Human Immunodeficiency Virus DNA Amplification and Serology in Blood Donors By L.H. Perrin, S.Yerly, N. Adami, P. Bachmann, E. Butler-Brunner, J. Burckhardt, and E. Kawashima The significance of indeterminate screening antibody test for human immunodeficiency virus (HIV) serology is still difficult t o evaluate, especially in low-risk populations. One hundred twenty-seven blood donors with an initially reactive screening test for HIV antibodies were enrolled in this study. The sera of 95 of these blood donors were reactive on repetition of the test, and none had detectable circulating p24 antigen. Western blot (WB) analysis of the repeatedly reactive sera was as follows: 9 positive, 31 indeterminate, and 55 negative. One of the blood donors with indeterminate WB later presented a seroconversion. On subsequent control 3 t o 12 months later, the sera from donors with indeterminate or negative WB did not present any parameters that may indicate a seroconversion. DNA was purified from citrated blood collected from the 127 blood donors at the time of the initial antibody screening. T HE RISK OF contracting human immunodeficiency virus (HIV) infection by transfusions is very small, following the introduction of the screening of blood products for antibodies against HIV type 1 (HIVl). Enzyme immunoassays (EIA) used for this purpose display a high sensitivity coupled with less than 100% specificity.’ This means that these tests detect the vast majority of donors infected with HIV, but also means that the tests have a poor predictive value for populations with a low prevalence of HIV infection. Therefore, more specific confirmatory tests are performed to distinguish between false-positive results on the screening EIA and the true-positive tests. The confirmatory tests include the Western blot (WB), radioimmunoprecipitation, and immunofluorescence assay^."^ These confirmatory assays do not always provide clear-cut results. For example, some sera react on WB with a single HIV component; the clinical importance of this kind of reactivity in low-risk populations is still ~ n c l e a rSimilar .~ difficulties in interpretation are encountered for samples repeatedly positive on EIA screening assays but negative on WB. There are various approaches to analyze the significanceof these results. One alternative is the monthly analysis of successive sera from the same individuals.6.’ A second alternative is to search for circulating viral antigen’ or isolate the virus itself by cocultivation.’ However, viral antigens are usually present at a very low concentration, and virus isolation is time-consuming and not always positive, even in known infected individuals.’ The third alternative is based on detection of HIV specific nucleic acids.’0’’2In this context, it has been shown that enzymatic amplification of conserved sequences of HIVl proviral DNA integrated into the genomic DNA of infected individuals is of interest for the early diagnosis of HIVl infection.”.” For this investigation we have selected blood donors on the basis of a positive EIA screening antibody test for HIVl. Serum samples of these blood donors have been further analyzed on WB. Genomic DNA purified from white blood cells of the same donors have been amplified by the polymerase chain reaction (PCR) using primers corresponding to HIVl DNA conserved sequences, and tested by hybridization using appropriate radiolabeled probes. B M , VOI 76, NO3 (August 1). 1990: pp 641-645 Five micrograms of each DNA sample corresponding to 7 x 10‘ nucleated white blood cells was amplified by polymerasechain reaction (PCR) in the presenceof oligonucleotides (primers) corresponding t o a highly conserved segment of the pol gene. The detection of amplified DNA was achieved by dot blot and Southern blot using appropriate 32P-labeled oligonucleotides. Ten DNA samples were positive, 9 corresponded t o blood donors with a positive HIV serology, and 1 t o the blood donor who later presented a seroconversion. These results confirm the sensitivity of the PCR for the diagnosis of HIV infection: they also suggest that repetition of the serology at 3-t o 12-month intervals is a valuable procedure for the control of HIV infection status in blood donors. 