Journal of Experimental Botany Advance Access published September 4, 2013
Journal of Experimental Botany
doi:10.1093/jxb/ert266
This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html for further details)
Research paper
Heritable variation and small RNAs in the progeny of
chimeras of Brassica juncea and Brassica oleracea
Junxing Li1,2,*, Yan Wang1,3,*, Langlang Zhang1,2, Bin Liu1,2, Liwen Cao1,2, Zhenyu Qi1,4 and Liping Chen1,2,†
1 Department of Horticulture, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310058, PR China
Key Laboratory of Horticultural Plants Growth, Development and Biotechnology, Agricultural Ministry of China, Hangzhou 310058, PR
China
3 Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, PR China
4 Agriculture Experiment Station, Zhejiang University, Hangzhou 310058, PR China
2 Received 1 March 2013; Revised 2 July 2013; Accepted 19 July 2013
Abstract
Chimeras have been used to study the transmission of genetic material and the resulting genetic variation. In this
study, two chimeras, TCC and TTC (where the origin of the outer, middle, and inner cell layers, respectively, of the
shoot apical meristem is designated by a ‘T’ for tuber mustard and ‘C’ for red cabbage), as well as their asexual
and sexual progeny, were used to analyse the mechanism and the inheritance of the variation induced by grafting.
Asexual TCC progeny were obtained by adventitious shoot regeneration, while TTC sexual progeny were produced by
self-crossing. This study observed similar morphological variations in both the asexual and sexual progeny, including changes in leaf shape and the pattern of shoot apical meristem termination. The leaf shape variation was stable,
while the rate of shoot apical meristem termination in the TTC progenies decreased from 74.52% to 3.01% after three
successive rounds of self-crossing. Specific red cabbage small RNAs were found in the asexually regenerated plants
(rTTT) that were not present in TTT, indicating that small RNAs might be transmitted from red cabbage to tuber mustard during grafting. Moreover, in parallel with the variations in phenotype observed in the progeny, some conserved
miRNAs were differentially expressed in rTTT and TTT, which correlated with changes in expression of their target
genes. These results suggest that the change in small RNA expression induced by grafting may be an important factor
for introducing graft-induced genetic variations, providing a basis for further investigating the mechanism of graftinduced genetic variation through epigenetics.
Key words: Brassica juncea, Brassica oleracea, chimera, grafting variation, inheritance, small RNA.
Introduction
Plant grafting is a well-recognized means of vegetative propagation. It differs from sexual breeding in that it involves germ
cells that have undergone meiotic recombination. It is generally thought that grafting does not alter the genetic content
of the graft partners (recipient stock/donor scion) or their offspring. However, graft-induced genetic variations (GIGVs) in
graft offspring have been well documented in several different experimental systems and plant species (Frankel, 1954;
Yagishita, 1961; Ohta and Choung, 1975; Hirata, 1979,
1980a, 1980b; Hirata et al., 1986, 1989; Hirata and Yagishita,
1986; Taller et al., 1998). For example, an earlier study using
male sterile petunia for the stock and normal fertile petunia as the scion showed that the male sterility of the stock
was transferred to the scion progeny (Frankel, 1954). A later
study reported the appearance of genetic variations in mung
bean progeny following grafting of the mung bean seedling
© The Author 2013. Published by Oxford University Press on behalf of the Society for Experimental Biology
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/3.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial reuse, please contact [email protected]
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
* These authors contributed equally to this manuscript.
To whom correspondence should be addressed. E-mail: [email protected]
† Page 2 of 12 | Li et al.
offspring of a periclinal chimera can be produced from a single layer, by asexual derivation from the LI layer or sexual
derivation from the LII layer (Satina, 1945; Zhu et al., 2007).
Therefore, the offspring consist of only one genotype, thus
enabling the analysis of heritable variation.
This study group previously reported the establishment of
several periclinal chimeras by in vitro micro-grafting between
tuber mustard (Brassica juncea) and red cabbage (Brassica
oleracea) (Chen et al., 2006). The present study further
investigates two of these periclinal chimeras, TCC and TTC
(where the origin of the outer, middle, and inner cell layers of
the SAM is designated by a ‘T’ for tuber mustard or ‘C’ for
red cabbage). In these chimeras, cell layers derived from tuber
mustard and red cabbage are present in the same SAM. These
two species have distinct phenotypic and molecular markers.
The goal of this study was to determine the status of sRNAs
during grafting and elucidate the origin of GIGVs by analysing variation in the asexual and sexual progeny of single-cell
lineages from the chimeras.
Materials and methods
Plant materials
Two periclinal chimeras (TCC and TTC) synthesized by in vitro
grafting between tuber mustard (Brassica juncea (L.) Czern. et Coss.
var. tumida Tsen et Lee.) and red cabbage (B. oleracea L. var. capitata L.) were used in this study (Chen et al., 2006). The ungrafted
tuber mustard and red cabbage plants are referred to as TTT and
CCC. Tuber mustard self-grafting was used as a control. All grafts
were performed under aseptic conditions.
Explants of chimera nodal segments were cultured on halfstrength MS basal medium (Murashige and Skoog, 1962) containing 0.2 mg/ml 6-benzyladenine (6-BA) at 25 ± 2 °C under a 16/8
light/dark cycle with 84 μmol m–2 s–1 fluorescent light. The axillary
shoots were excised and transferred to half-strength MS medium
for further growth. Chimeric shoots with four or five leaves were
then transferred to half-strength MS medium containing 0.1 mg/ml
α-naphthalene- acetic acid (NAA) for root induction (Zhu et al.,
2007). After acclimatization for 10 days in a greenhouse, the rooted
plantlets were transplanted to soil. Meanwhile, tuber mustard and
red cabbage plantlets were also transplanted to a field for further
phenotypic studies.
