Dev Genes Evol
DOI 10.1007/s00427-005-0008-9
ORIGINA L ARTI CLE
Peter W. Osborne . Peter K. Dearden
Expression of Pax group III genes in the honeybee (Apis mellifera)
Received: 30 March 2005 / Accepted: 20 May 2005
# Springer-Verlag 2005
Abstract Pax group III genes are involved in a number of
processes during insect segmentation. In Drosophila
melanogaster, three genes, paired, gooseberry and gooseberry-neuro, regulate segmental patterning of the epidermis and nervous system. Paired acts as a pair-rule gene and
gooseberry as a segment polarity gene. Studies of Pax
group III genes in other insects have indicated that their
expression is a good marker for understanding the underlying molecular mechanisms of segmentation. We have
cloned three Pax group III genes from the honeybee (Apis
mellifera) and examined their relationships to other insect
Pax group III genes and their expression patterns during
honeybee segmentation. The expression pattern of the
honeybee homologue of paired is similar to that of paired
in Drosophila, but its expression is modulated by anterior–
posterior temporal patterning similar to the expression of
Pax group III proteins in Tribolium. The expression of the
other two Pax group III genes in the honeybee indicates
that they also act in segmentation and nervous system
development, as do these genes in other insects.
Keywords Honeybee . Drosophila . Evolution .
Development . Segmentation . Pax group 3/7
Introduction
Segmentation is a well-studied process in Drosophila
melanogaster, providing an excellent comparative system
for examining the molecular control of segmentation in
Communicated by P. Simpson
P. W. Osborne . P. K. Dearden
Laboratory for Development and Evolution,
Biochemistry Department, University of Otago,
Dunedin, New Zealand
P. K. Dearden (*)
Biochemistry Department, University of Otago,
P.O. Box 56 Dunedin, New Zealand
e-mail: [email protected]
other species. The genes required for Drosophila segmentation were identified by the work of Nüsslein-Volhard and
Wieschaus (1980), and subsequent studies have provided
a great deal of information on the interactions and activities of these genes (reviewed in Davis and Patel 2002).
Drosophila have long-germ embryos in which the complete
body plan is represented at the blastoderm stage. This form
of development is a derived process that is not representative of ancestral insect segmentation or of segmentation in
the majority of insects (Patel et al. 1994). In other insects,
three major classes of germ type have been described: long,
short and intermediate germ (Patel et al. 1994). Short-germ
embryos form all but their most anterior segments by
growth after the blastoderm stage, and intermediate-germ
embryos define all but the abdomen in the blastoderm.
These three classes of germ development are not distributed
phylogenetically implying that transitions between short-,
intermediate- and long-germ development have occurred a
number of times in the evolution of insects (Sander 1976;
Patel et al. 1994).
We have investigated two phases of segmentation in the
honeybee (Apis mellifera; order Hymenoptera). The honeybee is formally a long-germ insect with large embryos, no
head involution or germband extension/retraction (Fleig
1990). The lineage leading to Hymenoptera has been separated from that leading to Diptera since at least the Triassic, 200–250 million years ago (and probably since the
Permian) (Hennig 1981). Traditionally, Hymenoptera have
been thought to be phylogenetically intermediate between
the Diptera and Coleoptera (Hennig 1981; Whiting et al.
1997), and several molecular phylogenies (Whiting et al.
1997; Kjer 2004) and combined molecular and morphological phylogenies (Whiting 1998) have supported this
view. Recent molecular phylogenetic studies, however,
have placed them as an early branching of the Endopterygota, sister to a grouping of Coleoptera, Lepidoptera and
Diptera (Whiting 2002; Krauss et al. 2004). Phylogenies
based on concatenated EST sequences (Philippe et al 2005)
place Coleoptera and Hymenoptera as a separate monophyletic group with Lepidoptera and Diptera as its sister
group.
Within the major Endopterygota orders, the three different germ types are widely distributed (Sander 1976; Patel
et al. 1994). Hymenoptera and Coleoptera have all three
types, Lepidoptera have both intermediate- and long-germ
types and Diptera display only long-germ development.
It is likely that the ancestral germ type in the Endopterygotes is intermediate-germ development (Patel et al.
1994). Although both honeybees and Drosophila exhibit
long-germ development, it is not clear if this form of
development is similar by descent or whether it has been
independently derived in each lineage.
The morphology of honeybee embryogenesis is well
studied (for example, Nelson 1915; DuPraw 1967; Fleig
and Sander 1986), allowing gene expression patterns to be
interpreted in the light of well-characterised stages of development. In addition, the honeybee genome has recently
been sequenced. Culture of honeybees is common practice,
embryos are easy to obtain in large quantities and techniques are available for studying honeybee development
(Beye et al. 2002; Osborne and Dearden 2005). Molecular
studies of honeybee development have examined the expression of even-skipped (Binner and Sander 1997) and
engrailed-like proteins during segmentation (Fleig 1990;
Beye et al. 2002) and Hox gene expression (Walldorf et al.
2000).
