Journal of Human Evolution 79 (2015) 55e63
Contents lists available at ScienceDirect
Journal of Human Evolution
journal homepage: www.elsevier.com/locate/jhevol
Insights into hominin phenotypic and dietary evolution from ancient
DNA sequence data
George H. Perry a, *, Logan Kistler a, Mary A. Kelaita b, Aaron J. Sams c
a
Departments of Anthropology and Biology, Pennsylvania State University, University Park, PA 16802, USA
Department of Anthropology, University of Texas at San Antonio, San Antonio, TX 78249, USA
c
Department of Biological Statistics and Computational Biology, Cornell University, Ithaca, NY 14853, USA
b
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 21 February 2014
Accepted 28 October 2014
Available online 3 January 2015
Nuclear genome sequence data from Neandertals, Denisovans, and archaic anatomically modern humans
can be used to complement our understanding of hominin evolutionary biology and ecology through i)
direct inference of archaic hominin phenotypes, ii) indirect inference of those phenotypes by identifying
the effects of previously-introgressed alleles still present among modern humans, or iii) determining the
evolutionary timing of relevant hominin-specific genetic changes. Here we review and reanalyze published Neandertal and Denisovan genome sequence data to illustrate an example of the third approach.
Specifically, we infer the timing of five human gene presence/absence changes that may be related to
particular hominin-specific dietary changes and discuss these results in the context of our broader reconstructions of hominin evolutionary ecology. We show that pseudogenizing (gene loss) mutations in
the TAS2R62 and TAS2R64 bitter taste receptor genes and the MYH16 masticatory myosin gene occurred
after the hominin-chimpanzee divergence but before the divergence of the human and Neandertal/
Denisovan lineages. The absence of a functional MYH16 protein may explain our relatively reduced jaw
muscles; this gene loss may have followed the adoption of cooking behavior. In contrast, salivary amylase
gene (AMY1) duplications were not observed in the Neandertal and Denisovan genomes, suggesting a
relatively recent origin for the AMY1 copy number gains that are observed in modern humans. Thus, if
earlier hominins were consuming large quantities of starch-rich underground storage organs, as previously hypothesized, then they were likely doing so without the digestive benefits of increased salivary
amylase production. Our most surprising result was the observation of a heterozygous mutation in the
first codon of the TAS2R38 bitter taste receptor gene in the Neandertal individual, which likely would
have resulted in a non-functional protein and inter-individual PTC (phenylthiocarbamide) taste sensitivity variation, as also observed in both humans and chimpanzees.
© 2014 Elsevier Ltd. All rights reserved.
Keywords:
Paleogenomics
Hominin evolutionary ecology
Gene content variation
Copy number variation
Ancient DNA-aided reconstruction of hominin evolutionary
biology and behavior
Nuclear DNA sequence data from individuals of extinct hominin
populations and species d and even archaic anatomically modern
human populations d can be used to complement our paleoanthropological and archaeological understandings of hominin
evolutionary biology and ecology. To date, high-coverage ancient
DNA complete nuclear genome sequence data from two archaic
hominin individuals have been published: i) a Neandertal (Homo
neanderthalensis) from Denisova Cave in the Siberian Altai
* Corresponding author.
E-mail address: [email protected] (G.H. Perry).
http://dx.doi.org/10.1016/j.jhevol.2014.10.018
0047-2484/© 2014 Elsevier Ltd. All rights reserved.
Mountains (~30x sequence coverage; Prüfer et al., 2014), and ii) a
representative of a not-yet named but putatively distinct hominin
population, herein referred to as a ‘Denisovan’ (~30x sequence
coverage; Meyer et al., 2012), whose existence has been inferred
through genomic sequence data recovered from a distal finger bone
and an upper molar that were also collected at the same Denisova
Cave site (Krause et al., 2010; Reich et al., 2010). Medium-to highcoverage DNA sequence data from nuclear gene coding regions only
(the ‘exome’) are also now available from an additional two
n Cave in Spain and one
Neandertal individuals, one from El Sidro
from Vindija Cave in Croatia (~12x and ~42x sequence coverage,
respectively; Castellano et al., 2014).
Excitingly for paleoanthropologists, the discovery of relatively
low levels of nuclear genome introgression from Neandertal and
Denisovan populations to a subset of surviving modern human
56
G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63
populations (Reich et al., 2010; Meyer et al., 2012; Prüfer et al.,
2014; Sankararaman et al., 2014; Vernot and Akey, 2014) provides
not only an opportunity to study archaic admixture and population
history, but also the ability to reconstruct major aspects of Neandertal and Denisovan biology in a relatively straightforward
manner. That is, we can now study modern human phenotypic and
genetic variation using genome wide association study (GWAS)
approaches for any originally introgressed genome segment that
remains in the modern human gene pool in order to infer the
biological characteristics of Neandertals and Denisovans. While the
value of this approach has been demonstrated on a case-by-case
basis, for example with potential light skin-associated alleles in
Neandertals (Vernot and Akey, 2014) and a high altitude-related
adaptation in Denisovans (Huerta-Sanchez et al., 2014), we expect
that anthropologists can look forward to the publication of much
more comprehensive analyses along these lines in the coming
years.
It is otherwise also possible, but considerably more difficult due
to the need for functional or experimental validation, to make
phenotypic inferences about Neandertals and Denisovans from the
direct study of their nuclear genome sequences. The best current
example is work on a Neandertal-specific melanocortin 1 receptor
(MC1R) gene variant that likely conferred light skin and red hair
phenotypes (Lalueza-Fox et al., 2007). A recent analysis identified a
significant enrichment for Neandertal-specific nonsynonymous
(amino acid-changing) substitutions within genes involved in
skeletal development, specifically lordotic curvature (Castellano
et al., 2014). The potential phenotypic consequences of these genetic changes have not yet been identified.
Finally, analyses of ancient DNA sequence data may benefit our
reconstructions of hominin evolutionary biology and behavior by
letting us infer the timing of relevant genetic changes that distinguish humans (Homo sapiens) from chimpanzees. Based on analyses of nuclear genome sequence data, Neandertals and
Denisovans are more closely related to each other than either is to
humans, with estimated Neandertal-Denisovan divergence of
~380 kya (thousands of years ago) and divergence of that lineage
from the human lineage of ~550e590 kya (Prüfer et al., 2014).
Medium-coverage ancient DNA nuclear genome sequence data
have also been published for anatomically modern humans dated
to ~12.6 kya from Montana, USA (~14x sequence coverage;
Rasmussen et al., 2014), ~4 kya from Greenland (~20x sequence
coverage; Rasmussen et al., 2010), ~7 kya and ~8 kya from Europe
(~19x and ~22x sequence coverage, respectively; Lazaridis et al.,
2014), with other nuclear genomes from similarly-dated or even
older modern human individuals published at lower coverage (e.g.,
Keller et al., 2012; Lazaridis et al., 2014; Olalde et al., 2014;
Raghavan et al., 2014). Thus, this particular approach has limited
resolution d we are presently only able to determine whether the
hominin-specific gene changes in question occurred prior to or
more recently than ~600 kya, or between this time and the relatively recent past. Yet, such analyses still have the potential to
provide insight into the timing of hominin phenotypic evolution
and behavioral ecology transitions.
Hominin dietary evolution
In this article, we illustrate the method and potential value of
the evolutionary timing approach through consideration of published ancient DNA nuclear genome sequence data for genes and
genetic changes with hypothesized relevance to outstanding
questions of hominin dietary evolution. A number of major dietary
transitions have occurred during the ~6 million years of hominin
evolution, including substantial increases in the consumption of
meat and starch, the cooking of food, and the domestication of
plants and animals (Wrangham and Conklin-Brittain, 2003; Ungar
et al., 2006; Luca et al., 2010). These transitions, in turn, are hypothesized to have played critical roles in other major aspects of
hominin evolution, including encephalization, molar size reduction, dispersals out of Africa, pair bonded social structure, and
sedentism (e.g., Leonard and Robertson, 1992; Aiello and Wheeler,
1995; Milton, 1999; Stanford, 1999; Wrangham et al., 1999; Mann,
2000; Diamond, 2002; Carmody and Wrangham, 2009;
Wrangham and Carmody, 2010). Therefore, understanding the nature and timing of these major dietary transitions is important for
our broader reconstruction of hominin evolutionary ecology.
However, with the exception of the agricultural transition, given
the rarity or absence of direct evidence from the hominin fossil
record there is considerable uncertainty d or even strong debate d
about the time periods during which these dietary shifts occurred
(de Heinzelin et al., 1999; Laden and Wrangham, 2005; Bunn, 2006;
McPherron et al., 2010; Roebroeks and Villa, 2011; Gowlett and
Wrangham, 2013).