Histological analysis and in situ hybridization
The chimeras were identified by histological analysis of the mature
leaves (Satina et al., 1940). The mature leaves from chimeras, tuber
mustard, and red cabbage were collected for free-hand sectioning.
The thinner leaf sections were observed and photographed using an
SP 350 Olympus digital camera.
B. juncea and B. juncea are AABB and CC genomes, respectively
(Maluszynska and Hasterok, 2005). The BB genome is only distantly
related to the AA and CC genomes. Genomic DNA from Brassica
nigra (which has a BB genome) can be used as specific probe to identify B. juncea by genome hybridization. The 358 bp atpA fragment
(located in the region from 65,976 bp to 66,334 bp in B. oleracea
mitochondrial DNA, but not in B. juncea) can be used as a specific
probe to identify B. oleracea. Thus, these two specific probes were
used to discriminate between the T cells and C cells. Genomic DNA
was extracted from B. nigra and then broken into 200–500 bp fragments by boiling in water. The atpA fragment was PCR-amplified
using the primers atpAF (5′-TAAATAAGTAAGACTTGACT-3′)
and
atpAR
(5′-GAATTTATAACCCACTAGTC-3′).
The
two probes were labeled with digoxigenin according to the
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
onto the stem of a sweet potato plant (Zhang et al., 2002).
Despite ample experimental evidence for the occurrence of
GIGVs, the pattern of inheritance is still unclear, and some
data are contradictory. For instance, Ohta (1991) showed that
the hereditary changes in certain traits in self-crossed generations of grafted red pepper followed a Mendelian pattern,
while Taller et al. (1998) described results that did not fit a
Mendelian pattern of inheritance. Even though several different mechanisms have been proposed to explain these conflicting results, the nature of GIGVs remains controversial.
Pandey (1976) first proposed that the genetic variation
resulted from a transfer of genetic material from the stock
to the scion across the graft junction. He hypothesized that
DNA fragments transferred from the stock plant integrate
into the chromosomes of scion cells during DNA replication
by homologous recombination with the scion genome. Later,
Zhou et al. (2002) attempted to detect evidence of DNA
exchange between stock and scion in citrus grafts, but were
unsuccessful. Stegemann and Bock (2009) grafted tobacco
plants from two transgenic lines carrying different markers
and reporter genes in the nucleus and the plastid. They found
that the plastid genomes were transferred between plant cells
that were in close contact. However, there is no direct evidence that genetic variation can be induced by the transmission of nuclear genomic DNA through grafting.
Grafting between different species involves contact between
heterologous cells at the stock and scion junction. It has
been previously shown that the cells of the scion and stock
species are linked to each other by plasmodesma (PD), and
that genetic material can be transported via PD for a short
distance (Jackson, 2001). In general, the PD only permits
the transfer of some macromolecules, such as specific proteins and RNA (Ding et al., 1999; Zambryski and Crawford,
2000; Oparka and Roberts, 2001; Kim and Pai, 2009). The
first endogenous plant protein found to move from cell to
cell was KNOTTED1 (KN1), which is a transcription factor
that regulates leaf and shoot meristem development (Lucas
et al., 1995). Kim et al. (2001) reported that the long-distance
transport of the mutant Mouse ears (Me) transcript correlates with a change in leaf morphology. These results showed
that the transmission of proteins and mRNAs from stock
to scion can cause changes in phenotypic traits. However,
there is no evidence that the variation induced by protein
and mRNA transport is inherited and maintained in the offspring. Recently, the biological significance of small RNAs
(sRNAs) has attracted much attention. Several groups have
shown that endogenous sRNAs can be transmitted during
grafting and induce epigenetic modifications such as DNA
methylation and RNA silencing, without changing the DNA
sequence (Haque et al., 2007; Pant et al., 2008; Dunoyer et al.,
2010; Molnar et al., 2010; Wu et al., 2010). However, further
research is needed to determine whether sRNAs play a role in
the variation induced by grafting.
The periclinal chimera obtained by grafting the shoot
apical meristem (SAM) in vitro is a special form of grafting (Chen et al., 2006). The SAM of the periclinal chimera
consists of three genetically distinct cell layers, named LI,
LII, and LIII (from the outer layer to the inner layer). The
Heritable variations in graft chimera progeny | Page 3 of 12
Phenotypic assessment of asexual and sexual chimera progeny
TCC periclinal chimera exhibit complete sterility when used as
the female parent (Wang et al., 2011). Asexual TCC progeny were
obtained by the regeneration of LI cells under aseptic conditions.
First, nodal segments from the TCC chimera were cultured on halfstrength MS medium supplemented with 0.2 mg/ml BA. Next, the
axillary buds were excised and cultured on MS medium supplemented with 3 mg/ml BA to induce adventitious shoots. After the
adventitious shoots reached 0.5 cm in length, they were excised and
transferred to half-strength MS basal medium containing 0.2 mg/
ml 6-BA for further propagation. The new shoots were designated
reverted TTT (rTTT), and the first and second generations of rTTT
progeny obtained by normal self-crossing were named RS1 and RS2
(Fig. 1).
TTC periclinal chimera are fertile and can produce sexual progeny by self-crossing. The first self-crossed line derived from TTC
was named GS1, and the successive generations GS2 and GS3 were
derived from GS1 (Fig. 1).