0 1990 by The American Society of Hematology. PATIENTS AND METHODS Blood donors and control population. One hundred twentyseven blood donors were selected on the basis of a positive EIA screening for antibodies against HIVl. These donors gave blood at the Blood Transfusion Service. Swiss Red Cross, Bern, and at the Geneva Blood Center, Switzerland. The samples were identified by their blood donation number. and the results of the HIV serology were not known to the technicians in charge of the DNA amplification assays. The control group consisted of 20 HIVl seronegative blood donors and 40 HIV1-infected patients followed at regular intervals at the outpatient clinic of the Department of Medicine (Geneva). HIVl serologic investigations. The Abbott HTLVIII EIA (Delkenheim, Wiesbaden) is used for the detection of antibodiesagainst HIVl. All positive sera are retested the next day and called “sera repeatedly positive” if they are positive on repetition. Repeatedly positive sera are next tested for p24 antigenemia (HIV antigen EIA, Abbott), and the specificity of anti-HIV1 antibodies is determined by WB (Dupont de Nemours, Bad Homburg).The results of WB are classified as negative (no reactive band detectable), indetermined (one single band or two weakly reactive bands), and positive (at least one band positive with one gene product corresponding to env. gag, and pol). Purification of DNA. DNA was isolated from 5 mL of citrated whole blood, collected for blood grouping, using a modification of the selective red blood cell (RBC) lysis procedure.” In brief, cells were washed twice with isotonic saline and the RBCs were selectively lysed with a solutionof 130 mmol/L NH, C1,O.g mmol/L NH4CO,. ~~ From the Department of Medicine and Blood Transfusion Center, Cantonal University Hospital of Geneva, Central Loboratory, Blood Transfusion Service SRC. Bern; and GIaxo IMB. Geneva, Switzerland. Submitted December 29,1989; accepted April 11.1990. Supported by the Federal w e e of the Public Health. Address reprint requests to L.H. Perrin, MD,Blood Transfusion Center, Cantonal University Hospital. 24. rue Micheli-du-crest, 121 1 Geneva 4, Switzerland. Thepublication costs of this article were defrayed in part by page charge payment. This article must therefoe be hereby marked “advertisement”in accordance with 18 U.S.C.section I734 solely to indicate this fact. 8 I990 by The American Society of Hematology. 0004-4971/90/7403~7$3.00/0 64 1 PERRIN ET AL 642 After centrifugation (2,000 rpm, 10 minutes), the loose pellet was treated with sodium dodecyl sulfate (SDS) and proteinase K, and the DNA was isolated by phenol extraction, precipitated by ethanol, and resuspended in 200 pL of 10 mmol/L Tris-HC1 pH 7.5, 1 mmol/L EDTA. DNA ampliJcation by PCR. By comparison of the available nucleotide sequences from several HIVl isolates (Gerald Myers, HIV sequence Database, Theoretical Biology and Biophysics, Los Alamos, NM), we selected one pair of conserved DNA sequences in the polymerase gene for use as primers, and two probes corresponding to sequences within the primers (Table 1). For the amplification of some of the DNA samples, additional pairs of primers corresponding to the gag (SK 38/39) and env (SK 68/69) genes, and corresponding probes (SK 19 and SK 70) were selected." Amplification of HIVl segments of proviral DNA was performed with slight modifications according to Ou et all0using a thermostable DNA polymerase (Taq DNA polymerase, Perkin Elmer Cetus, Norwalk, CT). In brief, 5 pg of each genomic DNA sample was mixed with 1.25 mmol/L of dATP, dTTP, dCTP, and dGTP; 50 mmol/L KCI; 10 mmol/L Tris HC1 pH 8.3; 2.5 mmol/L MgCI,; 0.01% gelatine; 0.5 mmol/L of primers 1 and 2 in a final volume of 100 pL. This mixture was treated for 5 minutes at 94°C and cooled in ice before the addition of 2.5 U of Taq polymerase to each sample. The samples were then overlayered