Graduate Theses and Dissertations
Graduate College
2016
Investigating impacts of altered central metabolism
on ovarian function
Ahmad Abdulrahman Al-Shaibi
Iowa State University
Follow this and additional works at: http://lib.dr.iastate.edu/etd
Part of the Agriculture Commons, Animal Sciences Commons, Genetics Commons, and the
Physiology Commons
Recommended Citation
Al-Shaibi, Ahmad Abdulrahman, "Investigating impacts of altered central metabolism on ovarian function" (2016). Graduate Theses
and Dissertations. Paper 15109.
This Thesis is brought to you for free and open access by the Graduate College at Digital Repository @ Iowa State University. It has been accepted for
inclusion in Graduate Theses and Dissertations by an authorized administrator of Digital Repository @ Iowa State University. For more information,
please contact [email protected].
Investigating impacts of altered central metabolism on ovarian function
by
Ahmad A. Al-Shaibi
A thesis submitted to the graduate faculty
in partial fulfillment of the requirements for the degree of
MASTER OF SCIENCE
Major: Genetics
Program of Study Committee:
Major Professor: Aileen F. Keating
Lance H. Baumgard
Jason W. Ross
Iowa State University
Ames, Iowa
2016
Copyright © Ahmad A. Al-Shaibi, 2016. All rights reserved.
ii
DEDICATION
"And of knowledge you were given not but a little." - Quran 17:85
"If I have seen further, it is by standing on the shoulders of Giants." Such were the
words of Isaac Newton. This thesis is composed of the field notes taken during my clumsy
attempt at the climb to be on those shoulders, and is an attempt at describing the view from
where I stand. I dedicate this climb to my parents, my family, and my country, for I owe
them everything. I also dedicate this thesis to the scientists whose footsteps I attempt to
follow, so unworthy this thesis might be of them; the men and women who drove humanity's
endless quest to elucidate our ignorance, and gave birth to the enterprise of science, one
dedicated to the investigation of the laws of nature and enabling humanity to access the
universe around us. Lastly, I dedicate this thesis as a stepping stone in my ongoing quest to
reach a horizon I dreamt of as a boy many years ago, and continue to march towards.
Finally, please adhere to Alhazen's word as you read this thesis, for critique is the best
that can happen to it: "The seeker after the truth is not one who studies the writings of the
ancients and, following his natural disposition, puts his trust in them, but rather the one who
suspects his faith in them and questions what he gathers from them and submits to argument
and demonstration, not to the sayings of a human being whose nature is fraught with all kinds
of imperfection and deficiency. Thus, the duty of the man who investigates the writings of
scientists, if learning the truth is his goal, is to make himself an enemy of all that he reads,
applying his mind to the core and margins of its content, and attack it from every side. He
should also suspect himself as he performs his critical examination of it, so that he may avoid
falling into either prejudice or leniency."
iii
TABLE OF CONTENTS
Page
LIST OF FIGURES .................................................................................................
v
LIST OF TABLES ...................................................................................................
vi
ABBREVIATIONS ..................................................................................................
vii
ACKNOWLEDGMENTS ....................................................................................... viii
ABSTRACT………………………………. .............................................................
x
ORGANIZATION OF THE THESIS ....................................................................
xi
CHAPTER 1: A REVIEW OF THE LITERATURE ...........................................
1
General background .............................................................................................
Oogenesis .........................................................................................................
Folliculogenesis ...................................................................................................
Ovarian steroidogenesis and the two-cell model .................................................
Phosphatidylinositol-3 kinase (PI3K) signaling .................................................
Obesity
.........................................................................................................
Heat stress .........................................................................................................
Fertility and metabolic energy status ...................................................................
Leptin
.........................................................................................................
Insulin
.........................................................................................................
LPS and TLR4 signaling ......................................................................................
Summary .........................................................................................................
Bibliography ........................................................................................................
1
1
2
4
7
8
9
10
11
16
18
19
22
CHAPTER 2: ALTERED OFFSPRING OVARIAN EXPRESSION OF
MICROSOMAL EPOXIDE HYDROLASE 1 DUE TO MATERNAL
HYPERLAPTINEMIA DURING GESTATION..................................................
45
Abstract
.........................................................................................................
Introduction .........................................................................................................
Materials and methods .........................................................................................
Results
.........................................................................................................
Discussion .........................................................................................................
Bibliography ........................................................................................................
46
48
51
56
60
76
iv
CHAPTER 3: IMPACT OF HEAT STRESS ON OVARIAN PATHWAYS
REGULATING FOLLICULOGENESIS AND STEROIDOGENESIS IN
SYNCHRONIZED POST-PUBERTAL GILTS ...................................................
85
Abstract
......................................................................................................... 86
Introduction ......................................................................................................... 88
Materials and methods ......................................................................................... 90
Results
......................................................................................................... 95
Discussion ......................................................................................................... 96
Acknowledgements .............................................................................................. 100
Funding
......................................................................................................... 101
Bibliography ........................................................................................................ 109
CHAPTER 4: GENERAL DISCUSSION AND CONCLUSIONS ..................... 117
General background .............................................................................................
Leptin ...............................................................................................................
TLR4 ...............................................................................................................
Insulin ...............................................................................................................
Phosphotidylinositol-3 kinase (PI3K) ..................................................................
Bibliography ........................................................................................................
117
118
122
123
123
125
v
LIST OF FIGURES
Page
Figure 1.1: Histological Features of the Mammalian Ovary ....................................
Figure 2.1: Impact of leptin exposure at basal physiological levels on ovarian
folliculogenesis ..........................................................................................................
Figure 2.2: Impact of leptin exposure at concentrations observed during Obesity
on ovarian folliculogenesis ........................................................................................
Figure 2.3: Effect of maternal gestational hyperleptinemia on ovarian mRNA
abundance in offspring ...............................................................................................
Figure 2.4: Impact of maternal gestational hyperleptinemia on ovarian mRNA
expression of genes encoding enzymes involved in xenobiotic biotransformation ...
Figure 2.5: Impact of maternal gestational hyperleptinemia on offspring mRNA ...
Figure 2.6: Impact of maternal gestational hyperleptinemia on offspring
steroidogenic mRNA .................................................................................................
Figure 2.7: Maternal gestational hyperleptinemia impact on ovarian protein
abundance ..................................................................................................................
Appendix Figure 1....................................................................................................
Figure 3.1: HS alters ovarian insulin signaling.........................................................
Figure 3.2: HS reduces AKT phosphorylation .........................................................
Figure 3.3: HS does not impact steroidogenic gene expression in post-pubertal gilt
ovaries ....................................................................................................................
Figure 3.4: HS does not affect StAR or CYP19A1 protein abundance ....................
Figure 3.5: Follicular fluid 17β-estradiol concentration is not impacted by HS ......
Figure 3.6: HS increases abundance of TLR4 indicating LPS signaling..................
Figure 3.7: Follicular fluid LPS binding protein concentration is not impacted By
HS
....................................................................................................................
21
68
69
70
71
72
73
74
75
102
103
104
105
106
107
108
vi
LIST OF TABLES
Page
Figure 2.1: Primer sequences used in this study .......................................................
67
Figure 3.1: Primer sequences .................................................................................... 101
vii
ABBREVIATIONS
PGC: Primordial Germ Cells
PI3K: Phosphotidylinositol-3 Kinase
AKT: Protein Kinase B
GV: Germinal Vesicle
FSH: Follicle Stimulating Hormone
LH: Luteinizing Hormone
COC: Cumulus Oocyte Complex
StAR: Steroid Acute Regulatory Hormone
CYP: Cytochrome P-450
GnRH: Gonadotropin-Releasing Hormone
HS: Heat Stress
LPS: Lipopolysaccharide
ob: Obese
Db: Diabetic
LEPR: Leptin Receptor
INSR: Insulin Receptor
GVBD: Germinal Vesicle Breakdown
HIF: Hypoxia Inducible Factor
VEGF: Vascular Endothelial Growth Factor
IRS: Insulin Receptor Substrate
IGF: Insulin-Like Growth Factor
TLR: Toll-Like Receptor
PAMP: Pathogen-Associated Molecular Pattern
NF-κB: Nuclear Factor-Kappa B
TNF-α: Tumor Necrosis Factor Alpha
PGF2α: Prostaglandin F2 Alpha
Lpt: Leptin Pump
Sal: Saline Pump
WT: Wild Type
viii
ACKNOWLEDGMENTS
First, I would like to thank everyone who helped me in any direct way, beginning
with my adviser and mentor Dr. Aileen Keating, for her tremendous support and her patience
in keeping up with this nightmare of a student. Next, I would like to thank my committee
members, Dr. Jason Ross and Dr. Lance Baumgard for their guidance and continued support.
I would also like to thank the Keating lab alumni, Dr. Jackson Nteeba, Dr. Shanthi Ganesan,
and Dr. Jill Madden, for their foundational guidance and assistance. Next, I would like to
thank my colleagues and current members of the Keating lab, Porsha Thomas, Katie Bidne,
Mackenzie Dickson, and Aysha Majeed, and extend those thanks to all the rotation students
and undergraduates who helped me with any procedure, chores, or just reminded me of
where something was.
Second, I would like to acknowledge those who collaborated with us helped with any
of our procedures. The Ross and Baumgard lab groups, beginning with their principle
investigators and extending to everyone else, for their great help in running animal
experiments and in executing molecular protocol, and for their generous, collaborative spirit.
I would also like to thank our collaborators Dr. Laura Schulz from the University of Missouri
for collaborating with us on the Leptin project, and Dr. George Perry, South Dakota State
University for conducting radioimmunoassay as part of the heat stress project.
Third, I would like to acknowledge two of my fellow students; PhD candidate and my
colleagues in the IG program, Laura Schultz, for her help with finding information on leptin's
angiogenic role, and Alexandra Brownstein who helped me overcome a major technical
hurdle with TLR4 detection.
Last, but not least, I would like to thank the staff at ISU, particularly those at the
department of Animal Science, for their tireless work and for enabling everything to run as
ix
smoothly as it does, and all the great people I've met during my stay in Ames since my
admission to ISU as an undergrad.
While stumbles were aplenty, it is thanks to everyone that I'm here, that this is
written, and that I'm still sane. Thank you.
x
ABSTRACT
Mammalian reproduction is highly dependent on the ovary. Ovarian health is crucial
for the health of the female and the offspring. Observations of the timing of puberty and
ovarian function reveal a major role for the metabolic status of the female on reproductive
function. Many metabolic signals such as leptin, insulin, and LPS influence ovarian function
as they participate in metabolic stress. All of these signals cross pathways at PI3K. Obesity,
the accumulation of excessive fat, is an international health concern of wide prevalence. It
causes an increase in circulating leptin, insulin, and LPS, and is associated with numerous
reproductive disorders. Here, we investigated the effects of increasing systemic leptin during
gestation on the offspring, and observed that gestational hyperleptinemia can alter the
ovarian capacity to metabolize toxicants later in the offspring's life. Heat stress is a condition
of increased core temperature, and it impedes the reproductive performance of production
animals during summer, making it an increased threat to food security, climate change only
worsening it. Heat stress causes increased circulating insulin and LPS. We heat stressed gilts
cyclically after synchronizing their estrous cycles, and observed decreased phosphorylation
of AKT and increased TLR4 abundance in their ovaries. This demonstrates that, during heat
stress, ovarian TLR4 signaling is upregulated and that the ovary might be initiating a stress
response as indicated by reduced AKT phosphorylation.
xi
ORGANIZATION OF THE THESIS
This thesis is focused on ovarian function in the contexts of obesity and heat stress.
Chapter 1 contains a general review of the relevant literature in which the major facets of
ovarian function are introduced, as well as the pathways relevant to the stressors discussed
herein. Chapter 2 contains the details of a project investigating the effects of leptin on
ovarian function, where we observed the effects of systemic, maternal hyperleptinemia
during gestation on the offspring, as well as the effects of exposing cultured ovaries to leptin
ex vivo. Chapter 3 tells the details of our investigation into the effects of cyclical heat stress
on the ovaries of synchronized, post-pubertal gilts. Chapter 4 is a general discussion of the
reviewed literature and the findings presented herein, in addition to the author's thoughts on
potential avenues of future research.
1
CHAPTER 1
A REVIEW OF THE LITERATURE
General background:
Reproduction is a cornerstone of evolution as it allows genes and traits to be inherited
through the generations. It takes on a wide range of forms through the different domains of life,
ranging from the simplicity and elegance of bacterial binary fission [1], all the way to the
sophistication and intricacy of mammalian reproduction. Mammalian species are typically split
into two sexes; male and female. Females, the subject of this thesis, specialize in the ovarian
production of oocytes, the female gamete (sometimes called eggs), and their maintenance. On a
cellular level, females contribute about 50% of the nuclear genome, all the cellular components,
and all of the non-nuclear genomes including those in the mitochondria, while the male's
contribution is limited to the other 50% of the nuclear genome [2–5]. This makes the health and
quality of the oocyte of absolute importance, as the oocyte's metabolic machinery would
constitute all machinery the offspring has as a single-cell embryo. Ovarian function is conducted
through a finite reserve of functional units known as follicles. Follicles consist of up to three cell
types; an oocyte, granulosa cells, and theca cells (Figure 1.1). The depletion of follicles
discontinues ovarian function, leading to acyclicity and menopause [6,7].
Oogenesis:
As with all organs, the ovary is derived from specific cellular lineages during embryonic
development [8,9]. As they develop, ovaries host the primordial germ cells (PGCs); a cell line
which differentiates into oocytes [8,9]. Giving rise to oocytes is a process called oogenesis.
2
Basically, PGCs are directed by means of protein and small RNA signals which orchestrate the
proliferation and differentiation of PGCs into prophase I of meiosis [8,9].
Oocytes arise from structures known as germ cell nests (also known as germline cysts).
Germ cell nests are formed from a single cell which undergoes multiple rounds of mitosis with
incomplete cytokinesis, resulting in an interconnected cluster of cells that divide in synchrony
[10,11]. Cells within germ cell nests, called cystocytes, are connected through structures termed
ring canals. In Drosophila, ring canals are threaded with microtubules that facilitate the transport
of organelles and mRNAs [10,12]; processes that determine which of the cystocytes develop into
an oocyte, while the rest become nurse cells that break down as the oocyte matures [12].
Cystocytes that are selected to become oocytes become arrested in prophase I of meiosis [9,10].
Germ cell nests break down after a period of time that varies between species [10]. For example,
while nest breakdown begins right after birth in mice [13], it begins in the second trimester of
gestation in humans [14]. As the nests break, oocytes separate into primordial follicles, which
then develop through the process of folliculogenesis.
Folliculogenesis:
Development and growth of follicles, referred to as folliculogenesis, proceeds through
four stages; primordial, primary, secondary, and tertiary. This classification was derived from a
proposal by Pedersen and Peters [15]. After germ cell nest breakdown, oocytes become packaged
into primordial follicles. Primordial follicles contain oocytes arrested in prophase I of meiosis
[8–10]. Surrounding the oocyte at this stage is a layer of squamous granulosa cells, which are flat
in morphology [8,16]. While considered metabolically inactive, primordial follicles are
3
responsive to circulating factors as shown by their activation in culture using serum-enriched
media [17]. Primordial follicles are also capable of responding to metabolic signals like insulin
[18] and insulin-like growth factor-1 (IGF-1) [19], which shows that, despite being metabolically
dormant, primordial follicles are capable of responding to external stimuli.
Activation of the primordial follicles is one of two broad categories of folliculogenesis.
The first is known as "initial recruitment," and refers to the process of initiating the growth of the
follicle and transitioning it from the dormant, primordial stage. The second category is known as
"cyclic recruitment," in which the signals associated with the ovarian/estrous cycle stimulate the
development of follicles at the tertiary stage (see below) [20]. Initial recruitment initiates the
growth of the oocyte and proliferation of the granulosa cells and transitions the oocyte into the
primary stage [20]. Mechanistically speaking, initial recruitment has yet to be fully elucidated. It
is thought that the phosphotidylinositol-3 kinase (PI3K) pathway plays a major role in this
process, primarily through protein kinase B (PKB/AKT) [21]. Activation of PI3K promotes the
translocation of forkhead transcription factor (FOXO3A) from the oocytic nucleus as signaled by
its phosphorylation, in turn signaling the activation of the primordial follicle [22–24]. Other
chemical factors, and even mechanical factors having to do with the vascular architecture
surrounding the early ovary, are thought to participate in orchestrating this transition, both at the
level of the individual follicle and at the level of the ovary as a whole [16,20]. A morphological
characteristic of primary follicles is the cuboidal morphology that their granulosa cells acquire as
they transition out of their primordial, flat morphology. It is also at the primary stage that the
oocytic nucleus becomes the germinal vesicle (GV).
4
After the primary stage, the follicle transitions into the secondary stage. A follicle is
morphologically characterized as secondary by having at least two layers of cuboidal granulosa
cells surrounding its oocyte. When in the secondary stage, the follicle acquires follicle
stimulating hormone (FSH) receptors. Studies have shown sensitivity of follicles to FSH during
this stage of development, but not necessarily a dependency on it, especially in follicles isolated
from neonatal animals [25]. Secondary follicles gain a third cell type, and those are the thecal
cells [9], the development of which varies in timing between species [8].
As secondary follicles transition into the next stage of development, they gain a fluidfilled cavity, called an antrum, which is characteristic of tertiary follicles (also known as the
antral or Graafian follicles). Antra are filled with follicular fluid that is derived from circulating
blood. Follicular fluid is essentially filtered blood as it contains less of the larger molecular
weight factors, about 50% of those smaller than 250kDa and almost no blood proteins above
850kDa [26]. From within emerging tertiary follicles, some are selected for further growth under
the influence of luteinizing hormone (LH) and they become dominant follicles that mature
towards ovulation [20]. Dominant follicles have a characteristic, morphological feature called the
cumulus oocyte complex (COC), which is released from the follicle upon ovulation [8].
Folliculogenesis continues until the ovary is depleted of follicles, the point at which ovarian
function ceases [6,7].
Ovarian steroidogenesis and the two-cell model:
In addition to housing the oocytes, the mammalian ovary produces sex hormones; mainly
progesterone and estrogens. Follicles are responsible for the production of estrogens through a
5
synergistic process between the granulosa and thecal cells [27]. While Falck's 1959 publication
demonstrated an interdependence between the granulosa cells and the thecal layer for estrogen
production, it wasn't until 1962 that the "two cell" term was coined to describe a model of
ovarian steroid production [28]. In the following years, experimental results were conflicted on
which cell type produced which steroid(s) and whether or not both cell types were necessary for
complete steroidogenesis [29–34]. In 1975 Makris and Ryan demonstrated a clear synergy
between granulosa and thecal cells in steroidogenesis in hamsters [35]. Shortly afterwards,
Erickson and Ryan demonstrated the specialized role of each cell type, and that gonadotropins
played a crucial role in the stimulation of steroidogenesis in rabbits [36]. In the same year, in the
same issue of Endocrinology, Dorrington et al. showed that granulosa cells produce estradiol
specifically in response to FSH in rabbits [37]. The following year, Erickson and Ryan
completed the picture by demonstrating that testosterone is produced by the thecal layer in
rabbits when stimulated by LH [38]. Taken together, those studies created a model for ovarian
steroidogenesis where thecal cells produce androgens under the influence of LH, and then the
granulosa cells produce estrogens under the influence of FSH. This is known today as the two
cell model of steroidogenesis. In the following year, experiments on rat [39] and ovine [40] cell
cultures demonstrated similar results, lending more credence to the two cell model.
Steroidogenesis begins with cholesterol. Although not yet fully elucidated, cholesterol is
imported into the mitochondria by a mechanism involving steroidogenic acute regulatory protein
(StAR) [41,42], and is stimulated by LH in the thecal cells [43]. Once cholesterol is translocated
into the inner membrane of the mitochondria, a 56kDa cholesterol side chain cleavage enzyme
transforms it into pregnenolone. The enzyme is cytochrome P450, family 11, subfamily A,
6
polypeptide 1 (CYP11A1) [44,45]. Pregnenolone is then exported from the mitochondria into the
cytoplasm where it is converted into progesterone by 3β-hydroxysteroid dehydrogenase [46–49].
Next, CYP17A1 converts progesterone to androstenedione [44,48,49], which is then converted to
testosterone as catalyzed by hydroxysteroid 17-β dehydrogenase [44,49]. Testosterone then
diffuses to the granulosa cells where it is acted upon by CYP19A1, or aromatase, and converted
to estrogens, in a process known as aromatization [8,44,49]. Steroid production continues in a
follicle even after ovulation, as the remnant of the ovulated follicle transforms into a structure
known as the corpus luteum (CL) which specializes in the production of progesterone [8,35].
Estrogen production is necessary for the release of gonadotropins into circulation.
Estrogen at the levels produced during the follicular phase of the estrous cycle is inhibitory to the
production of gonadotropins, in that it prevents the release of large quantities of LH as seen in
the LH surge [50]. This changes as more tertiary follicles are recruited for growth, increasing the
ovarian capacity for estrogenesis, in turn leading to increased levels of circulating estrogen that it
crosses a threshold of concentration, and gains a stimulatory effect that enables the LH surge
[50–52]. Progesterone conveys a similar function with respect to inhibiting gonadotropin release
as conferred by hypothalamic-pituitary signaling, particularly by influencing the release patterns
of the gonadotropin-releasing hormone (GnRH) [50–52]. GnRH neurons were reported to
express estrogen [53] and progesterone [54] receptors, indicating direct modes of action by
which ovarian steroids can regulate GnRH release.
7
Phosphatidylinositol-3 kinase (PI3K) signaling:
PI3K is a membrane-bound enzyme which participates in regulating a wide variety of
cellular processes. In the ovary, PI3K mediates its function primarily through the
phosphorylation of protein kinase B (AKT; pAKT) [21]. Once phosphorylated, pAKT is
imported into the nucleus, where it confers PI3K signaling by phosphorylating downstream,
nuclear factors [55]. One such factor is the forkhead transcription factor 3a (FOXO3A). pAKT
suppresses FOXO3A activity by phosphorylating it, which leads to its removal from the nucleus.
Inhibition of FOXO3A through pAKT promotes cell survival and suppresses programmed cell
death (apoptosis) [21,56,57]. While poorly understood, the initial recruitment of follicles is
regulated, at least partially, by FOXO3A. Involvement of FOXO3A seems to be centered around
activating the dormant oocyte, as the removal of FOXO3A from the oocytic nucleus as a
consequence of pAKT signaling was reported to initiate follicular development [22–24].
The motif of promoting survival and suppressing stress responses continues with
autophagy, as it is suppressed by pAKT activity [58]. Autophagy, the process of degrading
damaged cellular components for recycling, is a stress response observed in conditions such as
heat stress [59,60]. PI3K also participates in mediating the effects of gonadotropins. FSH was
shown to induce the phosphorylation of PI3K and AKT, and upregulate estrogenesis in granulosa
cells [61–64]. LH was also shown to act through PI3K to stimulate androgenesis by upregulating
the expression of CYP17A1 [65]. With these studies, it becomes reasonable to consider PI3K and
AKT as central regulators of general ovarian function.
8
Many stressors can alter these ovarian functions, and this thesis discusses alterations to
ovarian function in the contexts of two; obesity and heat stress.
Obesity:
Obesity is the " abnormal or excessive fat accumulation that may impair health [66]."
Clinically, the World Health Organization (WHO) uses BMI criteria to diagnose obesity, where a
BMI of 25 or greater is considered overweight, while a BMI of 30 or greater is considered obese.
WHO states that worldwide prevalence of obesity has doubled between 1980 and 2015. In 2014,
39% of adults were overweight, and 13% were obese, which equated to about 1.9 billion obese
or overweight adults [66]. Global prevalence of obesity is comparable to its prevalence in the
United States. Between 2011 and 2014, the percentage of obese adults exceeded 36% in the US
[67]. Women have a higher prevalence of obesity (36.3%) than men (34.3%) in the US [67].
Obesity's prevalence and its association with a wide variety of disorders poses it as a public
health concern worldwide [68,69].
Systemically, obesity is associated with a number of physiological changes such as
increased
circulating
(hyperinsulinemia),
leptin
and
(hyperleptinemia)
increased
circulating
[70,71],
increased
endotoxins
circulating
(metabolic
insulin
endotoxemia).
Reproductively, obesity is associated with a plethora of impairments to the female reproductive
function, such as polycystic ovary syndrome (PCOS) [72], miscarriage [73], and anovulation
[74]. Obesity is also associated with reduced chances of successful in vitro fertilization (IVF), as
well as other assisted fertility treatments [75]. In adult humans, BMI is negatively correlated with
circulating estrogen, LH, FSH, and inhibin levels [76]. Human childhood obesity, on the other
9
hand, was correlated with an earlier age of menarche [77]. In rats, obesity alone was shown to
blunt the LH surge required for ovulation, but that effect was worsened by a high-fat diet [78]. In
mice, obesity alters the estrous cycle, mainly by reducing the length of the estrus phase while
increasing the length of the metestrus phase [79].
Heat stress:
Coinciding with the summer season, particularly the months of July, August, and
September, American production pigs show a reduction in their overall reproductive
performance known as seasonal infertility [80,81]. Seasonal infertility manifests as impaired
overall reproductive performance due to reduced conception rates and increased embryonic
deaths. Reduced farrowing can extend to the month of December, indicating a lasting effect of
that period on the animals. During summer, animals are subjected to increased ambient
temperatures, which leads to a sustained increase in core body temperatures. This is the condition
known as heat stress (HS). US commercial swine production alone is estimated to suffer $299M
in annual losses due to HS [82]. HS doesn't just reduce the production potential of livestock
animals, but also compromises animal welfare.
HS challenges many facets of reproductive function. Investigations conducted mainly in
ruminants showed HS to impact follicular development [5,6], steroidogenesis [5–8], embryonic
[3,9,10] and fetal [10,11] development. HS also increases the onset of stress responses such as
autophagy [59,60] and apoptosis [83,84]. Atresia, a partly apoptotic process [85] by which
follicles die, was shown to be increased in ovaries of heat-stressed animals [86]. AKT
phosphorylation was shown to suppress both apoptosis [57] and autophagy [58]. These effects of
10
HS pose challenges to animal agriculture and international food security. Such concerns are
exacerbated by the grim outlook on climate change, as it is expected to increase the intensity of
heat waves [87], which could subsequently intensify the impact of HS on animal agriculture.
HS is associated with many systemic changes. Circulating insulin was repeatedly shown
to increase in heat-stressed production animals including pigs. This is paradoxical to the
phenotype of reduced feed intake, also a hallmark of HS [88–93]. Another apparent contradiction
is that, despite hyperinsulinemia, HS was shown to increase insulin sensitivity in pigs [94] and
protected rats from high-fat diet-induced insulin resistance [95]. Understanding the role of
insulin in HS is crucial as it influences ovarian function (explained below). Another systemic
hallmark of HS is endotoxemia, a condition of increased circulating bacterial debris. This
condition originates from the reduction in the integrity of the intestinal wall during HS as a
consequence of blood flow being diverted to the skin in an attempt to cool it [96,97], and is
characterized by the increased circulation of lipopolysaccharides (LPS) [92,98]. LPS signaling
through toll-like receptor 4 is also capable of regulating ovarian function, which is explained in
more detail later in this review.