The phenotypes of the asexual, sexual, and control progeny were
analysed under the same growth conditions.
Small RNA analysis
The newly regenerated rTTT plants were used to investigate the status of sRNAs in the T cell lineage after contact with C cell lineage.
To rule out contamination of the red cabbage cell lineage during
rTTT regeneration and confirm the pure LI origin of the TCC asexual progeny (T cell lineage), the candidate rTTT plants were assayed
using PCR amplification of atpA, a gene present in the mitochondria of Brassica species. The specific primer sequences used to
amplify atpA were 5′-GCTGCTTACAGGAGTTAGCC-3′ (F) and
5′-GTCCAATCGCTACATAGACA-3′ (R), and the PCR amplification reaction was carried as follows: an initial denaturation step at
94 °C for 5 min; 35 cycles of 94 °C for 45 s, 55 °C for 45 s, and 72 °C
for 1.5 min; followed by one last extension step at 72 °C for 10 min.
This primer pair amplifies fragments of different lengths from tuber
mustard and red cabbage DNA (1050 and 1500 bp, respectively),
allowing for the detection of potential contamination by the red cabbage lineage (Zhu et al., 2007).
To avoid contamination by viruses, bacterial pathogens, and endophytes, grafting and in vitro regeneration of rTTT were performed
under aseptic conditions. Total RNA from the newly expanded
leaves (the fourth leaf) of the rTTT plants and their parent plants
(both grown in vitro) was extracted with Trizol (Invitrogen) and
used to construct sRNA libraries. Three biological replicates were
Fig. 1. Diagram of grafting and creating the asexual and sexual
chimera progenies.
included for each sample. For each sample, the 18–30 nt sRNA fragments were purified, converted to DNA by reverse-transcription
PCR, and ligated sequentially to the 5′ and 3′ adaptors. The reversetranscription PCR products were then sequenced directly using a
Solexa sequencer. After removing the adaptor, filtering the low
quality tags and cleaning up the contaminants, the unique sequence
reads were counted. All of the sRNAs were mapped to the miRBase
(release 16), Genbank/Rfam, Repeats, and Exon/Intron databases.
If the results from different databases conflicted with each other,
the sRNA annotation was selected from one of the databases in the
following priority order: Genbank/Rfam, known miRNA, Repeats,
Exon/Intron. Any sRNAs that were not annotated in any database
were designated ‘unann sRNA’. After the sequences were aligned,
the composition and expression of the sRNAs in each sample was
determined. The sRNAs that were specific to rTTT or shared with
TTT and CCC were determined by sequencing. Because miRNAs
regulate the expression of their target genes to guide morphological
alteration of plants as developmental cues (Kim and Pai, 2009), the
present study compared the expression level (number of reads) of
some conserved miRNAs in TTT and rTTT to estimate their correlation with GIGVs.
Gene expression quantification by reverse-transcription PCR
The relative expression levels of target genes predicted by different
expression miRNAs were analysed in the progeny plants compared
to TTT, because similar morphological variations appeared in both
the asexual and sexual progeny. The target genes were predicted
using psRNA Target (http://plantgrn.noble.org/psRNATarget/).
Total RNA was extracted from the young leaves of TTT, RS1, GS1,
GS2, and GS3 using Trizol (Invitrogen) and converted to cDNA for
q-PCR analysis. GS1, GS2, and GS3 were selected on the basis of
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
manufacturer’s instructions (Roche). Hybridization was performed
using a modified protocol. The SAMs from the chimeras, tuber
mustard, and red cabbage were fixed using Carnoy’s fixative, and
paraffin sectioning was performed. The sections were rehydrated,
washed with 0.01 mol/l PBS for 5 min, and incubated with 0.3%
Triton X-100 and 5 μg/ml proteinase K for 10 min at 37 °C. After
treatment with 0.1 mol/l glycine-PBS for 5 min, the sections were
fixed in 4% paraformaldehyde at room temperature. The hybridization mixture consisted of 50% formamide, 4×SSC, 10% dextran sulphate, 5×Denhardt’s, 10% SDS, 0.1 μg/μl herring DNA, and 1 μg/
ml labelled probe.
Sections were denatured for 10 min at 82 °C, and then exposed
to approximately 20 μl of hybridization mixture per section.
Hybridization was performed at 42 °C overnight (approximately
18 h). The detection was carried out using the DIF High Prime
DNA Labeling and Detection Starter Kit І (Roche) according to the
manufacturer’s instructions. The hybridized sections were observed
and photographed using an Eclipse 90i camera (Nikon). A control
hybridization was performed with no probes included in the hybridization mixture, and negative control hybridizations were performed
using the atpA probe for tuber mustard and the BB genome probe
for red cabbage.
Page 4 of 12 | Li et al.
their SAM termination status. The SAM termination grew weaker
from GS1 to GS3. All amplification reactions were performed with
specific primers (Table 1) using 20 μl volumes of SYBR (Takara)
Table 1. Specific primers for quantitative PCR analysis
Sequence (5′–3′)
SPL9-F
SPL9-R
PHV-F
PHV-R
PHB-F
PHB-R
TCP2-F
TCP2-R
25SF
25SR
AGTCGGGTCAGATACCAAGG
TGTTCGATACCAGCCACAGT
GATTGGTCTTAACCATAGCC
GAAGTGGGAAACTGCATCGA
GAGGTGAAGCTGACCCAAAT
CAGATATTGGACTGATACTGG
GCCAAAGAGACCAAGGAGAG
GTCTGAACCGGGAAATGAGT
CGGTTCCTCTCGTACTAGGTTGA
CCGTCGTGAGACAGGTTAGTTTT
Results
Identification of periclinal chimeras TCC and TTC
The parental tuber mustard and red cabbage plants have
distinct phenotypic markers (Fig. 2A, B). The tuber mustard plant has epidermal hair and green leaves, while the red
cabbage plant has smooth, purple, waxy leaves. In addition,
tuber mustard leaves are thin, while red cabbage leaves are
thick. These morphological characteristics can be used as
markers for detecting the two cell lineages. The tuber mustard
and red cabbage plants are referred to hereafter as TTT and
CCC, respectively.