The relationship between DNA sequence and phenotype is
relatively simple for some diet-related genes. This is due, at least in
part, to the specific functional roles of digestive enzymes and taste
receptors. Multiple diet-related gene presence/absence substitutions distinguish modern humans from chimpanzees; functional interpretations are made more readily for these molecular
differences than for individual nucleotide substitutions at nonsynonymous (amino acid changing) or regulatory sites. The timings
of associated phenotypic changes in our evolutionary history that
may inform our understanding of hominin dietary transitions are
thus readily interpretable through the analysis of ancient DNA
sequence data. Here we review or determine the evolutionary
timing of all non-olfactory receptor, hominin-specific diet-related
gene function gain and loss changes that are known to us, discuss
the potential significance of these results, and look forward to potential future extensions of this approach.
Diet-related gene losses in hominin evolution
First consider a gene whose functionality has been conserved
and maintained by purifying selection (i.e., functional constraint)
across most or all studied mammals, over hundreds of millions or
billions of years of combined evolutionary history, but then lost
sometime during hominin evolution. Based on our knowledge of
the single nucleotide and small insertion/deletion mutation rates
we can infer that potential gene inactivating mutations d those
that i) introduce a premature stop codon, ii) obliterate a critical
exon/intron splice site, iii) alter the start codon, or iv) result in a
coding sequence frameshift and thereby alter all downstream
amino acids d occur regularly (e.g., Yamaguchi-Kabata et al., 2008;
Yngvadottir et al., 2009; MacArthur and Tyler-Smith, 2010; MacArthur et al., 2012). Typically, functional gene loss via one of these
mutational mechanisms would be detrimental to individual fitness
and therefore the mutation would be removed from the population
by purifying natural selection. However, changes in an organism's
environment or behavior (or, possibly, compensatory evolution at
other genes) may obviate the function of the gene's encoded protein product or make it less critical to individual fitness, such that
pseudogenizing mutations may then increase in frequency and
become fixed in a population or species.
A good example of this phenomenon is the convergent functional loss of the blue opsin gene (OPN1SW) in many nocturnal
mammals, including some nocturnal primates, resulting in monochromatic vision (Jacobs et al., 1996; Tan et al., 2005; Bowmaker
and Hunt, 2006). Under this framework, if we have knowledge
about the function of a gene in question and can make inferences
about the environmental or behavioral changes that likely
G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63
preceded or were associated with its functional loss, then studies of
the timing of those gene losses can help to reconstruct the evolutionary and ecological history of a species in ways that complement
and extend information available through the fossil record.
We analyzed the Neandertal and Denisovan high-coverage
complete nuclear genome sequence data (Supplementary Online
Material [SOM]) to study the evolutionary history of four potential diet-related genes harboring hominin lineage-specific pseudogenizing substitutions or function-eliminating mutations:
MYH16, TAS2R62, TAS2R64, and TAS2R38. As an anatomically
modern human ancient DNA control, we assessed the mediumcoverage nuclear genome sequence data from the ~12.6 kya Montana individual using identical methods. The sarcomeric myosin
gene MYH16 is expressed specifically in the masticatory muscles of
non-human primates, but the full protein cannot be produced in
humans due to an invariant 2 bp (base pair) deletion in exon 18
that results in a frameshift of the downstream amino acid sequence
and a subsequent premature stop codon (Stedman et al., 2004).
Presumably as a result, temporalis muscle Type II fibers are
significantly smaller in humans than in macaques, and the loss of
this gene may at least partly explain the greatly reduced masticatory muscle apparatus in humans relative to other catarrhine primates (Stedman et al., 2004). We hypothesize that the functional
loss of a gene that otherwise encodes an important masticatory
muscle protein may very well have followed hominin control of fire
and the advent of consistent cooking behavior, which results in
substantial food softening and reduces demand on the masticatory
apparatus (Wrangham and Conklin-Brittain, 2003; Dominy et al.,
2008).
TAS2R62, TAS2R64, and TAS2R38 are bitter taste receptors. In
TAS2R62 and TAS2R64 there are two and one premature stop
codon mutations, respectively, that are observed among all
humans and are hominin-specific among studied primates,
although orangutans do have a different premature stop codon
mutation that likely also inactivates their TAS2R64 gene (Parry
et al., 2004; Go et al., 2005; Wang et al., 2006). To the best of
our knowledge, the specific bitter molecules targeted by the
functional versions of these receptors are not yet known. Such a
functional assessment would be of potential value for the reconstruction of hominin dietary evolution, because those TAS2R proteins possibly target substances that are common in the diets of
most or all great ape species but were absent from or less prevalent in the hominin environment or dietary intake over at least
part of our evolutionary history.
In contrast, the hominin-specific functional mutations in the
TAS2R38 gene are not fixed among humans, and they also do not
result in a true pseudogene. Rather, there is a common haplotype at
this gene containing nonsynonymous mutations corresponding to
amino acid positions 49, 262, and 296. The protein encoded by the
ancestral haplotype responds to the bitter compound phenylthiocarbamide (PTC), whereas that encoded by the derived haplotype
does not (Bufe et al., 2005). The functional variation at this locus
explains the majority of human phenotypic variance in PTC sensitivity (Kim et al., 2003). The two functional haplotypes are both
observed at intermediate frequencies in human populations and
are associated with a pattern of genetic variation that suggests a
history of balancing selection (Wooding et al., 2004). Interestingly,
the chimpanzee TAS2R38 gene is also functionally variable due to a
different intermediate frequency haplotype (in this case, a start
codon-altering mutation) that helps to explain similar variation in
chimpanzee PTC sensitivity (Wooding et al., 2006). This finding
suggests the intriguing possibility of convergent balancing selection at this bitter taste receptor locus in humans and chimpanzees,
related to an unknown factor that may be common to the environments and diets of both species.
57
MYH16, TAS2R62, and TAS2R64 pseudogenizing mutations occurred
prior to ~600 kya
We aligned the Neandertal and Denisovan sequence reads to the
hominin-specific pseudogenes MYH16, TAS2R62, and TAS2R64. The
pseudogene-causing substitutions are a 2 bp frameshift deletion in
the sarcomeric myosin gene MYH16, and two and one stop codon
mutations in the TAS2R62 and TAS2R64 bitter taste receptor genes,
respectively. Both the Neandertal and Denisovan consensus sequences were identical to the human reference sequence in all
cases (Fig. 1), with no evidence of any variation within either individual at these sites. Thus, the functionality of these three genes
was likely lost prior to the ~550e590 kya divergence of the human
and Neandertal/Denisovan lineages. We note the remote possibility, which we consider very unlikely given the age and location of
the sequenced archaic hominins, that the derived Neandertal and
Denisovan variants at these genes reflect admixture with anatomically modern humans, rather than the shared ancestry of pseudogenizing mutations that occurred earlier in hominin evolution.
This possibility could be formally excluded once nuclear genome
sequences become available from Neandertal or Denisovan population samples.
In the absence of information on the compounds recognized by
the proteins encoded by the TAS2R62 and TAS2R64 bitter taste receptors, we are currently unable to make specific inferences about
hominin dietary history or evolutionary ecology on the basis of this
information. However, the functional MYH16 protein is expressed
in masticatory muscles; its absence in humans may explain our
relatively reduced jaw muscles and Type II muscle fiber size
(Stedman et al., 2004). We suggest that the hominin-specific loss of
this protein may have followed the adoption of cooking behavior,
which would have reduced constraints on the masticatory apparatus. Reductions in molar and gut size are commensurate with a
marked increase in brain size beginning ~1.9 mya (millions of years
ago; Aiello and Wheeler, 1995; Organ et al., 2011). This time period
has been inferred as the potential origin of hominin cooking
behavior (Wrangham et al., 1999; Wrangham and Carmody, 2010),
despite the absence of direct evidence from the fossil record.
Previously, Stedman et al. (2004) studied the rates of humanspecific nonsynonymous (amino acid changing) and synonymous
MYH16 substitutions to algebraically estimate a ~2.4 mya date for
the MYH16 frameshift deletion. Specifically, their dating method
assumed steady functional constraint on nonsynonymous mutations prior to pseudogenization followed by an equal rate of nonysynonymous and synonymous substitution after gene loss.
However, their analysis was based on human-chimpanzee differences at only one codon, surveyed from only a very short segment
of MYH16 (Perry et al., 2005). Thus, additional approaches, such as
the one applied in this study, are necessary to obtain more confidence in the time period in which this pseudogenizing mutation
occurred. Our finding that the Neandertal and Denisovan individuals shared with humans the MYH16 frameshift deletion is
consistent with both Stedman et al.'s (2004) ~2.4 mya estimate for
the loss of this gene and the ~1.9 mya inference for the origins of
hominin cooking behavior. The addition of nuclear genome
sequence data from other archaic hominin species (see below)
would provide a more precise estimate of the timing of the MYH16
gene loss, which in turn would have implications for different hypotheses concerning the origins of hominin cooking behavior.
