Production of Man5GlcNAc2-type sugar chain by the methylotrophic
yeast Ogataea minuta
Kousuke Kuroda1, Kazuo Kobayashi1, Haruhiko Tsumura1, Toshihiro Komeda2, Yasunori Chiba3 &
Yoshifumi Jigami3
1
CMC R&D Laboratories, Pharmaceutical Division, Kirin Brewery Co. Ltd, Gunma, Japan; 2Central Laboratories for Frontier Technology, Kirin Brewery
Co. Ltd, Gunma, Japan; and 3Research Center for Glycoscience (RCG), National Institute of Advanced Industrial Science and Technology (AIST), Ibaraki,
Japan
Correspondence: Yoshifumi Jigami,
Research Center for Glycoscience (RCG),
National Institute of Advanced Industrial
Science and Technology (AIST), Tsukuba,
Ibaraki 305-8566, Japan. Tel.: 181 29 861
6160; fax: 181 29 861 6161;
e-mail: [email protected]
Received 28 December 2005; revised 5 April
2006; accepted 26 April 2006.
First published online 15 June 2006.
DOI:10.1111/j.1567-1364.2006.00116.x
Editor: José Ruiz-Herrera
Keywords
Ogataea minuta ; OCH1 ; sugar chain.
Abstract
The methylotrophic yeast Ogataea minuta IFO 10746 was selected as a suitable
strain for producing human-compatible glycoproteins by means of analyses of its
cell-wall mannoproteins. First, the OmURA3 gene encoding an orotidine-5 0 phosphate decarboxylase was cloned and disrupted to generate a host strain with
a uracil auxotrophic marker. Second, both the promoters and the terminators from
the OmAOX1 gene encoding an alcohol oxidase for an inducible promoter, or
those from the OmTDH1 gene encoding a glyceraldehyde-3-phosphate dehydrogenase for a constitutive promoter, were isolated to construct an expression vector
system for heterologous genes. Next, the OmOCH1 gene encoding a starting
enzyme with a-1,6-mannosyltransferase activity to form a backbone of the Nlinked outer sugar chain peculiar to yeast was disrupted, and an a-1,2-mannosidase gene from Aspergillus saitoi with an endoplasmic reticulum retention signal
(HDEL) under the control of the OmAOX1 promoter was introduced to convert
the sugar chain to Man5GlcNAc2 in O. minuta. As a result, we succeeded in
breeding a new methylotrophic yeast, O. minuta, producing a Man5GlcNAc2high-mannose-type sugar chain as a prototype of a human-compatible sugar
chain. We also elucidate here the usefulness of the strategy for producing humancompatible sugar chains in yeast.
Introduction
In recent years, research on the commercial uses of yeast has
been undertaken for the purpose of heterologous protein
production. The benefits of a yeast production system are
that cells can be grown to high density on a low-cost
medium, and the cells can secrete the active form of the
protein with the addition of a sugar chain (Cregg et al., 1993;
Faber et al., 1995). Given that the widely used Saccharomyces
cerevisiae has low productivity except in some cases, heterologous protein production systems involving other yeasts
have been developed, for example Schizosaccharomyces
pombe, Kluyveromyces lactis and methylotrophic yeasts
(Dominguez et al., 1998; Muller et al., 1998; Sudbery et al.,
1988; Daly & Hearn, 2005).
Because methylotrophic yeasts have methanol-inducible
promoters that express heterologous genes at a high level
with a methanol-containing medium, they gain high productivity using these promoters (Higgins & Cregg, 1998;
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
Cereghino & Cregg, 2000; de Bruin et al., 2005). Based on
these characteristics, it is thought that a methylotrophic
yeast may be an extremely effective host for glycoprotein
production. However, the transformation and heterologous
gene expression systems have been established in only four
species, Candida boidinii, Hansenula polymorpha, Pichia
pastoris and Pichia methanolica. There are differences in the
sugar chain structure, inducible carbon sources and codon
usage among the species.
Yeasts produce glycoprotein with a heterogeneous sugar
chain that makes purification difficult (Bekkers et al., 1991).
Although sugar chains of mammalian cells, including
those of Homo sapiens, have various types of N-linked
sugar chains such as the high-mannose-type, hybrid-type,
complex-type and O-linked mucin-type sugar chains,
a yeast such as S. cerevisiae produces a high-mannan-type
N-linked sugar chain and an O-linked sugar chain with
only mannose (Gemmill & Trimble, 1999). Because of
these differences in sugar chains, the glycoprotein produced
FEMS Yeast Res 6 (2006) 1052–1062
1053
Man5GlcNAc2-type sugar chain by Ogataea minuta
by yeast does not have the same physiological activity as
glycoproteins from mammalian cells and shows strong
immunogenicity against mammals (Ballou, 1990). For this
reason, it is necessary, for medical use in humans, to convert
the yeast sugar chain into a chain that is compatible with
humans.
A mannan-type sugar chain is composed of several to a
hundred or more mannose residues that are attached to a
Man8GlcNAc2 high-mannose-type sugar chain (Ballou
et al., 1990), but no enzyme that trims the mannoside
linkage in the Golgi apparatus has been found in yeast. By
contrast, the a-mannosidase I (a-1,2-mannosidase), which
cleaves an a-1,2-mannoside linkage, converts Man8GlcNAc2 sugar chains into Man5-8GlcNAc2-type sugar
chains in mammalian cells.
In a yeast such as S. cerevisiae, the a-1,6-mannosyltransferase, encoded by the OCH1 gene, catalyses the initial
reaction of the outer sugar chain formation. This reaction
functions as a trigger for attaching excessive mannose
residues compared with mammalian cells, thereby resulting
in the formation of a mannan-type sugar chain peculiar to
yeast (Nakayama et al., 1992; Yoko-o et al., 2001; BarnayVerdier et al., 2004). The glycoprotein from the OCH1
gene disruptant (Doch1) has three types of sugar chain,
Man8GlcNAc2, Man9GlcNAc2 and Man10GlcNAc2. The
Man8GlcNAc2 sugar chain has the same structure as the
endoplasmic reticulum (ER) core sugar chain, which is
present in both S. cerevisiae and mammalian cells. In yeast,
the Man8GlcNAc2 sugar chain was successfully produced
by preparing a Doch1Dmnn1 mutant of S. cerevisiae
(Nakanishi-Shindo et al., 1993). Furthermore, we succeeded
in producing the Man5GlcNAc2 high-mannose-type
sugar chain by breeding a novel Doch1Dmnn1Dmnn4
strain, in which the a-1,2-mannosidase gene from Aspergillus saitoi was transferred (Chiba et al., 1998; Takamatsu
et al., 2004).