Fig. 2. Parent plants and periclinal chimeras: (A) tuber mustard; (B) red cabbage; (C) histological structure of tuber mustard;
(D) histological structure of red cabbage; (E) TCC; (F) TTC; (G) histological structure of TCC; and (H) histological structure of TTC.
Histological structures taken at magnification ×200 (this figure is available in colour at JXB online).
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
Primer name
and the ABI STEPONE Real-Time PCR system. The 25S ribosomal
RNA gene was selected as a reference gene for normalization. Three
biological replicates were included for each sample.
Heritable variations in graft chimera progeny | Page 5 of 12
GIGVs in the morphological phenotype of the asexual
and sexual progeny of TCC and TTC periclinal
chimeras
The phenotypes of the asexual progeny of TCC (rTTT,
RS1, RS2) and the sexual progeny of TTC (GS1, GS2,
GS3) were compared to the TTT parent plant (Fig. 4).
Phenotypic variations were detected in rTTT, RS1, RS2,
GS1, GS2, and GS3, but not in the progeny of the TTT
self-grafted chimera. rTTT, the asexual progeny of TCC,
showed remarkable phenotypic variation in leaf shape and
SAM growth termination compared to TTT. In particular,
the abaxial leaf margins were entire and undulate, resembling the red cabbage to some degree, while the adaxial
portions were split to the midrib (Fig. 5). The leaf variation was propagated by self-crossing without segregation
(Figs 4 and 5). There was a slight degree of SAM termination in rTTT.
Interestingly, similar phenotypic variations were observed
in the sexual offspring (GS1) of the TTC chimera. The variation in leaf shape was propagated to the GS2 and GS3 progeny (Figs 4 and 5). However, the SAM variation was different
in the sexual and asexual progeny. Significant SAM termination was observed in GS1 at the fourth-leaf stage (Fig. 6D).
As shown in Fig. 6E and F, the dome dispersed to the peripheral primordia, and its size was much smaller compared TTT,
as well as being connected with and integrated to the young
leaf primordia P1, P2, and P3. Notably, this SAM termination is an inheritable and unstable phenotype. Among the
sexual progeny, the frequency of SAM termination progressively decreased in succeeding generations of self-crossing
(Table 2).
Fig. 3. Identification of TCC by in situ hybridization. (A) and (B) The tuber mustard and red cabbage SAMs were hybridized with a
B. nigra genome probe and an atpA probe, respectively. (C) Only the LI cells of chimera TCC showed signals when hybridized with the
B. nigra genome probe. (D) The inner LII and LIII layers hybridized with the atpA probe. (E and F) The whole SAM of tuber mustard and
red cabbage was hybridized with atpA probe and BB genome probe, respectively. LI, LII, and LIII, outmost, middle, and innermost layer
of SAM, respectively. Bars, 50 μm (this figure is available in colour at JXB online).
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
Two types of chimeras were produced by in vitro grafting between tuber mustard and red cabbage (Fig. 2E, F).
The chimeras were identified by examining the histological
structure of their mature leaves (Fig. 2G, H), using the histological structure of mature leaves from TTT and CCC as
controls. As shown in Fig. 2, both chimeras had visible epidermal hairs, suggesting that their LI layer is derived from
TTT. The subepidermal layer of one chimera (Fig. 2G) was
similar in appearance to CCC (Fig. 2D), indicating that its
LII layer is derived from CCC. The subepidermal layer of
the other chimera (Fig. 2H) was green (Fig. 2C), indicating
that the LII layer originates from TTT. In both chimeras,
the cellular morphology and distribution were consistent
with those of CCC, with the sponge tissue composed of
four or five layers of closely spaced cells, indicating that
their LIII layers are derived from CCC. Based on these
observations, the two chimeras were named TCC and TTC.
Both plants represent periclinal chimeras with a stable
phenotype.
The identity of chimera TCC was further confirmed by in
situ hybridization. As shown in Fig. 3 A and B, the B. nigra
genome probe and the atpA gene fragment probe hybridized
with TTT and CCC, respectively, and showed the hybridization signals (black granules in cells). The control samples did not show any hybridization signal (Fig. 3E, F and
Supplementary Fig. S1, available at JXB online). Using the
B. nigra genome probe, hybridization signals were observed in
the LI (Fig. 3C). Using the atpA probe, hybridization signals
appeared in the LII and LIII layers (Fig. 3D). These results
confirm that the LI layer of the TCC chimera originated from
tuber mustard and the LII and LIII layers originated from
red cabbage.
Page 6 of 12 | Li et al.
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
Fig. 4. Diagram of grafting and creating the asexual and sexual chimera progenies: (A) TTT; (B) CCC; (C) TCC; (D) adventitious shoots
(arrow, indicating self-crossing); (E) rTTT; (F) RS1; (G) RS2; (H) TTC; (I) GS1; (J) GS2; (K) GS3 (this figure is available in colour at JXB online).