The Neandertal individual is heterozygous for a novel TAS2R38 start
codon-disrupting mutation
In humans, three common amino acid polymorphisms in the
TAS2R38 bitter taste receptor gene explain the majority of human
58
G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63
MYH16
T T L H S T A P H F V R C I I P N E
Chimpanzee ACCACCCTCCATAGCACCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAG
T T L H
S
R T P F C P L Y Y P Q *
Human hg19 ACCACCCTCCATAG--CCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAG
ACCACCCTCCATAG--CCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAG
Montana
Neandertal ACCACCCTCCATAG--CCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAG
ACCACCCTCCATAG--CCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAG
Denisovan
chr7:98,862,740
TAS2R62
Chimpanzee
Human hg19
Montana
Neandertal
Denisovan
S L C W Q L G Q/* M R D L R P G
TCACTGTGCTGGCAGTTGGGGCAGATGAGGGACCTCAGGCCCGGC
TCACTGTGCTGGCAGTTGGGGTAGATGAGGGACCTCAGGCCCGGC
TCACTGTGCTGGCAGTTGGGGTAGATGAGGGACCTCAGGCCCGGC
TCACTGTGCTGGCAGTTGGGGTAGATGAGGGACCTCAGGCCCGGC
TCACTGTGCTGGCAGTTGGGGTAGATGAGGGACCTCAGGCCCGGC
chr7:143,134,731
TAS2R62
Chimpanzee
Human hg19
Montana
Neandertal
Denisovan
N H W H W A W E/* V L I Y A N I
AATCACTGGCACTGGGCCTGGGAAGTGCTAATCTATGCCAACATC
AATCACTGGCACTGGGCCTGGTAAGTGCTAATCTATGCCAACATC
AATCACTGGCACTGGGCCTGGTAAGTGCTAATCTATGCCAACATC
AATCACTGGCACTGGGCCTGGTAAGTGCTAATCTATGCCAACATC
AATCACTGGCACTGGGCCTGGTAAGTGCTAATCTATGCCAACATC
chr7:143,134,899
TAS2R64
Chimpanzee
Human hg19
Neandertal
Denisovan
I T L T W N L W/* T Q Q N K L V
ATCACATTAACCTGGAATCTTTGGACACAGCAGAACAAACTTGTA
ATCACATTAACCTGGAATCTTTGAACACAGCAGAACAAACTTGTA
ATCACATTAACCTGGAATCTTTGAACACAGCAGAACAAACTTGTA
ATCACATTAACCTGGAATCTTTGAACACAGCAGAACAAACTTGTA
chr12:11,230,106
Figure 1. Analysis of Neandertal and Denisovan hominin DNA sequences at positions in the MYH16, TAS2R62, and TAS2R64 genes with hominin-specific inactivating substitutions.
Neandertal and Denisovan consensus sequences aligned to human (hg19) and chimpanzee (panTro4) reference genome sequences, plus consensus sequences from the ~12.6 kya
anatomically modern human from Montana, highlighting the positions with hominin-specific pseudogenizing substitutions. In each case, the loss-of-function mutations occurred
prior to the divergence of the modern human and archaic hominin lineages. The Montana human had insufficient coverage at the TAS2R64 SNP of interest (1 read 20 nt) and is
therefore omitted. Information on mapped read count and depth at these regions is provided in the SOM.
variation in PTC taste sensitivity (Kim et al., 2003). Independently,
chimpanzees are variable for a T-G polymorphism in the second
nucleotide of the first codon of TAS2R38, which would typically
effect an amino acid change from Methioinine to Arginine in the
encoded protein. However, since this Methionine represents the
start codon of TAS2R38, the T-G polymorphism results in the
expression of a greatly truncated, non-functional protein that also
explains variable PTC taste sensitivity in chimpanzees (Wooding
et al., 2006).
We examined all nucleotide positions in the TAS2R38 gene from
the Neandertal and Denisovan aligned reads in order to identify all
variants of potential functional significance (Fig. 2). Both the
Neandertal and Denisovan individuals were homozygous for the
ancestral chimpanzee nucleotides at the positions of the human
functional polymorphisms. Of course, we cannot exclude the possibility that these nucleotides were variable in the Neandertal and
Denisovan populations, given our sample size of only n ¼ 2 chromosomes in each case. In fact, a previous ancient DNA candidate
n, Spain, found that this
gene analysis of a Neandertal from El Sidro
individual was heterozygous for one of the three common modern
human amino acid polymorphisms (the other two could not be
amplified; Lalueza-Fox et al., 2009). We additionally observed a
homozygous nonsynonymous mutation in the first nucleotide of
the codon at amino acid position 36 of the Denisovan individual,
which would effect a ValineeIsoleucine amino acid change. The
program PolyPhen (Adzhubei et al., 2010) predicts that this substitution had a benign functional impact on the TAS2R38 protein
(PolyPhen score ¼ 0.001).
Surprisingly, we found that the Siberian Altai Neandertal individual was heterozygous for a mutation in the second nucleotide of
the first codon of the TAS2R38 gene, similar to the common variant
observed in chimpanzees, but here a T-C rather than a T-G polymorphism. Of the 19 aligned sequence reads at this position, 11 ¼ T
and 8 ¼ C (Fig. 2), providing strong evidence of a true polymorphism rather than a sequencing error. This single nucleotide
polymorphism (SNP) would typically effect a Methionine to Threonine substitution, but again, since this is the start codon we can
predict that this mutation results in a truncated and non-functional
protein, similar to the chimpanzee variant (Wooding et al., 2006).
Thus, human, chimpanzee, and Neandertal populations may all
have had variable PTC taste sensitivity, in each case due to different
functional mutations.
In the absence of nuclear genome sequence data from better
population samples of archaic hominins, we cannot determine
whether this Neandertal allele occurred at intermediate frequency, similar to the chimpanzee mutation and the human
TAS2R38 functional polymorphisms. We also cannot yet exclude
the possibility that similar variation existed in the Denisovan
population. Still, this very interesting result raises at least two
hypotheses for further testing, including with population
genomic analyses: i) balancing selection for TAS2R38 functional
polymorphism is common for hominins and non-human apes d
although specific adaptive hypotheses are largely lacking
(Wooding, 2006), and ii) the TAS2R38 gene is subject to only very
weak purifying selection, such that mutations with major functional effects have attained intermediate frequency but not
become fixed in any of these lineages. Either finding could help
advance our understanding of hominin dietary evolution, especially if we could comprehensively catalog the natural food items
targeted by this receptor.
G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63
A
Chimpanzee
Human hg19
Montana
Neandertal
Denisovan
M L T L T R I
AGTGACATCAKGTTGACTCTAACTCGCATC M/R
AGTGACATCATGTTGACTCTAACTCGCATC
AGTGACATCATGTTGACTCTAACTCGCATC
AGTGACATCAYGTTGACTCTAACTCGCATC M/T
AGTGACATCATGTTGACTCTAACTCGCATC
chr7:141,673,480; TAS2R38 CDS:pos 1
Chimpanzee
Human hg19
Montana
Neandertal
Denisovan
M T N A F V/I F L V N
CTGACCAATGCCTTCGTTTTCTTGGTGAAT
CTGACCAATGCCTTCGTTTTCTTGGTGAAT
CTGACCAATGCCTTCGTTTTCTTGGTGAAT
CTGACCAATGCCTTCGTTTTCTTGGTGAAT
CTGACCAATGCCTTCATTTTCTTGGTGAAT
Chimpanzee
Modern human
Montana
Neandertal
Denisovan
chr7:141,673,399; TAS2R38 CDS:pos 91
V V K R Q P/A L S N S
GTAGTGAAGAGGCAGCCACTGAGCAACAGT
GTAGTGAAGAGGCAGSCACTGAGCAACAGT
GTAGTGAAGAGGCAGCCACTGAGCAACAGT
GTAGTGAAGAGGCAGCCACTGAGCAACAGT
GTAGTGAAGAGGCAGCCACTGAGCAACAGT
Chimpanzee
Modern human
Montana
Neandertal
Denisovan
chr7:141,673,360; TAS2R38 CDS:pos 130
V I S S C A/V A F I S
GTGATATCATCCTGTGCTGCCTTCATCTCT
GTGATATCATCCTGTGYTGCCTTCATCTCT
GTGATATCATCCTGTGCTGCCTTCATCTCT
GTGATATCATCCTGTGCTGCCTTCATCTCT
GTGATATCATCCTGTGCTGCCTTCATCTCT
Chimpanzee
Modern human
Montana
Neandertal
Denisovan
chr7:141,672,692; TAS2R38 CDS:pos 769
S G H A A V/I L I S G
TCTGGGCATGCAGCCGTCCTGATCTCAGGC
TCTGGGCATGCAGCCRTCCTGATCTCAGGC
TCTGGGCATGCAGCCGTCCTGATCTCAGGC
TCTGGGCATGCAGCCGTCCTGATCTCAGGC
TCTGGGCATGCAGCCGTCCTGATCTCAGGC
59
B
AGTGACATCAYGTTGACTCTAACTCGCATC
..........C...................
..........T...................
..........T...................
.........C...................
..........T.........
....C...................
..........T...................
.T..............a....
..........T.............
..........C...................
..........T...................
..........C...................
..........T...................
..........C...................
..........T...................
..........T...................
..........C...................
C...................
T...................