Given this situation, a great deal of attention has been
paid to research into the conversion of the sugar chain of
yeast into a human-compatible type. Some groups have
succeeded in producing the complex-type sugar chain
Gal2GlcNAc2Man3GlcNAc2 (Choi et al., 2003; Nett &
Gerngross 2003; Bobrowicz et al., 2004; Wildt & Gerngross,
2005) with the methylotrophic yeast P. pastoris, but the
protein productivity differed depending on the host strains
and the sugar chains, which included untrimmed glucose
residues (Davidson et al., 2004). In order to construct a
glycoprotein production system using a yeast different from
P. pastoris, we selected the methylotrophic yeast Ogataea
minuta IFO 10746 as a suitable candidate for converting the
sugar chain of yeast into a human-compatible type. Here we
show the construction of the host–vector system and the
production of a Man5GlcNAc2-type sugar chain by this
yeast.
FEMS Yeast Res 6 (2006) 1052–1062
Materials and methods
Yeast strains and media
The strain used in this study was O. minuta IFO10746. The
yeast was cultured at 30 1C in the following media: SD
medium [0.67% yeast nitrogen base without amino acids
(YNB), 1% glucose]; SG medium (0.67% YNB, 1% glycerol); SM medium (0.67% YNB, 1% methanol); BYPGM
medium (2% Bacto-peptone, 1% Bacto-yeast extract,
1.34% YNB, 0.1 M phosphate buffer, pH 6.0, 0.5% glycerol,
1% methanol); and YPD medium (1% Bacto-yeast extract,
2% Bacto-peptone, 2% glucose). Transformants were selected on an SD medium plate as auxotrophic markers or on
a YPD plate supplemented with G418 at 400 mg mL1.
DNA methods
Escherichia coli DH5a was used for subcloning of the
plasmids. The plasmids were prepared by a QIAprep Spin
Miniprep Kit (Qiagen) from E. coli DH5a. A DNA fragment
from agarose gel was recovered by the QIAquick Gel Extraction Kit (Qiagen). The PCR-amplified DNA fragment was
subjected to DNA sequence analysis using a DNA sequencer
(Model 3700, ABI). The O. minuta genome was prepared
according to GENtorukun (TAKARA BIO).
Cloning of OmTDH1 , OmURA3 , OmAOX1 and
OmOCH1 genes
Ogataea minuta IFO10746 was used as a source of genomic
DNA. Degenerated primers for the amplification of a part of
OmTDH1, OmURA3, OmAOX1 and OmOCH1 genes by
PCR were synthesized based on a conserved amino acid
sequence among the various yeast strains shown in Table 1.
Amplified DNA fragments were cloned into pCR2.1 TOPO
(Invitrogen). The DNA fragments obtained were radiolabeled by the Megaprime DNA Labeling System (Amersham). In order to obtain the DNA fragment including the
whole target gene, the genomic DNA of O. minuta was
digested by various restriction enzymes and hybridized with
the labeled DNA probe. The restriction enzymes chosen to
digest the genomic DNA are detailed in Table 1. The digested
genomic DNA was inserted into a commercially available
cloning vector such as pBluescript II SK (Stratagene) or
pUC18 (TAKARA BIO) (Table 1). The resultant genomic
library was introduced into E. coli DH5a. The objective
DNA fragment was obtained by screening the positive clones
in colony hybridization with the labeled DNA probe.
Construction of plasmids for disruption of the
OmURA3 gene
The OmTDH1 gene was isolated as plasmid pOMGP1
containing a 6.0 kb HindIII–EcoRV fragment from the O.
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
1054
K. Kuroda et al.
Table 1. DNA primers used to obtain DNA probes for molecular cloning
Gene name
Primer
Nucleotide sequence
Referred genes
OmAOX1
PAX5
PAX3
PGP5
PGP3
PUR5
PUR3
POH5
POH3
5 0 -GGNGGNGGNWSNWSNATHAAYTTYATGATGTAYAC-3 0
5 0 -TTRTANGCCCANACCATNGGCCACATRTC-3 0
5 0 -GCNTAYATGTTYAARTAYGAYWSNACNCAYGG-3 0
5 0 -CCNCCNCKCCARTCYTTRTGNSWNGGNCCRTC-3 0
5 0 -GGNCCNTAYATHTGYYTNGTNAARACNCAYATHGA-3 0
5 0 -GGRTCNCKNCCYTTNCCRAANARNCCNCKNCC-3 0
5 0 -CCNCARCRYRTHTGGCARACNTGGAARGT-3 0
5 0 -CCAYTGRCARAAYTGDATNCKNCKNGCRTACCA-3 0
Pichia pastorisw
Candida boidiniiz
Saccharomyces cerevisiae‰
Pichia pastorisz
Saccharomyces cerevisiaek
Pichia pastoris
Saccharomyces cerevisiaeww
Pichia pastoriszz
OmTDH
OmURA3
OmOCH1
Plasmid for library/
Restriction enzyme
pUC18/HindIII
pBluescript II SK /HindIII-EcoRV
pUC18/HindIII
pBluescript II SK /XbaI
GenBank accession nos.:
U96967, U96968; zQ00922; ‰P00359; zQ92263; kK02207; AF321098; wwP31755. Japanese Patent Publication (Kokai): zz9-3097A.