One important set of genes regulating segmentation in
arthropods are the Pax group III genes (PGIII). In Drosophila, these genes include the pair-rule gene paired (prd)
and related genes gooseberry (gsb) (a segment polarity
gene) and gooseberry-neuro (gsb-n) (involved in neural
development) (Gutjahr et al. 1993a,b). All of these genes
encode transcription factors with two DNA binding motifs:
a paired domain and a homeodomain (Breitling and Gerber
2000). These genes have been examined in a number of
arthropods, and their expression demonstrates both underlying similarities in the segmentation gene cascade of
arthropods and also modifications of the cascade in arthropods with different germ types (Davis et al. 2001; Dearden
et al. 2002). An antibody raised against all Drosophila
PGIII genes cross-reacts in Tribolium and indicates that at
least one PGIII gene is expressed in a pair-rule manner, but
that its expression is deployed in an anterior to posterior
progression, reflecting the intermediate germ development
of this species (Davis et al. 2001). In Schistocerca, two
PGIII genes [pairberry1 (pby1) and pby2] are expressed in
a pattern consistent with pair-rule patterning but reflecting
the short-germ nature of Schistocerca development (Davis
et al. 2001). We have used the expression of the PGIII
genes as a marker for pair-rule and segment polarity patterning in the honeybee.
Materials and methods
Molecular cloning
The honeybee genes Ampaired (Amprd), Amgooseberry1
(Amgsb1) and Amgooseberry2 (Amgsb2) were located in
the honeybee genome sequence using tBLASTn align-
ments (Altschul et al. 1990) using the Drosophila protein
sequences from paired (prd), gooseberry (gsb) and gooseberry-neuro (gsb-n). Contigs containing the genes were
downloaded from the honeybee genome project, and intron/exon structure was predicted in order to determine the
coding sequence. These predictions were initially carried
out using the GeneMachine server (Makalowska et al.
2001) by pairwise comparisons with Drosophila PGIII
genes. Subsequently, the predicted genes were compared to
automated predictions of honeybee genes using gnomon
(NCBI). Intron/exon structures were drawn using GenePalette (Rebeiz and Posakony 2004).
Parts of these predictions (including the paired domain
and the homeodomain) were confirmed by RT-PCR. Poly
A+RNA was extracted from mixed stages of embryos using
an mTRAP midi kit (Active Motif). cDNA was transcribed
from poly A+RNA using Superscript II reverse transcriptase (Invitrogen), and RT-PCR was conducted using the
following primer pairs:
[Am-prd RNA 5′ ATGACGGTGACCACTAACTTC
TCG; Am-prd RNA 3′ CAACTGCTTTCTCAGCCT
CGC]:
[Am-prd RNA2 5′ CAAGGACGCGTCAATCAAC
TC; Am-prd RNA2 3′ CAACTGCTTTCTCAGCCT
CGC]:
[Am-gsb1 RNA 5′ GTGTGAATCAACTTGGAGGGG;
Am-gsb1RNA 3′ GTTTGCGAAGCCTTGCTCGCC]:
[Am-gsb2 RNA 5′ GGACAGGGACGTATGAATC;
Am-gsb2 RNA 3′ CACTTGGATCCTTGCTTCCG].
PCR products were cloned into pGEM-T Easy vector
(Promega). Plasmids with appropriately sized inserts were
extracted from bacterial cultures with the QIAprep Spin
miniprep kit (Qiagen) and were sequenced using ABI Big
Dye 3 chemistry and an ABI377 DNA sequencer.
Phylogenetic analysis
Phylogenetic analysis was conducted on predicted honeybee protein sequences and pax protein sequences downloaded from NCBI. The paired box regions of these genes
were aligned using CLUSTALX (Thompson et al. 1994).
Parsimony and distance analysis was performed using
PAUP4.0 b10 (Swofford 1998), with missing characters
defined as extra characters for the parsimony analysis. Maximum likelihood analysis was performed using PHYLIP
(Felsenstein 2004). The alignment was first bootstrapped
(100 times with the input order scrambled once per bootstrap) using SEQBOOT, and then phylogenetics was performed using PROML. Majority rule (extended) consensus
trees were identified using CONSENSUS. Maximum likelihood quartet puzzling was performed using TREEPUZZLE 5.0 (Strimmer and von Haeseler 1996). Trees were
drawn using TREEVIEW (Page 1996).
In situ hybridisation
Honeybee embryos were collected, prepared and stained as
described previously (Osborne and Dearden 2005). Probes
for in situ hybridisation were produced using run-off transcription from fragments of Amprd, Amgsb1 and Amgb2
measuring 857, 813 and 627 bp, respectively. Honeybee
embryos, stained for a gene of interest, were incubated in
1 μg/ml DAPI in PBS+0.1% Tween 20 for 1 h and destained in PBS+0.1% Tween 20 for 15 min. Embryos were
mounted in glycerol and observed with bright field optics
(alkaline phosphatase staining) or using incident light with
a filter for DAPI, on an Olympus BX51 upright microscope. Images were captured using a Magnafire (Optronics) digital camera and Magnafire software.
Immunohistochemistry
Expression of honeybee engrailed-like proteins were examined using the 4D9 cross-reacting antibody (Patel et al.
1989a,b) after in situ hybridisation. Embryos were washed
with PBS+0.1% Triton X-100, placed in 0.01 M sodium
citrate, pH 6, and incubated in a boiling water bath for 1 h.
Embryos were then immunostained using the protocol of
Patel et al. (1994). Primary antibody was used at a 1:1
dilution and the secondary antibody, goat α-mouse-HRP
(Jackson Immunochemicals), at 1:300. HRP was detected
using DAB (Sigma). Embryos were mounted and imaged
in 70% ultrapure glycerol.
Results
Sequence analysis
We isolated three homologues of the PGIII subgroup of pax
genes from the honeybee. tBLASTn searches (Altschul
et al. 1990) indicate that these three sequences are the only
PGIII gene homologues in version 1.2 of the honeybee
genome. Reciprocal blast searches with the three Drosophila PGIII homologues imply that the three genes isolated
are homologues of paired, gooseberry and gooseberryneuro. We have named these genes Ampaired (Amprd),
Amgooseberry1 (Amgsb1) and Amgooseberry2 (Amgsb2).