Local alignment at Neandertal
start codon mutation
Nucleotide ambiguity codes :
K
S
R
Y
-
G
C
A
C
or
or
or
or
T
G
G
T
chr7:141,672,590; TAS2R38 CDS:pos 871
Figure 2. Analysis of Neadertal and Denisovan hominin DNA sequences at TAS2R38 gene positions with nonsynonymous variants linked to loss-of-function. (A) TAS2R38 gene
sequence alignments for chimpanzee, human, the ~12.6 kya anatomically modern human from Montana, and the archaic hominins at selected regions containing nonsynonymous
variation. From top: independent start-codon polymorphisms in chimpanzees and the Neandertal individual, a Denisovan-specific nonsynonymous substitution inferred to effect a
Valine to Isoleucine amino acid substitution, and the three common human nonsynonymous polymorphisms that explain the majority of PTC taste sensitivity variation. (B)
Alignment of individual sequence reads for the Neandertal individual that were used to determine the consensus Neandertal sequence shown in the top panel of (A), including the
C-T heterozygosity in the second position of the start codon. Information on mapped read count and depth at this region is provided in the SOM.
Diet-related gene functional gains in hominin evolution
On the other side of the gene content spectrum, duplications or
regulatory sequence changes affecting diet-related genes, especially digestive enzymes, may provide a selective advantage under
certain environments or behaviors if they lead to functional increases in gene and protein expression. However, the evolutionary
reconstructions and interpretations that can be made based on the
timing of gene duplications and individual sequence changes are
less direct than those from gene losses. Specifically, whole gene
duplications or very specific regulatory mutations must first occur
(randomly) before selection can potentially act to maintain them.
For single-copy DNA sequence these mutational mechanisms are
much less commonplace than the expectedly steady rate of pseudogenizing mutations (as described above). Thus, we cannot make
strong ecological conclusions from the absence of gene duplication
or functionally relevant regulatory mutation at a given point in
evolutionary history. However, the evolutionary origins of gene
duplications and known regulatory sequence changes are still
useful to consider because (depending on the duplication) these
results may still help us make inferences about the fitness potential
of a species under hypothesized environments or behaviors.
The origins of lactase persistence mutations are consistent with the
agricultural transition
Lactase, encoded by the LCT gene, is the enzyme responsible for
the digestion of the milk sugar lactose. Expression of the LCT gene in
the small intestine is typically abolished sometime after weaning in
mammals, including for the majority of modern human individuals.
However, modern humans in multiple agriculturalist and pastoralist populations have continued expression of LCT, or ‘lactase
persistence,’ throughout adulthood (Ingram et al., 2009). At least
three independent mutations in a regulatory region located upstream of the LCT gene are responsible for the developmental gain
in enzyme expression in different populations (Bersaglieri et al.,
2004; Tishkoff et al., 2007; Heyer et al., 2011; Gallego Romero
et al., 2012; Peng et al., 2012). These mutations are associated
with genomic backgrounds that suggest past histories of strong
positive selection occurring within the past 10 kya or less
(Bersaglieri et al., 2004; Tishkoff et al., 2007; Ranciaro et al., 2014),
consistent with the origins of agriculture.
Since the specific mutations that confer the lactase persistence
phenotype in modern human populations are known, it has been
possible to study the presence or absence of these mutations in
ancient DNA nuclear genome sequence data from European
anatomically modern humans in order to more precisely estimate
the origins and spread of this phenotype (Itan et al., 2009). These
studies have revealed an absence or relatively low frequency of the
common European LCT persistence allele across ~10e5 kya and
even more recent time periods (Burger et al., 2007; Nagy et al.,
2011; Plantinga et al., 2012; Sverrisdottir et al., 2014), but then a
frequency of ~70% by AD 1200 in at least one population in Germany (Kruttli et al., 2014). Thus, nuclear ancient DNA data have
confirmed a likely relatively recent and agriculture/pastoralassociated origin for at least one of the mutations conferring human lactase persistence.
AMY1 duplications are human-specific and likely occurred within
the past ~600 kya
Amylase is the enzyme responsible for the initial stages of the
digestion of starch, which is a major dietary component for modern
human agricultural populations (up to 70% of caloric intake;
60
G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63
RNPC3
82.9x
AMY2B
Diploid
control region
A
AMY2A
AMY1
Region for CNV estimate
Denisovan
16.6x
0x
129.3x
Sequence read depth of AMY1 region
Neandertal
25.9x
0x
52x
Montana ~12.6kya Human
6.1x
0x
58.1x
Human NA18504
11.6x
0x
416x
Human NA18507
83.3x
0x
43.4x
Human NA18542
8.7x
0x
chr1:104,036,928
chr1:104,186,928
14
B
AMY1 read depth diploid copy number estimate
12
10
8
NA19239
NA18943
NA19238
NA18912
NA18561
NA18558
NA18542
NA18508
NA18526
NA18507
NA18504
NA12891
NA12154
NA06985
Montana
2
NA11994
4
Denisovan
Neandertal
6
0
AMY1 read depth diploid copy number estimate
14
C
NA18561
12
10
NA18542
NA18943
8
NA18558
6
NA18526
NA19238
NA06985
NA18504
4
NA19239
NA18507
Copeland et al., 2009) and some hunter-gatherer populations
(Vincent, 1984; Schoeninger et al., 2001). Humans have an average
of approximately six total copies of the salivary amylase gene
(AMY1), whereas chimpanzees, who consume relatively small
amounts of dietary starch compared with most human populations
(Hohmann et al., 2006), have only two diploid copies, or one per
chromosome (Perry et al., 2007).
The variable number of AMY1 gene copies observed among
humans is positively correlated with salivary amylase protein levels
(Bank et al., 1992; Perry et al., 2007), suggesting that the humanchimpanzee copy number difference likewise explains the substantial between-species difference in salivary amylase protein
expression (McGeachin and Akin, 1982). Differences in the average
number of AMY1 copies between modern human populations with
relatively higher versus lower levels of dietary starch intake and the
pattern of variation relative to other copy number variable loci
suggests that a greater number of AMY1 copies may have been
adaptive under conditions of high starch consumption (Perry et al.,
2007). The presence of AMY1 duplications in hunter-gatherers and
in all studied worldwide populations (Perry et al., 2007; Prüfer
et al., 2014) suggests that the initial gene copy number increase
pre-dates the agricultural transition (an assessment also supported
by the recent ancient DNA-based report of AMY1 duplications in
four 7e8 kya European hunter-gatherers; Lazaridis et al., 2014;
Olalde et al., 2014) and may pre-date modern human origins.
However, it is unknown how early in hominin evolution the initial
AMY1 duplications occurred, and specifically whether this event
coincided with the hypothesized importance of starch-rich underground storage organs (USOs) to archaic hominins such as Homo
erectus (Wrangham et al., 1999).
We used a sequence read depth analysis to estimate AMY1
diploid copy number for both the Neandertal and Denisovan individuals and a comparative sample of 15 modern humans by
comparing the average number of reads per bp mapped to the
AMY1 duplication region to that of a nearby non-duplicated, nondeleted control region (SOM; Fig. 3A). We selected these specific
individuals due to the availability of both high-coverage DNA
sequence data and an independent, array-based comparative
genomic hybridization (aCGH) estimate of copy number at the
AMY1 locus (Redon et al., 2006) for these individuals, which we use
to assess the accuracy of our approach. Prior studies have reported
substantial AMY1 copy number variation among modern humans
(Groot et al., 1989; Iafrate et al., 2004; Perry et al., 2007). We
observed similar diversity among the 15 sampled humans, with a
range from 4.31 to 14.25 AMY1 copies. Our mean estimate of 7.34
AMY1 copies (s.d. ¼ 2.61) is similar to that of a previous, quantitative PCR-based study of AMY1 copy number variation (Perry et al.,
2007). In contrast, our estimates for the Neandertal (1.83 diploid
copies) and Denisovan (1.76 diploid copies) individuals are lower
than those for each of the modern humans (Fig. 3B) and suggest
that, similar to chimpanzees, both of the archaic hominin individuals had only one copy of the AMY1 gene per chromosome. A
NA18508
NA12154
NA18912
NA12891
NA11994
2
−0.5
0.0
0.5
1.0
aCGH relative intensity log2 ratios for AMY1-mapped clone Chr1tp-6D2
Figure 3. Salivary amylase (AMY1) gene copy number analysis. (A) Plots of read depth
across the AMY1 region. Light shading indicates regions analyzed to estimate AMY1
copy number, via comparison of the AMY1 duplicated region (‘region for CNV estimate’) to the non-duplicated, non-deleted control region (‘diploid control region’).
Dashed lines indicate the median read depth across the diploid control region, and yaxes scale to 5x the median. Sequence read coverage for each individual was capped at
1.5x the median for the duplicated AMY1 segment in order to remove repetitive
element artifacts. For the plots only (not for the copy number estimation), the coverage
curves were smoothed using a rolling median in a window equal to 1% of the contig
length, then a 500 nt rolling window mean. Every 100th base position is represented
on the curve. (B) Barplot of AMY1 copy number estimates derived by comparing AMY1
duplicated segment and diploid control region read depths. (C) Comparison of AMY1
read depth copy number estimates to array-based comparative genomic hybridization
(aCGH) relative intensity log2 ratios for AMY1-mapped clone Chr1tp-6D2 for the
modern human samples (Redon et al., 2006).