Fertility and Metabolic Energy Status:
A link between the timing of puberty and body mass was described by Kennedy and
Mitra in 1963 when they demonstrated a relationship between body mass in rats and the timing
of the first onset of estrus, where rats of lower body mass showed a delayed time to first estrus
[99]. Afterwards, in 1970, Firsch and Revelle published an observational study on human
females in which they observed a similar correlation between body mass and the timing of the
11
onset of puberty, and hypothesized a correlation between the ratio of body mass and stature to
the timing of the onset of puberty [100]. Their hypothesis later came to be known as the FirschRevelle model, sometimes called the critical body weight hypothesis or the critical fat mass
hypothesis. Studies like this and others represented a growing body of evidence indicating a very
strong link between energy status and the regulation of fertility in mammals. While there was no
known mechanism linking energy status and the female reproductive system, scientists of the era
suspected the hypothalamus to be the intersection connecting the two, and it wasn’t until the
discovery of leptin that the mechanism linking energy status and fertility was recognized.
Leptin:
The characterization of leptin began with the 1950 discovery of the obese (ob) mutation
in mice [101]. Mice homozygous for the mutation (ob/ob) displayed a behavioral phenotype of
overeating, and thus were used as a model for studying obesity. ob/ob homozygous mice were
also sterile [101]. In 1994, the ob gene was cloned and its homologue identified in humans [102],
and a year later its protein product was purified and named leptin [103]. The protein is 16-kDa in
size, produced by adipose tissue [103,104], and signals satiety, thereby suppressing appetite.
Animals resistant to leptin, or incapable of producing it, develop a severe overeating phenotype,
resulting in the development of obesity and subsequent complications including Metabolic
Syndrome X and Type II diabetes. Administration of leptin to ob/ob mice reduced feed intake
and body weight. It also suppressed feed intake in fasting, wild type mice [105], which was
direct evidence of leptin's role in regulating food intake. Hypothalamic involvement in obesity
was suspected before the discovery of leptin [106], and the hypothalamic involvement in leptin’s
role in obesity was supported when hypothalamic expression of the leptin receptor (LEPR) was
12
shown in the human brain [107]. Microinjecting leptin into the ventromedial hypothalamus
enhanced its effects compared to injecting it into other regions of rat brains [108], further
supporting hypothalamic action of leptin. Together, the evidence suggested that leptin's control
of food intake was mediated by hypothalamic signaling.
With the discovery of leptin, an indicator of the body’s adipose reserves, the missing link
between energy storage and reproductive function, was identified. Injecting leptin into ob/ob
female mice rescued the sterility phenotype [109], and injecting it into normal female mice
accelerated the onset of puberty despite some retardation in growth [110,111]. Leptin was further
determined to influence reproductive function through regulation of the levels of circulating
gonadotropins [112]. Synthesis and release of gonadotropins is stimulated by GnRH which can
be regulated by leptin [113–115]. Leptin's effects on GnRH neurons are best described as
permissive as it functions following a pattern indicative of a threshold rather than a dosedependent response [115,116]. Unlike estrogen, leptin lacks the ability to interact directly with
GnRH neurons. Removal of LEPR from all neuronal populations prevented the onset of puberty
and rendered mice infertile, but selective knockout of LEPR from GnRH neurons conferred no
loss of fertility or blockage of puberty [117]. In addition, expression of STAT-3, a downstream
signal of LEPR, was not detected in GnRH neurons after the direct intracerebral administration
of leptin [117]. One indirect route by which leptin could influence GnRH neurons is by
regulating Kiss1 neurons.
The kisspeptin-kisspeptin receptor (GPR54) system was identified and characterized in
2001 by three independent reports [118–120]. However, it wasn't until 2003 that its reproductive
13
role became apparent. Two independent reports investigating idiopathic hypogonadotropic
hypogonadism – a disorder characterized by the blockage of the onset of puberty, reduced
circulating gonadotropin levels, and reduced gonadal size – in patients who were born of
multiple generations of first-cousin/tribal marriages discovered patients to be homozygous for
loss of function mutations in the GPR54 locus [121,122]. Seminara et al. expanded their
investigation using a model in which Gpr54 knockout (Gpr54-/-) mice were evaluated and
administered GnRH and gonadotropins. Gpr54-/- were infertile, never reached sexual maturity,
and had very low concentrations of circulating gonadotropins [121]. Administration of GnRH
and gonadotropins rescued reproductive function, showing kisspeptin signaling to be upstream of
both GnRH and gonadotropins [121]. A subset (10-40%) of kisspeptin neurons were shown to be
targets of leptin [123,124]. Administration of leptin in a variety of models, including the ob
mouse model, was shown to enhance kisspeptin production [124–127]. Leptin was also shown to
act outside of the kisspeptin pathway [128]. This kisspeptin-independent effect was further
explored by creating transgenic mice with Lepr knocked out in GABAergic neurons. Knockout
mice showed delayed onset of puberty, blunted LH surge, and reduced overall fertility [129].
Together, these reports show leptin as a permissive regulator of cyclicity and the onset of puberty
via indirect signaling to GnRH neurons through kisspeptin-dependent and -independent
mechanisms.
Leptin's effects are mediated by the leptin receptor, encoded by the Lepr gene. Lepr was
previously known as Db (abbreviation for diabetes) as mice homozygous for a loss of function
mutation in this gene were used as a model for Type II diabetes. The mutation was first observed
in an inbred strain of Jackson Laboratories mice (C57BL/Ks), and was first reported in a
14
publication by Hummel et al. in 1966 [130]. The authors showed this mutation to be recessive for
obesity and other visible phenotypes [130]. With the discoveries in leptin and leptin function, it
comes as no surprise that mice homozygous for the Db mutation had a similar behavioral
phenotype of overeating to the ob mice. A homozygous genotype for the loss of function in the
Db mutation also conferred infertility, which suggested a link between leptin signaling and
fertility.
Heterozygous
individuals
were
originally
considered
phenotypically
and
morphologically indistinguishable from the wild type mice, however, this has since been shown
to not be the case. Significant elevation in the levels of circulating leptin are characteristic of the
heterozygous phenotype, potentially as a compensatory response to leptin resistance induced by
the heterozygous loss of function in the leptin receptor [131]. In addition to its influence on
circulating levels of gonadotropins, leptin also directly regulates ovarian function. LEPR was
shown to be expressed in the ovaries of mice [132], cows [133], chickens [134,135], goats [136],
humans [137], rabbits [138], and pigs [139], although ovarian LEPR localization varies between
species.
Leptin signaling is primarily transduced through the PI3K pathway [140]. From a
mechanistic standpoint, this provides a possible link between leptin and ovarian physiology
through direct interactions with ovarian LEPR. As discussed above, many vital ovarian processes
including folliculogenesis and steroidogenesis are regulated by the PI3K pathway through AKT,
and leptin signaling has been shown to impact multiple stages of folliculogenesis both in vitro
and in vivo. Leptin can regulate the later stages of folliculogenesis, specifically acting as a
positive regulator of GV breakdown and ovulation. In in vitro culture of dominant follicles,
leptin absence reduced the fraction of oocytes going through germinal vesicle breakdown
15
(GVBD) without the addition of any exogenous gonadotropins [132]. Leptin’s effects on early
folliculogenesis on the other hand appear more contradictory. Administration of LEPR
antagonists resulted in the depletion of the primordial pool without an observed increase in the
accumulation of tertiary follicles in postnatal rats [141]. Conversely, reducing the effective levels
of peripheral leptin through passive immunization was shown to enhance early folliculogenesis
in prepubertal rats [142]. In addition, studies on caloric intake, which is directly related to
circulating levels of leptin, show that a modest reduction in caloric content of the diet can extend
fertility further into the lifespan, and improve the offspring's health [143].
Leptin plays an additional role in influencing ovarian development via angiogenesis, and
is an angiogenic factor [144] as well as an enhancer of fenestration [145]. The promoter of the
leptin-coding gene, ob, contains a hypoxia responsive element that enables it to respond to
hypoxia-inducible factor (HIF) 1-alpha [146] and to work in concert with vascular endothelial
growth factor (VEGF) [145]. Angiogenesis is crucial during folliculogenesis and is regulated on
an individual follicle basis, potentially leading to the selective delivery of circulating factors such
as gonadotropins [147]. Such a role of leptin provides a potential explanation for ovarian LEPR
expression. Tertiary and larger secondary follicles are dependent on gonadotropins in advancing
their development, making access to the circulatory system crucial for proper late
folliculogenesis [147]. In addition, their large size makes vascularization necessary to facilitate
the delivery of oxygen and nutrients. Because of this, appropriate follicular vascularization could
be an important factor in selecting which follicles become dominant and which are lost to atresia,
and ovarian expression of leptin could be one of its major regulators. Increased expression of
16
leptin was shown in breast [148], colon [115], and prostate [149] cancer cells, which fits with
leptin's angiogenic properties.
Insulin:
The Islets of Langerhans were first described in the pancreas in 1869 [150]. However, it
wasn’t until late 1921 that insulin was isolated and identified [150], followed by clinical use of
insulin in 1922 to successfully treat a diabetic patient [151] due to its role in regulating glucose
homeostasis. Insulin is a dipeptide; a polypeptide composed of two chains of amino acids linked
with disulphide bonds [152]. It is encoded by the Ins gene first characterized in 1982 by
Schröder and Zühlke, who also identified that mutations in this gene are among the causes of
diabetes [153]. The receptor for insulin, insulin receptor (INSR), was discovered in 1971 in the
liver [154]. Observing the rapid phosphorylation of tyrosine residues in proteins around 185kDa
in size in response to insulin stimulation of insulin-sensitive cells paved the way for the
discovery of the mechanism by which INSR transduces its signal [155].
Upon binding insulin, INSR phosphorylates a family of proteins called insulin receptor
substrates (IRS). IRS-1 was cloned in 1991 and provided crucial insight into the molecular
mechanism of insulin signaling [156]. IRS-1 knockout mice were capable of survival, and
maintained some insulin and insulin-like growth factor-1 (IGF1) function, showing that IRS-1
mediated signaling was not the sole pathway of insulin signaling. However, it is important to
note that IRS-1 knockout mice also displayed retarded growth beginning in utero [157,158],
which indicated a major role of IRS-1 in insulin signaling, even if it was not its sole pathway.
Redundancy in the mechanism of insulin signaling was explained by the discovery of IRS-2
17
[159], IRS-3 [160], IRS-4 [161], and more recently, IRS-5 and 6 [162]. IRS proteins are typically
activated through the phosphorylation of Threonine residues and are inhibited through the
phosphorylation of Serine residues [163]. Action on IRS, mainly IRS-1 and 2, can confer insulin
resistance, mainly via hyper-phosphorylation of Serine residues [163]. Reproductive tissues,
including ovarian tissue, show reduced insulin sensitivity when compared to non-reproductive
tissue [164]. The ovary and the hypothalamus also maintain insulin sensitivity in diet-induced
hyperinsulinemia [164].
IRS-mediated signaling induces the phosphorylation of SH2 domains [165]. A major
consequence of this is that PI3K becomes a target for insulin signaling [156,159–161] as it
contains multiple SH2 domains [166–168], although it is worth noting that some insulin effects,
such as the regulation of glucose transport, can function independently of PI3K signaling [18].
As explained above, PI3K is central to ovarian function at large, which enables insulin to exert a
direct influence on ovarian phenotype. In pigs, administration of insulin was associated with
improved rates of ovulation [169] and a decrease in the onset of atresia [170]. Ex vivo culture of
human ovarian cortical tissue showed accelerated early folliculogenesis in response to insulin
and IGF1 treatments, as treated tissues showed increased accumulation of primary follicles and
decelerated the loss of larger follicles due to atresia [171]. Insulin was also shown to stimulate
ovarian steroidogenesis [172]. As a general effect, the increase in steroidogenesis as a response
to insulin is well conserved, such that porcine and bovine insulin can stimulate ovarian
steroidogenesis in insects [173–175]. The sum of this evidence suggests that insulin has a direct
mode of action in regulating ovarian function, making hyperinsulinemia a probable causative
factor in the ovarian phenotypic perturbations displayed during obesity and HS.
18
LPS and TLR4 signaling:
Toll-like receptors (TLR) are cell-surface receptors that mediate the initiation of the
innate immune response to pathogens [176]. Toll-like receptors are named as such due to the
homology they share with Toll, a Drosophila receptor shown to participate the innate, antifungal
immune response [177]. Toll, and in turn TLRs, do this by recognizing antigens associated with
pathogens. These antigens are named pathogen-associated molecular patterns (PAMPs) [176]. So
far, 13 mammalian TLRs have been characterized [178,179]. Different TLRs specialize in
recognizing different classes of PAMPs. For instance, TLRs 3, 7, 8, and 9 bind nucleic acids,
while TLRs 2, 4, 5, 6 are capable of binding PAMPs found on bacterial surfaces [178]. Because
the elevation of circulating lipopolysaccharides, or LPS, is a characteristic of the endotoxemia
induced by obesity and HS, this thesis focuses on TLR4 as it is the primary receptor by which
the innate immune response to LPS is initiated [180,181].
TLRs mediate their inflammatory signaling through nuclear factor-kappa B (NF-κB) and
its family of transcription factors [182]; a response mediated by PI3K in the case of TLR4 [183].
Expression of TLR4 can be altered in response to circulating factors. For example, TLR4
expression can be altered during inflammation [182]. In renal epithelial cells, TLR4 expression
was shown to increase in response to the inflammatory, tumor necrosis factor alpha (TNF-α) in
vivo [184]. TLR4 is expressed in the reproductive tract and in the ovary [185], and its expression
is differential between follicular cell types [186]. Granulosa cells were shown to have increased
expression of TLR4 compared to the cumulus oocyte complex in mice [186]. Interestingly,
stimulating follicles with gonadotropins increased the expression of TLR4 in both the COC and
19
in granulosa cells [186]. Expression of TLR4 in the reproductive tract in general explains, at
least partially, the reproductive phenotypes displayed in response to an LPS challenge.
In mice, LPS administration induced early loss of pregnancy through both abortion and
resorption [187–189]. These observations fit with the increased production of prostaglandin F2α
(PGF2α), a factor which induces the degradation of the CL, in cultured bovine endometrial cells
when challenged with LPS [190]. Administration of LPS to cows during the luteal phase of the
estrous cycle caused shrinkage of the CL, and reduced circulating progesterone levels [191].
Additionally, LPS was shown to suppress the expression of progesterone receptors in mouse
uteri, which could contribute to the increase in PGF2α production [192]. LPS also disrupted
early folliculogenesis by depleting primordial follicles in mice and cows [193]. These data
demonstrate LPS's wide capacity to disrupt reproductive function, making it a good candidate for
participating in the reproductive impairment phenotypes observed during obesity and HS.
Summary:
The literature reviewed herein demonstrate the central role of AKT-mediated PI3K
signaling in ovarian function both in normal and abnormal conditions. PI3K regulates
folliculogenesis, steroidogenesis, and was shown to relay gonadotropic signaling. Stressors
which compromise reproductive performance by upsetting the balance of ovarian functions often
converge in their signaling, at least in part, at PI3K. Leptin exerts its effects through the PI3K
pathway as mediated by LEPR. Similarly, insulin activates PI3K through INSR and IRS
signaling. TLR4 also activates PI3K signaling once it binds LPS. Obesity induces many
reproductive problems, which can partly be explained by hyperinsulinemia, hyperleptinemia, and
20
endotoxemia. HS compromises the reproductive capacity of livestock, and is associated with
hyperinsulinemia, endotoxemia, increased apoptosis, autophagy, and atresia. All of these
responses converge at PI3K, indicating that metabolic signals insulin and LPS could participate
in said responses. We hypothesized a role for leptin in the reproductive phenotypes displayed
during obesity (Chapter 2), and contribution of hyperinsulinemia and metabolic endotoxemia
during HS-induced seasonal infertility (Chapter 3). Investigating these stressors is of great
importance: Obesity is a worldwide, public health concern which has been on an upwards trend
for decades. HS is also a significant issue as it reduces the capacity of animal production and
compromises animal welfare, problems which are only projected to be worsened by the
impending threat of climate change.
21
Figure 1.1. Histological Features of the Mammalian Ovary
This figure depicts the mammalian ovary and the follicles; the functional units which confer
ovarian functions. Stages of follicular development are visible here, beginning with the
primordial follicle shown as an oocyte (pink) surrounded by flattened granulosa cells (green).
Once activated, the granulosa cells take on a cuboidal morphology and the follicle transitions
into the primary stage. When gaining multiple layers of granulosa cells, the follicle becomes
secondary, and at this stage it gains a thecal layer composed of theca cells (purple). At this stage,
the follicle gains the capacity to catalyze the entire steroidogenic pathway to produce estrogen.
With further development, the follicle acquires a fluid-filled cavity, the antrum (beige), which
characterizes its entry into the tertiary, or antral, stage. Under the influence of LH, a tertiary
follicle can grow into a pre-ovulatory, or dominant, follicle, characterized by the cumulusoocyte-complex (COC) seen, in this figure, budding into the antrum. A surge in LH causes the
oocyte to be ovulated as a part of the COC, while the rest of the follicle goes on to become the
corpus luteum (CL; brown), specialized in producing progesterone. Unless a pregnancy takes
hold, the CL is degraded and the cycle starts over. Activated follicles not selected to become
dominant die through the process of atresia. With copyright permission. (Reproduced from
Keating, A.F. and Hoyer, P.B. 2009. Mechanisms of reproductive toxicity. In: Drug metabolism
in pharmaceuticals; Concepts and Applications. Chapter 24: 697-734.)
22
Bibliography:
[1]
Madigan MT, Martinko JM, Bender KS, Buckley DH, Stahl DA, Brock T. Brock Biology
of Microorganisms. 12th ed. San Francisco: Pearson Education; 2008.
[2]
Silver L, Hood L, Hartwell L, Goldberg M, Reynolds AE. Genetics: From Genes to
Genomes. 4th ed. New York: McGraw-Hil; 2010.
[3]
Lewin B, Krebs J, Kilpatrick ST, Goldstein ES. Lewin’s GENES X. Sudbry: Jones &
Bartlett Publishers; 2011.
[4]
Alberts B, Bray D, Hopkin K, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Essential
Cell Biology. 3rd ed. New York: Garland Science; 2010.
[5]
Nussbaum RL, McInnes RR, Willard HF. Thompson & Thompson Genetics in Medicine.
7th ed. Philadelphia: Elsevier Health Sciences; 2007.
[6]
Gosden RG, Laing SC, Felicio LS, Nelson JF, Finch CE. Imminent oocyte exhaustion and
reduced follicular recruitment mark the transition to acyclicity in aging C57BL/6J mice.
Biol Reprod 1983; 28:255–60.
[7]
Richardson SJ, Senikas V, Nelson JF. Follicular depletion during the menopausal
transition: evidence for accelerated loss and ultimate exhaustion. J Clin Endocrinol Metab
1987; 65:1231–7.
[8]
Hirshfield AN. Development of follicles in the mammalian ovary. Int Rev Cytol 1991;
124:43–101.
[9]
Edson MA, Nagaraja AK, Matzuk MM. The mammalian ovary from genesis to revelation.
Endocr Rev 2009; 30:624–712.
[10] Tingen C, Kim A, Woodruff TK. The primordial pool of follicles and nest breakdown in
mammalian ovaries. Mol Hum Reprod 2009; 15:795–803.
23
[11] Pepling ME, Spradling AC. Female mouse germ cells form synchronously dividing cysts.
Development 1998; 125:3323–8.
[12] de Cuevas M, Lilly MA, Spradling AC. Germline cyst formation in Drosophila. Annu Rev
Genet 1997; 31:405–28.
[13] Pepling ME, Spradling AC. Mouse ovarian germ cell cysts undergo programmed
breakdown to form primordial follicles. Dev Biol 2001; 234:339–51.
[14] Konishi I, Fujii S, Okamura H, Parmley T, Mori T. Development of interstitial cells and
ovigerous cords in the human fetal ovary: an ultrastructural study. J Anat 1986; 148:121–
35.
[15] Pedersen T, Peters H. Proposal for a classification of oocytes and follicles in the mouse
ovary. J Reprod Fertil 1968; 17:555–7.
[16] Fortune JE, Cushman RA, Wahl CM, Kito S. The primordial to primary follicle transition.
Mol Cell Endocrinol 2000; 163:53–60.
[17] Eppig JJ, O’Brien MJ. Development in vitro of mouse oocytes from primordial follicles.
Biol Reprod 1996; 54:197–207.
[18] Saltiel AR, Pessin JE. Insulin signaling pathways in time and space. Trends Cell Biol
2002; 12:65–71.
[19] Wilker E, Lu J, Rho O, Carbajal S, Beltrán L, DiGiovanni J. Role of PI3K/Akt signaling
in insulin-like growth factor-1 (IGF-1) skin tumor promotion. Mol Carcinog 2005;
44:137–45.
[20] McGee EA, Hsueh AJ. Initial and cyclic recruitment of ovarian follicles. Endocr Rev
2000; 21:200–14.
24
[21] Brazil DP, Hemmings BA. Ten years of protein kinase B signalling: a hard Akt to follow.
Trends Biochem Sci 2001; 26:657–64.
[22] Castrillon DH, Miao L, Kollipara R, Horner JW, DePinho RA. Suppression of ovarian
follicle activation in mice by the transcription factor Foxo3a. Science 2003; 301:215–8.
[23] John GB, Gallardo TD, Shirley LJ, Castrillon DH. Foxo3 is a PI3K-dependent molecular
switch controlling the initiation of oocyte growth. Dev Biol 2008; 321:197–204.
[24] Reddy P, Liu L, Adhikari D, Jagarlamudi K, Rajareddy S, Shen Y, Du C, Tang W,
Hämäläinen T, Peng SL, Lan Z-J, Cooney AJ, et al. Oocyte-specific deletion of Pten
causes premature activation of the primordial follicle pool. Science 2008; 319:611–3.
[25] Fortune JE. The early stages of follicular development: activation of primordial follicles
and growth of preantral follicles. Anim Reprod Sci 2003; 78:135–63.
[26] Shalgi R, Kraicer P, Rimon A, Pinto M, Soferman N. Proteins of human follicular fluid:
the blood-follicle barrier. Fertil Steril 1973; 24:429–34.
[27] Falck B. Site of production of oestrogen in rat ovary as studied in micro-transplants. Acta
Physiol Scand Suppl 1959; 47:1–101.
[28] Short R V. Steroids in the follicular fluid and the corpus luteum of the mare. A ‘two-cell
type’ theory of ovarian steroid synthesis. J Endocrinol 1962; 24:59–63.
[29] Bjersing L, Carstensen H. The Role of the Granulosa Cell in the Biosynthesis of Ovarian
Steroid Hormones. Biochim Biophys Acta 1964; 86:639–40.
[30] Bjersing L, Carstensen H. Biosynthesis of steroids by granulosa cells of the porcine ovary
in vitro. J Reprod Fertil 1967; 14:101–11.
[31] Ryan KJ, Short R V. Formation of Estradiol by Granulosa and Theca Cells of the Equine
Ovarian Follicle. Endocrinology 1965; 76:108–14.
25
[32] Ryan KJ, Petro Z. Steroid biosynthesis by human ovarian granulosa and thecal cells. J
Clin Endocrinol Metab 1966; 26:46–52.
[33] Ryan KJ, Petro Z, Kaiser J. Steroid formation by isolated and recombined ovarian
granulosa and tehcal cells. J Clin Endocrinol Metab 1968; 28:355–8.
[34] Channing CP. Steroidogenesis and morphology of human ovarian cell types in tissue
culture. J Endocrinol 1969; 45:297–308.
[35] Makris A, Ryan KJ. Progesterone, androstenedione, testosterone, estrone, and estradiol
synthesis in hamster ovarian follicle cells. Endocrinology 1975; 96:694–701.
[36] Erickson GF, Ryan KJ. The effect of LH/FSH, dibutyryl cyclic AMP, and prostaglandins
on the production of estrogens by rabbit granulosa cells in vitro. Endocrinology 1975;
97:108–13.
[37] Dorrington JH, Moon YS, Armstrong DT. Estradiol-17beta biosynthesis in cultured
granulosa cells from hypophysectomized immature rats; stimulation by folliclestimulating hormone. Endocrinology 1975; 97:1328–31.
[38] Erickson GF, Ryan KJ. Stimulation of testosterone production in isolated rabbit thecal
tissue by LH/FSH, dibutyryl cyclic AMP, PGE2alpha, and PGE2. Endocrinology 1976;
99:452–8.
[39] Fortune JE, Armstrong DT. Androgen production by theca and granulosa isolated from
proestrous rat follicles. Endocrinology 1977; 100:1341–7.
[40] Moor RM. Sites of steroid production in ovine graafian follicles in culture. J Endocrinol
1977; 73:143–50.
26
[41] Kallen CB, Billheimer JT, Summers SA, Stayrook SE, Lewis M, Strauss JF. Steroidogenic
Acute Regulatory Protein (StAR) Is A Sterol Transfer Protein. J Biol Chem 1998;
273:26285–26288.
[42] Miller WL. Steroidogenic acute regulatory protein (StAR), a novel mitochondrial
cholesterol transporter. Biochim Biophys Acta 2007; 1771:663–76.
[43] Clark BJ, Wells J, King SR, Stocco DM. The purification, cloning, and expression of a
novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor
cells. Characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem
1994; 269:28314–22.
[44] Hall PF. Cytochromes P-450 and the regulation of steroid synthesis. Steroids 48:131–96.
[45] Simpson ER. Cholesterol side-chain cleavage, cytochrome P450, and the control of
steroidogenesis. Mol Cell Endocrinol 1979; 13:213–27.
[46] Niswender GD. Molecular control of luteal secretion of progesterone. Reproduction 2002;
123:333–9.
[47] Rekawiecki R, Kowalik MK, Slonina D, Kotwica J. Regulation of progesterone synthesis
and action in bovine corpus luteum. J Physiol Pharmacol 2008; 59 Suppl 9:75–89.
[48] Miller WL, Auchus RJ. The molecular biology, biochemistry, and physiology of human
steroidogenesis and its disorders. Endocr Rev 2011; 32:81–151.
[49] Jamnongjit M, Hammes SR. Ovarian steroids: the good, the bad, and the signals that raise
them. Cell Cycle 2006; 5:1178–83.
[50] Tandon OP, Chintala R. Hypothalamo-pituitary-gonadal axis in control of female
reproductive cycle. Indian J Physiol Pharmacol 2001; 45:395–407.
27
[51] Knobil E. A Hypothalamic Pulse Generator Governs Mammalian Reproduction. News
Physiol Sci 1987; 2:42–43.
[52] Handelsman DJ, Swerdloff RS. Pharmacokinetics of gonadotropin-releasing hormone and
its analogs. Endocr Rev 1986; 7:95–105.