Examination of the honeybee genome assembly (Fig. 1a)
indicates that Amgsb1 and Amgsb2 are tandemly duplicated
(on an unplaced contig) approximately 40 kb from each
other, and the Amprd sequence is located in linkage group
14. The Drosophila gooseberry genes are organized in a
similar fashion to those of honeybees with the two genes
spaced 10 kb apart on chromosome 2R. The honeybee gsb
genes are transcribed in the same direction, whereas the
Drosophila homologues are transcribed in opposite directions. RT-PCR analysis indicates that the automated
gnomon gene predictions (NCBI) for both the Amprd
(hmm2453) and Amgsb1 (hmm3865) genes (Fig. 1a) are not
accurate. The first exon of Amprd is further downstream
than predicted, and one of the middle exons of Amgsb1 is
absent from the automated prediction. In addition, we have
predicted a different 5′ end to Amgsb2 (hmm3866).
To understand the evolution of these genes in holometabolous insects, we also examined the Anopheles genome
(Build 2, version 1) for PGIII genes. In Anopheles, only
two PGIII genes could be found: ENSANGG00000020676
(Agpax3/7-1) and ENSANGG00000020689 (Agpax3/7-2).
These genes are found closely linked on chromosome 3
(25 kb apart) and are transcribed in opposing directions
(Fig. 1a,ii). We examined the flanking genes in this region
to determine if they were similar to those surrounding the
linked gooseberry genes in Drosophila. In Drosophila, the
two gooseberry genes, on chromosome 2, are bounded by
goliath (Gol), flanking gsb and Neuropeptide-like precursor 1 (Nlnp1), flanking Gsb-n. In Anopheles, homologues
of these two genes flank Agpax3/7-1 and Agpax3/7-2.
Aggoliath (ENSANGG00000013591) is located next to
Agpax3/7-1 [separated by a predicted gene encoding a
protein with weak similarity to microtubule-associated proteins (ENSANGG00000013707)] and AgNeuropeptide-like
precursor 1 (ENSANGG00000020699) next to Agpax3/7-2
[separated by two predicted genes encoding peritrophinlike proteins (ENSANGG00000013661 and ENSANGG00
000020716)] (Fig. 1a,ii). The contig that contains honeybee
Amgsb1 and Amgsb2 contains only one other predicted
gene (hmm3867), which has some similarity to Nlnp1 and
is located next to Amgsb2 (Fig. 1a,i). No predicted genes
with strong similarities to gol are present in the current
version of the honeybee genome.
Phylogenetic analysis was performed from an alignment
of the isolated sequences and pax gene homologues for
other species (data not shown). The phylogenetic relationship of Amprd, Amgsb1 and Amgsb2 compared with the
other pax genes indicates that they fall into the PGIII
category (Davis et al. 2001; Dearden et al. 2002).
To understand the relationship between insect PGIII
genes, phylogenetic analysis was carried out on a multiple
protein alignment of the paired domain of arthropod PGIII
(Fig. 1b) proteins rooted with mouse and human pax3 and
pax7 sequences. To infer some relationships between these
genes, four methods of phylogenetic analysis, parsimony,
distance, maximum likelihood and maximum likelihood
quartet puzzling, were carried out (Fig. 1c). In all analyses,
human and mouse pax genes formed a separate clade. The
chelicerate sequence Tetranychus urticae Pax3/7 appeared
basal to insect sequences (except in the parsimony tree).
The relationship of the insect PGIII genes was the most
difficult to interpret, with the distance tree showing no
resolution of these sequences. The other techniques gave
better resolution, but bootstrap values are low. This difficulty is explained by the lack of significant sequence
variation in the paired domain, but the analysis is not improved by inclusion of the homeobox domain or linker
region of the sequences (data not shown).
The placement of the Schistocerca americana pairberry
sequences is consistent in most analyses. These two genes
do not show strong relationships with either paired or
gooseberry genes. The relationships of the holometabolous
Fig. 1 Phylogenetic and bioinformatic analyses of honeybee
PGIII genes. a Predicted gene
arrangements of the gooseberry
locus and flanking genes from
(i) honeybee, (ii) Anopheles
gambiae (with three predicted
genes removed for clarity; see
text) and (iii) Drosophila
melanogaster. b Multiple protein alignment of the paired and
homeodomains of PGIII proteins from D. melanogaster (Dm
prd, Dm gsb-n and Dm gsb),
Schistocerca americana (Sa
pby1 and Sa pby2) and Tetranychus urticae (Tu pax3/7)
compared with honeybee PGIII
proteins (Am prd, Am gsb1 and
Am gsb2). c Results of phylogenetic analyses of the paired
domain of PGIII proteins. Each
tree is rooted with mouse and
human pax3 and pax7. (i) Distance cladogram; (ii) maximum
likelihood cladogram; (iii) parsimony cladogram; and (iv)
maximum likelihood quartet
puzzling. Details of phylogeny
reconstruction are in Materials
and methods
pax3/7 genes, however, cannot be determined from these
analyses.
Amprd expression
Expression of the Amprd gene was examined using in situ
hybridisation. Amprd RNA is first expressed at stages 4 and
5 [25–33 h after egg laying (AEL)] (DuPraw 1967), in a
broad stripe of cells, without well-defined boundaries,
approximately a third of the way from the anterior of the
embryo (Fig. 2a). Unlike Drosophila (Gutjahr et al. 1993a)
and Tribolium (Davis et al. 2001), there is no anterior
expression prior to the formation of this first stripe. Before
the onset of stage 6 (approximately 33 h AEL), this initial
stripe of cells refines its expression into a sickle shape
patch of cells that is wider at the ventral end (Fig. 2b,c). By
examining the later morphology of the embryo in relation
to the late stripes of Amprd RNA, we can determine that
this initial stripe is in the presumptive mandibular segment.