w
Table 2. DNA primers used
DNA primer
Nucleotide sequence
UR-1
UR-2
GP-1
5 0 -ATGGAGAAAAAACTAGTGGATATACCACC-3 0
5 0 -CTGAGACGAAAAAGATATCTCAATAAACCC-3 0
5 0 -GTTTGAATTCACTCAATTAACATACACAAATACAATACAAAGTCGACAAAAAATGCATGTGGATAGATGACCAATGGCCTCTTTAAGTAAACATTTCGTTTTGAATATATTTC-3 0
5 0 -TTTTTACTAGTACGGTACCGCTCGAATCGACACAGGAG-3 0
5 0 -CTGCAGCCCCTTCTGTTTTTCTTTTGACGG-3 0
5 0 -CCCCCGGATCCAGGAACCCGGGAACAGAATCTAGATTTTTTCGTAAGTCGTAAGTCGTAACAGAACACAAGAGTCTTTGAACAAGTTGAG-3 0
5 0 -CCCCCCCGGATCCGAGACGGTGCCCGACTCTTGTTCAATTCTTTTGG-3 0
5 0 -CCCATAATGGTACCGTTAGTGGTACGGGCAGTC-3 0
5 0 -CCCCGAGCTCAAAAAAAAGGTACCAATTTCAGCTCCGACGCCGGAGCCCACTACGCCTAC-3 0
5 0 -GGGAAGCTTCCCCAGTTGTACACCAATCTTGTCGACAG-3 0
5 0 -GGGTCTAGAATGGTGGTCTTCAGCA-3 0
5 0 -CCCATGCATCTACAATTCGTCGTGT-3 0
5 0 - GGGTCTAGAATGACCATGATTACGAATTG-3 0
5 0 -CCCAGATCTTTATTATTTTTGACACCAGA-3 0
5 0 - GGGCTCGAGATGACCATGATTACGAATTG-3 0
5 0 -CCCATGCATTTATTATTTTTGACACCAGA-3 0
5 0 -AGGAAGAAGAGGAGGAAGAGGAAGAAAC-3 0
5 0 -CGATGCCATTGGGATATATCAACGGTGG-3 0
5 0 -CCGTGTTTGAGTTTGTGAAAAACCAGGGC-3 0
5 0 -TGTGGCGTGTTACGGTGAAAACCTGGCC-3 0
5 0 -CCATTGTCAGCTCCAATTCTTTGATAAACG-3 0
5 0 -ATCGATTTCGAGTGTTTGTCCAGGTCCGGG-3 0
5 0 -ACACTTCCGTAAGTTCCAAGAGACATGGCC-3 0
5 0 -TCACCACGTTATTGAGATAATCAAACAGGG-3
5 0 -GATATCACCAACGCCCACGGAGTGACCGGCTCGCG-3 0
5 0 -TCATGCGACACGACTCAAATAAGCGTCCCATCC-3 0
5 0 -CCCTGTTTGATTATCTCAATAACGTGGTGAGTGAC-3 0
5 0 -CGTCAAAACTGAACGAACAGCCCCATGCGGCGTGC-3 0
GP-2
AX-1
AX-2
AX-3
AX-4
RU-1
RU-2
MS-1
MS-2
LZ-1
LZ-2
LZ-3
LZ-4
DU5
DUC5
DU3
DUC3
DO3
DOU5
DO5
DO3-2
omura-sou-F
omura-sou-R
omoch-sou-F
omoch-sou-R
minuta genomic library. Plasmid pOMGP2 was constructed
by subcloning a 3.2 kb HindIII–BamHI fragment containing
the OmTDH1 gene from pOMGP1 into pBluescript II
SK . Plasmid pOMGP3 was constructed by transferring a
3.0 kb HindIII–KpnI fragment of pOMGP2 into pUC19 in
which the EcoRI site was blunt-ended. A 0.6-kb DNA
fragment was amplified by PCR using primers GP-1 and
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
GP-2 (Table 2) and pOMGP2 as a template. Plasmid
pOMGP4 was constructed by transferring an amplified
0.6-kb EcoRI–KpnI fragment into pOMGP3. pOMGP4 had
an OmTDH1 expression cassette comprising the SalI and
EcoT22I cloning sites between the TDH1 promoter and
terminator. In order to construct a cassette for the G418resistant marker, a 1.1-kb G418-resistant gene isolated as a
FEMS Yeast Res 6 (2006) 1052–1062
1055
Man5GlcNAc2-type sugar chain by Ogataea minuta
XhoI–PstI fragment from plasmid pUC4K (Pharmacia) was
inserted into the SalI–EcoT22I site of pOMGP4, resulting in
pOMKmR1.
The OmURA3 gene was isolated as plasmid pOMUR1
containing a 4.5-kb HindIII fragment from the O. minuta
genomic library. Plasmid pOMUM1 was constructed by
subcloning a 3.0-kb NotI–KpnI fragment containing the
OmURA3 gene into a pBluescript II SK . Plasmid pOMUM2 was constructed from pOMUM1, in which the NotI
and StyI sites had been blunt-ended and self-ligated. A part
of the chloramphenicol-resistant gene was amplified by PCR
using primers UR-1 and UR-2 (Table 2) and plasmid
pHSG398 (TAKARA BIO) as a template. Plasmid pOMUM3
was constructed by transferring the 0.4-kb amplified DNA
fragment digested with SpeI and EcoRV into pOMUM2. The
HindIII site of pOMKmR1 described above was converted to
the KpnI site to construct pOMKmR2. A knock-out vector
pDOMU1 for the URA3 gene of O. minuta was constructed
by transferring a 3.0-kb KpnI fragment containing the G418resistant gene expression cassette from pOMKmR2 into
pOMUM3.
Construction of expression vectors
The OmAOX1 gene was isolated as plasmid pOMAX1
containing a 6.0-kb HindIII fragment from the O. minuta
genomic library. A 0.5-kb DNA fragment was amplified by
PCR using primers AX-1 and AX-2 (Table 2) and plasmid
pOMAX1 as a template. Plasmid pOMAX2 was constructed
by transferring the 0.5-kb amplified DNA fragment digested
with PstI and BamHI into pOMAX1. A 0.8-kb DNA fragment was amplified by PCR using primers AX-3 and AX-4
(Table 2) and pOMAX1 as a template. Plasmid pOMAX3
was constructed by transferring the 0.8-kb amplified DNA
fragment digested with BamHI and KpnI into pOMAX2.
Plasmid pOMAX2 had the OmAOX1 expression cassette,
comprising the XbaI, SmaI and BamHI cloning sites between the OmAOX1 promoter and terminator.
Plasmid pOMUR2 was constructed by a 3.1-kb BglII–
HindIII fragment including OmURA3 from pOMUR1 into
pUC19. Plasmid pOMUR3 was constructed by converting
the StyI and SacI (in pUC19) sites in pOMUR2 into the ApaI
site. Plasmid pOMUR4 was constructed by disruption of the
XbaI site in pOMUR3. Plasmid pOMUR5 was constructed
by converting the Sa1I site in pOMUR4 to the NotI site. The
expression vectors pOMEU1 and pOMEGPU1 were constructed by transferring a 3.1-kb HindIII–KpnI fragment
isolated from pOMAX3 and a 2.0-kb HindIII–KpnI fragment isolated from pOMGP4 into pOMUR5, respectively.
pOMEU1 and pOMEGPU1 were used for heterologous gene
expression.
Plasmid pGAMH1 contained an A. saitoi-derived a-1,2mannosidase gene with both a signal sequence of aspergilloFEMS Yeast Res 6 (2006) 1052–1062
pepsin I (ApnS) at the amino terminus and a yeast ER
retention signal sequence (His-Asp-Glu-Leu) at the carboxyl
terminus (Chiba et al., 1998). Plasmid pOMEU1T was
constructed by the conversion of the BamHI site of pOMEU1 into the EcoT22I site. A 1.5-kb a-1,2-mannosidase
gene was amplified by PCR using primers MS-1 and MS-2
(Table 2) and plasmid pGAMH1 as a template. Plasmid
pOMEU1/Ms was constructed by insertion of a 1.5-kb
amplified DNA fragment into pOMEU1T.