with 100 pL of mineral oil (Sigma, St Louis, MO) to prevent evaporation. The samples were then transferred to a heating block (DNA thermal cycler, Perkin Elmer Cetus) at 55OC for 2 minutes (annealing of the primers to their target sequences); the temperature was then raised to 72OC (DNA synthesis) for 2 minutes, and denaturation was achieved by increasing the temperature to 94°C for 1 minute. This cycle was repeated 37 times. After the last cycle, all samples were incubated for an additional 2 minutes at 72°C. On each amplification procedure a known positive control DNA (at various concentrations: 5 pg, 0.5 pg, 0.05 pg) diluted in human DNA from a known HIV-negative individual was included. In the experimental conditions selected a very weak signal was observed on the dot and Southern blots using the lowest dilutions. All samples were tested at least twice. Hybridization and Southern blot analysis. Samples of 20 pL of amplified DNA were adjusted to 0.4 mol/L sodium hydroxide and 25 mmol/L EDTA. The mixture was heated at 95OC for 5 minutes, cooled, and neutralized by the addition of 0.8 mol/L ammonium acetate. Fifty microliters of denatured samples were applied to a nylon membrane (Gene Screen Plus; New England Nuclear) using a vacuum filtration Minifold I1 apparatus (Schleicher and Schiill). The membranes were baked at 8OoC for 30 minutes, prehybridized for 2 hours at 45°C in 4X SSC (standard saline citrate: 150 mmol/L sodium chloride, 15 mmol/L sodium citrate); 5X Denhardt's solution (1X Denhardt's: 0.02% ficoll, 0.02% polivinyl-pyrolidone,0.02% bovine serum albumin); 5% SDS; 20 mmol/L sodium phosphate pH 7; 100 pg/mL sheared and denatured salmon sperm DNA. Hybridization was performed by the addition of 50 ng/mL of oligonucleotide probe labeled with phosphorus 3214 at 45OC overnight. The membranes were then washed once with 3X SSC containing 0.1% SDS at 55°C for 15 minutes; once with 0.5X SSC containing 0.1% SDS at 55OC for 15 minutes; twice with 0.1X SSC containing 0.1% SDS at 55OC for 15 minutes. The membranes were autoradiographed for 2 to 16 hours with an intensifying screen at -8OOC. For Southern blot analysis, 10 pL of the amplified samples was subjected to electrophoresis on agarose NU-Sieve (FMC) 3% gel and transferred to a Gene Screen Plus nylon membrane (New England Nuclear) before hybridization with the labeled oligonucleotide probe. The hybridization protocol was the same as described above. RESULTS For the preliminary investigations, 20 individuals with anti-HIV1 antibodies (by EIA and WB) and 20 blood donors without anti-HIV1 antibodies (at the time of investigation and on at least two occasions in the previous year) were selected. D N A from each of these individuals was purified and amplified by PCR using three pairs of primers corresponding to the env, gag, and pol genes of HIVl, respectively. The amplified samples were tested by dot blot and Southern blot using appropriate 32Pend-labeled probes (for pol: probe 1). All the seronegative blood donors were negative, except one, for whom a weak signal was obtained on dot blot, but not on Southern blot, with the gag probe. For the 20 seropositive individuals, a positive signal was observed in 19 of 20 samples for the env probe, in 15 of 20 samples for the gag probe, and in 20 of 20 samples for the pol probe, using the appropriate amplified D N A samples each time. This preliminary step was extended by testing D N A samples purified from 20 additional seropositive individuals using the pol primers and both probes 1 and 2 contained within the DNA sequence amplified by the pol primers. All the amplified D N A gave positive signals on dot blot and Southern blot using probe 1, and 19 of 20 using probe 2. Therefore, the pair of pol primers and the probes 1 and 2 contained within the primers were selected for subsequent investigations. The results of the serologic investigations conducted on blood donors are reported in Fig 1. All the repeatedly positive samples were tested for p24 antigenemia, and none were positive. All of the blood donors