As development proceeds, this initial stripe is joined by a
broad stripe of Amprd-expressing cells just posterior to the
mandibular stripe. This ‘primary’ stripe of Amprd-expressing cells splits into two thinner (secondary) stripes, as a
second primary stripe forms posterior to it. Splitting occurs
by a reduction of Amprd RNA expression in cells in the
center of the primary stripe. This pattern continues down
the embryo with a primary stripe forming and beginning to
Fig. 2 Expression of Amprd RNA in honeybee embryos detected
using in situ hybridisation. a–f Bright-field images of embryos
between stages 4 and 8; arrows indicate the presumptive mandibular
segment where known. g–l Fluorescent images of the same embryos
stained with DAPI to indicate developmental stage. m–p Brightfield images of embryos between stages 8 and 9. Scale bars indicate
100 μm. All embryos, unless otherwise stated, are oriented with
anterior to the left and dorsal up. a Embryo showing initial Amprd
RNA expression, with one stripe of cells in the mandibular segment.
This is rapidly joined by a primary stripe of Amprd just posterior to
it, which splits as a second primary stripe (marked with asterisk in
B) appears in more posterior regions (b). This pattern continues
down the embryo, with broad primary bands appearing and splitting
into secondary bands (c) as the first signs of gastrulation occur (d
and j) (asterisk marks the youngest Amprd primary stripe). As
gastrulation proceeds (e, k, f, l), Amprd expression is lost from the
most anterior secondary stripes in anterior to posterior order. By
mid-late stage 8 (m, embryo viewed on the ventral surface), all but
the most posterior secondary stripes of Amprd have been lost, and
expression domains appear in the mandibular, first maxillary and
second maxillary lobes (asterisked in m, n and p). Arrow marks T1
segment in m, n and p. These patterns refine through stage 9 (n,
ventral view) when single cells (arrowed) in the central nervous
system in each segment also express Amprd RNA (o, ventral view).
By late stage 9, Amprd RNA is also found in the labrum (arrowhead
in p, ventral view)
split as the next primary stripe forms (Fig. 2b–d). By the
end of stage 5, five primary stripes of Amprd have formed,
two of which have already completely split into secondary
stripes (Fig. 2c). Early in stage 6, three primary stripes have
resolved into secondary stripes with the fourth beginning to
split (Fig. 2d). As development continues, the final stripes
form at the posterior of the embryo.
By mid-stage 6, a total of 15 secondary stripes of cells
expressing Amprd have appeared along the A/P axis. These
stripes do not extend to the dorsalmost cells of the embryo,
unlike the full circumferential rings of Drosophila (Gutjahr
et al. 1993a). As the last two stripes form, the stripes of
Amprd RNA begin to fade in the same anterior to posterior
order that they formed (Fig. 2e,f).
Prior to the loss of the final Amprd stripes, a second
phase of expression begins in the pro-cephalon. This expression begins in mid-late stage 8 (about 47 h AEL) with
domains of Amprd RNA expression appearing in the mandibular lobe, the medial side of the first maxilla and weakly
in cells in the second maxilla (Fig. 2m). At stage 9 (approximately 48 h), the expression domains in the mandible
and first maxilla reduce in size, but expression levels become higher and more sharply demarcated in all three
domains (Fig. 2n). At this point, there is also expression in
a single cell in the CNS on either side of the midline at the
posterior of every segment (Fig. 2o). At this time, another
domain of expression is established in the labrum. This
expression is initially very weak but increases until four
small distinct groups of cells express Amprd (arrowhead in
Fig. 2p). The expression of Amprd in the head continues
throughout stage 9 and into stage 10 (60 h AEL).
Amgsb1 expression
Amgsb1 RNA expression first appears during late stage 5
as two stripes of cells in the presumptive mandibular and
first maxillary segment (Fig. 3a, asterisks). Very rapidly,
stripes of cells in the presumptive second maxillary (asterisk in Fig. 3b) and first thoracic segments then begin to
express Amgsb1. Initially, the stripe in the second maxillary
segment appears much fainter than those in the first maxillary and first thoracic, but expression levels quickly become similar in each stripe. Stripes of cells then begin to
express Amgsb1 in anterior to posterior order in each segment, during the closure of the ventral ectoderm over the
mesoderm (Fig. 3c–f). Stripes form in each segment, are
broader at the ventral surface, narrow towards the dorsal
regions of the embryo and are restricted to the ectoderm.
Fig. 3 Expression of Amgsb1 RNA in honeybee embryos detected
using in situ hybridisation. Scale bars denote 100 μm. Amgsb1 RNA
expression first appears at stage 5 in two stripes of cells in the
presumptive mandibular and first maxillary segments (a, arrows
denote damage to the posterior of the embryo). Stripes then appear
in the second maxillary segment and the first thoracic segment (b,
asterisk indicates faint stripe in the second maxillary segment; arrows indicate damaged areas of the embryo). During stage 6, Amgsb1
RNA appears in stripes of cells in the ectoderm (c, lateral view).
