235
Bioscience Reports i, 235-241 (1981)
Printed in Great Britain
A s e v e r e and a m i l d p o t a t o s p i n d l e t u b e r v i r o i d i s o l a t e
d i l I e r in t h r e e n u c l e o t i d e exchanges o n l y
Hans 3. GROSS,~w Ursula LIEBL,~ Heidemarie ALBERTY, ~
Guido KRUPP,~w Horst DOMDEY, ~ Karla RAMM,*%
and Heinz L. 5ANGER,~%
*Max-Planck-Institut f~r Biochemie, D-8033 Martinsried
bei M~nchen; %Arbeitsgruppe Pflanzenvirologie, Justus-LiebigUniversit~t, D-6300 Giessen; and w
f ~ Biochemie der
Universit~t W~rzburg, i>-8700 Wu~zburg, F.R.G.
(Received 18 February 1981)
F i n g e r p r i n t analyses of two potato spindle tuber viroid
(PSTV) i s o l a t e s c a u s i n g s e v e r e and mild symptoms~
r e s p e c t i v e l y , in t om a t o exhibited defined differences in
the RNase T! and RNase A fingerprints.
The c o m p l e t e
sequencing of the mild isolate and the comparison of its
primary structure with the previously established one of
the pathogenic type strain revealed that oligonucleotides
CAAAAAAG, CUUUUUCUCUAUCUUACUUG,
and
A A A A A A G G A C in t h e ' s e v e r e ' strain are replaced by
CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and
A A G G A C in t h e ' m i l d ' strain.
Thus~ t hree nucleotide
exchanges at d i f f e r e n t sites of the molecule may change
a p a t h o g e n i c v i r o i d to a p r a c t i c a l l y n o n - p a t h o g e n i c
isolate.
The possible correlation between the secondary
s t r u c t u r e in a defined region o$ the PSTV molecule and
its pathogenicity for t om a t o is discussed.
Viroids a r e uni que p l a n t p a t h o g e n s and at p r e s e n t about nine
dkEferent viroids a r e known as t h e c a u s a l a g e n t s of e c o n o m i c a l l y
important plant diseases (l-3).
Viroids d i f f e r from conventional
v i r u s e s in t h a t t h e i r small s i n g l e - s t r a n d e d c i r c u l a r RNA with a
molecular weight of about 120 000 (4) is not p r o t e c t e d by a capsid
protein. The com pl e t e molecular structure of the potato spindle tuber
viroid (PSTV) has been established (5)~ and in its native s t a t e the 359
ribonucleotides of the PSTV molecule were shown to f o r m a l a r g e l y
d o u b l e - s t r a n d e d r o d - l i k e s t r u c t u r e which is c h a r a c t e r i z e d by an
alternating ar r angem e nt of short base-paired and unpaired regions (6).
T h e s e s t r u c t u r a l f e a t ur es are c h a r a c t e r i s t i c of all viroids studied so
far (7).
By comparison, almost nothing is known about the mechanism and
the molecular basis of viroid pathogenicity. Viroids are apparently the
only pathogens that do not code for any protein (8-10)7 and they seem
to contain the information for their own st ruct ure only. Fingerprinting
t e c h n i q u e s h a v e d e m o n s t r a t e d t h a t PSTV, c i t r u s e x o c o r t i s viroid
(CEV)~ and c h r y s a n t h e m u m s t u n t vi roi d (CSV) a r e all d i s t i n c t l y
d i f f e r e n t RNA s p e c i e s with m a r k e d d i f f e r e n c e s in t h e i r primary
sequence ( I I - 1 2 ) .
Even strains of PSTV which differ in pathogenicity
9
The Biochemical Society
236
GROSS ET AL.
have been d i f f e r e n t i a t e d by their RNA fingerprints (13).
Since RNA
is the only known component of viroids, these differences in nucleotide
s e q u e n c e can be r e l a t e d to d i f f e r e n c e s in v i r o i d host range and
pathogenicity.
C ons e que nt l y, a c o m p a r i s o n b e t w e e n t h e i r p r i m a r y
sequences will allow deeper insights into the interrelations between the
s tr u ctu r e of viroids and their biological functions.
In this s t u d y we
wish to report on the structural differences between two PSTV strains
which produce severe and mild d i s e a s e s y m p t o m s , r e s p e c t i v e l y , in
to mato plants.