Construction of plasmids for disruption of the
OmOCH1 gene
The upstream region of the OmURA3 structural gene was
amplified by PCR using primers RU-1 and RU-2 shown in
Table 2 and plasmid pOMUR1 as a template. Plasmid
pOMUR6 was constructed by introducing a 0.8-kb amplified DNA fragment digested with SacI and HindIII into
pUC18. Plasmid pROMU1 was constructed by inserting a
3.3-kb SacI–KpnI fragment isolated from pOMUR1 into
pOMUR6 and by disruption of the KpnI site and conversion
of the Styl site into the BglII site. Plasmid pROMU1 had
rURA3-containing repetitive sequences before and after the
OmURA3 structural gene between the BglII and HindIII
sites.
The OmOCH1 gene was isolated as plasmid pOMOC1
containing a 5.0-kb XbaI fragment from the O. minuta
genomic library. Plasmid pOMOC2 was constructed by
transferring a 4.4-kb NotI–XbaI fragment isolated from the
pOMOC1 into pBluescript II SK . Plasmid pOMOC3 was
obtained by digestion with AccI and XhoI, blunt-ended, and
self-ligated. Plasmids pOMOC2B and pOMOC3H were
constructed by conversion of the BalI site in pOMOC2 into
the BamHI site and the SmaI site in pOMOC3 into the
HindIII site, respectively. A plasmid for the OmOCH1
knock-out vector, pDOMOCH1, was constructed by transferring a 3.3-kb BglII–HindIII fragment from pROMU1 and
a 1.5-kb HindIII–ApaI fragment from the pOMOC3 H into
pOMOC2B.
Transformation
The cells were precultured in YPD medium at 30 1C overnight, inoculated into 50 mL of YPD medium, and cultured
at 30 1C for 8–16 h until the logarithmic growth phase
(OD600 nm = about 1.5). The cells were harvested by centrifugation at 1400 g for 5 min, and washed with 50 mL of
sterilized ice-cooled water. The cells were suspended in
10 mL of LC buffer (100 mM LiCl, 50 mM potassium
phosphate buffer, pH 7.5) and incubated at 30 1C for
45 min; 0.25 mL of 1 M dithiothreitol was then added to the
suspension and incubated for another 15 min. The cells were
washed with 40 mL of ice-cooled STM buffer (270 mM
sucrose, 10 mM Tris/HCl buffer, pH 7.5, 1 mM MgCl2), and
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
1056
resuspended in 160 mL of STM buffer to use as competent
cells. One microgram of the DNA sample linearized by the
digestion of an appropriate restriction enzyme was added
into 50 mL of the competent cell suspension and placed
into a 0.2 cm wide disposable cuvette. Transformation
was performed by the electric pulse method with a Gene
Pulser (Bio-Rad) under appropriate conditions (voltage:
1.0–1.5 kV, resistance: 200–800 O). One milliliter of cold
YPD medium containing 1 M sorbitol was added and
incubated at 30 1C for 4–6 h with shaking. The culture was
spread on a YPD selection medium plate containing
400–1000 mg mL1 G418, or on an SD plate, and incubated
at 30 1C until colonies appeared.
Evaluation of promoter by measurement of lacZ
activity
Plasmid pMC1871 (Pharmacia Biotech) was used as a
template for PCR to obtain an E. coli lacZ region, along with
sets of primers LZ-1 and LZ-2 or LZ-3 and LZ-4 (Table 2).
Plasmids pOMEU1/LacZ and pOMEGPU1/LacZ were constructed by insertion of the amplified DNA fragment
digested with XbaI and BglII or XhoI and EcoT22I into
pOMEU1 or pOMEGPU1, respectively.
The O. minuta transformants carrying either pOMEU1/
LacZ or pOMEGPU1/LacZ precultured to a stationary phase
in YPD medium at 30 1C were inoculated onto SD, SG or
SM medium at OD600 of 0.1 and cultured at the mid-log
phase. The specific b-galactosidase activity (unit =
OD405 nm 1000/OD600 nm min1) was measured with a
Yeast b-galactosidase Assay Kit (Pierce).
Preparation and analysis of mannoproteins
Yeast strains were cultivated at 30 1C for 24–48 h in YPD or
BYPGM medium. Cells were harvested and resuspended in
10 mL of 100 mM sodium citrate buffer (pH 7.0) and
autoclaved at 121 1C for 1 h (Peat et al., 1961). A supernatant
was poured into three volumes of ethanol to precipitate
mannoproteins. The precipitant was dissolved in a concanavalin A (ConA) column buffer [0.1 M sodium phosphate
buffer containing 0.15 M sodium chloride and 0.5 mM
calcium chloride (pH 7.2)], and applied to a ConA-agarose
column (0.6 2 cm, Honen Corporation). The column was
washed with ConA column buffer and eluted with ConA
column buffer containing 0.2 M a-methylmannoside. The
eluted fraction was dialysed and freeze-dried to yield mannoproteins. The mannoproteins were dissolved in 100 mL of
N-glycosidase F buffer [0.1 M Tris/HCl buffer, pH 8.0,
containing 0.5% sodium dodecylsulfate (SDS) and 0.35%
2-mercaptoethanol] and boiled for 5 min. In order to
remove the sugar chains from the mannoproteins, 50 mL of
7.5% Nonidet P-40, 138 mL of water and 12 mL of Nglycosidase F (Boehringer Ingelheim) were added and
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
K. Kuroda et al.
incubated at 37 1C for 16 h. The reaction mixture was
desalted with AG501-X8 resin (Bio-Rad), and the detergent
and proteins were removed by phenol/chloroform (1 : 1)
extraction. The extracted sugar chains were labeled using 2aminopyridine (PA) according to the method described by
Kondo et al. (1990). The PA-labeled sugar chain was
analysed by high-performance liquid chromatography
(HPLC) under the conditions and according to the method
described by Chiba et al. (1998). In order to examine the
sugar chains in detail, they were treated with A. saitoi a-1,2mannosidase (Seikagaku Kogyo).
Measurement of intracellular a-1,2-mannosidase
activity
The transformants cultured in the BYPGM medium were
harvested and suspended in 0.1 M sodium acetate buffer, pH
5.0, containing 1% Triton X100 and 1 mM phenylmethylsulphonylfluoride, and then disrupted with glass beads to
prepare a cell extract. The extract was incubated with
20 pmol of the Man6b sugar chain as a substrate (Takara
Bio) at 37 1C for 10–60 min. The reaction mixture was
boiled to inactivate the enzyme and analysed by HPLC
according to the method described by Chiba et al. (1998) to
separate the Man5 sugar chain from the Man6b sugar chain
produced. The yeast strain having the highest a-1,2-mannosidase activity was selected.