Heritable variations in graft chimera progeny | Page 7 of 12
Fig. 6. SAM degradation in GS1 and histological analysis: (A) TTT; (B) transverse section of TTT SAM; (C) longitudinal section of TTT SAM;
(D) GS1; (E) transverse section of GS1 SAM; (F) longitudinal section of GS1 SAM. Bars, 100 μm (this figure is available in colour at JXB online).
Analysis of specific small RNAs
As shown in Fig. 7, the PCR amplification products of atpA
from rTTT and TTT yielded bands of the same size (Fig. 7),
confirming that rTTT did not contain any cells derived from
CCC. To identify any change in sRNAs due to grafting,
sRNAs from three samples were sequenced. Overall, 24.29%
of the sRNAs expressed by rTTT differed from TTT, and
0.60% overlapped with CCC (the complete results are shown
in Fig. 8A). The lengths of the 97,324 sRNAs expressed by
rTTT but not TTT were analysed (Fig. 8B). sRNAs that were
23 and 24 nt in length accounted for 27.07% and 36.96% of
the total sRNAs, respectively. However, many of these sRNAs
Table 2. SAM termination rate of three self-crossing generations
Sample
Total plantlets
Total terminated
Termination rate (%)
GS1
GS2
GS3
214
251
260
160
29
8
74.52 ± 3.47
11.95 ± 2.04
3.01 ± 1.54
Fig. 7. PCR analysis of the atpA gene in TTT, CCC, and rTTT.
Lanes: M, marker DNA; 1, TTT; 2, CCC; 3: rTTT
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
Fig. 5. Leaf variation in the chimera progenies. (A) TTT; (B) RS1; (C) RS2; (D) GS1; (E) GS2; (F) GS3 (this figure is available in colour at JXB
online).
Page 8 of 12 | Li et al.
are not annotated in databases of known sRNAs. Out of the
pool of sequenced sRNAs, only 4846 siRNAs, 399 snRNAs,
37 miRNAs, and 27 snoRNAs have been annotated, and most
of them had relatively low reads. The details of the sRNAs
(excluding the rRNA and tRNA) with higher abundance
(reads ≥20) and miRNAs (with a low abundance) are shown in
Supplementary Table S1, although the identity of the majority of these sequences is unknown. Most of the miRNAs were
conserved among the TTT, CCC, and rTTT plants. It is presumed that this phenomenon also occurred in the TTC progeny, because the T cell lineage present in the LII layer is in
direct contact with the C cell lineage in the LIII layer.
termination status (Fig. 10). In conclusion, changes in the
expression level of target genes correlated with changes in the
expression level of the corresponding miRNAs.
Expression of conserved miRNAs and their predicted
target genes
Periclinal chimeras are a suitable system for analysing
genetic material exchange during grafting
This study next compared the expression levels of conserved
miRNAs in TTT and rTTT whose biological functions
are associated with the leaf development and morphology
(Table 3). The expression of miR166 and miR319 were all
downregulated in rTTT. Their target genes were predicted by
combining the phenotypic changes induced by grafting and
the genes related to the formation of leaf profile (TCP2 and
SPL9) and SAM development (PHB and PHV) (Williams
et al., 2005; Kim et al., 2005; Wu et al., 2009; Pulido and
Laufs, 2010). Based on the results observed in rTTT, the predicted target genes were also analysed in the sexual progeny
(GS). The expression levels of the target genes in both GS1
and RS1 were higher than in TTT, except that of SPL9 (targeted by miR156a) (Fig. 9). In addition, the expression of
genes related to SAM changed according to the SAM growth
The SAM of the periclinal chimera consists of genetically different layers, and its composition is traditionally determined
by the histological structure of the mature leaves (Satina
et al., 1940). This study used in situ hybridization to confirm the genetic constitution of the SAM (Fig. 3). Using the
B. nigra genome probe, hybridization signals were observed
in the LI layer (Fig. 3C). Using the atpA probe, hybridization signals appeared in the LII and LIII layers (Fig. 3D).
This is the first time that SAM composition has been determined at the molecular level. The results showed that the histological analysis was consistent with the molecular analysis.
This work then proceeded to use the two chimeras TCC and
TTC, in which the SAM composition had been confirmed by
histological or molecular analysis, to assess the exchange of
genetic material and its effect on succeeding generations.
Discussion
In agriculture and horticulture, grafting is widely used to
improve plant vigour, modify plant structure, and increase
plant tolerance to stresses or diseases. In general, genetic
changes in the graft offspring are not desirable, however,
GIGVs often appear. It is therefore important to understand
how GIGVs occurs and is passed on to offspring.
Table 3. Comparison of the conserved miRNAs in rTTT and TTT and their predicted target genes
miR-name
Sequence (5′–3′)
TTT (reads)
rTTT (reads)
Target genes
miR156
miR166
miR319
UGACAGAAGAGAGUGAGCAC
UCGGACCAGGCUUCAUUCCCC
UUGGACUGAAGGGAGCUCCCU
863,018
249,920
83
1,237,177
189,755
10
SPL9
PHV, PHB
TCP2
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
Fig. 8. Analysis of unique small RNAs among the three pairwise comparisons (A) and length distributions of the sRNAs transmitted
between the two lineages (B) (this figure is available in colour at JXB online).
