeated at least three times. Quantification
graphs were generated by PRISM or Microsoft Excel programs. Results were evaluated by twotailed and unpaired Student’s t test and each error bar represents the standard error of the mean
(SEM). p values are as follows: *p<0.05, **p<0.01, ***p<0.001.
REFERENCES
1.
2.
Kim JD, Kang H, Larrivée B, Lee MY, Mettlen M, Schmid SL, Roman BL,
Qyang Y, Eichmann A, Jin SW. Context-dependent proangiogenic function of
bone morphogenetic protein signaling is mediated by disabled homolog 2. Dev
Cell. 2012;23:441-448
Zeng XX, Wilm TP, Sepich DS, Solnica-Krezel L. Apelin and its receptor
control heart field formation during zebrafish gastrulation. Dev Cell.
3.
4.
5.
2007;12:391-402
Ober EA, Olofsson B, Mäkinen T, Jin SW, Shoji W, Koh GY, Alitalo K,
Stainier DY. Vegfc is required for vascular development and endoderm
morphogenesis in zebrafish. EMBO Rep. 2004;5:78-84
Gharbi SI, Zvelebil MJ, Shuttleworth SJ, Hancox T, Saghir N, Timms JF,
Waterfield MD. Exploring the specificity of the pi3k family inhibitor ly294002.
Biochem J. 2007;404:15-21
Thoreen CC, Kang SA, Chang JW, Liu Q, Zhang J, Gao Y, Reichling LJ, Sim T,
Sabatini DM, Gray NS. An atp-competitive mammalian target of rapamycin
inhibitor reveals rapamycin-resistant functions of mtorc1. J Biol Chem.
2009;284:8023-8032
Supplementary Figures
Figure I. Attenuation of Aplnra signaling selectively affects lymphatic development in
zebrafish and mouse embryos. (A) Validation of the MO efficacy. Since aplnra is a signle
exon gene, we generated a construct, pEGFP-N1-5'UTR-aplnra plasmid (50pg/embryo), which
encodes GFP containing 5'UTR from aplnra locus. Co-injection of this construct with control
MO did not attenuate expression of GFP, while co-injection with aplnra MO (2.7ng/embryo)
abolished the GFP expression. Embryos were imaged at shield stage. (B) Quantification on the
percentage of embryos expressing GFP. (C) The partial knock-down of aplnra did not affect the
heart rate in zebrafish embryos. Embryos were injected the aplnra MO (1.8ng/embryo) at 1-2
cell stage and heart beating rate was measured by 4dpf. (D) The late LEC development (6.5 dpf)
was perturbed in aplnra KD zebrafish embryos. (E) The number of VEGFR3+ LECs and
lymphatic vessel formation were substantially reduced in the diaphragm of P5 Apj-/- mouse
embryos. (F) Quantification on the number of lymphatic vessel branches in P5 wild-type and
Apj-/- mice. Images were taken from 3 individual wild-type and Apj-/-embryos. ISV, intersegmental vessel; DA, dorsal aorta; CV, cardinal vein. White arrows point individual LEC in
TD. Scale bars are 600 µm in (A) and 50 µm in (D).
Figure II. The validation of apln anti-sense morpholino (MO) and phenotype of the knockdown (KD) embryos of Apelin. (A) apln MO efficiency was evaluated by RTPCR. The
splicing aberrant forms of apln transcript (apln_aberrant) were increased by high dose apln MO
injection. Total RNA from control and apln MO injected embryos was extracted at 2 dpf. (B)
The partial KD embryos of Apln by MO injection had the normal body morphology and
vascular lecture at 4 dpf. (C) Heart beating rate of control and apln MO injected embryos were
counted at 4 dpf. Experiments were triplicated. ISV, inter-segmental vessel; DA, dorsal aorta;
CV, cardinal vein. Scale bar is 400 µm.
Figure III. Lymphatic function is compromised in zebrafish embryos with reduced
Apelin/Aplnr signaling Micro-lymphangiography was performed to determine function of
lymphatic vessels in apln or aplnra MO-injected embryos. Briefly, FITC-dextran (wt 2,000,000)
was injected to the subcutaneous space into control (right), apln (middle) or aplnra (right) MOinjected embryos. MOs were injected at 1-2 cell stage and FITC-dextran was injected at 4.5dpf.
Embryos were imaged at after one hour of FITC-dextran injection. While control MO-injected
embryos readily absorb FITC-dextran, apln or aplnra MO-injected embryos failed to do so,
indicating lack of lymphatic function in these embryos. ISV, inter-segmental vessel; DA, dorsal
aorta; CV, cardinal vein; TD, thoracic duct. Scale bar is 50 µm.
Figure IV. The phenotypes of Apln over-expression. (A) Representative images for the
phenotype of the Apln overexpression by synthetic apln mRNA injection. Embryos were
injected synthetic apln mRNA at 1-2 cell stage and pictured at 48 hpf. Arrows point the cardiac
edema. (B) Percentage of embryos having the cardiac edema after the injection of apln mRNA
was counted at 48hpf. Total experimented embryos were gathered from 3 individual experiment
set.
Figure V. Dose and time dependent activation of AKT1/2 by Apelin stimulation in human
lymphatic endothelial cells (hLECs) (A) Dose dependent induction of phospho-AKT1/2 by
Apelin ligand. hLECs were treated with incremental dose of Apelin after 1 day of starvation,
and phospho-AKT1/2, total AKT1/2, and GAPDH were detected after 1 hour of Apelin
treatments. (B) Time course of Apelin mediated activation of phospho-AKT1/2. hLECs were
treated with 1µM Apelin after 1 day starvation, and phospho-AKT1/2, total AKT1/2, and
GAPDH were detected at 15, 30, 60, 180, and 360 minutes after Apelin stimulation. (C)
Validating the effects of APLNR siRNA in hLECs.
Figure VI. Expressions of Apelin and Vegfc signaling components. (A) The vegfc and
vegfr3/flt4 expressions in Apln KD embryos were evaluated by quantitative real-time PCR at
48hpf. The vegfc and vegfr3/flt4 were not changed by Apln KD in zebra fish embryos. (B) The
apln, aplnra and aplnrb expressions in Vegfc KD embryos were evaluated by quantitative realtime PCR at 48hpf. These genes were not changed by Vegfc KD in zebrafish embryos. (C)
Expression of aplnra and apelin at late developmental stages detected whole mount in situ
hybridization. At 48hpf, aplnra is expressed in cardinal vein (CV), while apln is strongly
expressed within somites (sm). After72hpf, expression of both genes are difficult to detect,
possibly due to the technical limitations.