G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63
similar observation was also noted in the supplementary information of the Prüfer et al. (2014) Neandertal genome paper.
To validate our AMY1 copy number sequence read depth
method, we compared our modern human results to those from a
previous aCGH study conducted on the same individuals. Specifically, we compared our diploid copy number estimates to the
relative intensity log2 ratios for the Chr1tp-6D2 clone that is
mapped to the AMY1 locus from Redon et al. (2006). The ratios
reflect the relative fluorescence intensities from a competitive hybridization experiment in which dye-labeled DNA from each individual is separately co-hybridized to a microarray with the dyelabeled DNA (using a different dye) of a common reference sample. In regions of the genome in which an individual has a higher
copy number than the reference sample (and vice versa for lower
copy number), relatively more DNA from that individual will hybridize to the clones on the array containing DNA complementary
to that region, resulting in a measurable skew in the intensities of
the two fluorescent dyes. Thus, the Chr1tp-6D2 log2 ratios reflect
the relative AMY1 copy number among the 15 samples. These
values are strongly and significantly correlated with our sequence
read depth-based estimates of AMY1 diploid copy number in the
same individuals (Fig. 3C; Pearson correlation test; r2 ¼ 0.84;
P ¼ 1.73 106), confirming the reliability of this approach.
Finally, we performed two analyses to test the sensitivity of this
method to detect duplications in the archaic hominins. First, we
selected four additional genomic regions containing both a
segment with known duplication in the human genome and a nonduplicated, non-deleted control region. In each case, clear relative
copy number gains were observed in the Neandertal and Denisovan
individuals, similar to the modern human samples (SOM Figure 1).
Second, we used identical methods to estimate 3.54 diploid AMY1
copies from the medium coverage nuclear genome sequence
dataset of the anatomically modern human individual from Montana (Fig. 3). Thus, the absence of Neandertal and Denisovan AMY1
relative copy number gain signals reflects the absence of AMY1
duplications in the archaic hominins, rather than any lack of power
to detect duplications with ancient DNA sequence data and this
method. We can therefore conclude that AMY1 gene duplications
are likely human-specific and that they occurred following the
divergence of our lineage from the Neandertal/Denisovan lineage
~550e590 kya.
The three copies of AMY1 that are annotated in the human
reference genome sequence are very similar to each other, which
would seem to imply an origin within the past ~200 kya (Perry
et al., 2007). However, tandem duplication sequence divergence
may not scale with age, due to ongoing duplication and deletion
and potential gene conversion mechanisms among the copies.
Thus, an independent assessment of the likely origin of these
duplications was necessary. Our ancient DNA results d only two
diploid AMY1 copies in both the Neandertal and Denisovan individuals d are consistent with a relatively recent date for the
AMY1 duplications (but one prior to the origins of agriculture, as
evidenced by the presence of duplications in all anatomically
modern human hunter-gatherers thus far studied with ancient
DNA). This timing is not consistent with the hypothesized
importance of starch-rich underground storage organs beginning
in much earlier time periods of hominin evolution (Coursey, 1973;
Wrangham et al., 1999; Laden and Wrangham, 2005). However, as
noted in the Introduction, we cannot make strong inferences from
the absence of gene duplications at a particular time in hominin
evolutionary history. We can only conclude that if early hominins
were consuming large quantities of starchy foods, as hypothesized, then they were likely doing so without the digestive benefits of increased salivary amylase production (Mandel and
Breslin, 2012).
61
Concluding remarks
Looking forward, there are several ways in which the ancient
DNA evolutionary timing of diet-related genetic changes
approach could be expanded in order to better complement the
limited information from the fossil record concerning hominin
dietary transitions. Similar discussion points would also generally apply to investigations of other, non-diet-related hominin
phenotypes (Sams et al., 2014). First, nuclear DNA sequence data
from representatives of additional hominin lineages would
facilitate more precise dating of hominin-specific DNA sequence
changes. One interesting candidate is Homo floresiensis, which
survived until ~18 kya in Indonesia, where the relatively hot and
wet climate is not conducive to DNA preservation. However,
with continuing advances in sequencing technology and ancient
DNA methods such as single-strand DNA library preparation
(Meyer et al., 2012) and ultra-short read sequencing (Dabney
et al., 2013; Meyer et al., 2014), success may be possible in the
future.
Second, our inferences will become stronger with better
functional knowledge of specific taste receptors, including those
that have been lost along the hominin lineage. Likewise, we would
like to generally extend our analysis to specific nonsynonymous
and gene regulatory substitutions of many potential diet-related
genes in the genome, instead of focusing more heavily on
hominin-specific gene gains and losses. However, functional
knowledge of such changes is severely lacking for fixed humanchimpanzee differences, due to the difficulty in predicting
phenotype from genotype in the absence of within-species
variation.
Finally, the timing of olfactory receptor gene gains and losses
and functional changes could provide insights into hominin dietary
evolution and evolutionary ecology. This analysis is currently
challenged by our limited understanding of the specific functional
consequences of olfactory receptor variation and by the short
sequence reads typically obtained from ancient DNA, which often
cannot be mapped uniquely to specific, highly similar olfactory
receptor genes (Hughes et al., 2014). We are hopeful for progress on
all of these fronts.
In summary, we have demonstrated that analyses of highcoverage ancient DNA sequence data can facilitate inferences
about the relative timing of hominin-specific phenotypic changes
in diet-related genes. This analysis reveals the utility of ancient
DNA approaches for addressing questions about the timing of
evolutionary changes correlated with ecological shifts in hominin
history, including those that are strongly debated by paleoanthropologists due to the limitations of the direct fossil record. As both
our functional knowledge of genetic changes and the number of
nuclear genome sequences from ancient hominin individuals
expand, our ability to test such hypotheses and provide novel insights about hominin evolution will continue to improve.
Acknowledgments
This work was supported by the Pennsylvania State University
College of the Liberal Arts (to G.H.P.). Computational analyses were
supported in part by instrumentation funded by National Science
Foundation grant no. OCI-0821527.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.jhevol.2014.10.018.
62
G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63
References
Adzhubei, I.A., Schmidt, S., Peshkin, L., Ramensky, V.E., Gerasimova, A., Bork, P.,
Kondrashov, A.S., Sunyaev, S.R., 2010. A method and server for predicting
damaging missense mutations. Nat. Methods 7, 248e249.
Aiello, L.C., Wheeler, P., 1995. The expensive-tissue hypothesis: the brain and the
digestive system in human and primate evolution. Curr. Anthropol. 36,
199e221.
Bank, R.A., Hettema, E.H., Muijs, M.A., Pals, G., Arwert, F., Boomsma, D.I., Pronk, J.C.,
1992. Variation in gene copy number and polymorphism of the human salivary
amylase isoenzyme system in Caucasians. Hum. Genet. 89, 213e222.
Bersaglieri, T., Sabeti, P.C., Patterson, N., Vanderploeg, T., Schaffner, S.F., Drake, J.A.,
Rhodes, M., Reich, D.E., Hirschhorn, J.N., 2004. Genetic signatures of strong
recent positive selection at the lactase gene. Am. J. Hum. Genet. 74, 1111e1120.
Bowmaker, J.K., Hunt, D.M., 2006. Evolution of vertebrate visual pigments. Curr.
Biol. 16, R484eR489.
Bufe, B., Breslin, P.A., Kuhn, C., Reed, D.R., Tharp, C.D., Slack, J.P., Kim, U.K., Drayna, D.,
Meyerhof, W., 2005. The molecular basis of individual differences in phenylthiocarbamide and propylthiouracil bitterness perception. Curr. Biol. 15,
322e327.
Bunn, H.T., 2006. Meat made us human. In: Ungar, P.S. (Ed.), Evolution of the Human
Diet: The Known, the Unknown, and the Unknowable. Oxford University Press,
New York, pp. 191e211.
Burger, J., Kirchner, M., Bramanti, B., Haak, W., Thomas, M.G., 2007. Absence of the
lactase-persistence-associated allele in early Neolithic Europeans. Proc. Natl.
Acad. Sci. 104, 3736e3741.
Carmody, R.N., Wrangham, R.W., 2009. The energetic significance of cooking.
J. Hum. Evol. 57, 379e391.
Castellano, S., Parra, G., Sanchez-Quinto, F.A., Racimo, F., Kuhlwilm, M., Kircher, M.,
Sawyer, S., Fu, Q., Heinze, A., Nickel, B., Dabney, J., Siebauer, M., White, L.,
Burbano, H.A., Renaud, G., Stenzel, U., Lalueza-Fox, C., de la Rasilla, M., Rosas, A.,
Rudan, P., Brajkovic, D., Kucan, Z., Gusic, I., Shunkov, M.V., Derevianko, A.P.,
€bo, S., 2014. Patterns of coding
Viola, B., Meyer, M., Kelso, J., Andres, A.M., P€
aa
variation in the complete exomes of three Neandertals. Proc. Natl. Acad. Sci. 111,
6666e6671.