SDS-PAGE and Western blotting to detect a-1,2mannosidase
Four microliters of a cell suspension of cells cultured in
BYPGM medium for 72 h was subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and electroblotted
onto a polyvinylidenefluoride membrane. a-1,2-Mannosidase was detected by chemiluminescence with rabbit anti-A.
saitoi a-1,2-mannosidase antisera (Sawaday Technology) for
the first antibody and with horseradish peroxidase-conjugated antirabbit immunoglubulin antibody for the second
antibody.
Results
Construction of O. minuta transformation
system
The host having a ura3 marker for gene disruption was
regenerated by 5-fluororotic acid (5-FOA)-positive selection
of ura3 strains with spontaneous site-specific recombination
on a tandem-repeated sequence (Boeke et al., 1987; Rothstein, 1991; Sakai et al., 1991). The transformants by the
OmURA3 knock-out vector, pDOMU1, cleaved with SalI,
were obtained on a YPD plate supplemented with G418 at
400 mg mL1 (400–700 CFU mg1 DNA). The OmURA3
FEMS Yeast Res 6 (2006) 1052–1062
1057
Man5GlcNAc2-type sugar chain by Ogataea minuta
Fig. 1. Gene disruption scheme of OmURA3 (a)
and OmOCH1 (b) genes. (a1) OmURA3 locus in
the wild-type strain. (a2) OmURA3 locus in which
the plasmid pDOMU1 digested with SalI was
inserted. (a3) OmURA3 locus in TK1-3. (a4)
Southern blot analysis of the HindIII digested
genomic DNA. The radiolabeled 0.5 kb DNA
probe amplified by PCR with the set of primers
omura-sou-F and omura-sou-R (Table 2) is shown
in a1 as a black box. Lane 1: the wild-type strain
gave a band of 4.5 kb. Lane 2: transformant by
pDOMU1 gave bands of 5.3 and 8.2 kb. Lane 3:
TK1-3 gave a band of 4.5 kb. rURA3 indicates the
gene composed of the OmURA3 expression cassette and the repetitive sequences. (b1) OmOCH1
locus in TK1-3. (b2) OmOCH1 locus in TK2. (b3)
OmOCH1 locus in TK3-A. (b4) Southern blot
analysis of the SacI-digested genomic DNA. The
radiolabeled 0.5-kb DNA probe amplified by PCR
with the set of primers omoch-sou-F and omochsou-R (Table 2) is shown in b1 as a black box. Lane
1: TK1-3 gave a band of 3.0 kb. Lane 2: TK2 gave
a band of 5.7 kb. Lane 3: TK3-A gave a band of
3.3 kb.
gene replaced with the chloramphenicol-resistant gene region was deleted after the 5-FOA-resistant selection. The
resultant O. minuta URA3 disruptant strain TK1-3 (Dura3)
and the strain in which the plasmid pDOMU1 was integrated into the OmURA3 locus were screened by Southern
analysis with a radiolabeled DNA probe amplified by PCR
with the set of primers omura-sou-F and omura-sou-R
(Table 1, Fig. 1).
Analysis of the promoters from the AOX1 and
TDH1 genes
Ogataea minuta TK1-3LacZ/A and TK1-3LacZ/GP cells were
obtained by introducing the NotI-digested plasmids pOMEU1/LacZ and pOMEGPU1/LacZ to TK1-3, respectively.
In order to evaluate both the inducible and the constitutive
O. minuta heterologous gene expression system, the culture
supernatant was subjected to b-galactosidase assay. Highest
activities of b-galactosidase derived from TK1-3LacZ/A and
TK1-3LacZ/GP were detected in the methanol-containing
medium (Fig. 2). The OmTDH1 promoter constitutively
expressed the lacZ gene with any carbon sources. By
contrast, the OmAOX1 promoter was inducible with only
methanol. The OmAOX1 promoter had a fivefold higher
activity than the OmTDH1 promoter with methanol.
FEMS Yeast Res 6 (2006) 1052–1062
Fig. 2. Analysis of the promoters from the OmAOX1 and OmTDH1
genes. LacZ activities under the control of OmAOX1 and OmTDH1
promoters are shown with open and closed squares, respectively. The
values are means SD from triple independent experiments.
Analysis of mannoproteins from O. minuta
In a previous study, we developed the S. cerevisiae strain that
produced glycoproteins with Man5GlcNAc2 N-linked sugar
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
1058
K. Kuroda et al.
chains (Chiba et al., 1998). In order to minimize the steps in
the disruption and introduction of genes related to sugar
chain processing, nuclear magnetic resonance data for the
sugar chains produced by yeasts were consulted in order to
select a methylotrophic yeast, O. minuta, whose sugar chain
was considered to be similar to or simpler than that of S.
cerevisiae (Gorin & Spencer, 1970). N-linked sugar chains
from the cell wall mannoproteins were labeled with PA and
analysed by HPLC with an a-1,2-mannosidase treatment. Nlinked sugar chains derived from TK1-3 were converted to
Fluorescence intensity
(a)
30
30
20
20
10
10
The OmOCH1 gene obtained consisted of an ORF of 1302
nucleotides coding for a polypeptide of 434 amino acid
residues. Levels of similarity between Och1p derived from
80
80
60
60
40
40
20
20
0
0
0
0
5
10
15
20
25 30 35
min
Retention time (min)
40
45
50
(c)
0
5
10
15
20
25 30 35
min
Retention time (min)
40
45
50
(d)
60
Fluorescence intensity
Analysis of O. minuta Doch1 strain
(b)
0
60
40
250
250
Man5
200
Man6
40
Man5
20
200
150
150
100
100
50
50
0
0
20
0
0
0
5
10
15
20
25 30 35
min
Retention time (min)
40
45
50
(e)
Fluorescence intensity
Man5GlcNAc2 or Man6GlcNAc2 by in vitro a-1,2-mannosidase treatment (Figs 3a and c). The HPLC profile of the
sugar chain from TK 1-3 was identical in most part to that
from the O. minuta wild-type strain (data not shown).
0
5
10
15
20
25 30 35
min
Retention time (min)
40
45
50
(f)
1000
1000
Man5
800
800
600
600
400
400
200
200
0
0
0
5
10
15
20
25 30 35
min
Retention time (min)
40
45
50
400
400
Man5
300
300
200
200
100
100
0
0
0
5
10
15
20
25 30 35
min
Retention time (min)
40
45
50
Fig. 3. Analysis of mannoproteins from TK1-3 (Dura3), TK3-A (Doch1Dura3) and TK3-AM (Doch1Dura3 strain expressing a-1,2-mannosidase). Sugar
chains were prepared from mannoproteins and labeled by 2-aminopyridine (PA). The PA-sugar chains were separated by HPLC both on the Amide-80
column (a–e) and on the ODS column (f). (a, c) TK1-3; (b, d) TK3-A; (e, f) TK3-AM. (c, d) With a-1,2-mannosidase treatment.