[53] Herbison AE, Pape JR. New evidence for estrogen receptors in gonadotropin-releasing
hormone neurons. Front Neuroendocr 2001; 22:292–308.
[54] Bashour NM, Wray S. Progesterone directly and rapidly inhibits GnRH neuronal activity
via progesterone receptor membrane component 1. Endocrinology 2012; 153:4457–69.
[55] Meier R, Alessi DR, Cron P, Andjelković M, Hemmings BA. Mitogenic activation,
phosphorylation, and nuclear translocation of protein kinase Bbeta. J Biol Chem 1997;
272:30491–7.
[56] Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC,
Blenis J, Greenberg ME. Akt Promotes Cell Survival by Phosphorylating and Inhibiting a
Forkhead Transcription Factor. Cell 1999; 96:857–868.
[57] Franke TF, Hornik CP, Segev L, Shostak GA, Sugimoto C. PI3K/Akt and apoptosis: size
matters. Oncogene 2003; 22:8983–8998.
[58] Wang RC, Wei Y, An Z, Zou Z, Xiao G, Bhagat G, White M, Reichelt J, Levine B. Aktmediated regulation of autophagy and tumorigenesis through Beclin 1 phosphorylation.
Science 2012; 338:956–9.
[59] Liu T-T, Hu C-H, Tsai C-D, Li C-W, Lin Y-F, Wang J-Y. Heat stroke induces autophagy
as a protection mechanism against neurodegeneration in the brain. Shock 2010; 34:643–8.
28
[60] Oberley TD, Swanlund JM, Zhang HJ, Kregel KC. Aging results in increased autophagy
of mitochondria and protein nitration in rat hepatocytes following heat stress. J Histochem
Cytochem 2008; 56:615–27.
[61] Gonzalez-Robayna IJ, Falender AE, Ochsner S, Firestone GL, Richards JS. FollicleStimulating hormone (FSH) stimulates phosphorylation and activation of protein kinase B
(PKB/Akt) and serum and glucocorticoid-lnduced kinase (Sgk): evidence for A kinaseindependent signaling by FSH in granulosa cells. Mol Endocrinol 2000; 14:1283–300.
[62] Chen Y-J, Hsiao P-W, Lee M-T, Mason JI, Ke F-C, Hwang J-J. Interplay of PI3K and
cAMP/PKA signaling, and rapamycin-hypersensitivity in TGFbeta1 enhancement of FSHstimulated steroidogenesis in rat ovarian granulosa cells. J Endocrinol 2007; 192:405–19.
[63] Hunzicker-Dunn M, Maizels ET. FSH signaling pathways in immature granulosa cells
that regulate target gene expression: branching out from protein kinase A. Cell Signal
2006; 18:1351–9.
[64] Alam H, Maizels ET, Park Y, Ghaey S, Feiger ZJ, Chandel NS, Hunzicker-Dunn M.
Follicle-stimulating
hormone
activation
of
hypoxia-inducible
factor-1
by
the
phosphatidylinositol 3-kinase/AKT/Ras homolog enriched in brain (Rheb)/mammalian
target of rapamycin (mTOR) pathway is necessary for induction of select protein markers
of follic. J Biol Chem 2004; 279:19431–40.
[65] Fukuda S, Orisaka M, Tajima K, Hattori K, Kotsuji F. Luteinizing hormone-induced Akt
phosphorylation and androgen production are modulated by MAP Kinase in bovine theca
cells. J Ovarian Res 2009; 2:17.
29
[66] WHO.
Obesity
and
overweight;
2015.
http://www.who.int/mediacentre/factsheets/fs311/en/. Accessed 28 January 2016.
[67] Ogden CL, Carroll MD, Fryar CD, Flegal KM. Prevalence of Obesity Among Adults and
Youth: United States, 2011-2014. NCHS Data Brief 2015:1–8.
[68] Expert Panel Report: Guidelines (2013) for the management of overweight and obesity in
adults. Obesity (Silver Spring) 2014; 22 Suppl 2:S41–410.
[69] NHLBI Obesity Education Initiative Expert Panel on the Identification E and T of O in A
(US). Clinical Guidelines on the Identification, Evaluation, and Treatment of Overweight
and Obesity in Adults n.d.
[70] Considine R V, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR,
Ohannesian JP, Marco CC, McKee LJ, Bauer TL. Serum immunoreactive-leptin
concentrations in normal-weight and obese humans. N Engl J Med 1996; 334:292–5.
[71] Al Maskari MY, Alnaqdy AA. Correlation between Serum Leptin Levels, Body Mass
Index and Obesity in Omanis. Sultan Qaboos Univ Med J 2006; 6:27–31.
[72] Pasquali R, Casimirri F. The impact of obesity on hyperandrogenism and polycystic ovary
syndrome in premenopausal women. Clin Endocrinol (Oxf) 1993; 39:1–16.
[73] Rogers J, Mitchell GW. The relation of obesity to menstrual disturbances. N Engl J Med
1952; 247:53–5.
[74] Hartz AJ, Barboriak PN, Wong A, Katayama KP, Rimm AA. The association of obesity
with infertility and related menstural abnormalities in women. Int J Obes 1979; 3:57–73.
[75] Wittemer C, Ohl J, Bailly M, Bettahar-Lebugle K, Nisand I. Does body mass index of
infertile women have an impact on IVF procedure and outcome? J Assist Reprod Genet
2000; 17:547–52.
30
[76] De Pergola G, Maldera S, Tartagni M, Pannacciulli N, Loverro G, Giorgino R. Inhibitory
effect of obesity on gonadotropin, estradiol, and inhibin B levels in fertile women. Obesity
(Silver Spring) 2006; 14:1954–60.
[77] Zacharias L, Wurtman RJ, Schatzoff M. Sexual maturation in contemporary American
girls. Am J Obstet Gynecol 1970; 108:833–46.
[78] Balasubramanian P, Jagannathan L, Mahaley RE, Subramanian M, Gilbreath ET,
Mohankumar PS, Mohankumar SMJ. High fat diet affects reproductive functions in
female diet-induced obese and dietary resistant rats. J Neuroendocrinol 2012; 24:748–55.
[79] Nteeba J, Ganesan S, Keating AF. Progressive Obesity Alters Ovarian Folliculogenesis
with Impacts on Pro- Inflammatory and Steroidogenic Signaling in Female Mice 1. Biol
Reprod 2014; 91:1–11.
[80] Tompkins EC, Heidenreich CJ, Stob M. Effect of Post-Breeding Thermal Stress on
Embyronic Mortality in Swine. J Anim Sci 1967; 26:377–380.
[81] Edwards RL, Omtvedt IT, Tuesman EJ, Stephens DF, Mahoney GWA. Reproductive
Performance of Gilts following Heat Stress Prior to Breeding and in Early Gestation. J
Anim Sci 1968; 27:1634–1637.
[82] St-Pierre NR, Cobanov B, Schnitkey G. Economic losses from heat stress by US livestock
industries. J Dairy Sci 2003; 86:E52–E77.
[83] Brinton MR, Tagge CA, Stewart RJ, Cheung AK, Shiu Y-TE, Christensen DA. Thermal
sensitivity of endothelial cells on synthetic vascular graft material. Int J Hyperthermia
2012; 28:163–74.
31
[84] Gu ZT, Wang H, Li L, Liu YS, Deng XB, Huo SF, Yuan FF, Liu ZF, Tong HS, Su L.
Heat
stress
induces
apoptosis
through
transcription-independent
p53-mediated
mitochondrial pathways in human umbilical vein endothelial cell. Sci Rep 2014; 4:4469.
[85] Kaipia A, Hsueh AJ. Regulation of ovarian follicle atresia. Annu Rev Physiol 1997;
59:349–63.
[86] Shimizu T, Ohshima I, Kanai Y. Effects of heat stress on follicular development in
PMSG-treated immature rats. Anim Sci J 2000; 71:32–37.
[87] Meehl GA, Tebaldi C. More intense, more frequent, and longer lasting heat waves in the
21st century. Science 2004; 305:994–7.
[88] Quiniou N, Noblet J. Influence of high ambient temperatures on performance of
multiparous lactating sows. J Anim Sci 1999; 77:2124–34.
[89] Victoria Sanz Fernandez M, Johnson JS, Abuajamieh M, Stoakes SK, Seibert JT, Cox L,
Kahl S, Elsasser TH, Ross JW, Isom SC, Rhoads RP, Baumgard LH. Effects of heat stress
on carbohydrate and lipid metabolism in growing pigs. Physiol Rep 2015; 3.
[90] O’Brien MD, Rhoads RP, Sanders SR, Duff GC, Baumgard LH. Metabolic adaptations to
heat stress in growing cattle. Domest Anim Endocrinol 2010; 38:86–94.
[91] Wheelock JB, Rhoads RP, Vanbaale MJ, Sanders SR, Baumgard LH. Effects of heat stress
on energetic metabolism in lactating Holstein cows. J Dairy Sci 2010; 93:644–55.
[92] Pearce SC, Gabler NK, Ross JW, Escobar J, Patience JF, Rhoads RP, Baumgard LH. The
effects of heat stress and plane of nutrition on metabolism in growing pigs. J Anim Sci
2013; 91:2108–18.
[93] Pearce SC, Upah NC, Harris A, Gabler NK, Ross JW, Rhoads RP, Baumgard LH. Effects
of heat stress on energetic metabolism in growing pigs. FASEB J 2011; 25:1052.5–.
32
[94] Sanz Fernandez MV, Stoakes SK, Abuajamieh M, Seibert JT, Johnson JS, Horst EA,
Rhoads RP, Baumgard LH. Heat stress increases insulin sensitivity in pigs. Physiol Rep
2015; 3.
[95] Gupte AA, Bomhoff GL, Swerdlow RH, Geiger PC. Heat treatment improves glucose
tolerance and prevents skeletal muscle insulin resistance in rats fed a high-fat diet.
Diabetes 2009; 58:567–78.
[96] Hall DM, Baumgardner KR, Oberley TD, Gisolfi C V. Splanchnic tissues undergo
hypoxic stress during whole body hyperthermia. Am J Physiol 1999; 276:G1195–203.
[97] Lambert GP, Gisolfi C V, Berg DJ, Moseley PL, Oberley LW, Kregel KC. Selected
contribution: Hyperthermia-induced intestinal permeability and the role of oxidative and
nitrosative stress. J Appl Physiol 2002; 92:1750–61; discussion 1749.
[98] Pearce SC, Mani V, Boddicker RL, Johnson JS, Weber TE, Ross JW, Baumgard LH,
Gabler NK. Heat stress reduces barrier function and alters intestinal metabolism in
growing pigs. J Anim Sci 2012; 90 Suppl 4:257–9.
[99] Kennedy GC, Mitra J. Body weight and food intake as initiating factors for puberty in the
rat. J Physiol 1963; 166:408–18.
[100] Frisch RE, Revelle R. Height and weight at menarche and a hypothesis of critical body
weights and adolescent events. Science 1970; 169:397–9.
[101] Ingalls AM, Dickie MM, Snell GD. Obese, a new mutation in the house mouse. J Hered
1950; 41:317–318.
[102] Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning
of the mouse obese gene and its human homologue. Nature 1994; 372:425–32.
33
[103] Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL,
Burley SK, Friedman JM. Weight-reducing effects of the plasma protein encoded by the
obese gene. Science (80- ) 1995; 269:543–546.
[104] Elmquist JK, Elias CF, Saper CB. From Lesions to Leptin : Hypothalamic Control of Food
Intake and Body Weight. Neuron 1999; 22:221–232.
[105] Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P. Recombinant mouse OB protein:
evidence for a peripheral signal linking adiposity and central neural networks. Science
1995; 269:546–9.
[106] Hetherington AW, Ranson SW. Hypothalamic lesions and adiposity in the rat. Anat Rec
1940; 78:149–172.
[107] Couce ME, Burguera B, Parisi JE, Jensen MD, Lloyd R V. Localization of leptin receptor
in the human brain. Neuroendocrinology 1997; 66:145–50.
[108] Jacob RJ, Dziura J, Medwick MB, Leone P, Caprio S, During M, Shulman GI, Sherwin
RS. The effect of leptin is enhanced by microinjection into the ventromedial
hypothalamus. Diabetes 1997; 46:150–2.
[109] Chehab FF, Lim ME, Lu R. Correction of the sterility defect in homozygous obese female
mice by treatment with the human recombinant leptin. Nat Genet 1996; 12:318–20.
[110] Chehab FF, Mounzih K, Lu R, Lim ME. Early onset of reproductive function in normal
female mice treated with leptin. Science 1997; 275:88–90.
[111] Ahima RS, Dushay J, Flier SN, Prabakaran D, Flier JS. Leptin accelerates the onset of
puberty in normal female mice. J Clin Invest 1997; 99:391–5.
34
[112] Barash IA, Cheung CC, Weigle DS, Ren H, Kabigting EB, Kuijper JL, Clifton DK,
Steiner RA. Leptin is a metabolic signal to the reproductive system. Endocrinology 1996;
137:3144–7.
[113] Elias CF, Purohit D. Leptin signaling and circuits in puberty and fertility. Cell Mol Life
Sci 2013; 70:841–862.
[114] Elias CF. Leptin action in pubertal development: recent advances and unanswered
questions. Trends Endocrinol Metab 2012; 23:9–15.
[115] Uddin S, Hussain AR, Khan OS, Al-Kuraya KS. Role of dysregulated expression of leptin
and leptin receptors in colorectal carcinogenesis. Tumour Biol 2014; 35:871–9.
[116] Watanobe H. Leptin directly acts within the hypothalamus to stimulate gonadotropinreleasing hormone secretion in vivo in rats. J Physiol 2002; 545:255–268.
[117] Quennell JH, Mulligan AC, Tups A, Liu X, Phipps SJ, Kemp CJ, Herbison AE, Grattan
DR, Anderson GM. Leptin indirectly regulates gonadotropin-releasing hormone neuronal
function. Endocrinology 2009; 150:2805–2812.
[118] Kotani M, Detheux M, Vandenbogaerde A, Communi D, Vanderwinden JM, Le Poul E,
Brézillon S, Tyldesley R, Suarez-Huerta N, Vandeput F, Blanpain C, Schiffmann SN, et
al. The metastasis suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the
orphan G protein-coupled receptor GPR54. J Biol Chem 2001; 276:34631–6.
[119] Ohtaki T, Shintani Y, Honda S, Matsumoto H, Hori A, Kanehashi K, Terao Y, Kumano S,
Takatsu Y, Masuda Y, Ishibashi Y, Watanabe T, et al. Metastasis suppressor gene KiSS-1
encodes peptide ligand of a G-protein-coupled receptor. Nature 2001; 411:613–7.
[120] Muir AI, Chamberlain L, Elshourbagy NA, Michalovich D, Moore DJ, Calamari A,
Szekeres PG, Sarau HM, Chambers JK, Murdock P, Steplewski K, Shabon U, et al.
35
AXOR12, a novel human G protein-coupled receptor, activated by the peptide KiSS-1. J
Biol Chem 2001; 276:28969–75.
[121] Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno JS, Shagoury JK, BoAbbas Y, Kuohung W, Schwinof KM, Hendrick AG, Zahn D, Dixon J, et al. The GPR54
Gene as a Regulator of Puberty. N Engl J Med 2003; 349:1614–1627.
[122] de Roux N, Genin E, Carel J-C, Matsuda F, Chaussain J-L, Milgrom E. Hypogonadotropic
hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc
Natl Acad Sci U S A 2003; 100:10972–6.
[123] Cravo RM, Margatho LO, Osborne-Lawrence S, Donato J, Atkin S, Bookout AL,
Rovinsky S, Frazão R, Lee CE, Gautron L, Zigman JM, Elias CF. Characterization of
Kiss1 neurons using transgenic mouse models. Neuroscience 2011; 173:37–56.
[124] Smith JT, Acohido B V, Clifton DK, Steiner RA. KiSS-1 neurones are direct targets for
leptin in the ob/ob mouse. J Neuroendocr 2006; 18:298–303.
[125] Backholer K, Smith JT, Rao A, Pereira A, Iqbal J, Ogawa S, Li Q, Clarke IJ. Kisspeptin
cells in the ewe brain respond to leptin and communicate with neuropeptide Y and
proopiomelanocortin cells. Endocrinology 2010; 151:2233–2243.
[126] Luque RM, Kineman RD, Tena-Sempere M. Regulation of hypothalamic expression of
KiSS-1 and GPR54 genes by metabolic factors: analyses using mouse models and a cell
line. Endocrinology 2007; 148:4601–11.
[127] Castellano JM, Navarro VM, Fernandez-Fernandez R, Roa J, Vigo E, Pineda R, Dieguez
C, Aguilar E, Pinilla L, Tena-Sempere M. Expression of hypothalamic KiSS-1 system and
rescue of defective gonadotropic responses by kisspeptin in streptozotocin-induced
diabetic male rats. Diabetes 2006; 55:2602–2610.
36
[128] Donato J, Cravo RM, Frazão R, Gautron L, Scott MM, Lachey J, Castro IA, Margatho
LO, Lee S, Lee C, Richardson JA, Friedman J, et al. Leptin’s effect on puberty in mice is
relayed by the ventral premammillary nucleus and does not require signaling in Kiss1
neurons. J Clin Invest 2011; 121:355–68.
[129] Zuure WA, Roberts AL, Quennell JH, Anderson GM. Leptin signaling in GABA neurons,
but not glutamate neurons, is required for reproductive function. J Neurosci 2013;
33:17874–17883.
[130] Hummel KP, Dickie MM, Coleman DL. Diabetes, a new mutation in the mouse. Science
1966; 153:1127–8.
[131] Pollock KE, Stevens D, Pennington KA, Thaisrivongs R, Kaiser J, Ellersieck MR, Miller
DK, Schulz LC. Hyperleptinemia During Pregnancy Decreases Adult Weight of Offspring
and Is Associated With Increased Offspring Locomotor Activity in Mice. Endocrinology
2015; 156:3777–90.
[132] Ryan NK, Woodhouse CM, Van der Hoek KH, Gilchrist RB, Armstrong DT, Norman RJ.
Expression of leptin and its receptor in the murine ovary: possible role in the regulation of
oocyte maturation. Biol Reprod 2002; 66:1548–1554.
[133] Sarkar M, Schilffarth S, Schams D, Meyer HHD, Berisha B. The expression of leptin and
its receptor during different physiological stages in the bovine ovary. Mol Reprod Dev
2010; 77:174–81.
[134] Paczoska-Eliasiewicz HE, Gertler A, Proszkowiec M, Proudman J, Hrabia A, Sechman A,
Mika M, Jacek T, Cassy S, Raver N, Rzasa J. Attenuation by leptin of the effects of
fasting on ovarian function in hens (Gallus domesticus). Reproduction 2003; 126:739–51.
37
[135] Ohkubo T, Tanaka M, Nakashima K. Structure and tissue distribution of chicken leptin
receptor (cOb-R) mRNA. Biochim Biophys Acta 2000; 1491:303–8.
[136] Batista a. M, Silva DMF, Rêgo MJBM, Silva FLM, Silva ECB, Beltrão EIC, Gomes
Filho M a., Wischral a., Guerra MMP. The expression and localization of leptin and its
receptor in goat ovarian follicles. Anim Reprod Sci 2013; 141:142–147.
[137] Karlsson C, Lindell K, Svensson E, Bergh C, Lind P, Billig H, Carlsson LMS, Carlsson B.
Expression of Functional Leptin Receptors in the Human Ovary 1. J Clin Endocrinol
Metab 1997; 82:4144–4148.
[138] Zerani M, Boiti C, Zampini D, Brecchia G, Dall’Aglio C, Ceccarelli P, Gobbetti A. Ob
receptor in rabbit ovary and leptin in vitro regulation of corpora lutea. J Endocrinol 2004;
183:279–88.
[139] Ruiz-Cortés ZT, Men T, Palin MF, Downey BR, Lacroix DA, Murphy BD. Porcine leptin
receptor: molecular structure and expression in the ovary. Mol Reprod Dev 2000; 56:465–
74.
[140] Elias CF. the Biological Effects of Leptin. Arq Bras Endocrinol Metabol 2010; 54:591–
602.
[141] Attig L, Larcher T, Gertler A, Abdennebi-Najar L, Djiane J. Postnatal leptin is necessary
for maturation of numerous organs in newborn rats. Organogenesis 2011; 7:88–94.
[142] Panwar S, Herrid M, Kauter KG, McFarlane JR. Effect of passive immunization against
leptin on ovarian follicular development in prepubertal mice. J Reprod Immunol 2012;
96:19–24.
38
[143] Selesniemi K, Lee H-J, Tilly JL. Moderate caloric restriction initiated in rodents during
adulthood sustains function of the female reproductive axis into advanced chronological
age. Aging Cell 2008; 7:622–9.
[144] Bouloumié A, Drexler HC, Lafontan M, Busse R. Leptin, the product of Ob gene,
promotes angiogenesis. Circ Res 1998; 83:1059–66.
[145] Cao R, Brakenhielm E, Wahlestedt C, Thyberg J, Cao Y. Leptin induces vascular
permeability and synergistically stimulates angiogenesis with FGF-2 and VEGF. Proc
Natl Acad Sci U S A 2001; 98:6390–5.
[146] Ambrosini G, Nath AK, Sierra-Honigmann MR, Flores-Riveros J. Transcriptional
activation of the human leptin gene in response to hypoxia. Involvement of hypoxiainducible factor 1. J Biol Chem 2002; 277:34601–9.
[147] Zeleznik AJ, Schuler HM, Reichert LE. Gonadotropin-binding sites in the rhesus monkey
ovary: role of the vasculature in the selective distribution of human chorionic
gonadotropin to the preovulatory follicle. Endocrinology 1981; 109:356–62.
[148] Ishikawa M, Kitayama J, Nagawa H. Enhanced expression of leptin and leptin receptor
(OB-R) in human breast cancer. Clin Cancer Res 2004; 10:4325–31.
[149] Habib CN, Al-Abd AM, Tolba MF, Khalifa AE, Khedr A, Mosli HA, Abdel-Naim AB.
Leptin influences estrogen metabolism and accelerates prostate cell proliferation. Life Sci
2015; 121:10–5.
[150] Bliss M. The Discovery of Insulin. 25th ed. Chicago: The University of Chicago; 2007.
[151] Banting FG, Best CH, Collip JB, Campbell WR, Fletcher AA. Pancreatic extracts in the
treatment of diabetes mellitus: preliminary report. 1922. CMAJ 1991; 145:1281–6.
39
[152] Wilcox G. Insulin and insulin resistance. Clin Biochem Rev 2005; 26:19–39.
[153] Schröder D, Zühlke H. Gene technology, characterization of insulin gene and the
relationship to diabetes research. Endokrinologie 1982; 79:197–209.
[154] Freychet P, Roth J, Neville DM. Insulin receptors in the liver: specific binding of ( 125
I)insulin to the plasma membrane and its relation to insulin bioactivity. Proc Natl Acad
Sci U S A 1971; 68:1833–7.
[155] White MF, Maron R, Kahn CR. Insulin rapidly stimulates tyrosine phosphorylation of a
Mr-185,000 protein in intact cells. Nature 1985; 318:183–6.
[156] Sun XJ, Rothenberg P, Kahn CR, Backer JM, Araki E, Wilden PA, Cahill DA, Goldstein
BJ, White MF. Structure of the insulin receptor substrate IRS-1 defines a unique signal
transduction protein. Nature 1991; 352:73–7.
[157] Tamemoto H, Kadowaki T, Tobe K, Yagi T, Sakura H, Hayakawa T, Terauchi Y, Ueki K,
Kaburagi Y, Satoh S. Insulin resistance and growth retardation in mice lacking insulin
receptor substrate-1. Nature 1994; 372:182–6.
[158] Araki E, Lipes MA, Patti ME, Brüning JC, Haag B, Johnson RS, Kahn CR. Alternative
pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene. Nature
1994; 372:186–90.
[159] Sun XJ, Wang LM, Zhang Y, Yenush L, Myers MG, Glasheen E, Lane WS, Pierce JH,
White MF. Role of IRS-2 in insulin and cytokine signalling. Nature 1995; 377:173–7.
[160] Lavan BE, Lane WS, Lienhard GE. The 60-kDa phosphotyrosine protein in insulin-treated
adipocytes is a new member of the insulin receptor substrate family. J Biol Chem 1997;
272:11439–43.
40
[161] Lavan BE, Fantin VR, Chang ET, Lane WS, Keller SR, Lienhard GE. A novel 160-kDa
phosphotyrosine protein in insulin-treated embryonic kidney cells is a new member of the
insulin receptor substrate family. J Biol Chem 1997; 272:21403–7.
[162] Cai D, Dhe-Paganon S, Melendez PA, Lee J, Shoelson SE. Two new substrates in insulin
signaling, IRS5/DOK4 and IRS6/DOK5. J Biol Chem 2003; 278:25323–30.
[163] Gual P, Le Marchand-Brustel Y, Tanti J-F. Positive and negative regulation of insulin
signaling through IRS-1 phosphorylation. Biochimie 2005; 87:99–109.
[164] Wu S, Divall S, Wondisford F, Wolfe A. Reproductive tissues maintain insulin sensitivity
in diet-induced obesity. Diabetes 2012; 61:114–123.
[165] Sasaoka T, Rose DW, Jhun BH, Saltiel AR, Draznin B, Olefsky JM. Evidence for a
functional role of Shc proteins in mitogenic signaling induced by insulin, insulin-like
growth factor-1, and epidermal growth factor. J Biol Chem 1994; 269:13689–94.
[166] Otsu M, Hiles I, Gout I, Fry MJ, Ruiz-Larrea F, Panayotou G, Thompson A, Dhand R,
Hsuan J, Totty N. Characterization of two 85 kd proteins that associate with receptor
tyrosine kinases, middle-T/pp60c-src complexes, and PI3-kinase. Cell 1991; 65:91–104.
[167] Skolnik EY, Margolis B, Mohammadi M, Lowenstein E, Fischer R, Drepps A, Ullrich A,
Schlessinger J. Cloning of PI3 kinase-associated p85 utilizing a novel method for
expression/cloning of target proteins for receptor tyrosine kinases. Cell 1991; 65:83–90.
[168] Escobedo JA, Navankasattusas S, Kavanaugh WM, Milfay D, Fried VA, Williams LT.
cDNA cloning of a novel 85 kd protein that has SH2 domains and regulates binding of
PI3-kinase to the PDGF beta-receptor. Cell 1991; 65:75–82.
41
[169] Cox NM, Stuart MJ, Althen TG, Bennett WA, Miller HW. Enhancement of ovulation rate
in gilts by increasing dietary energy and administering insulin during follicular growth. J
Anim Sci 1987; 64:507–16.
[170] Matamoros IA, Cox NM, Moore AB. Effects of exogenous insulin and body condition on
metabolic hormones and gonadotropin-induced follicular development in prepuberal gilts.
J Anim Sci 1991; 69:2081–91.
[171] Louhio H, Hovatta O, Sjöberg J, Tuuri T. The effects of insulin, and insulin-like growth
factors I and II on human ovarian follicles in long-term culture. Mol Hum Reprod 2000;
6:694–8.