Stripes appear in anterior to posterior sequence as the ectodermal
plates close over the mesoderm (d ventral view; e, f ventral views).
g, h Ventral and lateral views, respectively, of embryos in stage 7
showing the Amgsb RNA expression domains becoming restricted to
the central nervous system. In stages 8 and 9 (i, j ventral views),
Amgsb1 expression is restricted to the CNS and a domain between the
gnathum and thorax (asterisk in i and j)
As the ectodermal plates fuse, the level of Amgsb1 RNA
expression in each stripe of cells increases, but the domains
become restricted to more ventral regions. This continues
throughout stages 7 and 8, after the ectoderm plates have
fully fused (Fig. 3g,h). During this phase, there is also a
patch of Amgsb1 expressing cells in the protocerebrum. As
the stripes of cells lose expression, Amgsb1 becomes restricted to the CNS (Fig. 3i,j). This is maintained throughout stage 9 when Amgsb1 expression also appears in cells
located between the first thoracic and second maxillary
segments (asterisks in Fig. 3i,j).
also appears in cells located between the first thoracic and
second maxillary segments (asterisks in Fig. 4c,d).
Amgsb2 expression
Expression of Amgsb2 RNA appears later in development
than that of Amgsb1, beginning during stage 7. Initially,
expression appears in segmentally reiterated stripes of cells
along the ventral surface of the embryo (Fig. 4a). These
stripes appear simultaneously and do not extend laterally as
far as the Amgsb1 stripes. In stage 8, these stripes of cells
become restricted to the ventral midline (Fig. 4b). Through
late stage 8 and stage 9, the expression of Amgsb2 RNA
becomes further restricted to neurectoderm cells in the
posterior of each segment (Fig. 4c,d). Amgsb2 expression
Detection of honeybee engrailed-like proteins
and Amprd, Amgsb and Amgsb2 RNA
Expression of honeybee engrailed-like proteins was examined with the cross-reacting antibody 4D9 (Patel et al.
1989a,b). It is not clear which of the two engrailed gene
protein products (Walldorf et al. 1989) or if both are recognised by the 4D9 antibody, but they have similar expression patterns (data not shown). The expression of 4D9
cross-reactivity has already been studied in honeybees
(Fleig 1990). Stripes of cells expressing engrailed-like proteins appear in the gnathum and thorax simultaneously,
with pair-rule modulation, and in anterior to posterior sequence in the abdomen during gastrulation. Initially, these
stripes are expressed across the prospective mesoderm but,
as the gastrulation furrow moves posteriorly, immunoreactivity becomes restricted to the ectoderm (Fleig 1990).
Double staining for engrailed-like proteins and Amprd
RNA was made difficult due to the stripes of cells expressing engrailed-like appearing when most of the Amprd
stripes have disappeared. The two genes’ expression, how-
Fig. 4 Expression of Amgsb2 RNA in honeybee embryos detected
with in situ hybridisation. Scale bars represent 100 μm; embryos are
oriented with anterior to the left, looking down on the ventral surface. a Stage 7 embryo showing the initial stages of Amgsb2 expression in stripes of cells across the ventral surface of the embryo;
these stripes become restricted to around the ventral midline in stage
8 (b), and Amgsb2 RNA expression becomes restricted to cells in the
neurectoderm in late stage 8 and stage 9 (c and d, respectively).
RNA expression is also seen in a domain similar to that of Amgsb1
at the boundary between the gnathum and the thorax (asterisks in c
and d)
ever, overlap by one to two cells (Fig. 5a) for a short time
before the Amprd stripes fade. Amgsb1 and Amgsb2 expression was easier to co-visualise with engrailed-like, as
the latter’s expression stabilises after the ectoderm plates
have closed. Engrailed-like expression overlaps both Amgsb1
(Fig. 5b) and Amgsb2 expressions (Fig. 5c) by one to two
cell rows. This overlap implies that Amprd, Amgsb1 and
Amgsb2 are expressed in the same cells and may have a
role in demarcating the parasegment boundaries in honeybees. Overlapping expression domains of engrailed-like
and PGIII genes are observed in Drosophila, Tribolium and
Schistocerca (Gutjahr et al. 1993a,b; Davis et al. 2001).
Discussion
Evolution of holometabolous PGIII genes
We have identified three PGIII genes in the honeybee and
examined their relationships and expression. We have also
Fig. 5 Double staining for honeybee engrailed-like proteins and
Amprd, Amgsb1 and Amgsb2 RNA. Scale bars represent 50 μm;
embryos are oriented with anterior to the left. a Double staining for
Amprd RNA (blue) and engrailed-like proteins (brown) in a stage 6
honeybee embryo, lateral view. At this stage, secondary stripes of
Amprd are disappearing as engrailed-like protein expression appears.
Arrows indicate cells expressing both Amprd and engrailed-like.
Amprd expressing cells form a stripe anterior to but overlapping by
one to two cell rows the stripes of engrailed-like expression. b Dual
labelling of Amgsb1 RNA (blue) and engrailed-like proteins (brown)
in a stage 8 embryo (ventral view of thoracic regions). Arrows
indicate groups of cells expressing both Amgsb1 and engrailed-like.
The Amgsb1 RNA expression domain lies just anterior to the stripe
of engrailed-like expressing cells and overlaps with it by one to two
cell rows. c Dual labelling of Amgsb2 RNA (blue) and engrailed-like
proteins (brown) in a stage 8 embryo (ventral view of gnathal
regions). The Amgsb2 expression domain lies anterior to the stripe
of engrailed-like expressing cells and overlaps it by one cell row
(arrows indicate cells expression both Amgsb2 and engrailed-like)
examined PGIII gene sequences in the Anopheles genome.