Copeland, L., Blazek, J., Salman, H., Chiming Tang, M., 2009. Form and functionality
of starch. Food Hydrocolloids 23, 1527e1534.
Coursey, D.G., 1973. Hominid evolution and hypogeous plant foods. Man 8,
634e635.
Dabney, J., Knapp, M., Glocke, I., Gansauge, M.T., Weihmann, A., Nickel, B.,
€a
€bo, S., Arsuaga, J.L., Meyer, M., 2013. Complete
Valdiosera, C., Garcia, N., Pa
mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proc. Natl. Acad. Sci. 110,
15758e15763.
de Heinzelin, J., Clark, J.D., White, T., Hart, W., Renne, P., WoldeGabriel, G., Beyene, Y.,
Vrba, E., 1999. Environment and behavior of 2.5-million-year-old Bouri hominids. Science 284, 625e629.
Diamond, J., 2002. Evolution, consequences and future of plant and animal
domestication. Nature 418, 700e707.
Dominy, N.J., Vogel, E.R., Yeakel, J.D., Constantino, P., Lucas, P.W., 2008. Mechanical
properties of plant underground storage organs and implications for dietary
models of early hominins. Evol. Biol. 35, 159e175.
Gallego Romero, I., Basu Mallick, C., Liebert, A., Crivellaro, F., Chaubey, G., Itan, Y.,
Metspalu, M., Eaaswarkhanth, M., Pitchappan, R., Villems, R., Reich, D., Singh, L.,
Thangaraj, K., Thomas, M.G., Swallow, D.M., Mirazon Lahr, M., Kivisild, T., 2012.
Herders of Indian and European cattle share their predominant allele for lactase
persistence. Mol. Biol. Evol. 29, 249e260.
Go, Y., Satta, Y., Takenaka, O., Takahata, N., 2005. Lineage-specific loss of function of
bitter taste receptor genes in humans and nonhuman primates. Genetics 170,
313e326.
Gowlett, J.A.J., Wrangham, R.W., 2013. Earliest fire in Africa: towards the convergence of archaeological evidence and the cooking hypothesis. Azania-Archaeol.
Res. Afr. 48, 5e30.
Groot, P.C., Bleeker, M.J., Pronk, J.C., Arwert, F., Mager, W.H., Planta, R.J.,
Eriksson, A.W., Frants, R.R., 1989. The human alpha-amylase multigene family
consists of haplotypes with variable numbers of genes. Genomics 5, 29e42.
Heyer, E., Brazier, L., Segurel, L., Hegay, T., Austerlitz, F., Quintana-Murci, L.,
Georges, M., Pasquet, P., Veuille, M., 2011. Lactase persistence in central Asia:
phenotype, genotype, and evolution. Hum. Biol. 83, 379e392.
Hohmann, G., Robbins, M., Boesch, C., 2006. Feeding Ecology in Apes and Other
Primates. Cambridge University Press, Cambridge.
Huerta-Sanchez, E., Jin, X., Asan, Bianba, Z., Peter, B.M., Vinckenbosch, N., Liang, Y.,
Yi, X., He, M., Somel, M., Ni, P., Wang, B., Ou, X., Huasang, Luosang, J., Cuo, Z.X.,
Li, K., Gao, G., Yin, Y., Wang, W., Zhang, X., Xu, X., Yang, H., Li, Y., Wang, J.,
Wang, J., Nielsen, R., 2014. Altitude adaptation in Tibetans caused by introgression of Denisovan-like DNA. Nature 512, 194e197.
Hughes, G.M., Teeling, E.C., Higgins, D.G., 2014. Loss of olfactory receptor function in
hominin evolution. PLoS One 9, e84714.
Iafrate, A.J., Feuk, L., Rivera, M.N., Listewnik, M.L., Donahoe, P.K., Qi, Y., Scherer, S.W.,
Lee, C., 2004. Detection of large-scale variation in the human genome. Nat.
Genet. 36, 949e951.
Ingram, C.J., Mulcare, C.A., Itan, Y., Thomas, M.G., Swallow, D.M., 2009. Lactose
digestion and the evolutionary genetics of lactase persistence. Hum. Genet. 124,
579e591.
Itan, Y., Powell, A., Beaumont, M.A., Burger, J., Thomas, M.G., 2009. The origins of
lactase persistence in Europe. PLoS Comput. Biol. 5, e1000491.
Jacobs, G.H., Neitz, M., Neitz, J., 1996. Mutations in S-cone pigment genes and the
absence of colour vision in two species of nocturnal primate. Proc. Biol. Sci. 263,
705e710.
Keller, A., Graefen, A., Ball, M., Matzas, M., Boisguerin, V., Maixner, F., Leidinger, P.,
Backes, C., Khairat, R., Forster, M., Stade, B., Franke, A., Mayer, J., Spangler, J.,
McLaughlin, S., Shah, M., Lee, C., Harkins, T.T., Sartori, A., Moreno-Estrada, A.,
Henn, B., Sikora, M., Semino, O., Chiaroni, J., Rootsi, S., Myres, N.M.,
Cabrera, V.M., Underhill, P.A., Bustamante, C.D., Vigl, E.E., Samadelli, M.,
Cipollini, G., Haas, J., Katus, H., O'Connor, B.D., Carlson, M.R., Meder, B., Blin, N.,
Meese, E., Pusch, C.M., Zink, A., 2012. New insights into the Tyrolean Iceman's
origin and phenotype as inferred by whole-genome sequencing. Nat. Commun
3, 698.
Kim, U.K., Jorgenson, E., Coon, H., Leppert, M., Risch, N., Drayna, D., 2003. Positional
cloning of the human quantitative trait locus underlying taste sensitivity to
phenylthiocarbamide. Science 299, 1221e1225.
€bo, S.,
Krause, J., Fu, Q., Good, J.M., Viola, B., Shunkov, M.V., Derevianko, A.P., P€
aa
2010. The complete mitochondrial DNA genome of an unknown hominin from
southern Siberia. Nature 464, 894e897.
Kruttli, A., Bouwman, A., Akgul, G., Della Casa, P., Ruhli, F., Warinner, C., 2014.
Ancient DNA analysis reveals high frequency of European lactase persistence
allele (T-13910) in Medieval Central Europe. PLoS One 9, e86251.
Laden, G., Wrangham, R., 2005. The rise of the hominids as an adaptive shift in
fallback foods: plant underground storage organs (USOs) and australopith origins. J. Hum. Evol. 49, 482e498.
Lalueza-Fox, C., Rompler, H., Caramelli, D., Staubert, C., Catalano, G., Hughes, D.,
Rohland, N., Pilli, E., Longo, L., Condemi, S., de la Rasilla, M., Fortea, J., Rosas, A.,
Stoneking, M., Schoneberg, T., Bertranpetit, J., Hofreiter, M., 2007.
A melanocortin 1 receptor allele suggests varying pigmentation among Neanderthals. Science 318, 1453e1455.
Lalueza-Fox, C., Gigli, E., de la Rasilla, M., Fortea, J., Rosas, A., 2009. Bitter taste
perception in Neanderthals through the analysis of the TAS2R38 gene. Biol. Lett.
5, 809e811.
Lazaridis, I., Patterson, N., Mittnik, A., Renaud, G., Mallick, S., Kirsanow, K.,
Sudmant, P.H., Schraiber, J.G., Castellano, S., Lipson, M., Berger, B., Economou, C.,
Bollongino, R., Fu, Q., Bos, K.I., Nordenfelt, S., Li, H., de Filippo, C., Prüfer, K.,
Sawyer, S., Posth, C., Haak, W., Hallgren, F., Fornander, E., Rohland, N.,
Delsate, D., Francken, M., Guinet, J.M., Wahl, J., Ayodo, G., Babiker, H.A.,
Bailliet, G., Balanovska, E., Balanovsky, O., Barrantes, R., Bedoya, G., Ben-Ami, H.,
Bene, J., Berrada, F., Bravi, C.M., Brisighelli, F., Busby, G.B., Cali, F., Churnosov, M.,
Cole, D.E., Corach, D., Damba, L., van Driem, G., Dryomov, S., Dugoujon, J.M.,
Fedorova, S.A., Gallego Romero, I., Gubina, M., Hammer, M., Henn, B.M.,
Hervig, T., Hodoglugil, U., Jha, A.R., Karachanak-Yankova, S., Khusainova, R.,
Khusnutdinova, E., Kittles, R., Kivisild, T., Klitz, W., Kucinskas, V.,
Kushniarevich, A., Laredj, L., Litvinov, S., Loukidis, T., Mahley, R.W., Melegh, B.,
Metspalu, E., Molina, J., Mountain, J., Nakkalajarvi, K., Nesheva, D., Nyambo, T.,
Osipova, L., Parik, J., Platonov, F., Posukh, O., Romano, V., Rothhammer, F.,
Rudan, I., Ruizbakiev, R., Sahakyan, H., Sajantila, A., Salas, A., Starikovskaya, E.B.,
Tarekegn, A., Toncheva, D., Turdikulova, S., Uktveryte, I., Utevska, O., Vasquez, R.,
Villena, M., Voevoda, M., Winkler, C.A., Yepiskoposyan, L., Zalloua, P.,
Zemunik, T., Cooper, A., Capelli, C., Thomas, M.G., Ruiz-Linares, A., Tishkoff, S.A.,
Singh, L., Thangaraj, K., Villems, R., Comas, D., Sukernik, R., Metspalu, M.,
€bo, S., Kelso, J., Reich, D.,
Meyer, M., Eichler, E.E., Burger, J., Slatkin, M., P€
aa
Krause, J., 2014. Ancient human genomes suggest three ancestral populations
for present-day Europeans. Nature 513, 409e413.