[172] Poretsky L, Glover B, Laumas V, Kalin M, Dunaif A. The effects of experimental
hyperinsulinemia on steroid secretion, ovarian [125I]insulin binding, and ovarian
[125I]insulin-like growth-factor I binding in the rat. Endocrinology 1988; 122:581–5.
[173] Graf R, Neuenschwander S, Brown MR, Ackermann U. Insulin-mediated secretion of
ecdysteroids from mosquito ovaries and molecular cloning of the insulin receptor
homologue from ovaries of bloodfed Aedes aegypti. Insect Mol Biol 1997; 6:151–163.
[174] Riehle MA, Brown MR. Insulin stimulates ecdysteroid production through a conserved
signaling cascade in the mosquito Aedes aegypti. Insect Biochem Mol Biol 1999; 29:855–
60.
[175] Manière G, Rondot I, Büllesbach EE, Gautron F, Vanhems E, Delbecque JP. Control of
ovarian steroidogenesis by insulin-like peptides in the blowfly (Phormia regina). J
Endocrinol 2004; 181:147–56.
[176] Kawai T, Akira S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol Med 2007;
13:460–9.
42
[177] Lemaitre B, Nicolas E, Michaut L, Reichhart JM, Hoffmann JA. The dorsoventral
regulatory gene cassette spätzle/Toll/cactus controls the potent antifungal response in
Drosophila adults. Cell 1996; 86:973–83.
[178] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;
124:783–801.
[179] Shi Z, Cai Z, Sanchez A, Zhang T, Wen S, Wang J, Yang J, Fu S, Zhang D. A novel Tolllike receptor that recognizes vesicular stomatitis virus. J Biol Chem 2011; 286:4517–24.
[180] Hijiya N, Miyake K, Akashi S, Matsuura K, Higuchi Y, Yamamoto S. Possible
involvement of toll-like receptor 4 in endothelial cell activation of larger vessels in
response to lipopolysaccharide. Pathobiology 2002; 70:18–25.
[181] Faure E, Equils O, Sieling PA, Thomas L, Zhang FX, Kirschning CJ, Polentarutti N,
Muzio M, Arditi M. Bacterial lipopolysaccharide activates NF-kappaB through toll-like
receptor 4 (TLR-4) in cultured human dermal endothelial cells. Differential expression of
TLR-4 and TLR-2 in endothelial cells. J Biol Chem 2000; 275:11058–63.
[182] Hayden MS, West AP, Ghosh S. NF-kappaB and the immune response. Oncogene 2006;
25:6758–80.
[183] Li X, Tupper JC, Bannerman DD, Winn RK, Rhodes CJ, Harlan JM. Phosphoinositide 3
kinase mediates Toll-like receptor 4-induced activation of NF-kappa B in endothelial
cells. Infect Immun 2003; 71:4414–20.
[184] Wolfs TG, Buurman WA, van Schadewijk A, de Vries B, Daemen MARC, Hiemstra PS,
van ’t Veer C. In vivo expression of Toll-like receptor 2 and 4 by renal epithelial cells:
IFN-gamma and TNF-alpha mediated up-regulation during inflammation. J Immunol
2002; 168:1286–93.
43
[185] Girling JE, Hedger MP. Toll-like receptors in the gonads and reproductive tract: emerging
roles in reproductive physiology and pathology. Immunol Cell Biol 85:481–9.
[186] Shimada M, Hernandez-Gonzalez I, Gonzalez-Robanya I, Richards JS. Induced
expression of pattern recognition receptors in cumulus oocyte complexes: novel evidence
for innate immune-like functions during ovulation. Mol Endocrinol 2006; 20:3228–39.
[187] Parant M, Chedid L. Protective Effect of Chlorpromazine Agaisnt Endotoxin-Induced
Abortion. Proc Soc Exp Biol Med 116:906–9.
[188] Chaouat G, Menu E, Clark DA, Dy M, Minkowski M, Wegmann TG. Control of fetal
survival in CBA x DBA/2 mice by lymphokine therapy. J Reprod Fertil 1990; 89:447–58.
[189] Yu G, Sun Y, Foerster K, Manuel J, Molina H, Levy GA, Gorczynski RM, Clark DA.
LPS-induced murine abortions require C5 but not C3, and are prevented by upregulating
expression of the CD200 tolerance signaling molecule. Am J Reprod Immunol 2008;
60:135–40.
[190] Leung ST, Cheng Z, Sheldrick EL, Derecka K, Flint AP, Wathes DC. The effects of
lipopolysaccharide and interleukins-1alpha, -2 and -6 on oxytocin receptor expression and
prostaglandin production in bovine endometrium. J Endocrinol 2001; 168:497–508.
[191] Herzog K, Strüve K, Kastelic JP, Piechotta M, Ulbrich SE, Pfarrer C, Shirasuna K,
Shimizu T, Miyamoto A, Bollwein H. Escherichia coli lipopolysaccharide administration
transiently suppresses luteal structure and function in diestrous cows. Reproduction 2012;
144:467–76.
[192] Agrawal V, Jaiswal MK, Jaiswal YK. Lipopolysaccharide-induced modulation in the
expression of progesterone receptor and estradiol receptor leads to early pregnancy loss in
mouse. Zygote 2013; 21:337–44.
44
[193] Bromfield JJ, Sheldon IM. Lipopolysaccharide reduces the primordial follicle pool in the
bovine ovarian cortex ex vivo and in the murine ovary in vivo. Biol Reprod 2013; 88:98.
45
CHAPTER 2
ALTERED OVARIAN EXPRESSION OF MICROSOMAL EPOXIDE HYDROLASE 1
DUE TO MATERNAL HYPERLEPTINEMIA DURING GESTATION
Al-Shaibi, A.A.1, Schulz, L.C.2, Pollock, K.E.2, and Keating, A.F.1*
1
2
Department of Animal Science, Iowa State University, Ames, IA, 50014
Department of Obstetrics, Gynecology, and Women’s Health, University of Missouri,
Columbia, MO 65212
Contribution Statement: Animal experiments were performed by LCS and KEP. AAA
performed all of the molecular analysis in this chapter, and wrote the manuscript. AFK mentored
AAA, planned the experiments and aided with data interpretation. AFK edited the chapter and
will serve as corresponding author for the research paper submission.
*Corresponding author: Aileen F. Keating, Ph.D., Department of Animal Science, Iowa State
University, Ames, IA 50014; Telephone 515-294-3849; Email [email protected]
46
Abstract:
Obesity is a pathology of worldwide prevalence and is correlated with a plethora of
reproductive problems such as infertility, polycystic ovary syndrome (PCOS), miscarriage,
anovulation, and difficulties with assisted reproduction treatments. Obesity also likely affects
oocyte quality. Systemic hyperleptinemia is caused by obesity as a consequence of increased
adipose tissue accumulation. Leptin, a 16 kDa adipokine, regulates satiety and is also a
permissive signal for the onset and continuation of ovarian cyclicity. Ovaries are sensitive to
leptin as they express the leptin receptor (LEPR) with varying localizations between species.
Leptin is a positive regulator of germinal vesicle breakdown (GVBD) and ovulation. Blocking
leptin signaling via a LEPR antagonist depleted primordial follicles without increasing
accumulated primary follicles while passive immunization against leptin increased the
accumulation of primary follicles. Our previous investigation of obesity in both the high fat diet
and the lethal yellow models revealed altered cyclicity, folliculogenesis, chemical metabolism,
and steroidogenesis. We hypothesized that leptin is at least partly culpable for these effects due
to its signaling being mediated by the phosphoinositide 3-kinase (PI3K) pathway, which
participates in regulating all of these processes. Among others, epoxide hydrolase 1 (EPHX1) is
a chemical metabolism enzyme regulated by PI3K. EPHX1 acts on epoxide groups to detoxify or
bioactivate ovotoxicants. To investigate the effects of leptin, we used two gestational
hyperleptinemia models: 1. Female mice who were heterozygous for a loss of function in the
leptin receptor gene (Db/+) compared to wild type controls, and 2. Female mice administered
leptin directly into circulation through a pump (Lpt) shortly before and during gestation
compared to females fitted with a saline pump (Sal). Ovaries were retrieved from wild type
offspring postmortem after 20 weeks of ad libitum feeding. We also used a rat ovarian culture
47
model where ovaries retrieved from postnatal day (PND) 4 ovaries were cultured in enriched
DMEM and treated with 10 or 40 ng/mL of recombinant leptin for 7 d, and then fixed and
sectioned for histological evaluation. Offspring of Db/+ females had reduced EPHX1 mRNA
abundance, while offspring of Lpt showed reduced EPHX1 protein abundance. Ex vivo, leptin
administration had no impact on the composition or health of the follicular pool in PND4
ovaries.
Keywords: Ovary, hyperleptinemia, gestation, microsomal epoxide hydrolase, folliculogenesis
48
Introduction:
The ovary is responsible for the maintenance of the female gamete, the oocyte, and
production of hormones that regulate the female reproductive cycle. Functional units within the
ovary, termed follicles, are composed of an oocyte, arrested in prophase I of meiosis, surrounded
by granulosa cells. Another cellular layer, composed of theca cells, is recruited to the growing
follicle during folliculogenesis [1]. Females are born with a finite number of primordial follicles
which comprise the finite ovarian reserve [1]. Development of follicles, a process called
folliculogenesis, begins with the recruitment of dormant primordial follicles coinciding with the
proliferation of squamous granulosa and their acquisition of a cuboidal morphology [1]. Follicles
mature through a number of stages in the order of primary, secondary, and tertiary, until the time
of ovulation [1]. Under the influence of luteinizing hormone, the corpus luteum (CL) is formed
from the remains of the ovulated follicle(s) [1,2]. Growing dominant follicle(s) and the CL
produce the sex hormones 17β-estradiol and progesterone, respectively, by steroidogenesis.
Steroidogenesis is coordinated between the theca and granulosa cells, where the theca cells
produce androgens that are converted into estrogens by the granulosa cells in response to the
gonadotropins, in what is known as the two cell model of steroidogenesis [1,3–9].
Recruitment and growth of primordial follicles are regulated by phosphoinositide 3kinase (PI3K), primarily mediated by protein kinase B (AKT) [10]. Activation of the PI3K
pathway results in the phosphorylation of forkhead transcription factor (FOXO3A), leading to its
translocation from the nucleus to the cytoplasm, and causing a suppression in its activity. A
number of reports support a role for FOXO3A in regulating the activation and growth of the
49
primordial follicle [11–13]. PI3K can be activated by external signals such as insulin [14],
insulin-like growth factor-1 [15], and leptin [16].
Leptin, a 16kDa adipokine produced by the Ob gene [17–19], regulates satiety through
hypothalamic signaling [20–22]. Leptin is also a permissive factor for the onset and
sustainability of ovarian cyclicity [23–26]. The leptin receptor (LEPR) is expressed in the ovaries
of a number of species with varying localization patterns [27–34]. In mice, LEPR is most
abundant in the follicular thecal layer, indicating that secondary and tertiary follicles could be the
most sensitive to systemic leptin [27]. Treatment of dominant follicles in culture with leptin was
shown to promote ovulation, spontaneous germinal vesicle breakdown (GVBD), and enhanced
gonadotropin-induced GVBD [27]. Blocking leptin signaling by administering leptin receptor
antagonist to newborn rats induced a depletion of the primordial pool without a coinciding
increase in the accumulation of primary follicles [35]. Passive immunization against leptin,
however, increased the accumulation of primary follicles [36]. Leptin provides the link between
energy stores and the reproductive system [37]. Changes in energy stores tend to manifest as
changes in body mass as an individual gains or loses fat reserves, and reproductive function has
been formally correlated to body mass for a number of decades [38].
Obesity is defined as the "abnormal or excessive fat accumulation that may impair
health" according to the World Health Organization (WHO) [39]. A characteristic effect of
obesity is an increase in circulating leptin [40,41]. Childhood obesity can reduce the age at which
menarche (the first menstruation) occurs [42]. Obesity is also correlated with a host of
reproductive problems such as infertility [43,44], polycystic ovary syndrome (PCOS) [45],
50
miscarriage [46], anovulation [43], and difficulties with assisted reproduction treatments like in
vitro fertilization (IVF) [47]. Oocyte quality is also an area where obesity could have adverse
effects. However, there is no clear consensus established in that regard [44,48,49].
As a human pathology, obesity is prevalent worldwide. The WHO cites that worldwide
obesity has doubled in the period between 1980 and 2015. WHO diagnoses obesity based on
body mass index (BMI), where a BMI of 25 or greater is considered overweight, and a BMI of
30 or greater is considered obese. Globally, 39% of adults aged 18 or older were overweight and
13% obese in 2014 [39]. This translates to 1.9 billion adults who are obese or overweight. In the
United States, between 2011 and 2014, the prevalence of obesity among adults in the US was in
excess of 36%, with a higher prevalence amongst women (36.3%) than men (34.3%) [50]. Due
to both its prevalence and association with an increased risk of a wide range of disorders, obesity
is an international public health concern [51,52].
We previously investigated the reproductive effects of obesity in the lethal yellow (LY)
hyperphagia-induced progressive obesity and the high-fat diet-induced obese mouse models. In
LY mice, changes in the abundance of ovarian steroidogenic proteins were observed [53].
Compared to wild type mice, progressive obesity increased abundance of CYP19A1 and
CYP11A1, while the abundance of StAR was decreased. Additionally, LY mice had reduced
primordial and primary follicle number at 12 weeks, and tended to have increased numbers of
tertiary follicles starting at the same age [53].
51
Our investigation into obesity induced by high-fat feeding demonstrated alterations in ovarian
PI3K signaling and the expression of xenobiotic metabolism enzymes [54]. Phosphorylation of
ovarian AKT tended to be reduced in obese females. Ovarian mRNA abundance of Cyp2e1 was
reduced, and ovarian EPHX1 tended to be reduced due to obesity [54]. Based on these data, we
hypothesized that obesity-induced ovarian signaling alterations could be, at least partially,
attributable to changes in circulating leptin concentrations. Utilizing two mouse models of
gestational hyperleptinemia (leptin infusion and Db/+ mice) we assessed ovarian PI3K signaling,
steroidogenesis, and xenobiotic metabolism in the offspring. In addition, we examined whether
leptin exposure at normal or high levels would alter folliculogenesis in cultured neonatal rat
ovaries.
Materials and Methods:
Reagents:
Primers were designed in-house as described in Nteeba et al. [53,54], and synthesized by
the DNA facility at Iowa State University (Ames, IA). Superscript III one-step RT-PCR system,
dNTP mix, Hanks’ balanced salt solution (without CaCl2, MgCl2, or MgSO4), and Dulbecco's
Modified Eagle Medium: nutrient mixture F-12 (Ham) 1x (DMEM/Ham's F12), Albumax,
Penicillin-Streptomycin (5000U/ml), were purchased from Invitrogen, Co. (Carlsbad, CA).
RNeasy mini-kit, QIAshredder kit, RNeasy MinElute kit, and Quantitect SYBR Green PCR kit
were obtained from Qiagen, Inc. (Valencia, CA). N0, N0, N0, N0-tetramethylethylenediamine
(TEMED), Tris base, Tris HCl, sodium chloride, Tween-20, ascorbic acid (vitamin C), sodium
dodecyl sulfate (SDS), 30% Acrylamide/Bis-acrylamide, 2-b-mercaptoethanol, Glycine, Bovine
Serum Albumin (BSA), paraformaldehyde (PFA), Ammonium persulphate, Recombinant Rat
52
Leptin, and transferrin were purchased from Sigma-Aldrich, Inc. (St. Louis, MO). Ponceau S and
hydrochloric acid was purchased from Fisher Scientific (Waltham, MA). Nonidet-P40 (N-P40)
was purchased from US Biological (Salem, MA). SignalFire ECL reagent was acquired from
Cell Signaling Technology (Danvers, MA).
Animal models:
Fisher 344 rat breeding scheme:
Fisher 344 female rats were housed individually in plastic cages in a climate-controlled
room (22 ± 2oC) with a fixed light-dark cycle (12 h light/12 h dark), and provided a standard
pelleted diet and water ad libitum. Rats were bred by placing two females in a cage with a male
for one week before the females were separated into individual cages for parturition to occur.
The Iowa State University Institutional Animal Care and Use Committee approved this breeding
protocol.
Ex vivo ovarian culture:
Ovaries were excised from postnatal day (PND) 4 rats, excess tissue trimmed, and placed
upon a Millipore cell culture insert floating on enriched DMEM/Ham’s F12 media (1 mg/mL
BSA, 1 mg/mL Albumax, 50 μg/mL ascorbic acid, 5 U/mL penicillin, 5 μg/mL streptomycin,
and 27.5 μg/ml transferrin). After the addition of treatment, each ovary was covered with a drop
of media to prevent dehydration. Ovaries were cultured in media containing vehicle control or rat
recombinant leptin at a final concentration of either 10 (n = 3-4) or 40 ng/mL (n = 4-8). Ovaries
were maintained at 37oC and 5% CO2 for 7 d with media and treatment being changed on
alternate days. Following culture, ovaries were incubated in 4% paraformaldehyde for 2 h before
53
being transferred to 70% ethanol for storage. Fixed ovaries were sectioned and used for follicle
counting.
Gestational hyperleptinemia:
Hyperleptinemia during gestation was induced using two animal models: 1) Control
females (WT) or females heterozygous for the diabetic mutation (Db/+) were mated with wild
type males. Wild type offspring from these dams were maintained and fed ad libitum for 20
weeks before euthanasia. 2) Females received direct infusion of saline (Sal) or recombinant
leptin (Lpt; 350 ng/h) through a subcutaneous Alzet mini-osmotic pump. Offspring of this group
were also maintained for 20 weeks and fed ad libitum before euthanasia. Ovaries were collected
postmortem and were flash frozen for mRNA and protein analyses. Circulating leptin was
measured using a mouse leptin ELISA kit (Intrassay variation, 15.5%; Millipore) as per the
manufacturer’s recommendations, with the exception of extending the primary antibody
incubation overnight. Animals procedures and serum assays were performed by the research
group of Dr. Laura Schulz at the University of Missouri [55]. Feed intake corrected to body mass
of Db/+ female offspring was increased compared to WT offspring at 4 weeks, but was not
statistically significant at 11 or 19 weeks. Female offspring of Lpt dams had increased feed
intake compared to female offspring of Sal dams at 11 weeks but not at 4 weeks or 19 weeks
[55].
RNA isolation and qRT-PCR:
RNA was isolated from whole ovaries using an RNeasy Mini Kit as per the
manufacturer’s recommended protocol. RNA quantity and purity was measured using an ND-
54
1000 Spectrophotometer (k ¼ 260/280 nm; NanoDrop Technologies, Inc.). cDNA was
synthesized from extracted RNA using a Superscript III system and an oligo-dT primer. Diluted
cDNA (1:25) was amplified using a QuantiTect SYBR® Green PCR Kit on a MasterCycler
RealPlex4. PCR was performed by heating the reaction vessels to 95 oC for 15 min, then cycling
through a 15 s melting at 95oC, a 15 s annealing at 58oC, and a 20 s extension at 72oC, 40 times.
A melting gradient of 72oC to 99oC with a 1oC increase per step was used to assess product melt
conditions. Gene-specific primers as listed in Table 1 were used. β-actin and Gapdh were used as
endogenous controls. PCRs performed to test for genomic contamination were as follows: no
template reaction for each primer, no primer reaction for each sample, and master mix without
template or primer. The thermocycler was tested by including water-loaded wells on each plate.
Protein extraction and western blotting:
Whole ovaries were homogenized in tissue lysis buffer (1% NP40, 50mM Tris-HCl,
150mM NaCL, 1% SDS, pH 8) using a handheld homogenizer before being centrifuged through
a Qiashredder column, and placed on ice for 30 min with occasional shaking. Lysate was then
centrifuged at 9300 x g at 4oC for 15 min. The supernatant was transferred into a new tube and
centrifuged at 9300 x g at 4oC for 15 min. Protein was separated by SDS-PAGE using a 10%
Tris-Glycine gel, before being transferred to a nitrocellulose membrane via wet transfer. Transfer
quality was assessed using Ponceau S staining. Membranes were washed of Ponceau S with Tris
Buffered Saline (TBS; 5M NaCl, 20mM Tris-HCl, and pH 8) with 0.15% Tween-20 (TTBS)
before blocking in 5% BSA in TTBS while rocking at 4oC overnight. Membranes were then
immersed in primary antibodies targeting StAR (Cell Signaling; D10H12), mEH (Detroit R&D;
MEH1), total AKT (Cell Signaling; 9272), or pAKT (Cell Signaling; C31E5E) at a dilution of
55
1:500 in 5% BSA in TTBS. Incubation in primary antibody dilutions were continued overnight
with constant rocking at 4oC. Membranes were washed three times with TTBS for 10 min before
being incubated in 1:5000 of goat anti-rabbit (Southern Biotech; 4030-05) or 1:10000 donkey
anti-goat (Santa Cruz; sc-2304) in 5% milk in TTBS. Afterwards, membranes were washed three
times with TTBS for 10 min before being immersed in SignalFire ECL reagent for 10 min, then
X-Ray film was exposed to the membranes to visualize fluorescence. Densitometric analysis and
quantification of the appropriately sized protein bands was performed using ImageJ (NCBI) and
raw protein of interest values normalized to Ponceau S total protein measurements. Testing for
random signal generated by the antibodies was performed by blotting pooled protein and testing
fluorescence after incubating it with each primary antibody in the absence of secondary
antibodies, normal goat serum in lieu of primary antibody with goat anti-rabbit as the secondary
antibody, and with donkey anti-goat as a secondary with omission of primary antibody.
Incubations and signal detection were performed as described above.
Slide preparation and follicle counts:
Ovaries were sectioned at a thickness of 5µM. Every sixth section was mounted and
stained with Hematoxylin and Eosin (H&E). After blinding mounted sections, follicle
classification and enumeration was performed using ImageJ (NCBI)’s Cell Counter plugin on
images that had been captured using a QImaging QICAM Fast 1394 camera attached to a Leica
DMI3000 B compound microscope. Healthy follicles were only counted if their nuclei were
visible to avoid double counting of large primary and secondary follicles. Follicles were
classified as primordial if the nucleated oocyte was surrounded by a partial or a complete layer of
squamous granulosa cells, which have a characteristic flat morphology. When a nucleated oocyte
56
was surrounded by three to nine cuboidal granulosa cells, it was considered a small primary
follicle. If it had 10 or more cuboidal granulosa cells, it was classified as a large primary.
Follicles were classified as secondary if their nucleated oocyte was surrounded by at least two
complete layers of cuboidal granulosa cells. Follicles showing pyknotic bodies, intense
eosinophilic staining of oocytes, or any striking morphological abnormalities were deemed
unhealthy.
Statistical Analysis:
Statistical analysis was performed on the ΔCt value for qRT-PCR data, on average
densitometric values standardized to Ponceau S densitometric values for western blot data, and
on average follicle counts of each category of follicles. Microsoft Excel was used to perform all
calculations and statistics. P-values were calculated using Welch's t-test computed using the
function t.test (<array 1>;<array 2>;1;2). Significant difference between treatments was
considered at P < 0.05. Graphs were created using GraphPad Prism 6 for Windows. Data bars
represent mean values, and error bars denote the standard error of the mean as calculated by
GraphPad.
Results:
Gestational hyperleptinemia decreases circulating levels of leptin in offspring
Offspring of Db/+ females had reduced levels of circulating leptin (66.5%; P < 0.05)
compared to offspring of wild type females (Appendix Figure 1A). Offspring of females infused
with leptin via an osmotic pump also had reduced circulating levels of leptin (32.3%; P < 0.05)
57
when compared to offspring of females infused with saline (Appendix Figure 1B), courtesy of
Dr. Laura Schulz [personal communication].
Altered leptin concentration does not influence early folliculogenesis or morphological
health of follicles in cultured PND4 rat ovaries
PND4 rat ovaries exposed to a normal, physiological concentration of leptin ex vivo had
no difference in the composition of their follicular pools compared to control treated ovaries.
Primordial (P = 0.32; Figure 2.1A) and small primary (P = 0.48; Figure 2.1B) follicles were
observed in equal abundance when comparing the control treated ovaries to those treated with
leptin at a concentration of 10 ng/mL Similarly, large primary (P = 0.67; Figure 2.1C) and
secondary (P = 0.74; Figure 2.1D) follicles were equally abundant when comparing both
treatments. The total number of healthy (P = 0.13; Figure 2.1E) and unhealthy (P = 0.06; Figure
2.1F) follicles did not differ due to leptin treatment.
PND4 rat ovaries were also exposed to a concentration of leptin measurable in obese
mice (40 ng/mL [56]). Primordial (P = 0.44; Figure 2.2A), small primary (P = 0.27; Figure
2.2B), large primary (P = 0.48; Figure 2.2C), and secondary (P = 0.14; Figure 2.2D) follicles
were not different in abundance compared to control treated ovaries. The overall abundance of
morphologically healthy (P = 0.39; Figure 2.2E) follicles was not observed to differ between
treatments, nor did the number of unhealthy follicles (P = 0.08; Figure 2.2F).
58
Gestational hyperleptinemia does not alter PI3K pathway member Akt1 mRNA in ovaries
of female offspring
When normalizing to β-actin, offspring of Db/+ dams showed no difference (P = 0.08) in
mRNA abundance of ovarian Akt1 compared to offspring of WT females (Figure 2.3A). A
similar trend was observed in the offspring of Lpt females as their ovaries displayed no
difference (P = 0.21) in the abundance of Akt1 mRNA (Figure 2.3D). Gapdh was not observed to
vary significantly between Db/+ and WT offspring (P = 0.23) or between Lpt and Sal offspring
(P = 0.39). Similarly, β-actin did not differ between the offspring of WT and Db/+ dams (P =
0.21) or Sal and Lpt dams (P = 0.30).
Steroidogenic gene expression is affected by gestational hyperleptinemia in ovaries of
female offspring
StAR mRNA abundance was decreased (P < 0.05) in offspring of Db/+ dams compared to
WT when β-actin was used as an endogenous control (Figure 2.3C). However, offspring of Lpt
dams had increased (P < 0.05) abundance of ovarian StAR mRNA compared to offspring of Sal
females when using β-actin as the endogenous control. There was no impact of gestational
hyperleptinemia due to genotype (P = 0.07; Figure 2.3B) or Lpt infusion (P = 0.20; Figure 2.3E)
on offspring Cyp11a1 mRNA abundance.
Gestational hyperleptinemia reduces ovarian Ephx1 mRNA abundance in offspring
Gestational hyperleptinemia in Db/+ or Lpt dams did not impact mRNA encoding
Cyp2e1 (igure 2.4A; (P = 0.25), E (P = 0.15)), Gstm (Figure 2.4B (P = 0.36); F (P = 0.40)), or
Gstp (Figure 2.4C (P = 0.32); G (P = 0.10)) in offspring ovaries. Ovaries of Db/+ dams'
59
offspring had equally abundant (P = 0.45) Ephx1 mRNA when compared to those of WT
offspring (Figure 2.4D). Ovarian Ephx1 mRNA was less abundant (24.7%; P < 0.05) in offspring
of Lpt compared to Sal females when standardized to β-actin (Figure 2.4H).