Little sequence difference exists between PGIII genes in
the holometabolous insects, making phylogenetics with
these sequences difficult. Using four methods of phylogeny
reconstruction, we have been unable to assign orthology
between the holometabolous PGIII genes.
The expression pattern and genomic location of Drosophila paired and Amprd provide better evidence of orthology. Both are located in a genomic area distant from
the two gsb genes, both are the earliest expressed genes of
the PGIII group and both appear to act as pair-rule genes.
Due to these similarities, we believe that we are justified
in naming this gene Amprd, to reflect its similarities to
paired, rather than naming all the honeybee genes ‘pairberry genes’ as has been done for Schistocerca (Davis
et al. 2001) and spiders (Schoppmeier and Damen 2005).
The gooseberry genes of Apis, Drosophila and the PGIII
genes of Anopheles are closely related and tend to come out
in the phylogenetic analyses together. These genes are
linked in all three species, and the chromosomal regions
they lie in have similar genes surrounding them. This
implies that the Anopheles genes are gooseberry homo-
logues, and that this species is lacking a ‘paired’ gene.
These findings further imply that gooseberry genes are
descended from an ancestral gooseberry gene created by a
duplication of a ‘pairberry’ gene before the divergence of
the holometabolous insects. Specific relationships between
each gooseberry gene cannot be identified, perhaps indicating that these genes were independently duplicated after
the holometabolous divergence. Because of this inability to
assign homology between specific gooseberry genes, we
have designated the honeybee gooseberry genes Amgsb1
and Amgsb2 to avoid implying any specific orthology
between these genes and any specific gooseberry gene in
Drosophila or Anopheles.
The relationship between the paired/gsb genes of holometabolous insects with the pairberry genes of Schistocerca (Davis et al. 2001) is also unclear. The expression
pattern of both pairberry genes, as assayed by a crossreacting antibody, encompasses the expression pattern of
prd and both gsb genes in honeybees and Drosophila, but
the pairberry genes do not cluster strongly with either prd
or gsb type genes in the phylogenetic analysis. This probably indicates that the two pairberry genes are a separate
duplication of an ancestral PGIII gene in insects that also
gave rise to prd and the gsb genes. The evolution of PGIII
genes in insects appears to be complex, with a number of
independent duplications in various lineages leading to
subdivision of the expression pattern and activity of an
ancestral PGIII gene.
Honeybee segmentation
The expression of PGIII genes in the honeybee gives
insight into two phases of the segmentation gene cascade.
In Drosophila, PGIII genes are involved in both pair-rule
patterning and the segment polarity system (Gutjahr et al.
1993a,b; Davis et al. 2001). The expression patterns of
PGIII genes in the honeybee indicate a similar range of
function (Fig. 6).
Pair-rule patterning seems to be a conserved process in
insects as evidence for pair-rule patterning has been observed in Diptera (Nüsslein-Volhard and Wieschaus 1980),
Coleoptera (Brown et al. 1994, 1997; Patel et al. 1994;
Maderspacher et al. 1998; Schröder et al. 1999; Davis et al.
2001) and Orthoptera (Davis et al. 2001). The question of
the presence of pair-rule patterning outside the insects is yet
to be resolved (Dearden et al. 2002; Davis and Patel 2003;
Chipman et al. 2004; Schoppmeier and Damen 2005).
In honeybees, Amprd expression, and expression of an
even-skipped protein recognised by the 2B8 cross-reacting antibody (Binner and Sander 1997), shows two segment
periodicity, indicating that pair-rule patterning plays a role
in honeybee segmentation.
In honeybees, the first expression of Amprd is in a stripe
of cells in the mandibular segment, similar to Drosophila
and Tribolium PGIII expression (Davis et al. 2001) (Fig. 6).
Primary pair-rule stripes then appear and split in anterior to
posterior sequence. The phasing of the primary stripes of
Amprd is identical to that of prd in Drosophila (Gutjahr
Fig. 6 Summary cartoon of PGIII gene expression during segmentation in the honeybee. Expression patterns of PGIII genes are
compared with that of engrailed-like genes at representative times
during four stages of embryogenesis, from the ventral surface of the
embryos. All of the PGIII genes are expressed across the putative
parasegment boundary (horizontal lines), as implied by their expression domains overlapping that of engrailed-like genes. a Amprd
(blue) and engrailed-like (green) expression. In stage 4, expression
is present in a mandibular stripe and, in late stage 4, a primary stripe
in both first and second maxillae. In stage 5, primary stripes of
Amprd form and split in anterior–posterior sequence. In stage 6,
during gastrulation (shown by vertical lines), Amprd expression
disappears forming stripes in anterior to posterior progression, overlapping with the beginnings of engrailed-like expression (stripes
forming in anterior–posterior sequence in the abdomen) by a few
stripes. Amprd is not expressed in stripes in stage 7. b Amgsb1 (red)
and engrailed-like (green) expression during segmentation. Amgsb1
expression first appears in stripes that do not include the ventralmost regions of the embryo, in stage 5, forming in anterior to posterior sequence. All segments form stripes in stage 6, overlapping by
a few cells with engrailed-like expression. Neither engrailed-like nor
Amgsb1 are expressed in the ventral, invaginating, regions of the
embryo. By stage 7, Amgsb1 expression is restricted to the CNS.
c Amgsb2 (purple) and engrailed-like expression (green). Amgsb2
expression does not appear until stage 7, when it is expressed in
all segments in a stripe of cells in the CNS, overlapping by one
to two cells with the domain of engrailed-like expression
et al. 1993a) and Tribolium (Davis et al. 2001). The first
stripe to form is in the mandibular segment, and this stripe
does not split. A primary stripe then forms in the first and
second maxillary segments, the first and second thoracic
segments and so on down the germband (Fig. 6). The major
difference between the expression of Amprd in honeybees
and prd in Drosophila is that the primary stripes of Amprd
split into secondary stripes soon after they have formed,
in anterior–posterior sequence, whilst in Drosophila, all
of the primary stripes form before splitting occurs (Gutjahr
et al. 1993a).