Heritable variations in graft chimera progeny | Page 9 of 12
The periclinal chimera offers specific advantages for
studying the transmission of genetic material between
heterologous cells. First, the cells in the genetically different layers are adjacent to each other and therefore in
more direct contact than in scion-stock grafting (Chen
et al., 2006), providing a greater chance for the exchange
of genetic material between the different layers. Secondly,
the heterologous cells in the SAM of a periclinal chimera
can be reseparated and purified through asexual and sexual
propagation. For example, the asexual progeny (rTTT) of
a single cell lineage (T) can be generated from the LI layer
(T) of TCC, which is in tight contact with the LII layer (C).
In addition, the sexual progeny (GS) of a single cell genotype (T) can be produced by self-crossing TTC, because all
gametes are derived from the LII layer (T) (Satina, 1945),
which is in tight contact with the LIII layer (C). The progeny of chimeras derived from the T layer can be used to
analyse the exchange of genetic material between the T and
C layers. Consequently, studying the genetic characteristics
of the asexual and sexual progeny may yield insights into
the origin of GIGVs.
Small RNAs are transmitted between the cells of the
graft parents
It is generally believed that the exchange of genetic material
between heterologous cells is the key factor for GIGVs. To
determine whether sRNAs are transmitted between heterologous cells across the grafted SAM conjunction, this study
analysed plants regenerated from the single cell lineage of a
periclinal chimera by asexual method, since sRNA would be
degraded or diluted by sexual propagation. The TCC chimera
was used to determine the status of sRNAs in the T cell lineage
after contact with the C cell lineage. The plant samples were
obtained under aseptic conditions to eliminate contamination
by genetic material from other organisms. Before sequencing
Fig. 10. Quantitative PCR analysis of predicted target genes in
TTT and TTC sexual progenies: GS1, GS2, and GS3 exhibited a
decreasing degree of SAM growth termination.
the sRNAs isolated from rTTT, PCR analysis ruled out any
possible contamination from red cabbage cells (Fig. 7).
In previous studies, sRNA transmission has been analysed in stock–scion grafts. Analysis of the sRNAs in rTTT
revealed a change in the specific sRNAs expressed by the T
cell lineage after contact with the C cell lineage (Fig. 8A).
Specific sRNAs detected in rTTT were expressed in CCC
but not in TTT, suggesting that there may be an exchange of
sRNAs between cells of the T and C layers. There was a wide
range in the expression level of these sRNAs, from less than
10 reads to 100 reads, suggesting that sRNAs with different
biological functions are differentially regulated. Thus, these
data may be a starting point for future studies investigating
the transmission of heterologous sRNAs.
Although this work did not investigate the transmission of
sRNAs in the sexual progeny derived from the LII layer of
TTC, it is presumed that sRNAs from the C lineage can be
transmitted the T cell lineage too, due to the contact of T and
C cell lineages in the LII and LIII layers. Further research is
needed to determine whether the effect of sRNA transmission on TCC asexual progeny is consistent with the effect in
TTC sexual progeny.
GIGVs may be caused by changes in small RNAs and
inherited genetically and epigenetically
As described above, plantlets of the T cell lineage segregated
from chimeric tissues by asexual and sexual propagation
exhibited similar variations after a cell-contact period with
cells of the C lineage. GS1 and rTTT plants were homozygotes, as no further segregation of leaf morphological traits
was observed in their self-crossed progenies. This conclusion
is consistent with a previous study in which the variation
induced by grafting changed from a dominant homozygous
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
Fig. 9. Expression of target genes in TTT, RS1, and GS1. TCP2
and SPL9 are related to the formation of the leaf profile, and PHB
and PHV are related to SAM development.
Page 10 of 12 | Li et al.
expression level and phenotype. Furthermore, the expression
of target genes was consistent with the results of digital gene
expression profiling in TTT and variation progeny (JX Li,
LW Cao, and LP Chen, unpublished results). These findings
strongly implicate that grafting can affect the expression level
of miRNAs. However, further research is needed to gain a
better understanding of how grafting affects miRNA expression levels.
In conclusion, this study has provided a detailed characterization of GIGVs in periclinal chimeras of Brassica, as well
as conclusive evidence for changes in sRNA during grafting.
However, GIGVs induced by the exchange of heterologous
sRNAs may only occur under certain conditions. This study
proposes that the diverse patterns of GIGVs are due not
only to the transmission of heterologous sRNAs but also to
genetic and epigenetic changes in novel targets of the heterologous sRNAs in the recipient cells.
Supplementary material
Supplementary data are available at JXB online.
Supplementary Table S1. The identified sequences of
sRNAs transmitted between the TTT and CCC lineages.
Supplementary Fig. S1. Negative control hybridizations.
Acknowledgements
This work was supported by the National Natural Science
Foundation of China (grant no. 31272159), the Zhejiang
provincial Natural Science Foundation of China (grant
no. LZ12C15001) and the Specialized Research Fund for
the Doctoral Program of Higher Education (grant no.
20110101110089). The authors thank Dr Zhihui Chen from
the Division of Cell and Developmental Biology, College of
Life Sciences, University of Dundee for critical comments on
this paper.
References
Baulcombe D. 2004. RNA silencing in plants. Nature 431, 356–363.
Chan SWL, Zilberman D, Xie Z, Johansen LK, Carrington JC,
Jacobsen SE. 2004. RNA silencing genes control de novo DNA
methylation. Science 303, 1336.
Chen LP, Ge YM, Zhu XY. 2006. Artificial synthesis of interspecific
chimeras between tuber mustard (Brassica juncea) and cabbage
(Brassica oleracea) and cytological analysis. Plant Cell Reports 25,
907–913.
Ding B, Itaya A, Woo YM. 1999. Plasmodesmata and cell-to-cell
communication in plants. International Review of Cytology 190,
251–262.