with a positive serology for HIVl infection confirmed by WB underwent control of their serology within 20 days on a second serum sample. Most of the blood donors with initially reactive serology by EIA also had one or more control within the next 3 to 12 months (72 of them had a t least two controls). As expected, the second samples collected from blood donors with nonreactive EIA on repetition of the test at the start of the study were all negative on subsequent control. For blood donors with repeatedly reactive serum by EIA but with negative WB, the general trend was either a disappearance or a diminution of the reactivity by EIA as measured by sample to cut-off index, or a persistence at the same level of the reactivity on EIA; Table 1. Localization and Nucleotide Sequences of Primers and Probes Used for the PCR (pol gene) Primer OT Probe Localization in HIV BRU. Sequences Primer 1 Primer 2 Probe 1 Probe 2 4107-42 12 43 15-4340 42 10-4230 4225-4259 CATGGGTACCAGCACACAAAGGAAIT TCACTAGCCATTGCTCTCCAATTACT TTGGAGGAAATGAACAAGTAG ~CCTGATTCCAGCACTGACTAAmATCTACTACTT 1 1 1b BRU alignment (Gerald Myers, HIV sequence Database). (5'-3') HIV DNA AMPLIFICATION IN BLOOD DONORS 643 EIA WESTERN BLOT Start Start ____ 3-1 2 Months Later Initially reactive 127 Positive / Repeatedly reactive g Positive* 9 Positive 1 indeterminate Indeterminate 95 18 Negative Not tested 3 \ \ Negative** Negative < 5 3 55 Not tested 2 Negative** Fig 1. Serology of blood donors. *Control carried on 10 to 20 days later on this group. **On these groups the control was carried on only by EIA. I Nonreactive32 on repetition similar findings were observed for blood donors with undetermined WB. The only notable exception was observed on the sera of a 25-year-old single male who seroconverted. This blood donor was controlled four times during the year preceding this study and was negative on EIA screening. The sample collected initially for this study had an index of 2.8 for the EIA antibody screening test, there was no p24 antigenemia, and the serum reacted with p24 only on WB. In this context, the blood donor was controlled 20 days later and his serum reacted on WB with gp160, p120, gp41, p66, and p24. The origin of the infection was a homosexual contact. The D N A samples of 127 blood donors enrolled in the study and of 20 additional controls (blood donors repeatedly seronegative by EIA) were amplified on two separate occasions with the pol primers and tested with probes 1 and 2. Ten of the D N A samples were positive four times by dot blot analysis and subsequently on Southern blot. Nine of these D N A samples corresponded to D N A samples of blood donors with positive HIVl serology, and one corresponded to the above-mentioned blood donor with an indeterminate reactivity on WB, followed by a seroconversion. Seven D N A samples from pol PCR-positive blood donors and 30 samples from repeatedly serologically reactive pol PCR-negative individuals were prepared at the time of the second serologic control, amplified with the pol and gag primers and tested 4 Not 31 tested 1 with the appropriate probes. Results with the pol primers were identical to those observed on the first passage. Six of the seven D N A samples prepared from seropositive individuals were also positive using the gag system; for the other samples, two DNA samples from serologically repeatedly reactive individuals, pol PCR-negative, gave a very weak signal with the gag system. This signal was clearly less intense than that observed with the positive samples and was not confirmed on Southern blot analysis and on a second amplification procedure. DISCUSSION Voluntary deferral of blood donation by persons a t risk for HIVl infection and systematic screening of blood donations for HIVl antibodies have markedly reduced the risk of transfusion-associated HIV infection,’5s16but rare cases of transfusion-associated HIV 1 infection by screened blood products have been reported.15.” There is effectively a “window” period between the start of the infection and the appearance of specific