The expression pattern of Amprd implies that the segmentation mechanism of honeybees is temporally modulated in an anterior to posterior manner, a modulation not
seen in the expression patterns of most segmentation genes
in Drosophila. Indeed, all of the segmentation genes examined thus far in Apis, apart from Amgsb2, from both the
pair-rule and segment polarity phases of segmentation,
show this temporal regulation. This implies that temporal
regulation plays a major role in the molecular control of
segmentation in this long-germ insect.
In Drosophila, paired regulates gooseberry which in
turn transactivates gooseberry-neuro (Gutjahr et al. 1993b;
Li and Noll 1993). While deletions of each of these genes
can be rescued by one of the other genes, their different
temporal expression gives them unique functions (Li and
Noll 1994). One of the main functions of these three genes
is to regulate engrailed and thereby the parasegment
boundary (Gutjahr et al. 1993b; Li and Noll 1993; DumanScheel et al. 1997). Double labelling embryos for any of the
honeybee PGIII genes and engrailed-like proteins indicate
that PGIII expression overlaps with engrailed-like by one
to two cell rows as they do in Drosophila. This implies that
Amprd, Amgsb1 and Amgsb2 probably have functions
similar to their Drosophila homologues, despite having
slightly modified expression patterns.
Evolution of long germband segmentation
A. mellifera, like Drosophila, is a long-germ insect, with all
of the body regions of the embryo represented in the
blastoderm, but it is not known if these two forms of longgerm development are independent derivations from an
intermediate germ ancestor. Studies of the expression
patterns of PGIII genes (this study) and previous studies of
engrailed-like (Fleig 1990) and even-skipped (Binner and
Sander 1997) expression in the honeybee indicate that,
unlike Drosophila, much of the segmentation cascade is
modulated by anterior–posterior temporal control.
Two scenarios may explain this difference. It is possible
that Apis segmentation represents a form of segmentation
intermediate between the long-germ development of Drosophila and the intermediate germ development proposed
for the ancestor of holometabolous insects, perhaps similar
to that of Tribolium. The evolution of the derived Drosophila form of development would thus be characterised
by loss of temporal modulation of segmentation.
The other scenario is that Apis segmentation represents
an independent derivation of long germband segmentation,
in which temporal modulation plays a major role in the
molecular control of segmentation. This scenario is supported by recent molecular phylogenies of holometabolous
insects that indicate that Hymenoptera are not the sister
group of Diptera and groups of holometabola with intermediate germband development are closer relatives of the
Diptera (Whiting 2002; Krauss et al. 2004; Philippe et al.
2005).
To determine which of these scenarios is accurate, it will
be necessary to investigate in detail the molecular control
of segmentation in both Apis and Tribolium and, in particular, to determine which characters are ancestral and
which are derived. Clearly, the Drosophila mode of segmentation is not the only way to produce a long-germ embryo. Identification of the molecular basis of the temporal
modulation of segmentation in short germ, intermediate
germ and Apis will be particularly important to the understanding of the evolution of segmentation mechanisms.
Acknowledgements The authors would like to thank Elaine
Emmerson for technical support and Melanie Havler, Hanna Leslie
and Victoria Dearden for critical readings of this manuscript. The
anti-engrailed monoclonal antibody developed by Corey Goodman
was obtained from the Developmental Studies Hybridoma Bank
developed under the auspices of the NICHD and maintained by The
University of Iowa, Department of Biological Sciences, Iowa City,
IA 52242. This work was supported by a University of Otago
Research Grant and a Royal Society of New Zealand Marsden fund
Grant (UOO0401).