Use of an alternative endogenous control gene impacts observed effect of maternal
gestational hyperleptinemia on offspring mRNA abundance.
When standardized to Gapdh, offspring of Db/+ females did not differ (P = 0.15) in the
abundance of ovarian Akt mRNA compared to wild type controls (Figure 2.5A). Consistent with
this result, ovarian Akt mRNA abundance was not altered (P = 0.16) in offspring of Lpt
compared to Sal dams (Figure 2.5D). The abundance of mRNA encoding the downstream target
of AKT, Foxo3a, was not different (P = 0.18) in Db+ offspring compared to offspring of WT
females (Figure 2.5B). Foxo3a mRNA abundance was not impacted (P = 0.18) in offspring of
Lpt dams relative to Sal dams (Figure 2.5E). The offspring of Db/+ dams had increased (14.6%;
P < 0.05) Ephx1 mRNA abundance, relative to their respective WT controls. Offspring of Lpt
dams tended to have increased (P = 0.05) abundance of mRNA encoding Ephx1 when compared
to the offspring of Sal dams (Figure 2.5F).
When using Gapdh as the endogenous control, mRNA abundance of the steroidogenic
genes StAR (Figure 2.6A (P = 0.28); D (P = 0.26)), Cyp11a (Figure 2.6B (P = 0.39); E (P =
0.27)) or Cyp19a (Figure 2.6C (P = 0.27); F (P = 0.43)) were not different between the offspring
of dams experiencing genetically-induced (Db/+) or pump-induced (Lpt) hyperleptinemia during
gestation compared to their respective control.
60
Offspring of hyperleptinemic dams have altered EPHX1 protein abundance
Compared to their respective controls, offspring of hyperleptinemic dams had no
difference in phosphorylation of AKT (P = 0.46; Figure 2.7 A,E) or its total protein abundance
(P = 0.36; Figure 2.7 B,F). In addition, there was no impact of gestational hyperleptinemia
exposure on StAR protein level in the offspring of DB/+ dams compared to the offspring of WT
dams (P = 0.32; Figure 2.7 C,G). In contrast, offspring of Lpt pump dams had increased (11.2%;
P < 0.05) EPHX1 protein abundance relative to the Sal offspring (Figure 2.7 D,H).
Discussion:
Body mass and the timing of puberty were formally correlated for the first time in rats in
1963 [38] and later extended to humans in 1970 [57]. Existence of a link between body mass and
cyclicity as a mechanism to regulate fertility in response to the body's energy reserves made
sense from an evolutionary standpoint, but such a signal was not characterized until the
purification of leptin in 1995 [17]. This adipokine was soon shown to be capable of regulating
the circulating concentrations of gonadotropins [37]. In addition, leptin can directly regulate
ovarian function. LEPR is expressed in the ovaries of a variety of species, specifically in
follicles, with varying distributions between species [27–34]. Mice in particular have an
increased density of LEPR in the thecal layer compared to the oocyte and granulosa cells [27].
This potentially infers that follicles are most likely sensitive to leptin from the secondary stage
onwards. Leptin's direct effects on ovarian function were demonstrated ex vivo by Ryan et al.
when they demonstrated leptin as a positive regulator of GVBD and ovulation [27]. In vivo,
administration of a LEPR antagonist to postnatal rats was correlated with the depletion of
primordial and primary follicles without an observed increase in accumulated tertiary follicle
61
numbers [35]. In contrast, passive immunization against leptin was shown to enhance early
folliculogenesis [36]. Both studies demonstrate a direct influence of leptin on ovarian function in
vivo. Such results support the view that leptin is capable of regulating reproductive function by
directly interacting with the ovary.
Obese individuals tend to have increased serum leptin concentrations [40,41], attributable
to the accumulation of adipose tissue in obese individuals, as adipocytes are major producers of
leptin [17]. Due to elevated leptin concentrations during obesity and the expression of LEPR in
the ovary, we investigated whether ovarian leptin signaling could be a participant in the
reproductive phenotype observed during obesity.
Our interest in leptin arises from our findings of altered ovarian function in two models
of obesity. Effects of hyperphagia-induced obesity on ovarian function were investigated using
the LY mouse model [53]. LY mice have an abnormal agouti signaling pathway which leads to
uncontrolled appetite and subsequent obesity when fed ad libitum. We observed that ovarian
steroidogenic enzymes had altered protein abundance: StAR was reduced, while the abundance
of CYP19A1 and CYP11A1 were increased in LY mice. We also observed a depletion of
primordial and primary follicles in LY mice beginning at 12 weeks of age, and a tendency for
increased accumulation of tertiary follicles in the LY mice beginning at the same time point [53].
We also examined the effects of inducing obesity using a high-fat diet on ovarian function in
mice [54]. In this study, obese females tended to have reduced phosphorylated AKT, reduced
Cyp2e1 mRNA levels, and a non-significant trend for increased ovarian EPHX1 protein
abundance.
62
We hypothesized that leptin exposure during gestation would cause offspring to display
changes in ovarian physiology in similar areas as our previous studies in obese models, namely
altered PI3K signaling and chemical metabolism. In addition, leptin's signaling through PI3K
[58] combined with ovarian expression of LEPR could enable it to act as a modulator of growth
and proliferation in the ovary. Our first hypothesis was that animals exposed to hyperleptinemia
during gestation would have altered PI3K signaling, steroidogenic gene expression, and chemical
metabolism. Our second hypothesis was that exposure to leptin would accelerate early
folliculogenesis in the absence of circulating gonadotropins, which we examined using an
ovarian ex vivo culture system.
In this project, two modes of inducing hyperleptinemia were examined. Hyperleptinemia
was induced by direct infusion of saline or recombinant leptin into circulation using a
subcutaneous osmotic pump prior to mating and during gestation [55]. The genetic Db/+ mouse
was also used since leptin resistance in this model is compensated for by increased production of
leptin, causing increased circulating leptin without any other noticeable phenotypic changes. We
then observed the effects of gestational hyperleptinemia on the WT offspring at 20 weeks of age
to determine whether or not gestational leptin concentrations had lasting effects on their ovarian
function. Recombinant leptin has been the standard practice when administration of exogenous
leptin for many years and has been shown to be biologically active in many experiments prior to
this [29,59–61].
Lpt mice had elevated fasting serum levels of leptin of around 50 ng/mL compared to
around 30 ng/mL in their saline pump fitted counterparts. WT mice averaged about 50 ng/mL of
63
fasting serum leptin, while Db/+ animals had systemic leptin in the range of 125 ng/mL. Lpt
females gave birth to offspring with leptin levels that were 32% lower than those born from Sal
females. Parallel to this trend were the circulating levels of Db/+ females' offspring, who had a
reduction of 66% in their circulating leptin levels. The differences between the offspring exposed
to pump-induced hyperleptinemia compared to offspring exposed to genetically-induced
hyperleptinemia could be explained by the differences between the circulating leptin levels in the
dams. Db/+ dams circulated about 2.5 times the leptin concentration compared to their leptin
pump counterparts [55].
Leptin signaling is carried through the PI3K pathway [16]. PI3K controls the growth and
development of follicles through phosphorylation of AKT [10]. Downstream of AKT is
FOXO3A; a transcription factor that suppresses the activation of the primordial oocyte until it is
removed from its nucleus [11–13]. We had previously observed reduced phosphorylation of
ovarian AKT in mice who developed obesity induced by a high-fat diet, which indicated a
decrease in PI3K signaling in these animals. Ovarian Akt1 mRNA content in offspring was not
affected by hyperleptinemia in the dams, nor was the abundance or phosphorylation of ovarian
AKT. These results indicate that exposure to increased leptin during gestation is insufficient to
induce changes in offspring PI3K signaling at 20 weeks of age. However, this does not exclude
any early effects that could imprint the ovaries.
Ovarian steroidogenesis is primarily inactive until puberty, and, similar to cyclic
recruitment of follicles, is regulated by gonadotropins through PI3K signaling [62]. We
previously observed a reduction in StAR protein during progressive obesity, beginning at 12
64
weeks onwards. In addition, CYP11A1 and CYP19A1 were decreased during progressive
obesity [53]. Obesity shortened the time spent in the proestrus and estrus phases of the estrous
cycle, and lengthened the time spent in diestrus [53]. Obesity was also demonstrated to be
correlated with increased levels of circulating testosterone in human females [63], indicating
altered steroidogenesis.
Our examination of steroidogenic genes in the mice exposed to hyperleptinemia in utero
revealed no impact of leptin on mRNA abundance of Star, Cyp11a1, Cyp19a1, relative to their
respective controls. Ovarian protein levels of StAR were also unchanged in offspring of Db/+
females. These results demonstrate a lack of effect of hyperleptinemia during gestation on the
expression of steroidogenic genes at 20 weeks of age in this model, potentially indicating that
hyperleptinemia might not be responsible for abnormalities in the concentration of circulating
steroid concentrations during obesity, at least not through influencing the abundance of ovarian
steroidogenic genes and proteins examined herein.
We have previously made the novel discovery that ovarian levels of proteins involved in
metabolism of environmental toxicants are altered in obese females [64,65]. In addition, we have
determined that the PI3K signaling pathway regulates ovarian expression of these genes [66,67].
In light of the crucial role of EPHX1 in detoxifying [67] or bioactivating [68] chemicals which
can destroy ovarian follicles and induce DNA damage, we examined the impact of gestational
hyperleptinemia on offspring ovarian EPHX1 abundance. Offspring of Lpt dams had increased
total EPHX1 abundance at 20 weeks of age compared to the controls, with a concomitant trend
for increased Ephx1 mRNA. Interestingly, the offspring of the Db/+ females had an opposing
65
trend as their Ephx1 mRNA levels was lower than their control females. Due to limited animal
numbers, investigation of EPHX1 protein was not possible in the offspring of females with this
genotype. Changes in EPHX1 abundance could reflect in the ovarian capacity to metabolize
ovotoxicants, and could in turn augment the ovarian response to a variety of chemical stressors.
This observation fits with our previous finding of increased ovarian EPHX1 during hyperphagiainduced obesity [64] and suggest that maternal hyperleptinemia during gestation could impact
the ovarian capacity of the offspring to metabolize toxicants.
To test whether the observed depletion of small follicles in obese females could be
attributed to differences in the concentrations of circulating leptin, we exposed PND4 rat ovaries
to leptin in culture. We chose leptin concentrations of 10 ng/mL and 40 ng/mL as they are
representative of circulating leptin concentrations in well-fed females and in obese females,
respectively [56]. We anticipated that ovaries exposed to leptin to have enhanced early
folliculogenesis. Leptin, however, had no impact on the composition or morphological health of
the ovarian pool at either concentration tested.
These data suggest that circulating leptin does not directly regulate the recruitment of
primordial follicles, or the development of follicles prior to the mid- to late-secondary stage.
Observing no changes in early folliculogenesis in response to leptin is consistent with the
distribution of leptin receptors in rodents. Postnatal ovaries used in the culture system used
herein lack any tertiary follicles, and even when taking culture time into account, are not mature
enough to develop large secondary follicles with a well-developed thecal layer, which could
explain the lack of response to exogenous leptin. However, these results do not exclude an
66
indirect action of leptin on the ovaries. Leptin is capable of changing the localization of ATPsensitive K+ ion channels in pancreatic beta cells, potentially leading to a change in glucose
sensitivity [69], and in turn affecting the patterns of insulin secretion. If so, leptin could influence
recruitment of primordial follicles through insulin, as insulin has been shown to positively
regulate the recruitment of primordial follicles [70]. Being absent in culture, insulin's effect as
regulated by leptin would not be apparent when treating ovaries with leptin ex vivo. Another
indirect effect of leptin that could account for the disparity between in vivo and ex vivo
observations is its role in augmenting vascularization. Leptin has been shown to promote
angiogenesis and fenestration, processes thought to participate in folliculogenesis by inducing a
selective delivery of circulating factors [60,71,72].
Taken as a whole, these results show that gestational hyperleptinemia did not impact
PI3K signaling as mediated by AKT, nor did it change the expression of ovarian steroidogenic
enzymes. Cultured ovaries lacking changes in folliculogenesis when exposed to leptin is
consistent with these results. Interestingly, the expression of Ephx1, both at the mRNA and
protein level, was impacted. This suggests that hyperleptinemia could impact the ovarian
capacity to metabolize chemicals, as observed in obese females, and that the offspring of obese
females could also have their ovarian chemical metabolism pathways augmented due to obesityinduced gestational hyperleptinemia.
67
Table 2.1: Primer sequences used in this study
Gene
Primer sequence (5' to 3')
Forward
Reverse
Forward
Gapdh
Reverse
Forward
Akt1
Reverse
Forward
Star
Reverse
Forward
Cyp191
Reverse
Forward
Cyp11a1
Reverse
Forward
Ephx1
Reverse
Forward
Cyp2e1
Reverse
Forward
Gstm
Reverse
Forward
Gstp
Reverse
Forward
Foxo3a
Reverse
TCTATCCTGGCCTCACTGTC
ACGCAGCTCAGTAACAGTCC
GTGGACCTCATGGCCTACAT
GGATGGAATTGTGAGGGAGA
ATGAACGACGTAGCCATTGTG
TTGTAGCCAATAAAGGTGCCAT
ATGTTCCTCGCTACGTTCAAG
CCCAGTGCTCTCCAGTTGAG
ATGTTCTTGGAAATGCTGAACCC
AGGACCTGGTATTGAAGACGAC
AGGTCCTTCAATGAGATCCCTT
TCCCTGTAAATGGGGCCATAC
GGCTCAAAGCCATCAGGCA
CCTCCAGAAGACACCACTTT
CCCAAGTCTTTAACCAAGTTGGC
CTTCCATGTGGGTCCATTATTGA
GAGAGGATCCGTGCAGACAT
ACTTGGGCTCAAACATACGG
CCCAAGTTTGAGGATGGAGA
CAGGGCCTTCACGTAGTCAT
CTGGGGGAACCTGTCCTATG
TCATTCTGAACGCGCATGAAG
β-actin
amplicon
size
120
134
115
121
151
136
185
210
243
212
209
68
Figure 2.1. Impact of leptin exposure at basal physiological level on ovarian folliculogenesis.
PND4 rat ovaries were exposed to 0 (n = 3) or 10 ng/mL (n = 4) of recombinant leptin for 7 d
and different classes of ovarian follicles counted. Leptin treatment at 10 ng/mL induced no
difference in the average abundance of follicles at the (A) primordial, (B) small primary, (C)
large primary, or (D) secondary stages. Leptin exposure also did not affect the abundance of
morphologically (E) healthy, or (F) unhealthy follicles.
69
Figure 2.2. Impact of leptin exposure at concentration observed during obesity on ovarian
folliculogenesis.
PND4 rat ovaries in culture were exposed to 0 ng/mL (n = 4) or 40 ng/mL (n = 8) of recombinant
leptin for 7 d. Leptin at a concentration observed during obesity, did not impact the number of
(A) primordial, (B) small primary, (C) large primary, or (D) secondary follicles. The health of the
follicular pool was not affected by leptin as (E) healthy and (F) unhealthy follicles were equally
numerous between treatments.
70
Figure 2.3. Effect of maternal gestational hyperleptinemia on ovarian mRNA abundance in
offspring.
Using whole mRNA extracted from whole ovarian homogenate, the expression of Akt1 and
steroidogenic genes (Star and Cyp11a1) were evaluated in offspring of hyperleptinemic Db/+ (n
= 3) and Lpt (n = 3) dams. Mean delta Ct values are depicted, which indicate higher mRNA
expression when delta Ct values are lower. Standardized to β-actin, offspring of Db/+ had no
changes in ovarian (A) Akt1 or (B) Cyp11a1 mRNA abundance compared to WT. (C) Db/+
offspring had decreased (41.8%; P < 0.05) abundance of ovarian Star mRNA compared to WT.
Compared to Sal offspring, Lpt offspring ovarian (D) Akt and (E) Cyp11a1 mRNA were equally
abundant. (F) Star mRNA was increased (44.7%; P < 0.05) in Lpt offspring compared to Sal
offspring. * indicates different from control, P < 0.05.
71
Figure 2.4. Impact of maternal gestational hyperleptinemia on ovarian mRNA expression
of genes encoding enzymes involved in xenobiotic biotransformation.
Whole ovarian homogenates from offspring of hyperleptinemic dams were utilized to compare
the expression of chemical metabolism genes between treatments. Standardized to β-actin, Db/+
offspring (n = 3) ovarian mRNA levels of (A) Cyp2e1 (P = 0.25), (B) Gst pi (P = 0.36), (C) Gst
mu (P = 0.32), and (D) Ephx1 (P = 0.45) were not different from WT mice. Ovarian levels of Lpt
offspring (n = 3) (E) Cyp2e1 (P = 0.15), (F) Gst pi (P = 0.10), and (G) Gst mu (P = 0.40) mRNA
were not different compared to Sal offspring. (H) Ephx1 mRNA was decreased (24.66%; P <
0.05) in offspring of Lpt dams compared to Sal dams. * indicates different from control, P < 0.05.
72
Figure 2.5. Impact of maternal gestational hyperleptinemia on offspring mRNA.
The effect of maternal gestational hyperleptinemia on mRNA encoding ovarian genes of interest
was also evaluated using Gapdh as the internal control. Offspring of Db/+ (n = 3) had no change
in the abundance of ovarian (A) Akt (P = 0.15) or (B) Foxo3a (P = 0.18) mRNA compared to
WT. Db/+ offspring had increased (14.65%; P < 0.05) abundance of ovarian (C) Ephx1 mRNA
compared to WT. Lpt offspring (n = 3) had no difference in the abundance of ovarian (D) Akt (P
= 0.16), (E) Foxo3a (P = 0.18), or (F) Ephx1 (P = 0.05) mRNA relative to Sal dam offspring.
73
A
B
C
D
E
F
Figure 2.6. Impact of maternal gestational hyperleptinemia on offspring steroidogenic
mRNA.
The effect of maternal gestational hyperleptinemia on mRNA encoding ovarian steroidogenic
genes was also evaluated using Gapdh as the internal control. Offspring of Db/+ (n = 3) had no
change in the abundance of ovarian (A) Star (P = 0.28), (B) Cyp11a1 (P > 0.39), or (C) Cyp19a1
(P = 0.27) mRNA compared to WT. Lpt offspring (n = 3) did not differ in their abundance of
ovarian (D) Star (P = 0.26), (E) Cyp11a1 (P = 0.27), or (F) Cyp19a1 (P = 0.43) mRNA when
compared to the offspring of the Sal dams.
74
Figure 2.7. Maternal gestational hyperleptinemia impact on ovarian protein abundance.
Whole ovarian protein homogenates from Lpt and Sal dam offspring (n = 3) were analyzed by
western blotting to evaluate abundance of proteins involve in PI3K signaling (AKT and pAKT0,
steroidogenesis (StAR) and chemical metabolism (EPHX1). Average densitometric intensities of
appropriately sized protein bands were standardized to Ponceau S total protein staining. There
was no difference in ovarian abundance of (A,E) AKT (P = 0.36) (B,F) pAKT (P = 0.46) or
(C,G) StAR (P = 0.32) protein content. (D,H) EPHX1 levels were increased (P < 0.05) in
ovaries of Lpt dam offspring compared to Sal. * indicates different from control, P < 0.05.
75
Appendix Figure 1. Maternal hyperleptinemia during gestation reduced serum leptin in
offspring. Serum leptin was quantified by ELISA in offspring who experienced exposure to
maternal hyperleptinemia during gestation. Reduced average serum leptin concentration was
demonstrated in offspring of dams who experienced hyperleptinemia due to (A) genotype or (B)
Lpt infusion. * indicates different from control, P < 0.05. Performed by the research group of Dr.
Laura Schulz, University of Missouri, and obtained through personal communication.
76
Bibliography:
[1]
Hirshfield AN. Development of follicles in the mammalian ovary. Int Rev Cytol 1991;
124:43–101.
[2]
McGee EA, Hsueh AJ. Initial and cyclic recruitment of ovarian follicles. Endocr Rev
2000; 21:200–14.
[3]
SHORT R V. Steroids in the follicular fluid and the corpus luteum of the mare. A ‘twocell type’ theory of ovarian steroid synthesis. J Endocrinol 1962; 24:59–63.
[4]
Makris A, Ryan KJ. Progesterone, androstenedione, testosterone, estrone, and estradiol
synthesis in hamster ovarian follicle cells. Endocrinology 1975; 96:694–701.
[5]
Erickson GF, Ryan KJ. The effect of LH/FSH, dibutyryl cyclic AMP, and prostaglandins
on the production of estrogens by rabbit granulosa cells in vitro. Endocrinology 1975;
97:108–13.
[6]
Erickson GF, Ryan KJ. Stimulation of testosterone production in isolated rabbit thecal
tissue by LH/FSH, dibutyryl cyclic AMP, PGE2alpha, and PGE2. Endocrinology 1976;
99:452–8.
[7]
Dorrington JH, Moon YS, Armstrong DT. Estradiol-17beta biosynthesis in cultured
granulosa cells from hypophysectomized immature rats; stimulation by folliclestimulating hormone. Endocrinology 1975; 97:1328–31.
[8]
Fortune JE, Armstrong DT. Androgen production by theca and granulosa isolated from
proestrous rat follicles. Endocrinology 1977; 100:1341–7.
[9]
Moor RM. Sites of steroid production in ovine graafian follicles in culture. J Endocrinol
1977; 73:143–50.
77
[10] Brazil DP, Hemmings BA. Ten years of protein kinase B signalling: a hard Akt to follow.
Trends Biochem Sci 2001; 26:657–64.
[11] Castrillon DH, Miao L, Kollipara R, Horner JW, DePinho RA. Suppression of ovarian
follicle activation in mice by the transcription factor Foxo3a. Science 2003; 301:215–8.
[12] John GB, Gallardo TD, Shirley LJ, Castrillon DH. Foxo3 is a PI3K-dependent molecular
switch controlling the initiation of oocyte growth. Dev Biol 2008; 321:197–204.
[13] Reddy P, Liu L, Adhikari D, Jagarlamudi K, Rajareddy S, Shen Y, Du C, Tang W,
Hämäläinen T, Peng SL, Lan Z-J, Cooney AJ, et al. Oocyte-specific deletion of Pten
causes premature activation of the primordial follicle pool. Science 2008; 319:611–3.
[14] Saltiel AR, Pessin JE. Insulin signaling pathways in time and space. Trends Cell Biol
2002; 12:65–71.
[15] Wilker E, Lu J, Rho O, Carbajal S, Beltrán L, DiGiovanni J. Role of PI3K/Akt signaling
in insulin-like growth factor-1 (IGF-1) skin tumor promotion. Mol Carcinog 2005;
44:137–45.
[16] Donato J, Frazão R, Elias CF. The PI3K signaling pathway mediates the biological effects
of leptin. Arq Bras Endocrinol Metabol 2010; 54:591–602.
[17] Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL,
Burley SK, Friedman JM. Weight-reducing effects of the plasma protein encoded by the
obese gene. Science (80- ) 1995; 269:543–546.
[18] Elmquist JK, Elias CF, Saper CB. From Lesions to Leptin : Hypothalamic Control of Food
Intake and Body Weight. Neuron 1999; 22:221–232.
[19] Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning
of the mouse obese gene and its human homologue. Nature 1994; 372:425–32.
78
[20] Satoh N, Ogawa Y, Katsuura G, Hayase M, Tsuji T, Imagawa K, Yoshimasa Y, Nishi S,
Hosoda K, Nakao K. The arcuate nucleus as a primary site of satiety effect of leptin in
rats. Neurosci Lett 1997; 224:149–52.
[21] Jacob RJ, Dziura J, Medwick MB, Leone P, Caprio S, During M, Shulman GI, Sherwin
RS. The effect of leptin is enhanced by microinjection into the ventromedial
hypothalamus. Diabetes 1997; 46:150–2.
[22] Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P. Recombinant mouse OB protein:
evidence for a peripheral signal linking adiposity and central neural networks. Science
1995; 269:546–9.
[23] Vazquez MJ, Romero-Ruiz A, Tena-Sempere M. Roles of leptin in reproduction,
pregnancy and polycystic ovary syndrome: consensus knowledge and recent
developments. Metabolism 2015; 64:79–91.
[24] Farooqi IS, Jebb SA, Langmack G, Lawrence E, Cheetham CH, Prentice AM, Hughes IA,
McCamish MA, O’Rahilly S. Effects of recombinant leptin therapy in a child with
congenital leptin deficiency. N Engl J Med 1999; 341:879–84.
[25] Cheung CC, Thornton JE, Kuijper JL, Weigle DS, Clifton DK, Steiner RA. Leptin is a
metabolic gate for the onset of puberty in the female rat. Endocrinology 1997; 138:855–
858.
[26] Ahima RS, Dushay J, Flier SN, Prabakaran D, Flier JS. Leptin accelerates the onset of
puberty in normal female mice. J Clin Invest 1997; 99:391–5.
[27] Ryan NK, Woodhouse CM, Van der Hoek KH, Gilchrist RB, Armstrong DT, Norman RJ.
Expression of leptin and its receptor in the murine ovary: possible role in the regulation of
oocyte maturation. Biol Reprod 2002; 66:1548–1554.
79
[28] Sarkar M, Schilffarth S, Schams D, Meyer HHD, Berisha B. The expression of leptin and
its receptor during different physiological stages in the bovine ovary. Mol Reprod Dev
2010; 77:174–81.
[29] Paczoska-Eliasiewicz HE, Gertler A, Proszkowiec M, Proudman J, Hrabia A, Sechman A,
Mika M, Jacek T, Cassy S, Raver N, Rzasa J. Attenuation by leptin of the effects of
fasting on ovarian function in hens (Gallus domesticus). Reproduction 2003; 126:739–51.
[30] Ohkubo T, Tanaka M, Nakashima K. Structure and tissue distribution of chicken leptin
receptor (cOb-R) mRNA. Biochim Biophys Acta 2000; 1491:303–8.
[31] Batista a. M, Silva DMF, Rêgo MJBM, Silva FLM, Silva ECB, Beltrão EIC, Gomes
Filho M a., Wischral a., Guerra MMP. The expression and localization of leptin and its
receptor in goat ovarian follicles. Anim Reprod Sci 2013; 141:142–147.
[32] Karlsson C, Lindell K, Svensson E, Bergh C, Lind P, Billig H, Carlsson LMS, Carlsson B.
Expression of Functional Leptin Receptors in the Human Ovary 1. J Clin Endocrinol
Metab 1997; 82:4144–4148.
[33] Zerani M, Boiti C, Zampini D, Brecchia G, Dall’Aglio C, Ceccarelli P, Gobbetti A. Ob
receptor in rabbit ovary and leptin in vitro regulation of corpora lutea. J Endocrinol 2004;
183:279–88.
[34] Ruiz-Cortés ZT, Men T, Palin MF, Downey BR, Lacroix DA, Murphy BD. Porcine leptin
receptor: molecular structure and expression in the ovary. Mol Reprod Dev 2000; 56:465–
74.