Materials
and M e t h o d s
The two PSTV i s o l a t e s w e r e p r o p a g a t e d in the tomato variety
' R en tita' and isolated and purified as described (4).
The pathogenic
i s o l a t e of PSTV o r i g i n a t e d f r o m an i n o c u l u m kindly provi ded by
Dr. T.O. D i e n e r , B e l t s v i l l e .
Under our g r e e n h o u s e c o n d i t i o n s it
p r o d u c e d in t h e t o m a t o c u l t i v a r s ' R u t g e r s ' and 'Rent i t a' a severe
retardation of t h e g e n e r a l p l a n t g r o w t h ( s t u n t i n g ) t o g e t h e r w i t h
epinasty, rugosity, and veinal necrosis of the upper foliage.
The inoculum of the Wmild' PSTV isolate was kindly p r o v i d e d by
Dr. K. Fernow, Ithaca, and resembles his mild strain no. 6 which he
originally obtained from naturally infected potatoes in f i e l d plots of
t h e C o r n e t I U n i v e r s i t y P o t a t o Breeding Program.
As described for
some of his other mild PSTV strains (14), it produces also under our
g r e e n h o u s e c o n d i t i o n s b a r e l y d e t e c t a b l e symptoms in 'Rutgers' and
' R e n t i t a ' tomato, so it may be considered a virtually n o n - p a t h o g e n i c
PSTV isolate.
For RNA-fingerprinting and for the determination of the complete
sequence of the mild PSTV isolate, 5'-phosphorylation in vitro w i t h
y-'~2P-ATP and b a c t e r i o p h a g e T 4 - i n d u c e d polynucleotide kinase was
applied exactly as described previously (5,12,15). The construction of
the corresponding secondary s t r uct ure model followed the principle of
maximal base=pairing as previously reported (5,6).
Results
and Discussion
The ribonuclease T| and pancreatic ribonuclease fingerprints of the
pathogenic and t h e mild PSTV i s o l a t e s a r e shown in Fig. 1.
By
comparison, it turns out that the RNase T I fingerprints of both strains
(Fig. 1, A and C) differ in the location of oligonucleotides nos. 30
and 39.
The n u c l e o t i d e sequence of no. 30 is CAAAAAAG in the
s e v e r e strain (5,15) and was established to be CAAUAAG in the mild
Fig. i. Fingerprints of PSTV strains causing severe
(A, B) and mild (C, D) symptoms in tomato.
A and C,
RNase T! fingerprints; B and D, RNase A fingerprints.
The sequences of the oligonucleotides in A and B are
given in ref. 5.
F i n g e r p r i n t s were p r o d u c e d by
electrophoresis and homochromatography as d e s c r i b e d
earlier (5).
All oligonucleotides were quantified
and sequenced.
Those d i f f e r i n g in the two PSTV
strains are marked with arrows.
PSTV SEQUENCES
237
Q
11
0
1&
g ,9
r'I/m~9~
2s
eo
O
23/24
2S~26 Q
2?
3t 34
9
9
J1~36
03'7
I
28
9 Q
2930
' 35
.....
e
38
2 A
9
9 39
2
.
B
gm
O
Q
:i
:i~!~ii!ii{~iil
]i~!ili~]!iiiil
:!!iii~}ii!:i!!~JiiJ~i~iii
238
GROSS ET AL.
isolate.
The s e q u e n c e of no. 39 is known to be CUUUUUCUCU A U C U U A C U U G in t h e s e v e r e s t r a i n ( 5 , 1 5 ) and t u r n e d o u t as
CUUUUUCUCUAUCUUUCUUUG in the mild PSTV.
The RNase A fingerprints of both strains (Fig. i, B and D) d~ffer
in that otigonucleotide no. 31 (AAAAAAGGAC) of the severe strai:n is
r e p l a c e d by o l i g o n u c l e o t i d e s AAU and A A G G A C which a r e now
c o m i g r a t i n g with nos. 9 and 23/249 respectively9 in the mild isolate.
These findings are summarized in Fig. 29 which shows the previously
d e t e r m i n e d (5) primary and secondary st ruct ure of the severe PSTV
(top) together with that of the mild PSTV strain as newly established
by sequence analysis.