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
FEMS Yeast Res 6 (2006) 1052–1062
1059
Man5GlcNAc2-type sugar chain by Ogataea minuta
O. minuta and other strains such as Pichia angusta [Pa], P.
pastoris [Pp], Candida albicans [Ca], S. cerevisiae [Sc], Sch.
pombe [Sp] and Yarrowia lipolytica [Yl] are 32% (PaOch1p),
60% (PaOch2p), 45% (PpOch1p), 47% (CaOch1p), 42%
(ScOch1p), 35% (SpOch1p) and 40% (YlOch1p), respectively. The OmOCH1 disruption strain O. minuta TK2
(Doch1:URA3Dura3) was obtained by transformation using
a 6.9-kb ApaI–NotI fragment from pDOMOCH1. Ogataea
minuta TK3-A (Doch1Dura3) in which the OmURA3 gene
was deleted was obtained by the 5-FOA-positive selection.
These strains, TK2 and TK3-A, were screened by Southern
analysis with a radiolabeled DNA probe amplified by a set of
primers, namely omoch-sou-F and omoch-sou-R (Table 2,
Fig. 1). In order to examine the reduction of a-1,6-mannosyltransferase activity in the Doch1 strain, sugar chains of the
cell wall mannoproteins prepared from both TK3-A and its
parent strain TK1-3 were labeled with PA and analysed by
HPLC with or without in vitro a-1,2-mannosidase treatment. Through the HPLC analysis using an Amide-80
column and a reversed-phase column in comparison with
commercially available standard sugar chains, both Man5GlcNAc2 and Man6GlcNAc2 were detected from the parent
strain TK1-3 after the a-1,2-mannosidase treatment,
whereas Man6GlcNAc2 was not detected from the TK3-A
strain at all (Figs 3c and d). These results confirm that the
OmOCH1 gene substantially codes for the a-1,6-mannosyltransferase gene. Moreover, an increase of sensitivity to
antibiotics is one of the phenotypes of the sugar chain
mutant. Because TK3-A was more sensitive to hygromycin
B and G418 than TK1-3, the degree of mannosylation was
considered to decrease in the Doch1 strain of O. minuta
(data not shown).
Analysis of mannoproteins of O. minuta Doch1
expressing the a -1,2-mannosidase gene
In order to examine whether the sugar chain was converted
into Man5GlcNAc2 in vivo, the a-1,2-mannosidase gene was
introduced to the TK3-A strain. For S. cerevisiae, the yield of
Man5GlcNAc2 was dependent upon the glycoproteins, even
if the a-1,2-mannosidase gene was expressed using the
TDH3 promoter, which is considered to gain the highest
expression constitutively (Chiba et al., 1998; Takamatsu
et al., 2004). In order to convert the sugar chain of O.
minuta to Man5GlcNAc2 efficiently, the plasmid pOMEU1/
Ms carrying the A. saitoi a-1,2-mannosidase (MsdS) gene
under the control of the OmAOX1 promoter was introduced
into TK3-A. Ogataea minuta TK3-AM with the intracellular
a-1,2-mannosidase was selected by Western analysis as
shown in Fig. 4a. Activity of a-1,2-mannosidase, which
converts the Man6GlcNAc2 substrate into Man5GlcNAc2,
was observed in the cell extracts of TK3-AM, whereas no
activity was observed in extracts of TK3-A (Fig. 4b). The
FEMS Yeast Res 6 (2006) 1052–1062
Fig. 4. Analysis of the a-1,2-mannosidase activity in TK3-AM (Doch1
strain expressing the a-1,2-mannosidase gene). (a) Western analysis of
the cellular lysate for Aspergillus saitoi a-1,2-mannosidase. Lane 1: TK3A carrying pOMEU1 (negative control). Lane 2: TK3-AM. (b) In vitro a1,2-mannosidase assay of cell extracts. (b1) TK3-AM; (b2) TK3-A carrying
pOMEU1. Assay procedures are described in the Materials and methods.
sugar chains from TK3-AM analysed by HPLC corresponded to Man5GlcNA2 (Figs 3e and f).
Discussion
To establish the expression system of O. minuta, the Dura3
auxotrophic mutant was isolated by the gene knock-out
technique, and the expression vectors were constructed
under the control of methanol-inducible OmAOX1 promoter or constitutive OmTDH1 promoter. The lacZ activity
assay derived from both TK1-3LacZ/A and TK1-3LacZ/GP
showed that the OmAOX1 promoter has a higher activity
than the OmTDH1 promoter. In the methanol metabolic
pathway of methylotrophic yeasts, several promoters, such
as the dihydroxyacetone synthetase (DAS1), catalase (CTA1)
and formaldehyde dehydrogenase (FDH1) promoters, are
known in addition to the AOX1 promoter. In the case of C.
boidinii, the highest expression level was observed under the
control of the DAS1 promoter. The transcriptional activities
of the AOX1 and FDH1 promoters were c. 64% and 18%,
respectively, relative to that of the DAS1 promoter (Yurimoto et al., 2000). Although the OmAOX1 and OmTDH1
promoters were compared in this study, it was not determined whether the OmAOX1 promoter shows higher activity than the OmDAS1 or OmFDH1 promoters. In addition,
Komeda et al. (2003) showed that the cis-acting regulatory
element enhanced the level of induction of the FDH1
promoter in a manner dependent on the number of copies.
To improve the O. minuta expression system, other methanol-inducible promoters need to be elucidated and the
increased transcript level needs to be investigated further.
Two alcohol oxidase genes were found in P. pastoris [Pp]
and P. methanolica [Pm], whereas P. angusta [Pa] and C.
boidinii [Cb] have unique genes. Although it is unknown
whether there are two AOX genes in O. minuta, there were
no other signals in the Southern analysis to clone the
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
1060
OmAOX1 gene. As the OmAOX1 promoter obtained was
inducible only under methanol, the regulation of OmAOX1
was thought to be similar to that in P. pastoris, P. angusta
and P. methanolica but not to that in C. boidinii, which
is inducible under both methanol and glycerol (Sakai et al.,
1998). Levels of similarity between Aox1p derived from
O. minuta and PpAox1p, PpAox2p, PmAox1p, PmAox2p,
PaAox1p and CbAox1p are 72%, 72%, 84%, 82%, 87%
and 75%, respectively. Analysis of the coding region of
the genes cloned in this study suggested that O. minuta
is taxonomically similar to P. angusta. Given that OmAOX1
had a DNA G1C content of 50 mol%, a value similar to
that of mammalian cells, gene synthesis for the heterologous genes derived from mammalian cells was not
required.