Dunoyer P, Brosnan CA, Schott G, Wang Y, Jay F, Alioua A,
Himber C, Voinnet O. 2010. An endogenous, systemic RNAi
pathway in plants. The EMBO Journal 29, 1699–1712.
Frankel R. 1954. Graft-induced transmission to progeny of
cytoplasmic male sterility in petunia. Science 124, 684–685.
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
to a recessive homozygous trait (i.e., both alleles changed
at the same time) (Ohta, 1991). The variation in leaf morphology was reproducible and directional, suggesting that it
was guided by red cabbage cells by an undefined mechanism.
However, the heritable pattern of the SAM growth termination was different from that of leaf morphology, as it was
unstable and exhibited occasional reversions in the progeny.
Therefore, the SAM and leaf morphology variation have
independent patterns of inheritance.
It was previously reported that sRNAs from one parent plant can regulate found novel targets in the genome or
transcriptome of the opposite parent plant, and that 24-nt
sRNAs are associated with the methylation of DNA with
similar sequences (Hamilton et al., 2002; Baulcombe, 2004;
Chan et al., 2004). Moreover, epigenetic states can be inherited by sexual progeny in a Mendelian manner (Kakutani,
2002; Zilberman and Henikoff, 2005). In the present study,
the 23- and 24-nt sRNAs accounted for a significant proportion of the specific sequence sRNAs (Fig. 8B). Because leaf
variations were observed in successive generations, it could be
that epigenetic modifications or other changes induced by the
transmitted sRNAs play an important role in leaf variation.
However, due to the insufficiency of siRNA databases and
genomic information for tuber mustard, specific epigenetic
changes could not be identified. However, changes in epigenetic states have been observed by other groups. For example, Jacobsen and Meyerowitz (1997) found an epigenetically
inherited allele of the SUPERMAN (SUP) gene could revert
to the normal allele. The present study observed a similar
phenomenon for SAM growth termination. The frequency
of SAM termination progressively decreased in the sexual
progeny and it is hypothesized that the methylation pattern
of genes related to SAM development may have reverted to
the original state after several generations. This study group is
currently investigating DNA methylation to understand how
the heterologous siRNAs are exchanged and their roles in the
induction of GIGVs.
It has been reported that gene regulation through sequencespecific interactions between miRNAs and their target genes
can affect plant growth and development (Zhou et al., 2007;
Kim and Pai, 2009). Many mature miRNA sequences are conserved among evolutionarily related plant species. This work
found that the miRNAs in rTTT and TTT were well-conserved, although the expression levels of the conserved miRNAs differ (Table 3). The expression of the predicted target
genes varied along with quantitative changes in the conserved
miRNA and progeny phenotypes. For example, Williams
et al. (2005) reported that the downregulation of PHB and
PHV miRNA leads to upregulation of WUS transcription
in the organizing centre of SAM, causing SAM enlargement
(Kim et al., 2005). In the present study, the expression levels
of PHB and PHV were higher in the progeny than in TTT,
which correlated well with the observations of SAM growth
termination. Furthermore, the expression levels of PHV and
PHB differ with different ratios of SAM growth termination
in plants. The function of two genes reported in another previous study (Wu et al., 2009; Pulido and Laufs, 2010) supports the present observation of the relationship between
Heritable variations in graft chimera progeny | Page 11 of 12
Hamilton AJ, Voinnet O, Chappell L, Baulcombe DC. 2002. Two
classes of short interfering RNA in RNA silencing. The EMBO Journal
21, 4671–4679.
Murashige T, Skoog F. 1962. A revised medium for rapid growth
and bioassays with tobacco tissue cultures. Physiologia Plantarum 15,
473–497.
Haque AKM, Yamaoka N, Nishiguchi M. 2007. Cytosine
methylation is associated with RNA silencing in silenced plants but
not with systemic and transitive RNA silencing through grafting. Gene
396, 321–331.
Ohta Y, Chuong PV. 1975. Hereditary changes in Capsicum annuum
L. I. Induced by ordinary grafting. Euphytica 24, 355–368.
Hirata Y. 1979. Graft-induced changes in eggplant (S. melongena L.)
I. Changes of hypocotyl color in the grafted scions and in the progenies
from the grafted scions. Japanese Journal of Breeding 29, 318–323.
Oparka KJ, Roberts AG. 2001. Plasmodesmata. A not so openand-shut case. Plant Physiology 125, 123–126.
Hirata Y. 1980a. Graft-induced changes in eggplant (S. melongena
L.) II. Changes of fruit color and fruit shape in the grafted scions and in
the progeny of the grafted scions. Japanese Journal of Breeding 30,
83–90.
Hirata Y, Yagishita N. 1986. Graft-induced changes in soybean
storage proteins. I. Appearance of the changes. Euphytica 35,
395–401.
Hirata Y, Yagishita N, Ledoux L, Thiery M, Diels L. 1986. Graftinduced change in pepper and eggplant. Sixth Eucarpia meeting on
genetics and breeding on capsicum and Eggplant, October 21–24.
Zaragoza, Spain 19–23
Hirata Y, Sassa H, Yagishita N. 1989. Graft transformation in
tobacco (Nicotiana tabacum). Proceedings of the sixth international
congress of SABRAO, Tsukuba, Japan 531–534.
Jackson D. 2001. The long and the short of it: signaling development
through plasmodesmata. The Plant Cell 13, 2569–2572.
Jacobsen SE, Meyerowitz EM. 1997. Hypermethylated
SUPERMAN epigenetic alleles in Arabidopsis. Science 277,
1100–1103.