[35] Attig L, Larcher T, Gertler A, Abdennebi-Najar L, Djiane J. Postnatal leptin is necessary
for maturation of numerous organs in newborn rats. Organogenesis 2011; 7:88–94.
80
[36] Panwar S, Herrid M, Kauter KG, McFarlane JR. Effect of passive immunization against
leptin on ovarian follicular development in prepubertal mice. J Reprod Immunol 2012;
96:19–24.
[37] Barash IA, Cheung CC, Weigle DS, Ren H, Kabigting EB, Kuijper JL, Clifton DK,
Steiner RA. Leptin is a metabolic signal to the reproductive system. Endocrinology 1996;
137:3144–7.
[38] KENNEDY GC, MITRA J. Body weight and food intake as initiating factors for puberty
in the rat. J Physiol 1963; 166:408–18.
[39] WHO.
Obesity
and
overweight;
2015.
http://www.who.int/mediacentre/factsheets/fs311/en/. Accessed 28 January 2016.
[40] Considine R V, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR,
Ohannesian JP, Marco CC, McKee LJ, Bauer TL. Serum immunoreactive-leptin
concentrations in normal-weight and obese humans. N Engl J Med 1996; 334:292–5.
[41] Al Maskari MY, Alnaqdy AA. Correlation between Serum Leptin Levels, Body Mass
Index and Obesity in Omanis. Sultan Qaboos Univ Med J 2006; 6:27–31.
[42] Zacharias L, Wurtman RJ, Schatzoff M. Sexual maturation in contemporary American
girls. Am J Obstet Gynecol 1970; 108:833–46.
[43] Hartz AJ, Barboriak PN, Wong A, Katayama KP, Rimm AA. The association of obesity
with infertility and related menstural abnormalities in women. Int J Obes 1979; 3:57–73.
[44] Metwally M, Li TC, Ledger WL. The impact of obesity on female reproductive function.
Obes Rev 2007; 8:515–23.
[45] Pasquali R, Casimirri F. The impact of obesity on hyperandrogenism and polycystic ovary
syndrome in premenopausal women. Clin Endocrinol (Oxf) 1993; 39:1–16.
81
[46] ROGERS J, MITCHELL GW. The relation of obesity to menstrual disturbances. N Engl J
Med 1952; 247:53–5.
[47] Wittemer C, Ohl J, Bailly M, Bettahar-Lebugle K, Nisand I. Does body mass index of
infertile women have an impact on IVF procedure and outcome? J Assist Reprod Genet
2000; 17:547–52.
[48] Purcell SH, Moley KH. The impact of obesity on egg quality. J Assist Reprod Genet 2011;
28:517–24.
[49] Tamer Erel C, Senturk LM. The impact of body mass index on assisted reproduction. Curr
Opin Obstet Gynecol 2009; 21:228–35.
[50] Ogden CL, Carroll MD, Fryar CD, Flegal KM. Prevalence of Obesity Among Adults and
Youth: United States, 2011-2014. NCHS Data Brief 2015:1–8.
[51] Expert Panel Report: Guidelines (2013) for the management of overweight and obesity in
adults. Obesity (Silver Spring) 2014; 22 Suppl 2:S41–410.
[52] NHLBI Obesity Education Initiative Expert Panel on the Identification E and T of O in A
(US). Clinical Guidelines on the Identification, Evaluation, and Treatment of Overweight
and Obesity in Adults n.d.
[53] Nteeba J, Ganesan S, Keating AF. Progressive Obesity Alters Ovarian Folliculogenesis
with Impacts on Pro- Inflammatory and Steroidogenic Signaling in Female Mice 1. Biol
Reprod 2014; 91:1–11.
[54] Nteeba J, Ross JW, Perfield J W II, Keating AF. High fat diet induced obesity alters
ovarian phosphatidylinositol-3 kinase signaling gene expression. Reprod Toxicol 2013;
42:68–77.
82
[55] Pollock KE, Stevens D, Pennington KA, Thaisrivongs R, Kaiser J, Ellersieck MR, Miller
DK, Schulz LC. Hyperleptinemia During Pregnancy Decreases Adult Weight of Offspring
and Is Associated With Increased Offspring Locomotor Activity in Mice. Endocrinology
2015; 156:3777–90.
[56] Yang Z, Norwood K a., Smith JE, Kerl JG, Wood JR. Genes involved in the immediate
early response and epithelial-mesenchymal transition are regulated by adipocytokines in
the female reproductive tract. Mol Reprod Dev 2012; 79:128–137.
[57] Frisch RE, Revelle R. Height and weight at menarche and a hypothesis of critical body
weights and adolescent events. Science 1970; 169:397–9.
[58] Elias CF. the Biological Effects of Leptin. Arq Bras Endocrinol Metabol 2010; 54:591–
602.
[59] Joo J-K, Joo B-S, Kim S-C, Choi J-R, Park S-H, Lee K-S. Role of leptin in improvement
of oocyte quality by regulation of ovarian angiogenesis. Anim Reprod Sci 2010; 119:329–
34.
[60] Cao R, Brakenhielm E, Wahlestedt C, Thyberg J, Cao Y. Leptin induces vascular
permeability and synergistically stimulates angiogenesis with FGF-2 and VEGF. Proc
Natl Acad Sci U S A 2001; 98:6390–5.
[61] Silveira Cavalcante F, Aiceles V, da Fonte Ramos C. Leptin regulates gonadotropins and
steroid receptors in the rats ovary. Nutr Hosp 2013; 28:164–168.
[62] Chen Y-J, Hsiao P-W, Lee M-T, Mason JI, Ke F-C, Hwang J-J. Interplay of PI3K and
cAMP/PKA signaling, and rapamycin-hypersensitivity in TGFbeta1 enhancement of FSHstimulated steroidogenesis in rat ovarian granulosa cells. J Endocrinol 2007; 192:405–19.
83
[63] Taponen S, Martikainen H, Järvelin M-R, Laitinen J, Pouta A, Hartikainen A-L, Sovio U,
McCarthy MI, Franks S, Ruokonen A. Hormonal profile of women with self-reported
symptoms of oligomenorrhea and/or hirsutism: Northern Finland birth cohort 1966 study.
J Clin Endocrinol Metab 2003; 88:141–7.
[64] Nteeba J, Ganesan S, Keating AF. Impact of obesity on ovotoxicity induced by 7,12dimethylbenz[a]anthracene in mice. Biol Reprod 2014; 90:68.
[65] Ganesan S, Nteeba J, Keating AF. Enhanced susceptibility of ovaries from obese mice to
7,12-dimethylbenz[a]anthracene-induced DNA damage. Toxicol Appl Pharmacol 2014;
281:203–10.
[66] Bhattacharya P, Keating AF. Protective role for ovarian glutathione S-transferase isoform
pi during 7,12-dimethylbenz[a]anthracene-induced ovotoxicity. Toxicol Appl Pharmacol
2012; 260:201–8.
[67] Bhattacharya P, Sen N, Hoyer PB, Keating AF. Ovarian expressed microsomal epoxide
hydrolase: role in detoxification of 4-vinylcyclohexene diepoxide and regulation by
phosphatidylinositol-3 kinase signaling. Toxicol Appl Pharmacol 2012; 258:118–23.
[68] Igawa Y, Keating AF, Rajapaksa KS, Sipes IG, Hoyer PB. Evaluation of ovotoxicity
induced by 7, 12-dimethylbenz[a]anthracene and its 3,4-diol metabolite utilizing a rat in
vitro ovarian culture system. Toxicol Appl Pharmacol 2009; 234:361–9.
[69] Park S-H, Ryu S-Y, Yu W-J, Han YE, Ji Y-S, Oh K, Sohn J-W, Lim A, Jeon J-P, Lee H,
Lee K-H, Lee S-H, et al. Leptin promotes K(ATP) channel trafficking by AMPK signaling
in pancreatic β-cells. Proc Natl Acad Sci U S A 2013; 110:12673–8.
84
[70] Louhio H, Hovatta O, Sjöberg J, Tuuri T. The effects of insulin, and insulin-like growth
factors I and II on human ovarian follicles in long-term culture. Mol Hum Reprod 2000;
6:694–8.
[71] Zeleznik AJ, Schuler HM, Reichert LE. Gonadotropin-binding sites in the rhesus monkey
ovary: role of the vasculature in the selective distribution of human chorionic
gonadotropin to the preovulatory follicle. Endocrinology 1981; 109:356–62.
[72] Bouloumié A, Drexler HC, Lafontan M, Busse R. Leptin, the product of Ob gene,
promotes angiogenesis. Circ Res 1998; 83:1059–66.
85
CHAPTER 3
IMPACT OF HEAT STRESS ON OVARIAN PATHWAYS REGULATING
FOLLICULOGENESIS AND STEROIDOGENESIS IN SYNCHRONIZED POSTPUBERTAL GILTS
Ahmad Al-Shaibi, Ben J. Hale, Candice L. Hager, Jason W. Ross, Lance H. Baumgard, Aileen F.
Keating*.
Department of Animal Science, Iowa State University, Ames, IA, 50014
Contribution Statement: Animal experiments were led by CLH and the Baumgard and Ross
research groups. BJH performed protein extractions and aided in ovary collection. AAA
executed the molecular and statistical analyses, with the exception of estradiol and LBP
measurements, and wrote this manuscript. AFK designed the experiments and aided with data
interpretation. AAA was mentored by AFK, who edited this chapter and shall be the
corresponding author when submitting the research article.
*Corresponding author: Aileen F. Keating, Ph.D., Department of Animal Science, Iowa State
University, Ames, IA 50014; Telephone 515-294-3849; Email [email protected]
86
Abstract:
Heat stress (HS) causes an estimated $299 million dollars in annual loss to the US swine
industry. HS induces seasonal infertility; a period of reduced fertility in pigs observed during
summer. The phenotypic response to HS manifests as altered folliculogenesis, steroidogenesis,
embryonic, and fetal development. Systemic, physiological hallmarks of HS include
hyperinsulinemia and endotoxemia. Insulin regulates ovarian function through the insulin
receptor (INSR), and can influence ovarian function via phosphatidylinositol-3 kinase (PI3K)
signaling, an event induced by phosphorylation of tyrosine residues of INSR substrates (IRS) by
INSR. PI3K phosphorylates protein kinase B (AKT) which, in turn, regulates ovarian
steroidogenesis and folliculogenesis. AKT regulation of folliculogenesis is mediated by forkhead
transcription factor 3A (FOXO3A) as it is translocated from the nucleus of the primordial oocyte
upon its phosphorylation, which begins the activation of the primordial follicle. Endotoxemia can
also regulate ovarian activity through the PI3K pathway. Integrity of the intestinal barrier is
reduced in heat-stressed animals which leads to debris from the intestinal flora to leaking into the
bloodstream. This leads to endotoxemia, as endotoxins are part of the composition of this floral
debris. Lipopolysaccharides (LPS) are endotoxins, and an increase in their circulating
concentration is a classic consequence of endotoxemia. Toll-like receptor (TLR) 4 is the receptor
that binds and initiates the cellular response to LPS, in part, through the PI3K pathway. We
previously investigated the ovarian effects of HS in pre-pubertal gilts, and discovered increased
abundance of INSR, IRS-1, AKT1, LDLR, and LHR mRNA during HS. We also observed
increased phosphorylation of AKT and increased abundance of StAR and CYP19A (mRNA and
protein). We hypothesized that HS would induce similar effects in post-pubertal gilts. Postpubertal gilts (n = 6) were exposed to thermal neutral (TN) or cyclical HS (12 h per day) for 5 d
87
after 14 d of oral Matrix© administration. Increased (P < 0.05) abundance of ovarian INSR,
reduced (P < 0.05) phosphorylation of AKT, and increased (P < 0.05) abundance of TLR4 were
observed. Concentrations of 17β-estradiol and LPS binding protein (LBP) were unaltered in the
follicular fluid of HS gilts compared to TN gilts. Protein abundance of AKT, CYP19A, and
StAR were not changed in HS gilts compared to TN. Ovarian mRNA abundance of StAR, IRS1,
LHR, LDLR, CYP17A1, CYP19A1, AKT1, and INSR did not differ between HS and TN gilts.
These data indicate increased ovarian insulin sensitivity, an increased LPS response as well as
reduced PI3K activation due to HS that could contribute to seasonal infertility in swine.
Keywords: Heat stress, Ovary, Steroidogenesis, Folliculogenesis
88
Introduction:
Heat stress (HS) is a condition of a sustained increase in core body temperature due to
increased ambient temperature. HS jeopardizes livestock production and animal welfare. The
American swine industry alone suffers an estimated $299M in annual losses due to HS [1].
Climate change is predicted to increase the intensity of heat waves [2], potentially leading to HS
posing a sustained challenge to animal agriculture and food security.
The US swine industry experiences seasonal infertility as a consequence of reduced
conception rates and increased embryonic deaths, particularly during July, August and
September [3,4]. In the months of August, September, and October, day 28 pregnancy rates
reach their lowest levels, with a subsequent reduction in farrowing rates occurring in November
and December. In studies performed mainly in ruminants, HS impacted follicular development
[5,6], steroidogenesis [5–8], embryonic [3,9,10] and fetal [10,11] development, indicating a
major role of HS in seasonal impairment of reproductive performance.
Hyperinsulinemia was observed repeatedly in production animals, including pigs, in
response to HS, which seems paradoxical to HS-induced reduction in feed intake [12–17].
Interestingly, HS was also demonstrated to increase insulin sensitivity in pigs [18]. Heat
treatment also prevented high-fat diet-induced insulin resistance and improved glucose tolerance
in rats [19]. Insulin functions by binding to the insulin receptor (INSR) which subsequently
recruits and activates INSR substrates (IRS) [20–23]. IRS-mediated INSR signaling is largely
conducted via phosphatidylinositol-3 kinase (PI3K) [24–26]. PI3K signaling is primarily
mediated through the actions of protein kinase B (AKT) [27]. Ovarian AKT regulates the
89
activation and growth of primordial follicles through the forkhead transcription factor
(FOXO3A) [28–30]. Primordial follicles are finite [31], meaning their depletion can be
accelerated if they are overactivated. PI3K signaling also regulates ovarian steroidogenesis [26],
which is responsible for the production of 17β-estradiol (E2) and progesterone (P4) from the
tertiary follicles and corpus luteum, respectively [31,32].
We previously investigated the ovarian response to HS in pre-pubertal gilts [33], and
demonstrated increased abundance of ovarian INSR and IRS-1 mRNA after 7 and 35 d of HS.
Increased ovarian insulin signaling activation via IRS-1 phosphorylation at the Tyr632 residue
was also observed in heat-stressed animals. Additionally, AKT signaling was upregulated,
evidenced by increased abundance of ovarian AKT1 mRNA and phosphorylation of AKT in
heat-stressed gilts compared to their thermal neutral controls. These data suggested that
folliculogenesis could be altered due to HS. In addition, HS increased ovarian STAR and
CYP19A (mRNA and protein), as well as LDLR and LHR mRNA abundance. Thus, despite
being pre-pubertal, HS altered steroidogenic pathways in gilts.
Systemic HS reduces intestinal wall integrity resulting in subsequent endotoxemia;
characterized by increased circulating lipopolysaccharide (LPS) [16,34]. Toll-like receptor
(TLR) 4 is the primary receptor through which LPS signaling is mediated [35,36], and TLR4 can
mediate its effects through the PI3K pathway [37]. In terms of ovarian function, LPS has been
shown to deplete primordial follicles in mice and cows [38]. LPS is capable of inducing early
loss of pregnancy through abortion or resorption in mice [39–41]. Administration of LPS to
cattle increased prostaglandin F2alpha production in cultured bovine endometrial cells [42], and
90
reduced the size of the corpus luteum and circulating P4 concentrations in vivo [43]. In addition,
LPS was demonstrated to reduce the expression of the P4 receptor in the uteri of mice [44].
Based on our data in pre-pubertal gilts and the potential for LPS to be at least partially
culpable in altering ovarian function, thereby contributing to seasonal infertility in swine, we
hypothesized that HS during the follicular phase would alter ovarian function in post-pubertal
estrous synchronized gilts in a manner similar to pre-pubertal gilts and that ovarian LPS
signaling would be activated during HS.
Materials and Methods:
Reagents:
Primers were designed using Primer 3 output with the exception of GAPDH which was
designed using Primer-BLAST. Primers were synthesized by the DNA facility at Iowa State
University (Ames, IA). Ponceau S, hydrochloric acid, Sodium Phosphate Monobasic, and
Sodium Phosphate Dibasic, were obtained from Fisher Scientific (Waltham, MA). SignalFire
ECL reagent was acquired from Cell Signaling Technology (Danvers, MA). Ammonium
persulfate, paraformaldehyde (PFA), Bovine Serum Albumin (BSA), Glycine, 30%
Acrylamide/Bis-acrylamide, 2-b-mercaptoethanol, sodium dodecyl sulfate (SDS), Tween-20,
Tris base, Tris HCl, sodium chloride, and N0, N0, N0, N0-tetramethylethylenediamine
(TEMED), were acquired from Sigma-Aldrich, Inc. (St. Louis, MO). Superscript III one-step
RT-PCR system, dNTP mix, iBlot 2 dry transfer system, and iBind western system, were
purchased from Invitrogen, Co. (Carlsbad, CA).
91
Animals and sample collection
12 post pubertal gilts (126.02 ± 21.6 kg) were synchronized in their follicular phase
through oral administration of Matrix® for 14 d. The gilts were then divided into two groups and
exposed to thermal neutral conditions (TN; 20.3oC ± 0.1°C) or cyclical heat stress conditions
(HS; 26°C during 12 dark hours and 32°C during 12 light hours) to simulate naturally-occurring
HS patterns. Heat treatment was administered for 5 d following Matrix® withdrawal. During the
treatment period, both TN and HS animals were limit-fed to 3 kg of feed per day. After 5 d,
animals were euthanized using captive bolt penetration and the ovaries were excised. Dominant
follicles were aspirated of their follicular fluid which was stored in pyrogen-free tubes on ice,
followed by centrifugation at 9300 x g to produce a pellet. The supernatant was stored at -80°C
in pyrogen-free tubes. One ovary from every animal was flash-frozen in liquid nitrogen and
stored at -80oC while the contralateral ovary was fixed in 4% paraformaldehyde overnight before
being stored in 70% ethanol. The Iowa State University Institutional Animal Care and Use
Committee approved all experimental procedures involving animals.
RNA isolation and quantitative RT-PCR
Ovaries were powdered using a mortar and pestle and RNA was extracted using an
RNeasy Mini Kit according to the manufacturer’s recommended protocol. Samples were treated
with DNaseI to remove genomic DNA. RNA concentration and purity were measured using an
ND-1000 Spectrophotometer (260/280 nm; NanoDrop Technologies, Inc.). mRNA was reversetranscribed to cDNA using the Superscript III system and an oligo dT primer. Diluted (2 µl;
1:25) cDNA was amplified using the QuantiTect SYBR® Green PCR Kit on an Eppendorf
MasterCycler RealPlex4 using gene-specific primers as detailed in Table 1. The thermocycler
92
program consisted of an initial hold at 95°C for 15 min, followed by 50 cycles of 95°C melting
for 15 sec, annealing at 57°C for 30 sec, and extension at 68°C for 1 min, which was when
amplification was measured. Melting curve analysis was conducted using a 60 to 99°C ramp of
1°C per step. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the
endogenous control gene to which all measurements were standardized as no variation between
treatments was observed. Delta Ct values for the experimental genes of interest were calculated
by normalization to the Ct values for GAPDH. To test for genomic contamination, a pool of
purified RNA was created after extraction and was run through the cDNA synthesis protocol
without including reverse transcriptase to the reaction. This reaction was then tested for GAPDH
signal using RT-PCR protocol as explained above and no contamination was found.
Additionally, samples primers were tested for template contamination by running them with no
template, and cDNA was tested for primer contamination by being run with no primers.
Protein extraction and western blotting
Total ovarian protein was extracted from whole tissue homogenate. A sample of ovarian
tissue was homogenized using a handheld homogenizer and lysed in phosphate lysis buffer
(10mM; 0.69g monobasic sodium phosphate, 1.34g dibasic sodium phosphate, and 20g SDS in
1L of double-distilled water at pH 7.0). The protein homogenate was applied to a Qiashredder
column and centrifuged at 9300 x g for 15 s. The lysate was centrifuged for 15 min at 9300 x g at
4°C and the supernatant placed on ice for 10 min before being recentrifuged for 15 min at 9300 x
g at 4°C. Extracted protein was quantified using a Nanodrop® (A-280 nm; k ¼ 260/280 nm;
NanoDrop Technologies, Inc.) and was stored at -80°C. Protein was separated using MiniPROTEAN® TGX™ 4-20% Precast Gels and then transferred onto a nitrocellulose membrane
93
using Life Technology’s iBlot® 2 Dry Blotting System. Transfer quality was assessed by
Ponceau S staining (0.5% Ponceau S in 1% Acetic Acid solution). Membranes were washed with
phosphate-buffered saline (PBS) with Tween 20 (PBST) then blocked overnight in 5% BSA in
PBST at 4°C with constant shaking. For TLR4 detection, the membrane was blocked in 2.5%
BSA in PBST at 4°C with constant shaking. Primary antibodies were diluted as follows: antiAKT (1:1000 in 5% BSA in PBST; Cell Signaling; 9272), anti-pAKTThr308 (1:1000 dilution in
5% BSA in PBST; Cell Signaling; C31E5E), anti-StAR (1:1000 dilution in 5% BSA in PBST;
Cell Signaling; D10H12), CYP19A (1:500 dilution in 5% BSA in PBST; Cell Signaling;
D5Q2Y), and anti-TLR4 (1:250 dilution in PBST; Santa Cruz; 8694). Membranes were
incubated in their respective primary antibody dilutions overnight at 4°C with constant shaking
then washed with PBST for three rounds of 10 minutes each at room temperature. Membranes
were then incubated in a 1:5000 dilution of the species appropriate antibody (goat anti-rabbit in
5% BSA in PBST; donkey anti-goat in 1% BSA in PBST) for 1 h at room temperature with
constant shaking. Membranes were washed with PBST for three rounds of 10 min each before
being immersed in ECL Reagent for 10 min. X-ray film was then exposed to the membranes.
Appropriate sized protein bands were quantified by densitometric analysis using ImageJ v1.49v
software. Densitometric measurements of the protein band of interest was normalized by
dividing by densitometric values obtained from Ponceau S images. Pooled protein samples were
blotted as explained above and incubated in each primary antibody, each secondary antibody,
and rabbit IgG or normal goat serum with rabbit anti-goat and goat anti-donkey secondary
antibodies respectively. Signal was detected as explained above.
94
Follicular fluid E2 quantification
Aspirated follicular fluid was diluted in 1% BSA buffer (1 g BSA, 0.12 g sodium
phosphate monobasic, anhydrous, 0.88 g sodium chloride, 0.01 g sodium azide, 100 mL ddH2O,
at 7.0-7.2 pH). Serial dilutions of 1:10, 1:100, 1:1000, and 1:10000 were prepared and
measurement of E2 concentration in follicular fluid was via radioimmunoassay performed by Dr.
George Perry at South Dakota State University.
Follicular fluid LBP measurement
Hycult Biotech's LBP ELISA kit (HK503) was used to quantify LPS binding protein
(LBP) content of follicular fluid as per the manufacturer's recommendation.
Statistical analysis:
Statistical analysis was performed by comparing ΔCt values derived from qRT-PCR
between TN and HS gilts. For protein abundance comparisons, densitometric measurements for
the protein of interest were divided by densitometric measurements for total protein. Statistical
comparison for both RNA and protein data between TN and HS treatments were performed using
a 2-tailed Student's t-test calculated in Microsoft Excel using the function t.test(<array 1>;<array
2>;2;2). Graphs were generated using GraphPad Prism 6 software, where columns denote mean
values while error bars represent the standard error of the mean. Statistical difference was
considered if the P-value was less than 0.05.
95
Results:
Rectal temperature was increased in response to HS
Heat-stressed gilts averaged a rectal temperature of 39.48oC compared to the 38.68oC of TN
controls (P < 0.05) during daytime.
HS alters ovarian insulin signaling
There was no effect of HS on mRNA encoding INSR (P = 0.94; Figure 3.1A) or IRS1 (P = 0.29;
Figure 3.1B). Ovarian INSR1b abundance was increased (19%; P < 0.05) in HS compared to TN
gilts (Figure 3.1C).
HS reduces AKT phosphorylation
The abundance of ovarian AKT1 mRNA was unaltered (P = 0.46; Figure 3.2A) in HS compared
to TN gilts. Neither was there any effect of HS on FOXO3A mRNA level (P = 0.71; Figure
3.2B). Total ovarian AKT abundance did not differ (P = 0.05) between HS and TN gilts (Figure
3.2C). HS reduced ovarian pAKT (10%; P < 0.05) relative to TN control gilts (Figure 3.2D).
HS does not affect ovarian steroidogenic enzyme abundance
After 5 d of HS, no impact on ovarian LDLR (P = 0.85), StAR (P = 0.53), CYP17A1 (P = 0.73),
CYP19A1 (P = 0.85), LHR (P = 0.97), or ESR1 (P = 0.90; Figure 3.3A-F) mRNA abundance was
observed, nor was there any effect of HS on StAR (P = 0.69; Figure 3.4A) or CYP19A (P =
0.58; Figure 3.4B) protein abundance.
96
There is no impact of HS on follicular fluid E2 levels
The concentration of E2 in the follicular fluid aspirated from dominant follicles of TN and HS
post-pubertal gilts did not differ (P = 0.90; Figure 3.5).
TLR4 protein is increased in the ovary of HS gilts
TLR4, the ligand for LPS, was increased in protein abundance in ovaries from HS gilts (4.9 fold;
P < 0.05) relative to TN controls (Figure 3.6).
HS does not alter follicular fluid concentrations of LBP
Follicular fluid LBP concentrations were not different (P = 0.93) in HS gilts compared to TN
gilts (Figure 3.7).
Discussion:
Coinciding with hot summer months, production animals undergo a period of reduced
reproductive capacity known as seasonal infertility. Seasonal infertility is attributed to both HS
and the longer photoperiod during the season [45,46]. The impact of HS on reproductive function
manifests in its influence on folliculogenesis [5,6], steroidogenesis [5–8], embryonic [3,9,10],
and fetal [10,11] development. We previously demonstrated altered ovarian signaling in response
to HS in pre-pubertal gilts [33], in which increased activation of ovarian IRS-1 by
phosphorylation of the Tyr632 residue was observed. In addition, ovarian StAR and CYP19A
(both mRNA and protein), and LHR mRNA were increased in abundance in heat-stressed gilts,
despite those animals being pre-pubertal, indicating a potential impact on ovarian capacity for
steroidogenesis. Additionally, our published data indicated increased PI3K signaling, as
97
evidenced by increased abundance of ovarian AKT1 mRNA and increased phosphorylation of
AKT due to HS [33]. Based on this, we hypothesized that post-pubertal gilts would also
experience perturbations to ovarian pathways involved in folliculogenesis and steroidogenesis.