Leonard, W.R., Robertson, M.L., 1992. Nutritional requirements and human evolution - a bioenergetics model. Am. J. Hum. Biol. 4, 179e195.
Luca, F., Perry, G.H., Di Rienzo, A., 2010. Evolutionary adaptations to dietary changes.
A. Rev. Nutr. 30, 291e314.
MacArthur, D.G., Tyler-Smith, C., 2010. Loss-of-function variants in the genomes of
healthy humans. Hum. Mol. Genet. 19, R125eR130.
MacArthur, D.G., Balasubramanian, S., Frankish, A., Huang, N., Morris, J., Walter, K.,
Jostins, L., Habegger, L., Pickrell, J.K., Montgomery, S.B., Albers, C.A., Zhang, Z.D.,
Conrad, D.F., Lunter, G., Zheng, H., Ayub, Q., DePristo, M.A., Banks, E., Hu, M.,
Handsaker, R.E., Rosenfeld, J.A., Fromer, M., Jin, M., Mu, X.J., Khurana, E., Ye, K.,
Kay, M., Saunders, G.I., Suner, M.M., Hunt, T., Barnes, I.H., Amid, C., CarvalhoSilva, D.R., Bignell, A.H., Snow, C., Yngvadottir, B., Bumpstead, S., Cooper, D.N.,
Xue, Y., Romero, I.G., Wang, J., Li, Y., Gibbs, R.A., McCarroll, S.A., Dermitzakis, E.T.,
Pritchard, J.K., Barrett, J.C., Harrow, J., Hurles, M.E., Gerstein, M.B., TylerSmith, C., 2012. A systematic survey of loss-of-function variants in human
protein-coding genes. Science 335, 823e828.
Mandel, A.L., Breslin, P.A., 2012. High endogenous salivary amylase activity is
associated with improved glycemic homeostasis following starch ingestion in
adults. J. Nutr. 142, 853e858.
Mann, N., 2000. Dietary lean red meat and human evolution. Eur. J. Nutr. 39, 71e79.
McGeachin, R.L., Akin, J.R., 1982. Amylase levels in the tissues and body fluids of
several primate species. Comp. Biochem. Physiol. A 72, 267e269.
McPherron, S.P., Alemseged, Z., Marean, C.W., Wynn, J.G., Reed, D., Geraads, D.,
Bobe, R., Bearat, H.A., 2010. Evidence for stone-tool-assisted consumption of
animal tissues before 3.39 million years ago at Dikika, Ethiopia. Nature 466,
857e860.
Meyer, M., Kircher, M., Gansauge, M.T., Li, H., Racimo, F., Mallick, S., Schraiber, J.G.,
Jay, F., Prüfer, K., de Filippo, C., Sudmant, P.H., Alkan, C., Fu, Q., Do, R.,
Rohland, N., Tandon, A., Siebauer, M., Green, R.E., Bryc, K., Briggs, A.W.,
G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63
Stenzel, U., Dabney, J., Shendure, J., Kitzman, J., Hammer, M.F., Shunkov, M.V.,
Derevianko, A.P., Patterson, N., Andres, A.M., Eichler, E.E., Slatkin, M., Reich, D.,
€€
Kelso, J., Pa
abo, S., 2012. A high-coverage genome sequence from an archaic
Denisovan individual. Science 338, 222e226.
Meyer, M., Fu, Q., Aximu-Petri, A., Glocke, I., Nickel, B., Arsuaga, J.L., Martinez, I.,
€a
€bo, S., 2014. A mitochondrial genome
Gracia, A., de Castro, J.M., Carbonell, E., Pa
sequence of a hominin from Sima de los Huesos. Nature 505, 403e406.
Milton, K., 1999. A hypothesis to explain the role of meat-eating in human evolution. Evol. Anthropol. 8, 11e21.
Nagy, D., Tomory, G., Csanyi, B., Bogacsi-Szabo, E., Czibula, A., Priskin, K., Bede, O.,
Bartosiewicz, L., Downes, C.S., Rasko, I., 2011. Comparison of lactase persistence
polymorphism in ancient and present-day Hungarian populations. Am. J. Phys.
Anthropol. 145, 262e269.
Olalde, I., Allentoft, M.E., Sanchez-Quinto, F., Santpere, G., Chiang, C.W.,
Degiorgio, M., Prado-Martinez, J., Rodriguez, J.A., Rasmussen, S., Quilez, J.,
Ramirez, O., Marigorta, U.M., Fernandez-Callejo, M., Prada, M.E., Encinas, J.M.,
Nielsen, R., Netea, M.G., Novembre, J., Sturm, R.A., Sabeti, P., Marques-Bonet, T.,
Navarro, A., Willerslev, E., Lalueza-Fox, C., 2014. Derived immune and ancestral
pigmentation alleles in a 7,000-year-old Mesolithic European. Nature 507,
225e228.
Organ, C., Nunn, C.L., Machanda, Z., Wrangham, R.W., 2011. Phylogenetic rate shifts
in feeding time during the evolution of Homo. Proc. Natl. Acad. Sci. 108,
14555e14559.
Parry, C.M., Erkner, A., le Coutre, J., 2004. Divergence of T2R chemosensory receptor
families in humans, bonobos, and chimpanzees. Proc. Natl. Acad. Sci. 101,
14830e14834.
Peng, M.S., He, J.D., Zhu, C.L., Wu, S.F., Jin, J.Q., Zhang, Y.P., 2012. Lactase persistence
may have an independent origin in Tibetan populations from Tibet, China.
J. Hum. Genet. 57, 394e397.
Perry, G.H., Verrelli, B.C., Stone, A.C., 2005. Comparative analyses reveal a complex
history of molecular evolution for human MYH16. Mol. Biol. Evol. 22, 379e382.
Perry, G.H., Dominy, N.J., Claw, K.G., Lee, A.S., Fiegler, H., Redon, R., Werner, J.,
Villanea, F.A., Mountain, J.L., Misra, R., Carter, N.P., Lee, C., Stone, A.C., 2007. Diet
and the evolution of human amylase gene copy number variation. Nat. Genet.
39, 1256e1260.
Plantinga, T.S., Alonso, S., Izagirre, N., Hervella, M., Fregel, R., van der Meer, J.W.,
Netea, M.G., de la Rua, C., 2012. Low prevalence of lactase persistence in
Neolithic South-West Europe. Eur. J. Hum. Genet. 20, 778e782.
Prüfer, K., Racimo, F., Patterson, N., Jay, F., Sankararaman, S., Sawyer, S., Heinze, A.,
Renaud, G., Sudmant, P.H., de Filippo, C., Li, H., Mallick, S., Dannemann, M.,
Fu, Q., Kircher, M., Kuhlwilm, M., Lachmann, M., Meyer, M., Ongyerth, M.,
Siebauer, M., Theunert, C., Tandon, A., Moorjani, P., Pickrell, J., Mullikin, J.C.,
Vohr, S.H., Green, R.E., Hellmann, I., Johnson, P.L., Blanche, H., Cann, H.,
Kitzman, J.O., Shendure, J., Eichler, E.E., Lein, E.S., Bakken, T.E., Golovanova, L.V.,
Doronichev, V.B., Shunkov, M.V., Derevianko, A.P., Viola, B., Slatkin, M., Reich, D.,
€€
Kelso, J., Pa
abo, S., 2014. The complete genome sequence of a Neanderthal from
the Altai Mountains. Nature 505, 43e49.
Raghavan, M., Skoglund, P., Graf, K.E., Metspalu, M., Albrechtsen, A., Moltke, I.,
Rasmussen, S., Stafford, T.W. Jr., Orlando, L., Metspalu, E., Karmin, M.,
Tambets, K., Rootsi, S., Magi, R., Campos, P.F., Balanovska, E., Balanovsky, O.,
Khusnutdinova, E., Litvinov, S., Osipova, L.P., Fedorova, S.A., Voevoda, M.I.,
DeGiorgio, M., Sicheritz-Ponten, T., Brunak, S., Demeshchenko, S., Kivisild, T.,
Villems, R., Nielsen, R., Jakobsson, M., Willerslev, E., 2014. Upper Palaeolithic
Siberian genome reveals dual ancestry of Native Americans. Nature 505, 87e91.
Ranciaro, A., Campbell, M.C., Hirbo, J.B., Ko, W.Y., Froment, A., Anagnostou, P.,
Kotze, M.J., Ibrahim, M., Nyambo, T., Omar, S.A., Tishkoff, S.A., 2014. Genetic
origins of lactase persistence and the spread of pastoralism in Africa. Am. J.