Kakutani T. 2002. Epi-alleles in plants: inheritance of epigenetic
information over generations. Plant Cell Physiology 43, 1106–1111.
Kim M, Canio W, Kessler S, Sinha N. 2001. Developmental
changes due to long-distance movement of a homeobox fusion
transcript in tomato. Science 293, 287–289.
Kim I, Pai HS. 2009. Mobile macromolecules in plant development.
Journal of Plant Biology 52, 186–192.
Kim J, Jung JH, Reyes JL, et al. 2005. microRNA-directed
cleavage of ATHB15 mRNA regulates vascular development in
Arabidopsis inflorescence stems. The Plant Journal 42, 84–94.
Lucas WJ, Bouché-Pillon S, Jackson DP, Nguyen L, Baker
L, Ding B, Hake S. 1995. Selective trafficking of KNOTTED1
homeodomain protein and its mRNA through plasmodesmata.
Science 270, 1980–1983.
Maluszynska J, Hasterok R. 2005. Identification of individual
chromosomes and parental genomes in Brassica juncea using GISH
and FISH. Cytogenetic and Genome Research 109, 310–314.
Molnar A, Melnyk CW, Bassett A, Hardcastle TJ, Dunn R,
Baulcombe DC. 2010. Small silencing RNAs in plants are mobile
and direct epigenetic modification in recipient cells. Science 328,
872–875.
Pandey KK. 1976. Genetic transformation and ‘graft-hybridization’ in
flowering plants. Theoretical and Applied Genetics 47, 299–302.
Pant BD, Buhtz A, Kehr J, Scheible WR. 2008. MicroRNA399
is a long-distance signal for the regulation of plant phosphate
homeostasis. The Plant Journal 53, 731–738.
Pulido A, Laufs P. 2010. Co-ordination of developmental processes
by small RNAs during leaf development. Journal of Experimental
Botany 61, 1277–1291.
Satina S, Blakeslee AF, Aveyr AA. 1940. Demonstration of the
three germ layers in the shoot apex of Datara by means of induced
polyploidy in periclinal chimeras. American Journal of Botany 27,
895–905.
Satina S. 1945. Periclinal chimeras in Datura in relation to the
development and structure of the ovule. American Journal of Botany
32, 72–81.
Stegemann S, Bock R. 2009. Exchange of genetic material between
cells in plant tissue grafts. Science 324, 649–651.
Taller J, Hirata Y, Yagishita N, Kita M, Ogata N. 1998. Graftinduced genetic changes and the inheritance of several characteristics
in pepper (Capsicum annuum L.). Theoretical and Applied Genetics
82, 68–79.
Wang Y, Cheng Q, Zhu XY, Chen LP. 2011. Studies on reproductive
characteristics of an interspecific chimera between Brassica juncea and
Brassica oleracea. Plant Cell, Tissue and Organ Culture 104, 209–215.
Williams L, Grigg SP, Xie MT, Christensen S, Fletcher JC. 2005.
Regulation of Arabidopsis shoot apical meristem and lateral organ
formation by microRNA miR166g and its AtHD-ZIP target genes.
Development 132, 3657–3668.
Wu G, Park M, Conway SR, Wang JW, Weigel D, Poethig RS.
2009. The sequential action of miR156 and miR172 regulates
developmental timing in Arabidopsis. Cell 138, 750–759.
Wu L, Zhou H, Zhang Q, Zhang J, Ni F, Liu C, Qi Y. 2010. DNA
methylation mediated by a microRNA pathway. Molecular Cell 38,
465–475.
Yagishita N. 1961. Studies on graft hybrids of Capsicum annuum
L. II. Variation in fruit shape caused by grafting of three successive
generations and effects in the progeny. Botanica Marina (Tokyo) 74,
480–489.
Zambryski P, Crawford K. 2000. Plasmodesmata: gatekeepers for
cell-to-cell transport of developmental signals in plants. Annual Review
of Cell and Developmental Biology 16, 393–421.
Zhang DH, Meng ZH, Xiao WM, Wang XC, Sodmergon. 2002.
Graft-induced inheritable variation in mungbean and its application in
Mungbean breeding. Acta Botanica Sinica 44, 832–837.
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014
Hirata Y. 1980b. Graft-induced changes in skin and flesh color in
tomato (Lycopersicon esculentum Mill.). Journal of the Japanese
Society for Horticulture Science 49, 211–216.
Ohta Y. 1991. Graft-transformation, the mechanism for graft-induced
genetic changes in higher plants. Euphytica 55, 91–99.
Page 12 of 12 | Li et al.
Zhou GK, Kubo M, Zhong R, Demura T, Ye ZH. 2007.
Overexpression of miR165 affects apical meristem formation, organ
polarity establishment and vascular development in Arabidopsis. Plant
Cell Physiology 48, 391–404.
Zhu XY, Zhao M, Ma S, Ge YM, Zhang MF, Chen LP. 2007.
Induction and origin of adventitious shoots from chimeras of
Brassica juncea and Brassica oleracea. Plant Cell Reports 26,
1727–1732.
Zhou JM, Hirata Y, Nou IS. 2002. Interactions between
different genotypic tissues in citrus graft chimeras. Euphytica 126,
355–364.
Zilberman D, Henikoff S. 2005. Epigenetic inheritance in
Arabidopsis: selective silence. Current Opinion in Genetics and
Development 15, 557–562.
Downloaded from http://jxb.oxfordjournals.org/ at College of Science Zhejiang University on May 8, 2014