To test this hypothesis, post-pubertal estrus synchronized gilts were utilized and ovaries
collected on the fifth day after Matrix® withdrawal, therefore our data is representative of the
impacts of HS on the ovary during the follicular phase.
Insulin signaling can be directed through the PI3K pathway of signaling proteins. Upon
binding insulin, INSR phosphorylates tyrosine residues in members of the IRS protein family
[20–23], which go on to activate PI3K which, subsequently, activates AKT [24–27]. Cultured
human ovarian tissue was shown to respond to insulin by increased accumulation of primary
follicles, indicating a role of insulin in enhancing early folliculogenesis [47]. In addition,
administration of insulin was shown to decrease atresia [48], and increase the rate of ovulation in
pigs [49]. Together, these reports suggest that insulin can act as a growth factor in the ovary.
Insulin signaling is a participant in the systemic response to HS, as insulin levels were shown to
increase in heat-stressed production animals [12–16]. We observed increased abundance of
ovarian INSR1b in HS gilts. HS can enhance insulin sensitivity, as evidenced by improved
insulin sensitivity in pigs [18], and mitigation of high-fat diet-induced insulin resistance and
improved glucose tolerance in rats [19]. Increased abundance of INSR1b is an indicator of
increased insulin sensitization. Our previous findings of increased expression of INSR and IRS-1
are consistent with increased ovarian insulin sensitivity during HS [33]. If altered insulin
sensitization is persistent, then ovarian function could be altered by HS even after the animal
returns to thermoneutral conditions and normal circulating levels of insulin for as long as it takes
98
INSR abundance to return to normal. However, it is important to note that increased abundance
of insulin receptors is not sufficient to confirm increased insulin sensitization. Insulin resistance
can be induced through hyper-phosphorylation of serine residues on IRS-1, for instance, which
could happen independently from any changes to INRS abundance [50]. Conversely, our
previous investigation into the pre-pubertal ovarian response to HS revealed increased
phosphorylation of IRS-1 at the Tyr632 residue [33], which indicates activation of insulin
signaling [20–23].
PI3K regulates folliculogenesis by changing the localization of FOXO3A through AKT
signaling [28–30]. Steroidogenesis is also regulated by PI3K as it regulates the production of E2
and P4 in tertiary follicles and CL, respectively [31,32]. No impact on total AKT was noted,
however, AKT phosphorylation was decreased by HS. This is an interesting contrast to our
previous findings of increased INSR signaling through IRS-1 and increased activation of ovarian
AKT [33]. Also, these data are contrary to our previous findings of increased pAKT in the prepubertal gilt ovary in response to HS, potentially indicating an altered response due to the
presence of circulating gonadotrophins and/or being at the end of the follicular phase of the
estrous cycle. This could be interpreted as the ovary switching to a stress response state which
requires a specific level of AKT phosphorylation lower than that required for normal ovarian
function at the end of the follicular phase of the estrous cycle. AKT phosphorylation suppresses
stress responses such as autophagy [51] and apoptosis [52]. HS was shown to enhance atresia
[53], a process that is partly mediated through apoptosis [54]. In addition, HS induced apoptosis
in human and bovine endothelial cells [55,56]. Autophagy is also upregulated under conditions
of HS [57,58]. A reduction in ovarian AKT phosphorylation despite hyperinsulinemia and
99
circulating gonadotropins is potentially indicative of an ovarian stress response involving
apoptosis and/or autophagy.
We previously identified increased StAR and CYP19A during HS in pre-pubertal gilts as
well as altered mRNA abundance of genes involved in steroidogenesis [33]. Interestingly, in the
ovaries from post-pubertal gilts, we did not observe any impact of HS on mRNA encoding
LDLR, LHR, StAR, CYP17A1, CYP19A or ESR. LDLR was examined to elucidate any potential
alterations to ovarian capacity to import cholesterol from the blood via LDL. LHR was examined
to observe any responses which could change ovarian LH sensitivity as LH resistance is a
potential mechanism of impairing ovarian function. StAR, CYP17A1, and CYP19A were
investigated to evaluate any effect of HS on the ovarian steroidogenic capacity as they encode
proteins responsible for importing cholesterol to the mitochondria, synthesizing pregnenolone,
and synthesizing E2, respectively. ESR was examined to observe any potential changes in ovarian
estrogen sensitivity. Additionally, HS did not affect ovarian StAR or CYP19A protein
abundance. Since the gilts were heat-stressed during the follicular phase of the estrous cycle,
these data are surprising. Additionally, we did not observe any effect of HS on 17β-estradiol
concentration in the follicular fluid aspirated from the dominant follicles our observed values fell
well within the range of concentrations previously observed in the dominant follicles of pigs
[59]. It is possible for the ovaries of the HS gilts being close to their maximum steroidogenic
capacity due to being in late proestrus, but this is an area for future investigation.
Endotoxemia results from compromised integrity of the intestinal wall observed in heatstressed animals [16,34]. Elevated circulating LPS is characteristic of HS-induced endotoxemia
100
[16,34]. TLR4 is the primary receptor responsible for detecting LPS and initiating a cellular
response to its presence [35,36], and it does so by activating PI3K [37]. Administering LPS to
gestating mice causes early loss of pregnancy [39–41]. It potentially causes that by suppressing
the expression of uterine P4 receptors [44], increasing circulating PGF2alpha [42], and reducing
the size and P4 production by the CL [43]. We observed a dramatic increase in the abundance of
ovarian TLR4 in HS gilts. This implies increased ovarian TLR4 signaling in response to HS.
However, the levels of LBP observed in the follicular fluid of HS gilts did not differ from their
TN counterparts. While this could indicate that there is not a significant amount of LPS reaching
the ovary, it is important to emphasize that our LBP measurements were taken from follicular
fluid, which is derived, partly, by filtering blood [60], meaning that LPS could have been
removed while the follicular fluid was passing through the thecal and granulosa layers.
In summary, cyclical HS in synchronized post-pubertal gilts increased the abundance of
ovarian INSR1b but reduced ovarian AKT phosphorylation. HS did not alter E2 concentration in
follicular fluid nor the expression of steroidogenic genes. HS, however, did increase abundance
of ovarian TLR4 indicating an ovarian response to HS-induced endotoxemia. Taken together,
these data shed light on biological alterations to ovarian function that could contribute to
seasonal infertility in swine.
Acknowledgements:
Our thanks are extended to Samantha Lei for her measurements of LPS binding protein in
follicular fluid, and Dr. George Perry, South Dakota State University for measuring follicular
fluid E2 level.
101
Funding:
This work was funded by the National Pork Board.
Table 3.1: Primer sequences
Gene
Primer sequence (5' to 3')
Left
Right
Left
AKT1
Right
Left
ESR1
Right
Left
LDLR
Right
Left
LHR
Right
Left
StAR
Right
Left
CYP17A1
Right
Left
CYP19A1
Right
ACTGGAAGTCAGGAGATGCT
GACCACTTCGTCAAGCTCAT
ATCGTGTGGCAGGATGTGTA
CTGGCCGAGTAGGAGAACTG
AGCACCCTGAAGTCTCTGGA
TGTGCCTGAAGTGAGACAGG
GAGTTGGCTTTTGCTCTGCT
GGGTTTTGGTGAATGAATGG
CATGGCACCGATCTCTTTCT
CGGAATGCCTTTGTGAAAAT
TTGGAAGAGACGGATGGAAG
CCCACATTCCTGCTATTGCT
CACAGGGCTATCATTGACTCCAG
GATGGTGAGATGAGCTGGGTTC
ATGTTCTTGGAAATGCTGAACCC
AGGACCTGGTATTGAAGACGAC
GAPDH
Amplicon
size
214
199
160
157
150
235
175
151
102
Figure 3.1. HS alters ovarian insulin signaling.
Total RNA or protein was isolated from ovaries of gilts who experienced thermal neutral (TN;
20.3oC ± 0.1oC) or heat stress (HS; 26oC) conditions during the follicular phase of the estrous
cycle. The ovarian mRNA abundance of (A) INSR (P = 0.94) and (B) IRS1 (P = 0.29) were
measured using qRT-PCR. Barcharts indicate delta Ct, normalized to GAPDH where an
increased Delta Ct value reflects reduced mRNA abundance of the gene of interest. (C) Total
ovarian INSR protein level was found to be increased (19%; P < 0.05) in HS animals compared
to TN as quantified using (D) western blot. The data is expressed as average intensity of the
INSR protein band, normalized to total protein loaded as determined by Ponceau S staining (PS).
* indicates difference from TN controls at P < 0.05.
103
Figure 3.2. HS reduces AKT phosphorylation.
Total RNA or protein was isolated from ovaries of gilts who experienced thermal neutral (TN;
20.3oC ± 0.1oC) or heat stress (HS; 26oC) conditions during the follicular phase of the estrous
cycle. The ovarian mRNA abundance of (A) AKT1 (P = 0.46) and (B) FOXO3A (P = 0.71) were
measured using qRT-PCR. Barcharts indicate delta Ct, normalized to GAPDH where an
increased Delta Ct value reflects reduced mRNA abundance of the gene of interest. (C) Total
ovarian AKT (tAKT) was not changed (P = 0.5) in abundance in HS animals, while (D)
phosphorylated AKT (pAKT) protein level was decreased (10%; P < 0.05). Abundance of both
proteins was quantified using western blot, and the data was expressed as average intensity of the
protein band of interest, normalized to total protein loaded as determined by Ponceau S staining
(PS). * indicates difference from TN controls at P < 0.05.
104
Figure 3.3. HS does not impact steroidogenic gene expression in post-pubertal gilt ovaries.
Total RNA was isolated from ovaries of gilts who experienced thermal neutral (TN; 20.3oC ±
0.1oC) or heat stress (HS; 26oC) conditions during the follicular phase of the estrous cycle. The
ovarian mRNA abundance of (A) LDLR (P = 0.85), (B) StAR (P = 0.53), (C) CYP17A1 (P =
0.73), (D) CYP19A1 (P = 0.85), (E) LHR (P = 0.97), and (F) ESR-1 (P = 0.90) were measured
using qRT-PCR. Barcharts indicate delta Ct, normalized to GAPDH where an increased Delta Ct
value reflects reduced mRNA abundance of the gene of interest.
105
Figure 3.4. HS does not affect StAR or CYP19A1 protein abundance.
Total protein was isolated from ovaries of gilts who experienced thermal neutral (TN; 20.3oC ±
0.1oC) or heat stress (HS; 26oC) conditions during the follicular phase of the estrous cycle.
Ovarian protein abundance of (A) StAR (P = 0.69) and (B) CYP19A1 (P = 0.58) were quantified
by western blotting. Data is expressed as average intensity of the protein band of interest,
normalized to total protein loaded as determined by Ponceau S staining (PS).
106
Figure 3.5. Follicular fluid 17β-estradiol concentration is not impacted by HS.
Follicular fluid was aspirated from dominant follicles on ovaries from gilts who experienced
thermal neutral (TN; 20.3oC ± 0.1oC) or heat stress (HS; 26oC) conditions during the follicular
phase of the estrous cycle. 17β-estradiol concentration was measured by radioimmunoassay.
Data represents total 17β-estradiol concentration (ng/mL). Concentrations of E2 was not changed
(P = 0.90) in the follicular fluid aspirated from HS animals compared to TN.
107
*
Figure 3.6. HS increases abundance of TLR4 indicating LPS signaling.
Total protein was isolated from ovaries of gilts who experienced thermal neutral (TN; 20.3oC ±
0.1oC) or heat stress (HS; 26oC) conditions during the follicular phase of the estrous cycle.
Ovarian protein abundance of TLR4 was quantified by western blotting. Data is expressed as
average intensity of the protein band of interest, normalized to total protein loaded as determined
by Ponceau S staining (PS). TLR4 abundance in the ovaries of HS gilts was observed to be
elevated (4.9 fold; P < 0.05) compared to TN controls.
108
Figure 3.7. Follicular fluid LPS binding protein concentration is not impacted by HS.
Follicular fluid was aspirated from dominant follicles on ovaries from gilts who experienced
thermal neutral (TN; 20.3oC ± 0.1oC) or heat stress (HS; 26oC) conditions during the follicular
phase of the estrous cycle. LPS binding protein (LBP) concentration was measured by ELISA.
Data represents total LBP concentration (ng/mL). No difference (P = 0.93) was observed in the
concentration of LBP in the follicular fluid of HS gilts compared to TN.
109
Bibliography:
[1]
St-Pierre NR, Cobanov B, Schnitkey G. Economic losses from heat stress by US livestock
industries. J Dairy Sci 2003; 86:E52–E77.
[2]
Meehl GA, Tebaldi C. More intense, more frequent, and longer lasting heat waves in the
21st century. Science 2004; 305:994–7.
[3]
Tompkins EC, Heidenreich CJ, Stob M. Effect of Post-Breeding Thermal Stress on
Embyronic Mortality in Swine. J Anim Sci 1967; 26:377–380.
[4]
Edwards RL, Omtvedt IT, Tuesman EJ, Stephens DF, Mahoney GWA. Reproductive
Performance of Gilts following Heat Stress Prior to Breeding and in Early Gestation. J
Anim Sci 1968; 27:1634–1637.
[5]
Roth Z, Meidan R, Braw-Tal R, Wolfenson D. Immediate and delayed effects of heat
stress on follicular development and its association with plasma FSH and inhibin
concentration in cows. J Reprod Fertil 2000; 120:83–90.
[6]
Ozawa M, Tabayashi D, Latief TA, Shimizu T, Oshima I, Kanai Y. Alterations in
follicular dynamics and steroidogenic abilities induced by heat stress during follicular
recruitment in goats. Reproduction 2005; 129:621–30.
[7]
Roth Z, Meidan R, Shaham-Albalancy A, Braw-Tal R, Wolfenson D. Delayed effect of
heat stress on steroid production in medium-sized and preovulatory bovine follicles.
Reproduction 2001; 121:745–51.
[8]
Wolfenson D, Lew BJ, Thatcher WW, Graber Y, Meidan R. Seasonal and acute heat
stress effects on steroid production by dominant follicles in cows. Anim Reprod Sci 1997;
47:9–19.
110
[9]
Ealy AD, Drost M, Hansen PJ. Developmental changes in embryonic resistance to adverse
effects of maternal heat stress in cows. J Dairy Sci 1993; 76:2899–905.
[10] Alexander G, Williams D. Heat stress and development of the conceptus in domestic
sheep. J Agric Sci 2009; 76:53.
[11] Galan HL, Hussey MJ, Barbera A, Ferrazzi E, Chung M, Hobbins JC, Battaglia FC.
Relationship of fetal growth to duration of heat stress in an ovine model of placental
insufficiency. Am J Obstet Gynecol 1999; 180:1278–1282.
[12] Quiniou N, Noblet J. Influence of high ambient temperatures on performance of
multiparous lactating sows. J Anim Sci 1999; 77:2124–34.
[13] Victoria Sanz Fernandez M, Johnson JS, Abuajamieh M, Stoakes SK, Seibert JT, Cox L,
Kahl S, Elsasser TH, Ross JW, Isom SC, Rhoads RP, Baumgard LH. Effects of heat stress
on carbohydrate and lipid metabolism in growing pigs. Physiol Rep 2015; 3.
[14] O’Brien MD, Rhoads RP, Sanders SR, Duff GC, Baumgard LH. Metabolic adaptations to
heat stress in growing cattle. Domest Anim Endocrinol 2010; 38:86–94.
[15] Wheelock JB, Rhoads RP, Vanbaale MJ, Sanders SR, Baumgard LH. Effects of heat stress
on energetic metabolism in lactating Holstein cows. J Dairy Sci 2010; 93:644–55.
[16] Pearce SC, Gabler NK, Ross JW, Escobar J, Patience JF, Rhoads RP, Baumgard LH. The
effects of heat stress and plane of nutrition on metabolism in growing pigs. J Anim Sci
2013; 91:2108–18.
[17] Pearce SC, Upah NC, Harris A, Gabler NK, Ross JW, Rhoads RP, Baumgard LH. Effects
of heat stress on energetic metabolism in growing pigs. FASEB J 2011; 25:1052.5–.
111
[18] Sanz Fernandez MV, Stoakes SK, Abuajamieh M, Seibert JT, Johnson JS, Horst EA,
Rhoads RP, Baumgard LH. Heat stress increases insulin sensitivity in pigs. Physiol Rep
2015; 3.
[19] Gupte AA, Bomhoff GL, Swerdlow RH, Geiger PC. Heat treatment improves glucose
tolerance and prevents skeletal muscle insulin resistance in rats fed a high-fat diet.
Diabetes 2009; 58:567–78.
[20] Sun XJ, Rothenberg P, Kahn CR, Backer JM, Araki E, Wilden PA, Cahill DA, Goldstein
BJ, White MF. Structure of the insulin receptor substrate IRS-1 defines a unique signal
transduction protein. Nature 1991; 352:73–7.
[21] Sun XJ, Wang LM, Zhang Y, Yenush L, Myers MG, Glasheen E, Lane WS, Pierce JH,
White MF. Role of IRS-2 in insulin and cytokine signalling. Nature 1995; 377:173–7.
[22] Lavan BE, Lane WS, Lienhard GE. The 60-kDa phosphotyrosine protein in insulin-treated
adipocytes is a new member of the insulin receptor substrate family. J Biol Chem 1997;
272:11439–43.
[23] Lavan BE, Fantin VR, Chang ET, Lane WS, Keller SR, Lienhard GE. A novel 160-kDa
phosphotyrosine protein in insulin-treated embryonic kidney cells is a new member of the
insulin receptor substrate family. J Biol Chem 1997; 272:21403–7.
[24] White MF. The IRS-signaling system: a network of docking proteins that mediate insulin
and cytokine action. Recent Prog Horm Res 1998; 53:119–38.
[25] Metz HE, Houghton AM. Insulin receptor substrate regulation of phosphoinositide 3kinase. Clin Cancer Res 2011; 17:206–11.
[26] White MF. Insulin signaling in health and disease. Science 2003; 302:1710–1.
112
[27] Brazil DP, Hemmings BA. Ten years of protein kinase B signalling: a hard Akt to follow.
Trends Biochem Sci 2001; 26:657–64.
[28] Castrillon DH, Miao L, Kollipara R, Horner JW, DePinho RA. Suppression of ovarian
follicle activation in mice by the transcription factor Foxo3a. Science 2003; 301:215–8.
[29] John GB, Gallardo TD, Shirley LJ, Castrillon DH. Foxo3 is a PI3K-dependent molecular
switch controlling the initiation of oocyte growth. Dev Biol 2008; 321:197–204.
[30] Reddy P, Liu L, Adhikari D, Jagarlamudi K, Rajareddy S, Shen Y, Du C, Tang W,
Hämäläinen T, Peng SL, Lan Z-J, Cooney AJ, et al. Oocyte-specific deletion of Pten
causes premature activation of the primordial follicle pool. Science 2008; 319:611–3.
[31] Hirshfield AN. Development of follicles in the mammalian ovary. Int Rev Cytol 1991;
124:43–101.
[32] Chen Y-J, Hsiao P-W, Lee M-T, Mason JI, Ke F-C, Hwang J-J. Interplay of PI3K and
cAMP/PKA signaling, and rapamycin-hypersensitivity in TGFbeta1 enhancement of FSHstimulated steroidogenesis in rat ovarian granulosa cells. J Endocrinol 2007; 192:405–19.
[33] Nteeba J, Sanz-Fernandez M V., Rhoads RP, Baumgard LH, Ross JW, Keating a. F. Heat
Stress Alters Ovarian Insulin-Mediated Phosphatidylinositol-3 Kinase and Steroidogenic
Signaling in Gilt Ovaries. Biol Reprod 2015; 92:148–148.
[34] Pearce SC, Mani V, Boddicker RL, Johnson JS, Weber TE, Ross JW, Baumgard LH,
Gabler NK. Heat stress reduces barrier function and alters intestinal metabolism in
growing pigs. J Anim Sci 2012; 90 Suppl 4:257–9.
[35] Hijiya N, Miyake K, Akashi S, Matsuura K, Higuchi Y, Yamamoto S. Possible
involvement of toll-like receptor 4 in endothelial cell activation of larger vessels in
response to lipopolysaccharide. Pathobiology 2002; 70:18–25.
113
[36] Faure E, Equils O, Sieling PA, Thomas L, Zhang FX, Kirschning CJ, Polentarutti N,
Muzio M, Arditi M. Bacterial lipopolysaccharide activates NF-kappaB through toll-like
receptor 4 (TLR-4) in cultured human dermal endothelial cells. Differential expression of
TLR-4 and TLR-2 in endothelial cells. J Biol Chem 2000; 275:11058–63.
[37] Li X, Tupper JC, Bannerman DD, Winn RK, Rhodes CJ, Harlan JM. Phosphoinositide 3
kinase mediates Toll-like receptor 4-induced activation of NF-kappa B in endothelial
cells. Infect Immun 2003; 71:4414–20.
[38] Bromfield JJ, Sheldon IM. Lipopolysaccharide reduces the primordial follicle pool in the
bovine ovarian cortex ex vivo and in the murine ovary in vivo. Biol Reprod 2013; 88:98.
[39] Parant M, Chedid L. Protective Effect of Chlorpromazine Against Endotoxin-Induced
Abortion. Proc Soc Exp Biol Med 116:906–9.
[40] Chaouat G, Menu E, Clark DA, Dy M, Minkowski M, Wegmann TG. Control of fetal
survival in CBA x DBA/2 mice by lymphokine therapy. J Reprod Fertil 1990; 89:447–58.
[41] Yu G, Sun Y, Foerster K, Manuel J, Molina H, Levy GA, Gorczynski RM, Clark DA.
LPS-induced murine abortions require C5 but not C3, and are prevented by upregulating
expression of the CD200 tolerance signaling molecule. Am J Reprod Immunol 2008;
60:135–40.
[42] Leung ST, Cheng Z, Sheldrick EL, Derecka K, Flint AP, Wathes DC. The effects of
lipopolysaccharide and interleukins-1alpha, -2 and -6 on oxytocin receptor expression and
prostaglandin production in bovine endometrium. J Endocrinol 2001; 168:497–508.
114
[43] Herzog K, Strüve K, Kastelic JP, Piechotta M, Ulbrich SE, Pfarrer C, Shirasuna K,
Shimizu T, Miyamoto A, Bollwein H. Escherichia coli lipopolysaccharide administration
transiently suppresses luteal structure and function in diestrous cows. Reproduction 2012;
144:467–76.
[44] Agrawal V, Jaiswal MK, Jaiswal YK. Lipopolysaccharide-induced modulation in the
expression of progesterone receptor and estradiol receptor leads to early pregnancy loss in
mouse. Zygote 2013; 21:337–44.
[45] Kraeling RR, Webel SK. Current strategies for reproductive management of gilts and
sows in North America. J Anim Sci Biotechnol 2015; 6:3.
[46] Claus R, Weiler U. Influence of light and photoperiodicity on pig prolificacy. J Reprod
Fertil Suppl 1985; 33:185–97.
[47] Louhio H, Hovatta O, Sjöberg J, Tuuri T. The effects of insulin, and insulin-like growth
factors I and II on human ovarian follicles in long-term culture. Mol Hum Reprod 2000;
6:694–8.
[48] Matamoros IA, Cox NM, Moore AB. Effects of exogenous insulin and body condition on
metabolic hormones and gonadotropin-induced follicular development in prepuberal gilts.
J Anim Sci 1991; 69:2081–91.
[49] Cox NM, Stuart MJ, Althen TG, Bennett WA, Miller HW. Enhancement of ovulation rate
in gilts by increasing dietary energy and administering insulin during follicular growth. J
Anim Sci 1987; 64:507–16.
[50] Gual P, Le Marchand-Brustel Y, Tanti J-F. Positive and negative regulation of insulin
signaling through IRS-1 phosphorylation. Biochimie 2005; 87:99–109.
115
[51] Wang RC, Wei Y, An Z, Zou Z, Xiao G, Bhagat G, White M, Reichelt J, Levine B. Aktmediated regulation of autophagy and tumorigenesis through Beclin 1 phosphorylation.
Science 2012; 338:956–9.
[52] Franke TF, Hornik CP, Segev L, Shostak GA, Sugimoto C. PI3K/Akt and apoptosis: size
matters. Oncogene 2003; 22:8983–8998.
[53] Shimizu T, Ohshima I, Kanai Y. Effects of heat stress on follicular development in
PMSG-treated immature rats. Anim Sci J 2000; 71:32–37.
[54] Kaipia A, Hsueh AJ. Regulation of ovarian follicle atresia. Annu Rev Physiol 1997;
59:349–63.
[55] Brinton MR, Tagge CA, Stewart RJ, Cheung AK, Shiu Y-TE, Christensen DA. Thermal
sensitivity of endothelial cells on synthetic vascular graft material. Int J Hyperthermia
2012; 28:163–74.
[56] Gu ZT, Wang H, Li L, Liu YS, Deng XB, Huo SF, Yuan FF, Liu ZF, Tong HS, Su L.
Heat stress induces apoptosis through transcription-independent p53-mediated
mitochondrial pathways in human umbilical vein endothelial cell. Sci Rep 2014; 4:4469.
[57] Liu T-T, Hu C-H, Tsai C-D, Li C-W, Lin Y-F, Wang J-Y. Heat stroke induces autophagy
as a protection mechanism against neurodegeneration in the brain. Shock 2010; 34:643–8.
[58] Oberley TD, Swanlund JM, Zhang HJ, Kregel KC. Aging results in increased autophagy
of mitochondria and protein nitration in rat hepatocytes following heat stress. J Histochem
Cytochem 2008; 56:615–27.
[59] Conley AJ, Howard HJ, Slanger WD, Ford JJ. Steroidogenesis in the preovulatory porcine
follicle. Biol Reprod 1994; 51:655–61.
116
[60] Shalgi R, Kraicer P, Rimon A, Pinto M, Soferman N. Proteins of human follicular fluid:
the blood-follicle barrier. Fertil Steril 1973; 24:429–34.
117
CHAPTER 4
GENERAL DISCUSSION AND CONCLUSIONS
The reviewed literature and the data presented in this thesis underscore the important
role(s) of metabolic status and ensuing signaling events on mammalian body on ovarian function.
The rationale for these investigations are the systemic effects on the female body exerted by the
ovary through the production of steroids, as well as the effects on future generations due to the
ovarian role in production and maintenance of the maternal gamete. The capacity to sense and
respond to global energy status demonstrate evolutionary importance to the reproductive system.
This discussion contains the author's overall interpretation of the reviewed literature, the
conducted studies, and thoughts on the direction that future research could take.
General background:
Reproduction is a nutritionally expensive process on the female body, both in terms of
caloric expenditure and in micronutrients. These expenses continue after parturition in mammals,
and many other vertebrates, due to the offspring requiring nursing and care for a developmental
period before they are capable of functioning independently. The reproductive system has
evolved to recognize when the energy status of the female is insufficient to carry out these
processes. Reproductive impairment is demonstrated in individuals who lead lifestyles of high
caloric expenditure and low body fat. Female gymnasts possess extremely low body fat content,
and this reflects on their reproductive performance as delayed onset of puberty [1]. Studies of the
onset of puberty in the context of body mass support a correlation between energy status,
measured mainly by body mass, and reproductive performance [2,3].