anti-HIV1 antibodies that may last up Recent publications also indicate that the to a detection of HIVl D N A sequences is possible before the appearance of specific anti-H1V1 antibodies through amplification of proviral D N A sequences by PCR.1’.12,20 PERRIN ET AL 644 For this investigation we have selected blood donors on the basis of initially reactive EIA for HIVl antibodies to search for the presence in their D N A of HIVl sequences. As expected, most of the sera of these blood donors were not classified as positive for HIVl antibodies according to W B analysis. However, the blood donors with negative or indeterminate W B may present an increased risk of HIVl infection compared to blood donors with negative screening tests. In this group we identify a blood donor with indeterminate WB, who later presented a seroconversion. This is a rare event and our sequential serologic analysis of sera of donors with an initially reactive screening test, not confirmed by WB, supports previous investigations demonstrating that the vast majority of these blood donors did not present seroconversion on subsequent control^.^.' One of the limitations of PCR technology in the identification of proviral DNA of HIVl is the marked variation of the HIVl genome among virus isolates. In this respect the percentage of known HIV 1-infected individuals detected by the PCR technology varied markedly depending on the choice of the primer pairs.”-” Here we have selected a highly conserved pair of primers within the pol gene. With these primers, we amplified and detected proviral HIV DNA in 40 of 40 seropositive patients. Negative results were obtained in some of the patients using primers corresponding to the env and gag genes. The present investigation based on pol primers confirms the usefulness, sensitivity, and specificity of PCR for the diagnosis of HIV infection since all seropositive blood donors gave a positive signal. In addition, by PCR we were able to identify one blood donor with indeterminate serology who later presented a seroconversion. In contrast, none of the other 127 blood donors with initially reactive screening tests not confirmed by WB had positive PCR results. This suggests that these donors are not infected by HIV and that the serologic results may be interpreted in the context of cross-reactive antibodies shared by HIVl and other nonself-components. However, these results should be modulated in relation to the amount of genomic D N A amplified (5 pg corresponding to approximately 7 x lo5 nucleated cells); to the percentage of nucleated cells carrying the virus; to the sensitivity of the method, which is not able to detect less than 10 copies of proviral HIV”; and to the possible deletion of part of the pol gene for some HIV isolates. Therefore, it is not possible to completely exclude low-grade HIVl infection in the population studied. However, the number of samples tested, the reproducibility of the results, and the efficiency of the test for known positive individuals strongly argue against low-grade HIVl infection in these blood donors. Finally, comparison of the serologic analysis and the PCR results suggest that repetition of serology a t 3- to 12-month intervals is a satisfactory procedure to determine the infectious HIV status of blood donors with initially reactive EIA not confirmed as positive by WB. ACKNOWLEDGMENT We thank K. Zollinger and P. Schreiber for expert technical assistance, and C. Brown for preparing the manuscript. REFERENCES 2. The Consortium for Retrovirus Serology Standardization: Serological diagnosis of human immunodeficiencyvirus infection by Western blot testing. JAMA 260:674, 1988 3. Kitchen LW, Barin F, Sullivan JL, McLane MF, Bretter DB, Levine PH, Essex M: Aetiology of AIDS antibodiesto human T-cell leukemia virus (type 111) in hemophiliacs. Nature 312:367,1984 4. Carlson JR, Yee J, Hinrichs SH, Bryant ML, Gardner MB, Pedersen NC: Comparison of indirect immunofluorescence and Western blot for detection of anti-human immunodeficiency virus antibodies.J Clin Microbiol25:494, 