Thus 9 it becomes evident that t hree nucleotide
changes involving the introduction of t hree uridines by one i n s e r t i o n
and by t w o r e p l a c e m e n t s of adenosines, respectively, may change a
p a t h o g e n i c PSTV s t r a i n to a v i r t u a l l y n o n - p a t h o g e n i c
isolate.
Interestingly these changes are such that the total number of the 359
ribonucleotides of the PSTV molecule is not altered.
R e g a r d i n g the secondary-Structure model of PSTV with respect to
these sequence changes, it is interesting to note that they occur in or
o p p o s i t e to such oligopurine sequences (i.e. nucleotides 118-122 and
307-313) which have been found to exist in all viroids studied so far
(5912). Only one of the observed sequence differences~ namely t hat in
the left half of the molecule9 seems to alter the secondary s t r u c t u r e
to some degree, in that the mild PSTV strain has two more base pairs
in this region than the severe strain.
Therefore, the question arose
whether the number of base pairs~ i.e., the secondary st ruct ure around
n u c l e o t i d e s nos. 50 and 3109 coul d in s o m e way d e t e r m i n e t h e
p a t h o g e n i c r e s p o n s e of t h e host pl ant during PSTV replication in
to mato plants.
Dickson e t a2. (13) have analysed fingerprints of PSTV isolates of
d if f er en t pathogenicities a f t e r labelling i n v i e r o with 12$I. From the
description of their viroid isolates and from a recent study of viroid
host range and symptomatology (16)9 it may be i n f e r r e d t h a t e v e n
more pathogenic PSTV isolates seem to exist than the strain we have
used in our investigations.
According to the e x p e r i e n c e of D i c k s o n
and co-workers (13,16)9 the PSTV from Dr. Diener's laboratory is an
Fig. 2.
Primary and secondary structure of PSTV
strains causing severe (top) and m i l d ( b o t t o m )
symptoms in tomato.
Around nucleotide no. 120, two
adenosines in the severe strain have been replaced by
one u r i d i n e in the mild strain, whereas in the
neighbourhood of nucleotide no. 310 an adenosine of
the severe strain has been replaced by a uridine, and
another uridine has been inserted, in the m i l d
strain.
There are no further differences between
these strains, since the m i l d P S T V s t r a i n was
sequenced as completely as the severe strain (5).
Note that the two strains differ slightly in their
secondary structures, the mild strain having two
additional base pairs.
The nucleotide changes from
the severe to the mild strain are shown separately in
the boxes.
PSTV SEQUENCES
239
|
.qt
'~6.~ ~ q.D'~
~g
11
@|
2Lt0
GROSS ET AL.
' i n t e r m e d i a t e ' isolated which could also apply to our strain from the
same source.
HoweverD the i n t e r p r e t a t i o n of 1251-fingerprints is
d i f f i c u l t because RNase T! oligonucleotides without a cytidine and
pancreatic i r a g m e n t s w i t h a 3 ' - t e r m i n a l uridine w i l l not become
labelled.
In the context of correlating changes in secondary structure
and pathogenicityD i t is i n t e r e s t i n g t h a t the (even more) severe
isolates of Dickson ee a l . ( I 3 ) could be interpreted as having an
additional mutation in the region around nucleotides 50 and 310 as
compared to the corresponding mild and intermediate strains investigated including our severe isolate. HoweveG this i n t e r p r e t a t i o n is
c o r r e c t only if we assume t h a t t h e i r intermediate strain and our
severe PSTV strain are identical.
If sod the absence of the unique
G A G C in t h e i r severe isolates would result from an additional
mutation in the region of nucleotides 44-47.
Considering the more dynamic aspects of PSTV structure9 it is of
interest that all the observed mutations are located outside those
regions which have been shown to be directly involved in the formation of branched intermediatesD i.e.~ in stable hairpins which are newly
formed during the thermal denaturation of the PSTV molecule (6D17).
The existence of these regions and the formation of the corresponding
hairpins in several viroid species suggests that they are of functional
importance (6D17). Although their relevance for c e r t a i n biological
properties is not yet understoodD there are indications that they could
act as specific signals during viroid transcription (18).
With respect
to the theoretical translation potential of viroids (5~8-10)D it should be
noted that the described mutations would change the reading frame9 in
that the infecting (+) RNA molecule codes for peptides or proteins9
and the replacement of adenosine in position 120 by uridine would
create a possible UAA terminator codon.