TK3-AM produced the Man5GlcNAc2 sugar chain by
disrupting the OmOCH1 gene and introducing the a-1,2mannosidase gene. This result suggested that there might be
little a-1,3-mannosyltransferase activity in O. minuta. The
MNN1 gene is responsible for the addition of an a-1,3mannoside to the end of the N-linked sugar chain. In
addition, a further three a-1,3-mannosyltransferase genes
that are related to a-1,3-mannosylation for either the
N-linked or the O-linked sugar chains exist in S. cerevisiae.
Although it is not known whether there are any MNN1
gene homologues in O. minuta, the products of the
OmMNN1 gene or gene homologues were thought not
to have activity that could be detected in this study. Because
it is not necessary for O. minuta to disrupt the a-1,3mannosyltransferase gene, such as MNN1, O. minuta has
the advantage of producing a glycoprotein with a humancompatible sugar chain. Recently, Kim et al. (2006)
showed the same advantage in the production of Man5GlcNAc2 by H. polymorpha. These details are summarized in
Fig. 5.
Some sugar chains were found in a molecular-weight
fraction higher than Man5GlcNAc2 by means of analyses of
the size fractionation chromatography of Amide-80 (Figs
3c–e) and of the reverse phase chromatography of ODS (Fig.
3f). Two reasons were considered for why these sugar chains
were found. The first was phosphomannosylation, and the
second was competition between the removal of the mannose residues by the a-1,2-mannosidase and mannosylation
by the product of the MNN2 gene, the MNN5 gene and the
KTR/KRE2 gene family. Because phosphomannosylation, in
which a mannose-1-phosphate is added to an a-1,2-mannoside chain, occurs in yeasts, sugar chains containing mannose-1-phosphates would be resistant to the a-1,2mannosidase. The MNN4 and MNN6 genes are responsible
for phosphomannosylation in S. cerevisiae. It is known that
the MNN4 gene is a positive regulator for phosphomannosylation (Odani et al., 1996, 1997) and that the MNN6 gene
is a mannosylphosphate transferase gene (Wang et al., 1997).
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
K. Kuroda et al.
Fig. 5. General strategy for the production of the ‘human-compatible
yeast’ and predicted sugar chain structures of Ogataea minuta. Ogataea
minuta mainly has an a-1,2-mannoside outer chain and has the advantage of producing a humanized sugar chain compared with Saccharomyces cerevisiae. The enclosure is the core structure Man8GlcNAc2 in
the endoplasmic reticulum.
When the OmMNN4 gene is disrupted to remove phosphomannose, the a-1,2-mannosidase proceeds to digest the a1,2-mannoside chain. As a result, the remaining sugar
chains would be efficiently changed to Man5GlcNAc2 (this
is currently under investigation).
Davidson et al. (2004) have shown the sugar chain
structures of the kringle 3 domain of human plasminogen
from various P. pastoris mutant cells. Pichia pastoris Doch1
mutant produced not only Man8GlaNAc2 sugar chains
but also Man9-12GlcNAc2 sugar chains. Half of these sugar
chains were digested by the a-1,2-mannosidase, whereas
the resultants were not completely trimmed to the Man5GlcNAc2 structure. The Doch1Dalg3 mutants also contained
very heterogeneous sugar chains (Man5-12GlcNAc2), and
some of them were resistant to treatment with the a-1,2mannosidase. These results suggested that the resistant
sugar chains of P. pastoris contained a-1,3-mannoside,
a-1,6-mannoside, phosphomannose, b-mannoside and/or
b-glucoside. On the other hand, our results indicate
that the sugar chain of O. minuta has a simpler structure
than those of P. pastoris; therefore, O. minuta may be a
good host for producing human-compatible glycoproteins
in yeast.
FEMS Yeast Res 6 (2006) 1052–1062
1061
Man5GlcNAc2-type sugar chain by Ogataea minuta
Acknowledgements
We would like to thank N. Niori, N. Kawashima, K. Sato, M.
Ueno, Y. Yamamoto and A. Ohnishi for their technical
assistance. We are also grateful to Drs M. Tsukahara and T.
Katsumata for their helpful suggestions. The late Dr M.
Takeuchi came up with the original idea for this research,
and this study is dedicated to him.
References
Ballou CE (1990) Isolation, characterization, and properties of
Saccharomyces cerevisiae mnn mutants with nonconditional
protein glycosylation defects. Methods Enzymol 185:
440–470.
Ballou L, Hernandez LM, Alvarado E & Ballou CE (1990)
Revision of the oligosaccharide structures of yeast
carboxypeptidase Y. Proc Natl Acad Sci USA 87: 3368–3372.
Barnay-Verdier S, Boisrame A & Beckerich JM (2004)
Identification and characterization of two a-1,6mannosyltransferases, Anl1p and Och1p, in the yeast Yarrowia
lipolytica. Microbiology 150: 2185–2195.
Bekkers AC, Franken PA, Van den Bergh CJ, Verbakel JM, Verheij
HM & De Haas GH (1991) The use of genetic engineering to
obtain efficient production of porcine pancreatic
phospholipase A2 by Saccharomyces cerevisiae. Biochim
Biophys Acta 1089: 345–351.
Bobrowicz P, Davidson RC, Li H, et al. (2004) Engineering of an
artificial glycosylation pathway blocked in core oligosaccharide
assembly in the yeast Pichia pastoris: production of complex
humanized glycoproteins with terminal galactose. Glycobiology
14: 757–766.
Boeke JD, Trueheart J, Natsoulis G & Fink GR (1987)
5-Fluoroorotic acid as a selective agent in yeast molecular
genetics. Methods Enzymol 154: 164–175.
Cereghino JL & Cregg JM (2000) Heterologous protein
expression in the methylotrophic yeast Pichia pastoris. FEMS
Microbiol Rev 24: 45–66.
Chiba Y, Suzuki M, Yoshida S, Yoshida A, Ikenaga H, Takeuchi M,
Jigami Y & Ichishima E (1998) Production of human
compatible high mannose-type (Man5GlcNAc2) sugar
chains in Saccharomyces cerevisiae. J Biol Chem 273:
26298–26304.
Choi BK, Bobrowicz P, Davidson RC, Hamilton SR, Kung DH, Li
H, Miele RG, Nett JH, Wildt S & Gerngross TU (2003) Use of
combinatorial genetic libraries to humanize N-linked
glycosylation in the yeast Pichia pastoris. Proc Natl Acad Sci
USA 100: 5022–5027.
Cregg JM, Vedvick TS & Raschke WC (1993) Recent advances in
the expression of foreign genes in Pichia pastoris. Biotechnology
(NY) 11: 905–910.