Hum. Genet. 94, 496e510.
Rasmussen, M., Li, Y., Lindgreen, S., Pedersen, J.S., Albrechtsen, A., Moltke, I.,
Metspalu, M., Metspalu, E., Kivisild, T., Gupta, R., Bertalan, M., Nielsen, K.,
Gilbert, M.T., Wang, Y., Raghavan, M., Campos, P.F., Kamp, H.M., Wilson, A.S.,
Gledhill, A., Tridico, S., Bunce, M., Lorenzen, E.D., Binladen, J., Guo, X., Zhao, J.,
Zhang, X., Zhang, H., Li, Z., Chen, M., Orlando, L., Kristiansen, K., Bak, M.,
Tommerup, N., Bendixen, C., Pierre, T.L., Gronnow, B., Meldgaard, M.,
Andreasen, C., Fedorova, S.A., Osipova, L.P., Higham, T.F., Bronk Ramsey, C.,
Hansen, T.V., Nielsen, F.C., Crawford, M.H., Brunak, S., Sicheritz-Ponten, T.,
Villems, R., Nielsen, R., Krogh, A., Wang, J., Willerslev, E., 2010. Ancient human
genome sequence of an extinct Palaeo-Eskimo. Nature 463, 757e762.
Rasmussen, M., Anzick, S.L., Waters, M.R., Skoglund, P., DeGiorgio, M.,
Stafford, T.W. Jr., Rasmussen, S., Moltke, I., Albrechtsen, A., Doyle, S.M.,
Poznik, G.D., Gudmundsdottir, V., Yadav, R., Malaspinas, A.S., White, S.S. V,
Allentoft, M.E., Cornejo, O.E., Tambets, K., Eriksson, A., Heintzman, P.D.,
Karmin, M., Korneliussen, T.S., Meltzer, D.J., Pierre, T.L., Stenderup, J., Saag, L.,
Warmuth, V.M., Lopes, M.C., Malhi, R.S., Brunak, S., Sicheritz-Ponten, T.,
Barnes, I., Collins, M., Orlando, L., Balloux, F., Manica, A., Gupta, R., Metspalu, M.,
Bustamante, C.D., Jakobsson, M., Nielsen, R., Willerslev, E., 2014. The genome of
63
a Late Pleistocene human from a Clovis burial site in western Montana. Nature
506, 225e229.
Redon, R., Ishikawa, S., Fitch, K.R., Feuk, L., Perry, G.H., Andrews, T.D., Fiegler, H.,
Shapero, M.H., Carson, A.R., Chen, W., Cho, E.K., Dallaire, S., Freeman, J.L.,
Gonzalez, J.R., Gratacos, M., Huang, J., Kalaitzopoulos, D., Komura, D.,
MacDonald, J.R., Marshall, C.R., Mei, R., Montgomery, L., Nishimura, K.,
Okamura, K., Shen, F., Somerville, M.J., Tchinda, J., Valsesia, A., Woodwark, C.,
Yang, F., Zhang, J., Zerjal, T., Armengol, L., Conrad, D.F., Estivill, X., Tyler-Smith, C.,
Carter, N.P., Aburatani, H., Lee, C., Jones, K.W., Scherer, S.W., Hurles, M.E., 2006.
Global variation in copy number in the human genome. Nature 444, 444e454.
Reich, D., Green, R.E., Kircher, M., Krause, J., Patterson, N., Durand, E.Y., Viola, B.,
Briggs, A.W., Stenzel, U., Johnson, P.L., Maricic, T., Good, J.M., Marques-Bonet, T.,
Alkan, C., Fu, Q., Mallick, S., Li, H., Meyer, M., Eichler, E.E., Stoneking, M.,
Richards, M., Talamo, S., Shunkov, M.V., Derevianko, A.P., Hublin, J.-J., Kelso, J.,
€bo, S., 2010. Genetic history of an archaic hominin group from
Slatkin, M., P€
aa
Denisova Cave in Siberia. Nature 468, 1053e1060.
Roebroeks, W., Villa, P., 2011. On the earliest evidence for habitual use of fire in
Europe. Proc. Natl. Acad. Sci. 108, 5209e5214.
Sams, A.J., Hawks, J., Keinan, A., 2014. The utility of ancient human DNA for
improving allele age estimates, with implications for demographic models and
tests of natural selection. J. Hum. Evol. http://dx.doi.org/10.1016/
j.jhevol.2014.10.009.
€€
Sankararaman, S., Mallick, S., Dannemann, M., Prüfer, K., Kelso, J., Pa
abo, S.,
Patterson, N., Reich, D., 2014. The genomic landscape of Neanderthal ancestry in
present-day humans. Nature 507, 354e357.
Schoeninger, M.J., Bunn, H.T., Murray, S.S., Marlett, J.A., 2001. Composition of tubers
used by Hadza foragers of Tanzania. J. Food Comp. Anal. 14, 15e25.
Stanford, C.B., 1999. The Hunting Apes: Meat Eating and the Origins of Human
Behavior. Princeton University Press, Princeton.
Stedman, H.H., Kozyak, B.W., Nelson, A., Thesier, D.M., Su, L.T., Low, D.W.,
Bridges, C.R., Shrager, J.B., Minugh-Purvis, N., Mitchell, M.A., 2004. Myosin gene
mutation correlates with anatomical changes in the human lineage. Nature 428,
415e418.
Sverrisdottir, O.O., Timpson, A., Toombs, J., Lecoeur, C., Froguel, P., Carretero, J.M.,
Arsuaga Ferreras, J.L., Gotherstrom, A., Thomas, M.G., 2014. Direct estimates of
natural selection in Iberia indicate calcium absorption was not the only driver of
lactase persistence in Europe. Mol. Biol. Evol. 31, 975e983.
Tan, Y., Yoder, A.D., Yamashita, N., Li, W.H., 2005. Evidence from opsin genes rejects
nocturnality in ancestral primates. Proc. Natl. Acad. Sci. 102, 14712e14716.
Tishkoff, S.A., Reed, F.A., Ranciaro, A., Voight, B.F., Babbitt, C.C., Silverman, J.S.,
Powell, K., Mortensen, H.M., Hirbo, J.B., Osman, M., Ibrahim, M., Omar, S.A.,
Lema, G., Nyambo, T.B., Ghori, J., Bumpstead, S., Pritchard, J.K., Wray, G.A.,
Deloukas, P., 2007. Convergent adaptation of human lactase persistence in Africa and Europe. Nat. Genet. 39, 31e40.
Ungar, P.S., Grine, F.E., Teaford, M.F., 2006. Diet in early Homo: A review of the
evidence and a new model of adaptive versatility. A. Rev. Anthropol 35,
209e228.
Vernot, B., Akey, J.M., 2014. Resurrecting surviving Neandertal lineages from
modern human genomes. Science 343, 1017e1021.
Vincent, A.S., 1984. Plant foods in savanna environments: a preliminary report of
tubers eaten by the Hadza of northern Tanzania. World Archaeol. 17, 131e148.
Wang, X., Grus, W.E., Zhang, J., 2006. Gene losses during human origins. PLoS Biol. 4,
e52.
Wooding, S., 2006. Phenylthiocarbamide: A 75-Year Adventure in Genetics and
Natural Selection. Genetics 172, 2015e2023.
Wooding, S., Kim, U.K., Bamshad, M.J., Larsen, J., Jorde, L.B., Drayna, D., 2004. Natural
selection and molecular evolution in PTC, a bitter-taste receptor gene. Am. J.
Hum. Genet. 74, 637e646.
Wooding, S., Bufe, B., Grassi, C., Howard, M.T., Stone, A.C., Vazquez, M., Dunn, D.M.,
Meyerhof, W., Weiss, R.B., Bamshad, M.J., 2006. Independent evolution of bittertaste sensitivity in humans and chimpanzees. Nature 440, 930e934.
Wrangham, R.W., Carmody, R., 2010. Human adaptation to the control of fire. Evol.
Anthropol. 19, 187e199.
Wrangham, R., Conklin-Brittain, N., 2003. Cooking as a biological trait. Comp. Biochem. Physiol. A 136, 35e46.
Wrangham, R.W., Jones, J.H., Laden, G., Pilbeam, D., Conklin-Brittain, N., 1999. The
raw and the stolen e cooking and the ecology of human origins. Curr.
Anthropol. 40, 567e594.
Yamaguchi-Kabata, Y., Shimada, M.K., Hayakawa, Y., Minoshima, S., Chakraborty, R.,
Gojobori, T., Imanishi, T., 2008. Distribution and effects of nonsense polymorphisms in human genes. PLoS One 3, e3393.
Yngvadottir, B., Xue, Y., Searle, S., Hunt, S., Delgado, M., Morrison, J., Whittaker, P.,
Deloukas, P., Tyler-Smith, C., 2009. A genome-wide survey of the prevalence
and evolutionary forces acting on human nonsense SNPs. Am. J. Hum. Genet. 84,
224e234.