1987 5. Biberfeld G, Bredberg-Raden U, Bottiger B, Putkonen PO, Blomberg J, Juto P, Wadell G: Blood donor sera with false positive Western blot reactions in human immunodeficiency virus. Lancet M, Haynes BF, Palker TJ, Redfield R, Oleske J, Safai B, White G, Foster P, Markhan PD: Frequent detection and isolation of cytopathic retroviruses(HTLV-111) from patients with AIDS and at risk for AIDS. Science 224500, 1984 10. Ou CY, Kwok S, Mitchell SW, Mack DH, Sninsky JJ, Krebs JW, Feorino P, Warfield D, SchochetmanG: DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells. Science 239:295, 1988 11. Loche M, Mach B: Identification of HIV-infected seronegative individuals by a direct diagnostic test based on hybridisation to amplified DNA. Lancet 2:418, 1988 12. Laure F, Rouzioux C, Veber E, Jacomet C, Courgnaud V, Blanche S, Burgard M, Griscelli C, Brechot C: Detection of HIVl DNA in infants and children by means of the polymerase chain reaction. Lancet 2538, 1988 13. Poncz M, Solowiejczyk D, Harpel B, Mory Y, Schwartz E, Surrey S: Constructionof human gene libraries from small amounts of peripheral blood: Analysis of B like globin genes. Hemoglobin 2:289, 1986 6. Mozzi F, Zanella A, Bellobuono A: Clinical and laboratory 6:21, 1982 14. Angelini G, De Preval C, Gorski J, Mach B: High resolution follow-up of asymptomatic blood donors with only anti-HIV core antibodies.Vox Sang 54:188, 1988 7. Van der Poel CL, Lelie PN, Reesnick HW, Van Exel-Oehlers PJ, Tersmette M, Van den Akker R, Gonsalves M, Huisman JG: Blood donors with undeterminate anti-p24 gag reactivity in HIVl Western blot: Absence of infectivity to transfused patients and in virus culture. Vox Sang 56:162, 1989 8. Bgker U, Weinauer F, Gathof G, Eberle J: HIV antigen screening in blood donors. Lancet 2:1213, 1987 9. Gallo RC, Salahuddin S Z , Popovic M, Shearer GM, Kaplan analysis of the human HLA-DR polymorphism by hybridisation with sequence specific oligo probes. Proc Natl Acad Sci USA 1 . Reesnik HW, Lelie PN, Huisman JG, Schaasberg W, Gon- salves M, Aaij C, Winkel IN, Van der Does JA, Hekker AC, Desmyter J, Goudsmit J: Evaluation of six enzyme immunoassays for antibody against human immunodeficiency virus. Lancet 2:483, 1986 83:4489, 1986 15. Ward JW, Grindon AJ, Feorino PM, Homberg SD, Allen JR, Cohn DL, Gritchley SE, Kleinman SH, Lenes BA, Ravenhdt 0, Davis JR, Quinn MG, Jaffe HW: Transmission of human immunodeficiency virus (HIV) by blood transfusion screened as negative for HIV antibody. N Engl J Med 318:473,1988 16. Leitman SF, Klein HG, Melpolder JJ, Read EJ, Esteban JI, Leonard EM, Harvath L, Wai-Kuo Shih J, Nealon R, Foy J, Darr F, HIV DNA AMPLIFICATION IN BLOOD DONORS Alter HJ: Clinical implications of positive tests for antibodies to human immuno-deficiency virus type 1 in asymptomatic blood donors. N Engl J Med 321:917,1989 17. Cohen ND, Munoz A, Reitz BA, Ness PK, Frazier OH, Yawn DH, Lee H, Blattner W, Donahue JG, Nelson KE, Polk F Transmission of retro-viruses by transfusion of screened blood in patients undergoing cardiac surgery. N Engl J Med 320:1172, 1989 18. Rank A, Valle SL, Krohn M, Antonen J, Allain JP, Leuther M, Franchini G: Long latency precedes seroconversion in sexually transmitted human immunodeficiencyvirus infection. Lancet 2:889, 1983 19. lmagawa DT, Lee MH, Wolinsky SM, Sang K, Morales F, Kwok S, Sninsky JJ, Nishanian PG, Giogi J, Faney JL, Dudley J, 645 Visscher BR, Detels R: Human immunodeficiency virus type 1 infection in homosexual men who remain seronegative for prolonged periods. N Engl J Med 320:1458, 1989 20. Horsburgh CR Jr, Ou CY, Jason J, Holmberg SD, Longini IM, Schable C, Mayer KH, Lifson AR, Schochetman G, Ward JW, Rutherford GW, Evatt BL, S a g e GR, Jaffe HW: Duration of human immunodeficiency virus infection before detection of antibody. Lancet 2:637, 1989 21. Abbott MA, Poiesz BJ, Byrne BC, Kwok S , Sninsky JJ, Ehrlich GD: Enzymatic gene amplification: Qualitative and quantitative methods for detecting proviral DNA amplified in vitro. J Inf Dis 158:1158, 1988
© Copyright 2026 Paperzz