Daly R & Hearn MT (2005) Expression of heterologous proteins
in Pichia pastoris: a useful experimental tool in protein
engineering and production. J Mol Recogn 18: 119–138.
FEMS Yeast Res 6 (2006) 1052–1062
Davidson RC, Nett JH, Renfer E, et al. (2004) Functional analysis
of the ALG3 gene encoding the Dol-P-Man: Man5GlcNAc2-PPDol mannosyltransferase enzyme of P. pastoris. Glycobiology
14: 399–407.
de Bruin EC, Duitman EH, de Boer AL, Veenhuis M, Bos IG &
Hack CE (2005) Pharmaceutical proteins from methylotrophic
yeasts. Methods Mol Biol 308: 65–76.
Dominguez A, Ferminan E, Sanchez M, et al. (1998) Nonconventional yeasts as hosts for heterologous protein
production. Int Microbiol 1: 131–142.
Faber KN, Harder W, Ab G & Veenhuis M (1995) Methylotrophic
yeasts as factories for the production of foreign proteins. Yeast
11: 1331–1344.
Gemmill TR & Trimble RB (1999) Overview of N- and O-linked
oligosaccharide structures found in various yeast species.
Biochim Biophys Acta 1426: 227–237.
Gorin PAJ & Spencer JFT (1970) Proton magnetic resonance
spectroscopy – an aid in identification and chemotaxonomy of
yeasts. Adv Appl Microbiol 13: 25–89.
Higgins DR & Cregg JM (1998) Introduction to Pichia pastoris.
Methods Mol Biol 103: 1–15.
Kim MW, Kim EJ, Kim JY, Park JS, Oh DB, Shimma Y, Chiba Y,
Jigami Y, Rhee SK & Kang HA (2006) Functional
characterization of the Hansenula polymorpha HOC1, OCH1,
and OCR1 genes as members of the yeast OCH1
mannosyltransferase family involved in protein glycosylation. J
Biol Chem 281: 6261–6272.
Komeda T, Yurimoto H, Kato N, Sakai Y & Kondo K (2003) Cisacting elements sufficient for induction of FDH1 expression by
formate in the methylotrophic yeast Candida boidinii. Mol
Genet Genomics 270: 273–280.
Kondo A, Suzuki J, Kuraya N, Hase S, Kato I & Ikenaka T (1990)
Improved method for fluorescence labeling of sugar chains
with sialic acid residues. Agric Biol Chem 54: 2169–2170.
Muller S, Sandal T, Kamp-Hansen P & Dalboge H (1998)
Comparison of expression systems in the yeasts Saccharomyces
cerevisiae, Hansenula polymorpha, Kluveromyces lactis,
Schizosaccharomyces pombe and Yarrowia lipolytica. Cloning of
two novel promoters from Yarrowia lipolytica. Yeast 14:
1267–1283.
Nakanishi-Shindo Y, Nakayama K, Tanaka A, Toda Y & Jigami Y
(1993) Structure of the N-linked oligosaccharides that show
the complete loss of a-1,6-polymannose outer chain from
och1, och1 mnn1, and och1 mnn1 alg3 mutants of
Saccharomyces cerevisiae. J Biol Chem 268: 26338–26345.
Nakayama K, Nagasu T, Shimma Y, Kuromitsu J & Jigami Y
(1992) OCH1 encodes a novel membrane bound
mannosyltransferase: outer chain elongation of asparaginelinked oligosaccharides. EMBO J 11: 2511–2519.
Nett JH & Gerngross TU (2003) Cloning and disruption of the
PpURA5 gene and construction of a set of integration vectors
for the stable genetic modification of Pichia pastoris. Yeast 20:
1279–1290.
Odani T, Shimma Y, Tanaka A & Jigami Y (1996) Cloning and
analysis of the MNN4 gene required for phosphorylation of
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
1062
N-linked oligosaccharides in Saccharomyces cerevisiae.
Glycobiology 6: 805–810.
Odani T, Shimma Y, Wang XH & Jigami Y (1997)
Mannosylphosphate transfer to cell wall mannan is regulated
by the transcriptional level of the MNN4 gene in
Saccharomyces cerevisiae. FEBS Lett 420: 186–190.
Peat S, Whelan WJ & Edwards TE (1961) Polysaccharides of
baker’s yeast. IV. Mannan. J Chem Soc 1: 29–34.
Rothstein R (1991) Targeting, disruption, replacement, and allele
rescue: integrative DNA transformation in yeast. Methods
Enzymol 194: 281–301.
Sakai Y, Kazarimoto T & Tani Y (1991) Transformation system
for an asporogenous methylotrophic yeast, Candida boidinii:
cloning of the orotidine-5 0 -phosphate decarboxylase gene
(URA3), isolation of uracil auxotrophic mutants, and use of
the mutants for integrative transformation. J Bacteriol 173:
7458–7463.
Sakai Y, Nakagawa T, Shimase M & Kato N (1998) Regulation and
physiological role of the DAS1 gene, encoding
dihydroxyacetone synthase, in the methylotrophic yeast
Candida boidinii. J Bacteriol 180: 5885–5890.
Sudbery PE, Gleeson MA, Veale RA, Ledeboer AM & Zoetmulder
MC (1988) Hansenula polymorpha as a novel yeast system for
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
K. Kuroda et al.
the expression of heterologous genes. Biochem Soc Trans 16:
1081–1083.
Takamatsu S, Chiba Y, Ishii T, Nakayama K, Yokomatsu-Kubota
T, Makino T, Fujibayashi Y & Jigami Y (2004) Monitoring of
the tissue distribution of fibroblast growth factor containing a
high mannose-type sugar chain produced in mutant yeast.
Glycoconjugate J 20: 385–397.
Wang XH, Nakayama K, Shimma Y, Tanaka A & Jigami Y (1997)
MNN6, a member of the KRE2/MNT1 family, is the gene for
mannosylphosphate transfer in Saccharomyces cerevisiae. J Biol
Chem 272: 18117–18124.
Wildt S & Gerngross TU (2005) The humanization of Nglycosylation pathways in yeast. Nat Rev Microbiol 3: 119–128.
Yoko-o T, Tsukahara K, Watanabe T, Hata-Sugi N, Yoshimatsu K,
Nagasu T & Jigami Y (2001) Schizosaccharomyces pombe och11
encodes a-1,6-mannosyltransferase that is involved in outer
chain elongation of N-linked oligosaccharides. FEBS Lett 489:
75–80.
Yurimoto H, Komeda T, Lim CR, Nakagawa T, Kondo K, Kato N
& Sakai Y (2000) Regulation and evaluation of five methanolinducible promoters in the methylotrophic yeast Candida
boidinii. Biochim Biophys Acta 1493: 56–63.
FEMS Yeast Res 6 (2006) 1052–1062