Approaching the problem from a more biological standpoint9 it must
be emphasized that pathogenicity is a complex biological property and
that the expression of disease symptoms is specified by the genome of
both the viroid isolate and the host plant.
Thus not only do severe~
intermediateD and mild v i r o i d strains existD but d i f f e r e n t tomato
cultivars may respond with severe (cv. Rutgers)D mild (cv. Rentita)D
or practically no symptoms (cv. Hilda 72) upon infection with one and
the same viroidD although replication and accumulation is about the
same in all three host plants (19).
Moreover D symptom development
is dependent on a threshold concentration of the viroid~ as is demonstrated after inoculation w i t h highly dilute inocula.
In this case
pronounced symptoms may be recognized only after an extended period
or in the newly growing axillary buds after decapitationD which can be
d i r e c t l y related to the increased viroid concentration in the corresponding tissue. Finally environmental factors such as the natured
intensity, and length of illumination and the temperature during plant
growth may greatly influence the response of the host plant to viroid
i n f e c t i o n and also the i n t e n s i t y of v i r o i d r e p l i c a t i o n itself (20).
NeverthelessD the knowledge of s t r u c t u r a l details of more v i r o i d
isolates will be necessary for definite assessment of the influence of
viroid sequence and structure on the biological properties of these
pathogens.
PSTV SEQUENCES
2#1
Acknowledgements
We wish to thank Drs. T.O. Diener and K.H. F e r n o w for the
original cuitures of PSTV and Mrs. H. Muth, M. Bahr, and I. Schlag for
t h e i r a s s i s t a n c e with viroid propagation and purification.
This work
was s u p p o r t e d by t h e D e u t s c h e F o r s c h u n g s g e m e i n s c h a f t t h r o u g h
personal grants and the Sonderforschungsbereich #7.
References
i. Diener TO (1979) Viroids and Viroi4 Diseases, John Wiley &
Sons.
2. S~hger HL (1979) in Slow Transmissible Diseases of the Nervous
System, Prusiner St B & Hadlow WJ (eds), Academic Press.
3. Gross HJ & Riesner D (1980) Angew. Chemie Internat. Ed. Engl.
19~ 231-243.
4. Sgnger HL, Klotz G, Riesner D, Gross HJ, & Kleinschmidt AK
(1976) Proc. Natl. Acad. Sci. U.S.A. 73, 3852-3856.
5. Gross HJ~ Domdey H, Lossow Ch, Jank P~ Raba M, Alberty H, &
S~nger HL (1978) Nature 273, 203-208.
6. Riesner D, Henco K~ Rokohl U9 Klotz G, Kleinschmidt AK, Domdey
H, Jank P, Gross HJ, & S~nger HL (1979) J. Mol. Biol. 133,
85-115.
7. Langowski J~ Henco K, Riesner D~ & S~nger HL (1978) Nucleic
Acids Res. 5~ 1589-1610.
8. Davies JW, Kaesberg P, & Diener TO (1974) Virology 61,
281-286.
9. Hall TC, Wepprich RK~ Davies JW, Weathers LG~ & Semancik JS
(1974) Virology 61~ 486-492.
I0. Semancik JS, Conejero V 9 & Gerhart J (1977) Virology 80,
218-221.
ii. Dickson E, Prensky W~ & Robertson HD (1975) Virology 68,
309-316.
12. Gross HJ~ Domdey H~ & S~nger HL (1977) Nucleic Acids Res. 4,
2021-2028 (1977).
13. Dickson E, Rohertson HD~ Niblett CL, Horst RK~ & Zaitlin M
(1979) Nature 227, 60-62.
14. Fernow KH (1967) Phytopathology 57, 1347-1352.
15. Domdey H, Jank P, S~nger HL, & Gross HJ (1978) Nucleic Acids
Res. 5~ 1221-1236.
16. Niblett CL, Dickson E, Horst RK~ & Romaine CP (1980) Phytopathology 70, 610-615.
17. Henco K, Riesner D, & S~nger HL (1977) Nucleic Acids Res. 6,
3041-3059.
18. Rackwitz HR, Rohde W, & S~nger HL, Nature, in press.
19.. MShlbach H-P & S~nger HL (1977) J. gen. Virol. 35, 377-386.
20. S~nger HL & Ramm K (1975) in Modification of the Information
Content of Plant Cells, Markham R et al. (eds), pp 229-252~
North Holland/Elsevier, Amsterdam.