References
Altschul S, Gish W et al (1990) Basic local alignment search tool. J
Mol Biol 215(3):403–410
Beye M, Hartel S et al (2002) Specific developmental gene silencing
in the honey bee using a homeobox motif. Insect Mol Biol 11
(6):527–532
Binner P, Sander K (1997) Pair-rule patterning in the honeybee Apis
mellifera; expression of even-skipped combines traits known
from beetles and fruitfly. Dev Genes Evol 206:447–454
Breitling R, Gerber JK (2000) Origin of the paired domain. Dev
Genes Evol 210(12):644–650
Brown SJ, Hilgenfeld RB et al (1994) The beetle Tribolium castaneum has a fushi tarazu homolog expressed in stripes during
segmentation. Proc Natl Acad Sci U S A 91(26):12922–12926
Brown SJ, Parrish JK et al (1997) Molecular characterization and
embryonic expression of the even-skipped ortholog of Tribolium castaneum. Mech Dev 61(1–2):165–173
Chipman AD, Arthur W et al (2004) A double segment periodicity
underlies segment generation in centipede development. Curr
Biol 14(14):1250–1255
Davis GK, Patel NH (2002) Short, long, and beyond: molecular and
embryological approaches to insect segmentation. Annu Rev
Entomol 47:669–699
Davis GK, Patel NH (2003) Playing by pair-rules? BioEssays 25
(5):425–429
Davis GK, Jaramillo CA et al (2001) Pax group III genes and the
evolution of insect pair rule patterning. Development 128(18):
3445–3458
Dearden P, Donly C et al (2002) Expression of pair-rule gene
homologues in a chelicerate: early patterning of the two-spotted
spider mite Tetranychus urticae. Development 129(23):5461–
5472
Duman-Scheel M, Li X et al (1997) Genetic separation of the neural
and cuticular patterning functions of gooseberry. Development
124(15):2855–2865
DuPraw EJ (1967) The honeybee embryo. In: FH Wilt, NK Wessells
(eds) Methods in developmental biology. Thomas Y Cromwell
Company, New York, pp 183–217
Felsenstein J (2004) PHYLIP (Phylogeny Inference Package)
version 3.6
Fleig R (1990) Engrailed expression and body segmentation in the
honeybee, Apis mellifera. Roux’s Arch Dev Biol 198:467–473
Fleig R, Sander K (1986) Embryogenesis of the honeybee Apis
mellifera L. (Hymenoptera: Apidae): an SEM study. Int J Inst
Morphol Embryol 15(5):449–462
Gutjahr T, Frei E et al (1993a) Complex regulation of early paired
expression: initial activation by gap genes and pattern modulation by pair-rule genes. Development 117:609–623
Gutjahr T, Patel NH et al (1993b) Analysis of the gooseberry locus
in Drosophila embryos: gooseberry determines the cuticular
pattern and activates gooseberry neuro. Development 118
(1):21–31
Hennig W (1981) Insect phylogeny. Wiley, Bath
Kjer KM (2004) Aligned 18S and insect phylogeny. Syst Biol 53
(3):506–514
Krauss V, Pecyna M et al (2004) Phylogenetic mapping of intron
positions: a case study of translation initiation factor eIF2γ.
Mol Biol Evol 22:74–84
Li X, Noll M (1993) Role of the gooseberry gene in Drosophila
embryos: maintenance of wingless expression by a wingless–
gooseberry autoregulatory loop. EMBO J 12(12):4499–4509
Li X, Noll M (1994) Evolution of distinct developmental functions
of three Drosophila genes by acquisition of different cisregulatory regions. Nature 367(6458):83–87
Maderspacher F, Bucher G et al (1998) Pair-rule and gap gene
mutants in the flour beetle Tribolium castenatum. Dev Genes
Evol 208:558–568
Makalowska I, Ryan JF et al (2001) GeneMachine: gene prediction
and sequence annotation. Bioinformatics 17(9):843–844
Nelson JA (1915) The embryology of the honeybee. Princeton
University Press, Princeton
Nüsslein-Volhard C, Wieschaus E (1980) Mutations affecting
segment number and polarity in Drosophila. Nature 287
(5785):795–801
Osborne P, Dearden PK (2005) Non-radioactive in situ hybridisation
to honeybees embryos and ovaries. Apidologie 36:113–118
Page RDM (1996) TREEVIEW: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12:
357–358
Patel NH, Kornberg TB et al (1989a) Expression of engrailed during
segmentation in grasshopper and crayfish. Development 107
(2):201–213
Patel NH, Martín-Blanco E et al (1989b) Expression of engrailed
proteins in arthropods, annelids, and chordates. Cell 58:955–
968
Patel NH, Condron BG et al (1994) Pair-rule expression patterns of
even-skipped are found in both short and long germ beetles.
Nature 367:429–434
Philippe H, Lartillo N, Brinkman H (2005) Multigene analyses of
Bilatarian animals corroborate the monophyly of Ecdysozoa,
Lophotrochozoa, and Protostomia. Mol Biol Evol 22:1246–
1253
Rebeiz M, Posakony JW (2004) GenePalette: a universal software
tool for genome sequence visualization and analysis. Dev Biol
271(2):431–438
Sander K (1976) Specification of the basic body pattern in insect
embryogenesis. Adv Insect Physiol 12:125–238
Schoppmeier M, Damen WGM (2005) Expression of Pax group III
genes suggests a single-segmental periodicity for opisthosomal
segment patterning in the spider Cupiennius salei. Evolut
Develop 7(2):160–169
Schröder R, Jay DG et al (1999) Elimination of EVE protein by
CALI in the short germ band insect Tribolium suggests a
conserved pair-rule function for even skipped. Mech Dev 80
(2):191–195
Strimmer K, von Haeseler A (1996) Quartet puzzling: a quartet
maximum-likelihood method for reconstructing tree topologies.
Mol Biol Evol 13(7):964–969
Swofford DL (1998) PAUP* Phylogenetic analysis using parsimony
(*and other methods). Sinauer Associates, Sunderland, MA
Thompson JD, Higgins DG et al (1994) CLUSTAL W: improving
the sensitivity of progressive multiple sequence alignment
through sequence weighting, positions-specific gap penalties
and weight matrix choice. Nucleic Acids Res 22:4673–4680
Walldorf U, Fleig R et al (1989) Comparison of homeoboxcontaining genes of the honeybee and Drosophila. Proc Natl
Acad Sci U S A 86(24):9971–9975
Walldorf U, Binner P et al (2000) Hox genes in the honey bee Apis
mellifera. Dev Genes Evol 210(10):483–492
Whiting MF (1998) Phylogenetic position of the Strepsiptera:
review of molecular and morphological evidence. Int J Insect
Morphol Embryol 27(1):53–60
Whiting MF (2002) Phylogeny of the holometabolous insect orders:
molecular evidence. Zool Scr 31(1):3–15
Whiting MF, Carpenter JC et al (1997) The Strepsiptera problem:
phylogeny of the holometabolous insect orders inferred from
18S and 28S ribosomal DNA sequences and morphology. Syst
Biol 46(1):1–68