118
While plentiful nourishment is positively associated with ovarian function, excessive
caloric intake leads to compromised reproductive performance. Polycystic ovary syndrome
(PCOS) [4], miscarriage [5], anovulation [6], and difficulties with assisted fertility treatments
[7], are all correlated to the condition yielded by excessive caloric intake; obesity. Metabolic
factors such as leptin and insulin, as well as byproducts of extreme metabolic states like
lipopolysaccharides (LPS), have been linked to altered reproductive performance. This
impairment of reproductive performance in what is, essentially, a lifestyle of ad libitum feeding
leads to the posit that a restriction in the quantity of available calories might be necessary for the
reproductive system to function properly. Reduction in caloric intake has already been shown to
increase lifespan [8] and prolong reproductive function [9]. Current animal research tends to
include ad libitum feeding in its definition of "normal." A consequence of this might be that our
understanding and expectations of what is biologically "normal" are skewed by convenience or
by a biased human angle on the availability of food sources. Whether or not this bias is
significant when it comes to overall research, I believe, is something worth investigating.
Leptin:
In this thesis, leptin signaling was discussed as a major regulator of reproductive
function. Leptin is crucial in maintaining cyclicity due to its permissive effect over hypothalamic
release of gonadotropin-releasing hormone (GnRH), mainly through the indirect routes of
GABAergic neurons [10,11] and kisspeptin neurons [12–16]. Leptin is also capable of directly
influencing ovarian function through its positive regulation of germinal vesicle breakdown
(GVBD) and ovulation [17]. Initially, these observations suggest that systemic leptin could act as
a general promoter of ovarian function. However, directly blocking leptin receptor (LEPR)
119
signaling via LEPR antagonists impedes early folliculogenesis [18], while reducing the efficacy
of circulating leptin through passive immunization enhances it [19]. To add to the conflict, our
experiments with cultured post-natal day (PND) 4 rat ovaries show no effects of leptin on early
folliculogenesis (Chapter 2). We can consider two effects of leptin in an attempt to illicit an
explanation for these conflicting reports.
Leptin is a factor which promotes both angiogenesis and fenestration [20,21], meaning
that it has the capacity to recruit and make blood vessels more permeable. Ovarian vascular
architecture is thought to be a limiting factor in early folliculogenesis due to its restricting of
primordial follicles' access to circulating factors, which is supported by accelerated early
follicular growth ex vivo compared to in vivo [22,23]. As follicles grow larger, their requirements
of oxygen and nutrients increase, which leads to increased vascularization on individual follicles
[24]. Leptin potentially participates in this process as ovaries of a variety of species were shown
to produce leptin in all follicular cell types with variations in expression levels [17,25–31].
Recruitment of cells is a process typically carried out by chemical signal gradients, meaning
more of a signal has to be at the destination relative to the rest of the environment. If one were to
visualize a signal gradient by means of a drop of ink in a glass of clear water, the concept
becomes clear as the gradient of ink would direct towards the drop. If the ink was leptin, then
blood vessels would follow that gradient to where the droplet, in this case representing the ovary,
is. Mixing some ink into the water beforehand would not negate the fact that ink is still most
abundant at the source, but it would make finding the direction towards it more difficult due to
the diminished relative strength of the signal. Passive immunization against leptin would, in
effect, clarify the water as it reduces the effective concentration of circulating leptin, leading to a
120
stronger relative signal. Blocking leptin signaling via LEPR antagonists would block the sensors
detecting the gradient, effectively "blinding" blood vessels to the existence of the signal gradient.
The conflicting results could be interpreted as a result of ovarian vascularization being
influenced by the blood vessels' ability to sense a leptin signal gradient produced by the ovary,
which in turn could affect their recruitment and capacity to deliver circulating factors, thus
influencing folliculogenesis. Our own results showing a lack of an effect of leptin on cultured
ovaries also fall in line with this hypothesis as vascularization is of no concern to cultured
ovaries (Chapter 2). An effect on vascularization could also explain the increased incident of
anovulation during obesity. Reducing the efficacy of a leptin gradient in recruiting blood vessels
to a growing follicle could restrict its access to luteinizing hormone (LH), which is already
produced in lowered amounts during the LH surge necessary for ovulation in obese individuals
[32]. Using models such as ob/ob, Db/Db, and high-fat diet mouse models, and examining their
ovarian vascular architecture would help in tackling this hypothesis.
The second route by which leptin might influence early folliculogenesis is its influence
on pancreatic beta cells. Leptin was shown to increase the localization of ATP-sensitive K+
channels in insulin-producing pancreatic cells [33]. If this was effective in influencing insulin
response to glucose, leptin concentrations could influence early folliculogenesis by changing
insulin secretion patterns and overall glucose tolerance. Monitoring systemic insulin levels in
response to a glucose challenge after the administration of leptin into circulation could help in
clarifying the picture and in providing more information to simulate such effects in culture.
121
Leptin is also a potential participant in heat stress (HS). During HS, animals display a
consistent phenotype of reduced feed intake and seemingly paradoxical hyperinsulinemia [34–
39]. Some hypothesize that as a result of inflammation due to endotoxemia, while others
speculate it to be a mechanism of reducing thermogenesis. However, reduced feed intake could
be mechanistically explained through leptin signaling. Chronic HS was shown to increase leptin
production and leptin sensitivity in mice [40]. As a satiety-inducing factor, leptin could be a
participant in reducing feed intake by directly suppressing feeding behavior. Elucidating this
potential effect could be done by manipulating central leptin signaling to observe whether
suppressing it would be effective in increasing feed intake during HS.
Another facet of appetite regulation is ghrelin; a promoter of appetite produced by the
stomach [41]. Ghrelin is also a suppressor of insulin production [41,42]. Its production location,
the stomach, is part of the gastrointestinal (GI) tract, which experiences hypoxia and reduced
integrity during HS in the intestines due to circulation diverting blood to the extremities in an
attempt to cool it [43,44]. If this hypoxia extends to compromising the stomach's capacity to
produce ghrelin, then it could inhibit its stimulation of appetite and its suppression of insulin,
contributing to reduced feed intake and hyperinsulinemia during HS.
Circulating leptin concentrations could be of transgenerational consequence. Our results
show that gestational hyperleptinemia can have the ability to change the ovarian capacity to
metabolize ovotoxicants through EPHX1 later in life (Chapter 2). These results suggest a
possible capacity of leptin to imprint offspring in some way depending on its concentration in
maternal circulation. If that is the case, investigating caloric intake during gestation might
122
elucidate an effect on offspring health, which would parallel the findings of general
improvements in lifespan and reproductive longevity in response to reduced caloric intake.
TLR4:
Toll-like receptor (TLR) 4 is a specialized member of a larger family of receptors [45,46]
concerned with initiating the innate immune response to invading pathogens by recognizing
pathogen-associated molecular patterns (PAMPS) [47], specifically lipopolysaccharides (LPS) in
the case of TLR4 [48,49]. LPS is increased in a condition known as endotoxemia. Both HS
[38,50] and obesity have systemic endotoxemia as a phenotypic perturbation. Our observations
in the ovaries of HS gilts showed a dramatic increase in the ovarian content of TLR4, indicating
an increase in TLR4 signaling. Being associated with a plethora of impairments to the
mechanisms of the reproductive system, LPS signaling is a potential target for rescuing reduced
fertility in production animals when challenged by HS. The benefit of initiating an immune
response outside the immune system is that it aids in the recruitment of immune cells and allows
local tissues to resist active pathogens. However, in HS, this might not be entirely necessary.
While endotoxemia is present, bacteremia might not be. The absence of active pathogens in
circulation might justify a blockage of TLR4 signaling in the ovary as a method of protecting the
corpus luteum (CL) from regression, and early follicles from depletion. An ovarian TLR4
knockout model would be ideal in elucidating the role TLR4 plays during early folliculogenesis,
and whether innate immunity is necessary during HS-induced endotoxemia.
123
Insulin:
Insulin is a direct regulator of ovarian function. It functions as a stimulator of growth and
a survival factor by enhancing the folliculogenic process and suppressing atresia [51–53]. Insulin
also stimulates ovarian steroidogenesis [54] in such a conserved manner that exposing insect
ovaries to mammalian insulin was shown to stimulate their steroid production [53–55]. Due to
these effects, hyperinsulinemia during obesity and HS could stress the ovary by overactivating its
metabolic machinery by overstimulating follicular growth and steroidogenic pathways.
Manipulating systemic insulin through passive immunization and/or through INSR antagonists
during HS and obesity might provide some insight into the role and the consequences of insulin
under these conditions.
Phosphotidylinositol-3 kinase (PI3K):
When considering general ovarian function and all the factors discussed herein, it is
important to remember that they all converge, at least partially, at a major signaling node. That
node is PI3K and its downstream signal protein kinase B (AKT). PI3K not only mediates leptin,
TLR4, and insulin signaling, but also controls folliculogenesis, steroidogenesis, apoptosis, and
autophagy (Chapter 1). The reduction of AKT phosphorylation observed in HS gilts is indicative
of a trend towards a stress response. PI3K regulates apoptosis and folliculogenesis through
forkhead transcription factor (FOXO3A). pAKT-mediated inhibition of FOXO3A initiates
folliculogenesis [56–58], increases cell survival, and suppresses apoptosis [59–61]. pAKT also
suppresses autophagy [62]. HS is a condition which upregulates both autophagy [63,64] and
apoptosis [65,66]. Upregulation of apoptosis could be attributed to the increase in atresia during
HS [67] as it is a partly apoptotic process [68]. Our observed reduction in the phosphorylation of
124
AKT in response to HS despite hyperinsulinemia, endotoxemia, and gonadotropic signaling
being positive regulators of PI3K signaling, is indicative of ovarian stress where apoptotic and
autophagic pathways are being activated. Heat stressing post-pubertal gilts during the luteal
phase or before the development of dominant follicles could help in elucidating that particular
response of PI3K and AKT.
Apoptosis is another facet of ovarian function worth investigating. Apoptosis is the
process of programmed cell death, where a cell could be eliminated either due to displaying signs
of dysfunction, or having completed its role during a specific developmental stage. Apoptosis is
activated in one of three ways: intrinsic, extrinsic, or by the granzyme pathway [69]. The
characteristic markers of these pathways are activated caspase 9, caspase 8, and
perforin/granzyme, respectively. Atresia's apoptotic portion is mediated by the extrinsic pathway
through the Fas, cell-surface death receptor signaling system [70]. Histological investigation of
sectioned ovaries from HS animals could show which, if any, apoptotic pathway is being
activated as the activating signals are varied and could be independent of the common markers
used to detect apoptosis (such as P53 and caspase 9).
Taken together, the studies described in this thesis provide starting points from which
biological understanding of compromised reproductive function during obesity and HS can
develop.
125
Bibliography:
[1]
Weimann E, Witzel C, Schwidergall S, Böhles HJ. Effect of high performance sports on
puberty development of female and male gymnasts. Wien Med Wochenschr 1998;
148:231–4.
[2]
KENNEDY GC, MITRA J. Body weight and food intake as initiating factors for puberty
in the rat. J Physiol 1963; 166:408–18.
[3]
Frisch RE, Revelle R. Height and weight at menarche and a hypothesis of critical body
weights and adolescent events. Science 1970; 169:397–9.
[4]
Pasquali R, Casimirri F. The impact of obesity on hyperandrogenism and polycystic ovary
syndrome in premenopausal women. Clin Endocrinol (Oxf) 1993; 39:1–16.
[5]
ROGERS J, MITCHELL GW. The relation of obesity to menstrual disturbances. N Engl J
Med 1952; 247:53–5.
[6]
Hartz AJ, Barboriak PN, Wong A, Katayama KP, Rimm AA. The association of obesity
with infertility and related menstural abnormalities in women. Int J Obes 1979; 3:57–73.
[7]
Wittemer C, Ohl J, Bailly M, Bettahar-Lebugle K, Nisand I. Does body mass index of
infertile women have an impact on IVF procedure and outcome? J Assist Reprod Genet
2000; 17:547–52.
[8]
McCay CM, Crowell MF, Maynard LA. The effect of retarded growth upon the length of
life span and upon the ultimate body size. 1935. Nutrition 5:155–71; discussion 172.
[9]
Selesniemi K, Lee H-J, Tilly JL. Moderate caloric restriction initiated in rodents during
adulthood sustains function of the female reproductive axis into advanced chronological
age. Aging Cell 2008; 7:622–9.
126
[10] Donato J, Cravo RM, Frazão R, Gautron L, Scott MM, Lachey J, Castro IA, Margatho
LO, Lee S, Lee C, Richardson JA, Friedman J, et al. Leptin’s effect on puberty in mice is
relayed by the ventral premammillary nucleus and does not require signaling in Kiss1
neurons. J Clin Invest 2011; 121:355–68.
[11] Zuure WA, Roberts AL, Quennell JH, Anderson GM. Leptin signaling in GABA neurons,
but not glutamate neurons, is required for reproductive function. J Neurosci 2013;
33:17874–17883.
[12] Cravo RM, Margatho LO, Osborne-Lawrence S, Donato J, Atkin S, Bookout AL,
Rovinsky S, Frazão R, Lee CE, Gautron L, Zigman JM, Elias CF. Characterization of
Kiss1 neurons using transgenic mouse models. Neuroscience 2011; 173:37–56.
[13] Smith JT, Acohido B V, Clifton DK, Steiner RA. KiSS-1 neurones are direct targets for
leptin in the ob/ob mouse. J Neuroendocr 2006; 18:298–303.
[14] Backholer K, Smith JT, Rao A, Pereira A, Iqbal J, Ogawa S, Li Q, Clarke IJ. Kisspeptin
cells in the ewe brain respond to leptin and communicate with neuropeptide Y and
proopiomelanocortin cells. Endocrinology 2010; 151:2233–2243.
[15] Luque RM, Kineman RD, Tena-Sempere M. Regulation of hypothalamic expression of
KiSS-1 and GPR54 genes by metabolic factors: analyses using mouse models and a cell
line. Endocrinology 2007; 148:4601–11.
[16] Castellano JM, Navarro VM, Fernandez-Fernandez R, Roa J, Vigo E, Pineda R, Dieguez
C, Aguilar E, Pinilla L, Tena-Sempere M. Expression of hypothalamic KiSS-1 system and
rescue of defective gonadotropic responses by kisspeptin in streptozotocin-induced
diabetic male rats. Diabetes 2006; 55:2602–2610.
127
[17] Ryan NK, Woodhouse CM, Van der Hoek KH, Gilchrist RB, Armstrong DT, Norman RJ.
Expression of leptin and its receptor in the murine ovary: possible role in the regulation of
oocyte maturation. Biol Reprod 2002; 66:1548–1554.
[18] Attig L, Larcher T, Gertler A, Abdennebi-Najar L, Djiane J. Postnatal leptin is necessary
for maturation of numerous organs in newborn rats. Organogenesis 2011; 7:88–94.
[19] Panwar S, Herrid M, Kauter KG, McFarlane JR. Effect of passive immunization against
leptin on ovarian follicular development in prepubertal mice. J Reprod Immunol 2012;
96:19–24.
[20] Bouloumié A, Drexler HC, Lafontan M, Busse R. Leptin, the product of Ob gene,
promotes angiogenesis. Circ Res 1998; 83:1059–66.
[21] Ambrosini G, Nath AK, Sierra-Honigmann MR, Flores-Riveros J. Transcriptional
activation of the human leptin gene in response to hypoxia. Involvement of hypoxiainducible factor 1. J Biol Chem 2002; 277:34601–9.
[22] Fortune JE, Cushman RA, Wahl CM, Kito S. The primordial to primary follicle transition.
Mol Cell Endocrinol 2000; 163:53–60.
[23] McGee EA, Hsueh AJ. Initial and cyclic recruitment of ovarian follicles. Endocr Rev
2000; 21:200–14.
[24] Zeleznik AJ, Schuler HM, Reichert LE. Gonadotropin-binding sites in the rhesus monkey
ovary: role of the vasculature in the selective distribution of human chorionic
gonadotropin to the preovulatory follicle. Endocrinology 1981; 109:356–62.
[25] Sarkar M, Schilffarth S, Schams D, Meyer HHD, Berisha B. The expression of leptin and
its receptor during different physiological stages in the bovine ovary. Mol Reprod Dev
2010; 77:174–81.
128
[26] Paczoska-Eliasiewicz HE, Gertler A, Proszkowiec M, Proudman J, Hrabia A, Sechman A,
Mika M, Jacek T, Cassy S, Raver N, Rzasa J. Attenuation by leptin of the effects of
fasting on ovarian function in hens (Gallus domesticus). Reproduction 2003; 126:739–51.
[27] Ohkubo T, Tanaka M, Nakashima K. Structure and tissue distribution of chicken leptin
receptor (cOb-R) mRNA. Biochim Biophys Acta 2000; 1491:303–8.
[28] Batista a. M, Silva DMF, Rêgo MJBM, Silva FLM, Silva ECB, Beltrão EIC, Gomes
Filho M a., Wischral a., Guerra MMP. The expression and localization of leptin and its
receptor in goat ovarian follicles. Anim Reprod Sci 2013; 141:142–147.
[29] Karlsson C, Lindell K, Svensson E, Bergh C, Lind P, Billig H, Carlsson LMS, Carlsson B.
Expression of Functional Leptin Receptors in the Human Ovary 1. J Clin Endocrinol
Metab 1997; 82:4144–4148.
[30] Zerani M, Boiti C, Zampini D, Brecchia G, Dall’Aglio C, Ceccarelli P, Gobbetti A. Ob
receptor in rabbit ovary and leptin in vitro regulation of corpora lutea. J Endocrinol 2004;
183:279–88.
[31] Ruiz-Cortés ZT, Men T, Palin MF, Downey BR, Lacroix DA, Murphy BD. Porcine leptin
receptor: molecular structure and expression in the ovary. Mol Reprod Dev 2000; 56:465–
74.
[32] Balasubramanian P, Jagannathan L, Mahaley RE, Subramanian M, Gilbreath ET,
Mohankumar PS, Mohankumar SMJ. High fat diet affects reproductive functions in
female diet-induced obese and dietary resistant rats. J Neuroendocrinol 2012; 24:748–55.
[33] Park S-H, Ryu S-Y, Yu W-J, Han YE, Ji Y-S, Oh K, Sohn J-W, Lim A, Jeon J-P, Lee H,
Lee K-H, Lee S-H, et al. Leptin promotes K(ATP) channel trafficking by AMPK signaling
in pancreatic β-cells. Proc Natl Acad Sci U S A 2013; 110:12673–8.
129
[34] Quiniou N, Noblet J. Influence of high ambient temperatures on performance of
multiparous lactating sows. J Anim Sci 1999; 77:2124–34.
[35] Victoria Sanz Fernandez M, Johnson JS, Abuajamieh M, Stoakes SK, Seibert JT, Cox L,
Kahl S, Elsasser TH, Ross JW, Isom SC, Rhoads RP, Baumgard LH. Effects of heat stress
on carbohydrate and lipid metabolism in growing pigs. Physiol Rep 2015; 3.
[36] O’Brien MD, Rhoads RP, Sanders SR, Duff GC, Baumgard LH. Metabolic adaptations to
heat stress in growing cattle. Domest Anim Endocrinol 2010; 38:86–94.
[37] Wheelock JB, Rhoads RP, Vanbaale MJ, Sanders SR, Baumgard LH. Effects of heat stress
on energetic metabolism in lactating Holstein cows. J Dairy Sci 2010; 93:644–55.
[38] Pearce SC, Gabler NK, Ross JW, Escobar J, Patience JF, Rhoads RP, Baumgard LH. The
effects of heat stress and plane of nutrition on metabolism in growing pigs. J Anim Sci
2013; 91:2108–18.
[39] Pearce SC, Upah NC, Harris A, Gabler NK, Ross JW, Rhoads RP, Baumgard LH. Effects
of heat stress on energetic metabolism in growing pigs. FASEB J 2011; 25:1052.5–.
[40] Morera P, Basiricò L, Hosoda K, Bernabucci U. Chronic heat stress up-regulates leptin
and adiponectin secretion and expression and improves leptin, adiponectin and insulin
sensitivity in mice. J Mol Endocrinol 2012; 48:129–38.
[41] Pradhan G, Samson SL, Sun Y. Ghrelin: much more than a hunger hormone. Curr Opin
Clin Nutr Metab Care 2013; 16:619–24.
[42] Verhulst P-J, Depoortere I. Ghrelin’s second life: from appetite stimulator to glucose
regulator. World J Gastroenterol 2012; 18:3183–95.
[43] Hall DM, Baumgardner KR, Oberley TD, Gisolfi C V. Splanchnic tissues undergo
hypoxic stress during whole body hyperthermia. Am J Physiol 1999; 276:G1195–203.
130
[44] Lambert GP, Gisolfi C V, Berg DJ, Moseley PL, Oberley LW, Kregel KC. Selected
contribution: Hyperthermia-induced intestinal permeability and the role of oxidative and
nitrosative stress. J Appl Physiol 2002; 92:1750–61; discussion 1749.
[45] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;
124:783–801.
[46] Shi Z, Cai Z, Sanchez A, Zhang T, Wen S, Wang J, Yang J, Fu S, Zhang D. A novel Tolllike receptor that recognizes vesicular stomatitis virus. J Biol Chem 2011; 286:4517–24.
[47] Kawai T, Akira S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol Med 2007;
13:460–9.
[48] Hijiya N, Miyake K, Akashi S, Matsuura K, Higuchi Y, Yamamoto S. Possible
involvement of toll-like receptor 4 in endothelial cell activation of larger vessels in
response to lipopolysaccharide. Pathobiology 2002; 70:18–25.
[49] Faure E, Equils O, Sieling PA, Thomas L, Zhang FX, Kirschning CJ, Polentarutti N,
Muzio M, Arditi M. Bacterial lipopolysaccharide activates NF-kappaB through toll-like
receptor 4 (TLR-4) in cultured human dermal endothelial cells. Differential expression of
TLR-4 and TLR-2 in endothelial cells. J Biol Chem 2000; 275:11058–63.
[50] Pearce SC, Mani V, Boddicker RL, Johnson JS, Weber TE, Ross JW, Baumgard LH,
Gabler NK. Heat stress reduces barrier function and alters intestinal metabolism in
growing pigs. J Anim Sci 2012; 90 Suppl 4:257–9.
[51] Louhio H, Hovatta O, Sjöberg J, Tuuri T. The effects of insulin, and insulin-like growth
factors I and II on human ovarian follicles in long-term culture. Mol Hum Reprod 2000;
6:694–8.
131
[52] Poretsky L, Glover B, Laumas V, Kalin M, Dunaif A. The effects of experimental
hyperinsulinemia on steroid secretion, ovarian [125I]insulin binding, and ovarian
[125I]insulin-like growth-factor I binding in the rat. Endocrinology 1988; 122:581–5.
[53] Graf R, Neuenschwander S, Brown MR, Ackermann U. Insulin-mediated secretion of
ecdysteroids from mosquito ovaries and molecular cloning of the insulin receptor
homologue from ovaries of bloodfed Aedes aegypti. Insect Mol Biol 1997; 6:151–163.
[54] Riehle MA, Brown MR. Insulin stimulates ecdysteroid production through a conserved
signaling cascade in the mosquito Aedes aegypti. Insect Biochem Mol Biol 1999; 29:855–
60.
[55] Manière G, Rondot I, Büllesbach EE, Gautron F, Vanhems E, Delbecque JP. Control of
ovarian steroidogenesis by insulin-like peptides in the blowfly (Phormia regina). J
Endocrinol 2004; 181:147–56.
[56] Castrillon DH, Miao L, Kollipara R, Horner JW, DePinho RA. Suppression of ovarian
follicle activation in mice by the transcription factor Foxo3a. Science 2003; 301:215–8.
[57] John GB, Gallardo TD, Shirley LJ, Castrillon DH. Foxo3 is a PI3K-dependent molecular
switch controlling the initiation of oocyte growth. Dev Biol 2008; 321:197–204.
[58] Reddy P, Liu L, Adhikari D, Jagarlamudi K, Rajareddy S, Shen Y, Du C, Tang W,
Hämäläinen T, Peng SL, Lan Z-J, Cooney AJ, et al. Oocyte-specific deletion of Pten
causes premature activation of the primordial follicle pool. Science 2008; 319:611–3.
[59] Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC,
Blenis J, Greenberg ME. Akt Promotes Cell Survival by Phosphorylating and Inhibiting a
Forkhead Transcription Factor. Cell 1999; 96:857–868.
132
[60] Brazil DP, Hemmings BA. Ten years of protein kinase B signalling: a hard Akt to follow.
Trends Biochem Sci 2001; 26:657–64.
[61] Franke TF, Hornik CP, Segev L, Shostak GA, Sugimoto C. PI3K/Akt and apoptosis: size
matters. Oncogene 2003; 22:8983–8998.
[62] Wang RC, Wei Y, An Z, Zou Z, Xiao G, Bhagat G, White M, Reichelt J, Levine B. Aktmediated regulation of autophagy and tumorigenesis through Beclin 1 phosphorylation.
Science 2012; 338:956–9.
[63] Liu T-T, Hu C-H, Tsai C-D, Li C-W, Lin Y-F, Wang J-Y. Heat stroke induces autophagy
as a protection mechanism against neurodegeneration in the brain. Shock 2010; 34:643–8.
[64] Oberley TD, Swanlund JM, Zhang HJ, Kregel KC. Aging results in increased autophagy
of mitochondria and protein nitration in rat hepatocytes following heat stress. J Histochem
Cytochem 2008; 56:615–27.
[65] Brinton MR, Tagge CA, Stewart RJ, Cheung AK, Shiu Y-TE, Christensen DA. Thermal
sensitivity of endothelial cells on synthetic vascular graft material. Int J Hyperthermia
2012; 28:163–74.
[66] Gu ZT, Wang H, Li L, Liu YS, Deng XB, Huo SF, Yuan FF, Liu ZF, Tong HS, Su L.
Heat
stress
induces
apoptosis
through
transcription-independent
p53-mediated
mitochondrial pathways in human umbilical vein endothelial cell. Sci Rep 2014; 4:4469.
[67] Shimizu T, Ohshima I, Kanai Y. Effects of heat stress on follicular development in
PMSG-treated immature rats. Anim Sci J 2000; 71:32–37.
[68] Kaipia A, Hsueh AJ. Regulation of ovarian follicle atresia. Annu Rev Physiol 1997;
59:349–63.
133
[69] Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol 2007; 35:495–
516.
[70]
Manabe N, Goto Y, Matsuda-Minehata F, Inoue N, Maeda A, Sakamaki K, Miyano T.
Regulation mechanism of selective atresia in porcine follicles: regulation of granulosa cell
apoptosis during atresia. J Reprod Dev 2004; 50:493–514.